Supplementary material

Table S1: Biologically relevant differentially expressed genes. The 130 biologically relevant genes (pertaining to fear conditioning and extinction, anxiety and stress-

related disorders, as identified by the BORG analyses tool) that were significantly differentially expressed between the FEAR + DCS WA and the FEAR + SALINE MA

group; negative fold changes indicate that genes were downregulated in the FEAR + DCS WA group compared to the FEAR + SALINE MA group, positive fold changes

indicate that genes were upregulated in the FEAR + DCS WA group compared to the FEAR + SALINE MA group.

Biologically relevant genes downregulated in the FEAR + DCS WA group compare to the FEAR + SALINE MA group

Gene Name Fold change Function

Mmp12 matrix metallopeptidase 12 -inf * abnormal myelination; decreased oligodendrocyte number

Spp1 secreted phosphoprotein 1 -8.26 demyelination; increased neuron number; abnormal microglial cell morphology; abnormal substantia

nigra morphology; increased neuron number; abnormal striatum morphology; abnormal microglial

cell morphology; decreased susceptibility to dopaminergic neuron neurotoxicity

Serpina3n serine (or cysteine) peptidase inhibitor, clade A, member -7.89 implicated_in disease: dementia, Alzheimer's disease

Clec7a C-type lectin domain family 7, member A -6.63 positive regulation of tumor necrosis factor production

Kng1 kininogen 1 -6.60 positive regulation of cytosolic calcium ion concentration

Cxcl13 chemokine (C-X-C motif) ligand 13 -6.28 positive regulation of cytosolic calcium ion concentration

Ccl7 chemokine (C-C motif) ligand 7 -5.86 cellular calcium ion homeostasis

Msr1 macrophage scavenger receptor 1 -5.61 amyloid beta deposits; neuron degeneration

Lgals3 lectin, galactoside-binding, soluble, 3 -5.50 positive regulation of calcium ion import; brain inflammation

C6 complement component 6 -5.18 prion diseases pathway

Cd8a CD8a molecule -5.12 positive regulation of calcium-mediated signaling; demyelination

Hmox1 Heme oxygenase (decycling) 1 -4.80 Negative regulation of neuron apoptotic process (GO:0043524)

(http://www.ncbi.nlm.nih.gov/pubmed/19177228) / response to oxidative stress (GO:0006979)

(http://www.ncbi.nlm.nih.gov/pubmed/17020887) / increased inflammatory response (MP:0001846)

(http://www.ncbi.nlm.nih.gov/pubmed/22075990)

Ccl2 chemokine (C-C motif) ligand 2 -4.81 cellular calcium ion homeostasis; neuron degeneration; demyelination; abnormal microglial cell

physiology; abnormal action potential; decreased nerve conduction velocity; abnormal action

potential; abnormal conditioned taste aversion behavior; retinal photoreceptor degeneration;

decreased susceptibility to neuronal excitotoxicity

Ccl6 chemokine (C-C motif) ligand 6 -4.55 cellular calcium ion homeostasis

Cd36 CD36 molecule -4.49 positive regulation of tumor necrosis factor production; positive regulation of interleukin-6 amd

IL12 production; abnormal myelination; abnormal peripheral nervous system regeneration;

abnormal microglial cell physiology; positive regulation of macrophage cytokine production

Cxcl9 chemokine (C-X-C motif) ligand 9 -4.43 positive regulation of release of sequestered calcium ion into cytosol

Gpnmb glycoprotein -4.39 retinal ganglion cell degeneration; optic nerve atrophy

Il1rn interleukin 1 receptor antagonist -4.29 learning or memory; implicated_in disease: endogenous depression

Runx3 runt-related transcription factor 3 -4.11 abnormal nervous system electrophysiology; abnormal sensory neuron morphology; decreased

spinal cord size ; abnormal sensory neuron innervation pattern; abnormal spinal cord dorsal column

morphology; abnormal excitatory postsynaptic potential; absent muscle spindles

Kcnn4 potassium intermediate/small conductance calcium-activated

channel, subfamily N, member 4

-4.05 calcium ion transport

S100a4 S100 calcium-binding protein A4 -3.77 calcium/calcium-mediated signalling pathway

Ccl3 chemokine (C-C motif) ligand 3 -3.75 calcium-mediated signalling; cellular calcium ion homeostasis; calcium ion transport; positive

regulation of tumor necrosis factor production; abnormal spatial learning; CNS inflammation;

positive regulation of interleukin-1 beta secretion; release of sequestered calcium ion into cytosol by

sarcoplasmic reticulum; abnormal astrocyte physiology; abnormal long term spatial reference

memory; abnormal microglial cell activation; abnormal conditioned taste aversion behavior

Lbp lipopolysaccharide binding protein -3.61 positive regulation of cytokine production (TNF, IL6, IL8); positive regulation of chemokine

production

Cxcl10 chemokine (C-X-C motif) ligand 10 -3.57 CNS inflammation; positive regulation of release of sequestered calcium ion into cytosol;

demyelination

Cybb cytochrome b-245, beta polypeptide -3.53 neurodegeneration; abnormal spatial learning; axon degeneration; abnormal long term potentiation;

decreased post-tetanic potentiation; implicated_in disease:Alzheimer's disease

Trh thyrotropin releasing hormone -3.50 abnormal pituitary gland development

Gngt2 guanine nucleotide binding protein (G protein), gamma

transducing activity polypeptide 2

-3.48 glutamate signaling pathway (excitatory synaptic transmission pathway)

S100a9 S100 calcium binding protein A9 -3.46 implicated_in disease:Alzheimer's disease

Cd14 CD14 molecule -3.42 positive regulation of tumor necrosis factor production

Pf4 platelet factor 4 -3.42 positive regulation of tumor necrosis factor production

Il20rb interleukin 20 receptor beta -3.28 positive regulation of cytokine production (Il4/Il10)

Itgal integrin, alpha L -3.06 positive regulation of calcium-mediated signalling

Il1b interleukin 1 beta -3.02 learning or memory; positive regulation of cytokine production (IL6, IL8, IFNg); positive regulation

of granulocyte macrophage colony-stimulating factor production; positive regulation vascular

endothelial growth factor production; memory; positive regulation of cytosolic calcium ion

concentration; abnormal myelination; abnormal blood-brain barrier function; Alzheimer disease

pathway; prion diseases pathway; positive regulation of monocyte chemotactic protein-1 production;

abnormal oligodendrocyte morphology

St14 suppression of tumorigenicity 14 (colon carcinoma) -3.02 abnormal neural tube morphology/development; exencephaly; spina bifida

Hspb1 heat shock protein 1 -2.99 positive regulation of interleukin-1 beta production

Serpine1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator

inhibitor type 1), member 1

-2.95 positive regulation of interleukin-8 production; p53 signaling pathway

Cdk1 cyclin-dependent kinase 1 -2.92 p53 signaling pathway/stress response pathway

RT1-Bb RT1 class II, locus Bb -2.88 abnormal neuron proliferation

Tspo translocator protein -2.84 behavioral response to pain; positive regulation of calcium ion transport; implicated_in disease:

panic disorder

Anxa1 annexin A1 -2.83 abnormal pituitary gland morphology

F5 coagulation factor V -2.76 intracranial haemorrhage

Ccnb2 cyclin B2 -2.74 p53 stress response signaling pathway

Tagln transgelin -2.74 intracranial hemorrhage;

Calcb calcitonin-related polypeptide, beta -2.73 cellular calcium ion homeostasis

Slc11a1 solute carrier family 11 (proton-coupled divalent metal ion

transporter), member 1

-2.68 positive regulation of cytokine production (Ifg)

Vim vimentin -2.67 increased anxiety-related response; abnormal nervous system morphology; intracranial hemorrhage;

abnormal spinal cord morphology; abnormal motor learning; neurodegeneration; abnormal neuron

differentiation; gliosis; abnormal CNS glial cell morphology; brain inflammation; astrocytosis;

Purkinje cell degeneration; decreased brain weight; hippocampal neuron degeneration

Cenpa centromere protein A -2.63 abnormal neural tube morphology/development; abnormal forebrain morphology

Ctsc cathepsin C -2.60 decreased prepulse inhibition

Olr59 olfactory receptor 59 -2.60 abnormal olfactory bulb development; abnormal olfactory sensory neuron morphology

Mt2A metallothionein 2A -2.60 abnormal learning/memory/conditioning; abnormal microglial cell physiology; tonic-clonic seizures;

increased neuron apoptosis; abnormal astrocyte morphology; increased susceptibility to

pharmacologically induced seizures

C1qc complement component 1, q subcomponent, C chain -2.57 prion diseases pathway

Bcl3 B-cell CLL/lymphoma 3 -2.57 positive regulation of interferon-gamma production

Ncf1 neutrophil cytosolic factor 1 -2.53 impaired cued conditioning behavior; abnormal spatial learning; enhanced long term potentiation

RT1-Da RT1 class II, locus Da -2.49 implicated_in disease: bipolar disorder

Pttg1 pituitary tumor-transforming 1 -2.44 abnormal neural tube morphology/development;

Cp ceruloplasmin (ferroxidase) -2.43 abnormal neuron morphology; neurodegeneration; abnormal astrocyte physiology; abnormal brain

iron level; neuron degeneration; abnormal Purkinje cell morphology; demyelination; abnormal

fourth ventricle morphology; abnormal astrocyte morphology; decreased motor neuron number;

retinal photoreceptor degeneration; abnormal cerebellar granule layer morphology; abnormal

cerebellar granule layer morphology

C3ar1 complement component 3a receptor 1 -2.41 positive regulation vascular endothelial growth factor production (cytokine production); positive

regulation of cytosolic calcium ion concentration; demyelination

Cox6a2 cytochrome c oxidase subunit VIa polypeptide 2 -2.40 neurodegenerative disease pathway: Parkinson, Alzheimer & Huntington disease pathway

Ptprc protein tyrosine phosphatase, receptor type, C -2.39 release of sequestered calcium ion into cytosol; abnormal myelination; abnormal oligodendrocyte

morphology

Slc6a5 solute carrier family 6 (neurotransmitter transporter), member 5 -2.38 abnormal neuron physiology; abnormal CNS synaptic transmission; abnormal miniature inhibitory

postsynaptic currents; abnormal neuromuscular synapse morphology; abnormal miniature inhibitory

postsynaptic currents; implicated_in disease: bipolar disorder

Cd44 Cd44 molecule -2.37 abnormal miniature inhibitory postsynaptic currents; abnormal phrenic nerve morphology; abnormal

miniature excitatory postsynaptic currents

Ccna2 cyclin A2 -2.36 p53 stress response signaling pathway

Ripk3 receptor-interacting serine-threonine kinase 3 -2.33 positive regulation of type I interferon production

Cd300a Cd300a molecule -2.27 negative regulation of serotonin secretion

A2m alpha-2-macroglobulin -2.25 Alzheimer disease pathway, neurodegenerative disease pathway; implicated_in disease:Alzheimer's

disease

C1qb complement component 1, q subcomponent, B chain -2.23 prion diseases pathway

Mmp9 matrix metallopeptidase 9 -2.23 impaired contextual conditioning behavior; abnormal blood-brain barrier function; abnormal

myelination; decreased susceptibility to ischemic brain injury; decreased neuron apoptosis; reduced

long term potentiation; decreased oligodendrocyte number

Pla2g2a phospholipase A2, group IIA -2.18 long term depression; glutamate signaling pathway; implicated_in disease: vascular dementia,

Alzheimer's disease, endogenous depression

Plau plasminogen activator, urokinase -2.16 implicated_in disease:Alzheimer's disease

Cd86 CD86 molecule -2.15 abnormal nervous system morphology; abnormal meninges morphology; brain inflammation;

abnormal nerve conduction; abnormal action potential; demyelination; decreased nerve conduction

velocity; abnormal ventral/dorsal spinal root morphology; abnormal myelin sheath morphology

Pycard PYD and CARD domain containing -2.10 positive regulation of cytokine production (TNF, IL6, Ifg, IL1B); positive regulation of chemokine

secretion

Mt1a metallothionein 1a -2.07 abnormal learning/memory/conditioning ; abnormal microglial cell physiology; tonic-clonic

seizures; clonic seizures; increased neuron apoptosis; abnormal microglial cell morphology;

abnormal astrocyte morphology; increased susceptibility to pharmacologically induced seizures

Nos2 nitric oxide synthase 2, inducible -2.02 amyloid beta deposits; abnormal brain interneuron morphology; abnormal brain wave pattern;

abnormal long term spatial reference memory; amyloid beta deposits; neuron degeneration;

abnormal central nervous system regeneration; abnormal peripheral nervous system regeneration;

loss of hippocampal neurons; decreased cerebral infarction size; increased susceptibility to

pharmacologically induced seizures; abnormal hippocampus CA3 region morphology

Fes feline sarcoma oncogene -2.00 enlarged lateral ventricles/ enlarged lateral ventricles

Tyrobp Tyro protein tyrosine kinase binding protein -2.00 abnormal myelination; abnormal neuron morphology; reduced sensorimotor gating; abnormal

microglial cell morphology; abnormal axon morphology; abnormal excitatory/inhibitory

postsynaptic currents; enhanced long term potentiation; decreased prepulse inhibition

Fcer1g Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide -1.99 positive regulation of tumor necrosis factor production/interleukin-6 production/ interleukin-10

production; decreased platelet calcium level; positive regulation of mast cell cytokine production

C1qa complement component 1, q subcomponent, A chain -1.97 seizures; prion diseases pathway; abnormal hippocampus pyramidal cell morphology; abnormal

inhibitory postsynaptic currents; nonconvulsive seizures; abnormal CNS synaptic transmission;

abnormal synaptic bouton morphology

Irf7 interferon regulatory factor 7 -1.96 positive regulation of type I interferon production (alpha & beta); MDA-5 signaling pathway

Cdc20 cell division cycle 20 -1.94 positive regulation of synapse maturation

Btk Bruton agammaglobulinemia tyrosine kinase -1.92 calcium-mediated signalling

Lgals1 lectin, galactoside-binding, soluble, 1 -1.92 abnormal postnatal subventricular zone morphology; abnormal sensory neuron morphology;

abnormal postnatal subventricular zone morphology; abnormal mechanoreceptor morphology;

abnormal nociceptor morphology; abnormal neuromuscular synapse morphology; abnormal

olfactory nerve morphology; abnormal mechanoreceptor morphology; abnormal dorsal root ganglion

morphology

Prlhr prolactin releasing hormone receptor -1.91 enhanced conditioned place preference behaviour

Fermt3 fermitin family member 3 -1.89 intracranial haemorrhage

Slc39a4 solute carrier family 39 (zinc transporter), member 4 -1.88 hydroencephaly; exencephaly

Cd74 Cd74 molecule, major histocompatibility complex, class II -1.88 positive regulation of chemokine (C-X-C motif) ligand 2 production; GO:positive regulation of

invariant chain macrophage cytokine production

Ptpn6 protein tyrosine phosphatase, non-receptor type 6 -1.86 regulation of release of sequestered calcium ion into cytosol

Tlr2 toll-like receptor 2 -1.85 positive regulation of cytokine production (IL6, IL8, TNF, Il18, IL12, IL10); positive regulation of

chemokine production; impaired passive avoidance behavior; amyloid beta deposits; abnormal

myelination; CNS ischemia; abnormal glial cell physiology; abnormal long term spatial reference

memory; decreased neuron apoptosis

Tnfrsf1b tumor necrosis factor receptor superfamily, member 1b -1.85 abnormal nervous system physiology; CNS inflammation; abnormal neuron physiology; abnormal

glial cell physiology; seizures; amyotrophic lateral sclerosis disease pathway; demyelination;

abnormal oligodendrocyte apoptosis; abnormal glutamate-mediated receptor currents; increased

susceptibility to neuronal excitotoxicity; decreased susceptibility to dopaminergic neuron

neurotoxicity

Cd4 Cd4 molecule -1.85 positive regulation of calcium-mediated signaling; brain inflammation; demyelination

Spi1 spleen focus forming virus (SFFV) proviral integration

oncogene

-1.82 motor neuron degeneration; decreased motor neuron number; abnormal microglial cell morphology;

abnormal astrocyte morphology

Slc22a3 solute carrier family 22 (organic cation transporter), member 3 -1.78 abnormal dopamine level; increased susceptibility to dopaminergic neuron neurotoxicity;

implicated_in disease: obsessive-compulsive disorder

S100a10 S100 calcium binding protein A10 -1.78 abnormal depression-related behavior; increased thigmotaxis; decreased single cell response

intensity; implicated_in disease: mental depression

Lilrb3l leukocyte immunoglobulin-like receptor, subfamily B (with TM

and ITIM domains), member 3-like

-1.78 negative regulation of serotonin secretion; negative regulation of calcium ion transport

Casp1 caspase 1 -1.77 learning and memory; amyotrophic lateral sclerosis disease pathway; positive regulation of

interleukin-1 beta and interleukin-1 alpha secretion; decreased susceptibility to ischemic brain

injury; decreased neuron apoptosis

Arhgdib Rho, GDP dissociation inhibitor (GDI) beta -1.75 neurotrophic factor signaling pathway

Irf8 interferon regulatory factor 8 -1.75 positive regulation of cytokine production (IL12/IFg)

Fas Fas cell surface death receptor -1.75 CNS inflammation; abnormal spatial learning; p53 signaling pathway; Alzheimer disease pathway;

demyelination; abnormal retinal ganglion cell morphology; decreased neuron apoptosis; abnormal

cerebellum morphology; decreased Purkinje cell number; decreased brain weight; small cerebellum;

abnormal cerebellar foliation; implicated_in disease:Alzheimer's disease

Tlr7 toll-like receptor 7 -1.74 positive regulation of cytokine production (IL6, IL8, TNF, Il18, IL12, IL10); positive regulation of

chemokine production;

Grn granulin -1.74 abnormal nervous system physiology; increased thigmotaxis; increased anxiety-related response;

abnormal neuron physiology; abnormal brain morphology; abnormal spatial learning;; abnormal

neurite morphology; impaired synaptic plasticity; microgliosis; loss of dopaminergic neurons;

astrocytosis; reduced long term potentiation; increased susceptibility to dopaminergic neuron

neurotoxicity

Pik3ap1 phosphoinositide-3-kinase, regulatory subunit 5 -1.73 neurotrophic factor signaling pathway

Hpgds hematopoietic prostaglandin D synthase -1.73 abnormal astrocyte morphology

Mafb v-maf avian musculoaponeurotic fibrosarcoma oncogene

homolog B

-1.71 abnormal nervous system physiology; abnormal brainstem morphology; abnormal neural tube

morphology/development; abnormal hindbrain development; abnormal rhombomere morphology

Actg2 actin, gamma 2, smooth muscle, enteric -1.70 actin, gamma 2, smooth muscle, enteric

Sema3a sema domain, immunoglobulin domain -1.68 abnormal neuronal migration /differentiation; abnormal cerebral cortex pyramidal cell morphology;

abnormal sensory neuron innervation pattern; abnormal spinal nerve morphology ; abnormal enteric

nervous system morphology; decreased neuron number; abnormal neuronal migration; abnormal

axon fasciculation; decreased brain size; abnormal vagus nerve morphology

Pla2g2d phospholipase A2, group IID -1.67 long term depression; glutamate signaling pathway

Spta1 spectrin, alpha, erythrocytic 1 (elliptocytosis 2) -1.67 abnormal brain morphology;

Itga5 integrin, alpha 5 -1.65 learning or memory; abnormal spatial learning; abnormal neuronal migration; kinked neural tube;

reduced long term potentiation; abnormal cerebral cortex morphology; abnormal cerebral cortex

morphology

Casp4 caspase 4, apoptosis-related cysteine peptidase -1.65 positive regulation of interleukin-1 beta secretion; implicated_in disease:Alzheimer's disease

Cmklr1 chemokine-like receptor 1 -1.63 regulation of calcium-mediated signalling

Bard1 BRCA1 associated RING domain 1 -1.62 open neural tube

Espl1 extra spindle pole bodies homolog 1 (S. cerevisiae) -1.61 abnormal neural tube morphology/development

B4galt1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, -1.60 abnormal pituitary gland morphology

polypeptide 1

Ada adenosine deaminase -1.59 calcium-mediated signalling

Plek pleckstrin -1.59 negative regulation of calcium-mediated signaling

Pla2g5 phospholipase A2, group V -1.59 long term depression; glutamate signaling pathway

Serpinf1 serpin peptidase inhibitor, clade F -1.59 learning or memory; short-term memory; decreased retinal ganglion cell number

Capn3 calpain 3 -1.59 positive regulation of release of sequestered calcium ion into cytosol

Igf1 insulin-like growth factor 1 -1.55 regulation of calcium ion transport; abnormal nervous system physiology; long term depression;

calcium ion transport; learning or memory; abnormal myelination; p53 signaling pathway; positive

regulation of calcineurin-NFAT signaling cascade; abnormal sensory neuron innervation pattern;

decreased motor neuron number; increased neuron apoptosis; abnormal cochlear ganglion

morphology; abnormal olfactory bulb layer morphology; implicated_in disease: dementia,

Alzheimer's disease

Tgif1 TGFB-induced factor homeobox 1 -1.53 abnormal brain development; hydroencephaly; abnormal hindbrain development; abnormal forebrain

development; holoprosencephaly; abnormal brain ventricle morphology; exencephaly; abnormal

brain development; abnormal folding of telencephalic vesicles

Col13a1 collagen, type XIII, alpha 1 -1.52 abnormal miniature endplate potential; abnormal synaptic vesicle morphology; abnormal

neuromuscular synapse morphology; abnormal endplate potential; abnormal synaptic acetylcholine

release

Lat2 linker for activation of T cells family, member 2 -1.51 calcium-mediated signalling

Biologically relevant genes upregulated in the FEAR + DCS WA group compare to the FEAR + SALINE MA group

Gene Name Fold change Function

P2ry4 pyrimidinergic receptor P2Y, G-protein coupled, 4 2.91 positive regulation of cytosolic calcium ion concentration

Gabrq gamma-aminobutyric acid (GABA) A receptor, theta 2.46 decreased prepulse inhibition;

Galr1 galanin receptor 1 2.09 positive regulation of cytosolic calcium ion concentration

Gnb3 guanine nucleotide binding protein (G protein), beta polypeptide

3

2.04 glutamate signaling pathway; abnormal retinal rod bipolar cell morphology; implicated_in disease:

endogenous depression

Crhr2 corticotropin releasing hormone receptor 2 1.66 increased anxiety-related response; positive regulation of serotonin secretion; corticotropin-releasing

hormone signaling pathway; negative regulation of calcium ion import; positive regulation of

interleukin-6 production; behavioral despair; implicated_in disease: panic disorder; implicated_in

disease: endogenous depression

Trhr thyrotropin releasing hormone receptor 1.64 increased anxiety-related response; positive regulation of cytosolic calcium ion concentration ;

behavioral despair

Lrp2 low density lipoprotein receptor-related protein 2 1.61 decreased circulating calcium level; abnormal brain morphology; exencephaly; abnormal embryonic

neuroepithelium morphology; holoprosencephaly; delayed neural tube closure

rno-mir-9b-1 Rat microRNA-9b-1 (previous ID mir-3597-1 ) Inf* decreased expression in the hippocampal CA1 region under acute or chronic stress

Htr2c 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled 1.58 serotonin binding; positive regulation of acetylcholine secretion, neurotransmission; cellular calcium

ion homeostasis; behavioral fear response; abnormal response to new environment; abnormal spatial

learning; sporadic seizures; reduced long term potentiation; increased susceptibility to

pharmacologically induced seizures implicated_in disease: anxiety disorder; implicated_in disease:

bipolar disorder; implicated_in disease: Alzheimer's disease

Plagl1 pleiomorphic adenoma gene-like 1 1.57 abnormal neural tube closure

*-Inf: FKPM value for Mmp12 and rno-mir-9b-1 in the FEAR + DCS WA group was zero, therefore dividing the FKPM of Mmp12 in the FEAR + SALINE MA group with

zero results in an infinite fold change. FEAR + DCS WA – fear-conditioned + DCS well-adapted, FEAR + SALINE MA - fear-conditioned + saline maladapted, BORG -

Bio-Ontological Relationship Graph

1.1 Modified contextual fear conditioning protocol

The modified contextual fear conditioning protocol used in this study was based on a PTSD

mouse model originally described by Siegmund and Wotjak (2007). In the current study, ten

repetitive footshocks (each lasting one second) over a period of one minute were used during

fear conditioning instead of the single two second electric footshocks described in the

original model (Siegmund and Wotjak, 2007), and male Sprague-Dawley rats were used

instead of mice (C57BL/6N [B6N] and C57BL/6JOla [B6JOla]) as in the original

publication. Rat pups were weaned at PND 21 and were subjected to regular manual

handling. Animals were housed according to standard laboratory conditions as stipulated by

the Ethical Guidelines of the University for Housing Experimental Animals.

A single electric footshock (intensity 1.5 mA; duration 1 second; ten repetitive shocks over a

period of one minute) was used during fear conditioning. The footshock was administered via

a chamber with a metal grid floor, connected to an electrical current supply. Following the

footshock, rats remained in the chamber for an additional 60 s, after which they were returned

to their home cages. Control animals were placed in the shock chamber, but did not receive

the electric footshock. Fear conditioning commenced on PND 61 (Fig. 1).

1.2 Intrahippocampal DCS administration

The cannulas were surgically implantated on postnatal day (PND) 59. Briefly, rats were

anaesthetized by intraperitoneal injection of a combination of ketamine hydrochloride

(Anaket-V, Bayer Healthcare, South Africa) and medetomide hydrochloride (Domitor, Pfizer,

South Africa) at a dose of 0.1 ml/100 g. Anaesthetised rats were then placed in a David Kopf

stereotaxic instrument. After exposing the skull, holes were drilled the precise coordinates

corresponding to the target area (dorsal hippocampus). The coordinates were obtained from

the rat brain atlas of Paxinos and Watson (http://www.scribd.com/doc/22822097/Rat-Brain-

Atlas). Guide cannulas were then positioned at these coordinates, and 2 jewellers screws and

dental cement were used to anchor these cannulas. For drug or saline infusions, 32 gauge

needles were lowered into the dorsal hippocampus. DCS (Aspen Pharmacare, Durban, South

Africa) was prepared fresh daily (immediately before administration), by dissolving it in

physiological saline to a concentration of 15 mg/kg per rat (Yang and Lu, 2005). A needle

was subsequently inserted into the guide cannula for the administration of DCS or saline;

10μl of either DCS or saline was infused over a period of 2 minutes and the needle was left in

place for a further two minutes to allow diffusion from the tip of the needle into the

hippocampus.

To ensure full recovery, animals received post-operative antibiotics (Trimethoprim

sulfadiazine 30 mg/kg once daily for 5 days) and analgesia (Flunixin meglumine 2.5 mg/kg

once daily for 3 days). The rats were allowed to rest for one day following surgery (PND 60).

To assess the rats’ wellbeing, they were examined twice daily, in their cages, for signs of

distress. These signs included checking the quality of the animals’ coat (pilorection), their

food and water intake as well as general locomotor activity. It was not anticipated that the

experimental procedures and/or the DCS would induce illness. Data generated during the

behavioural tests also indicated that the anesthetics, surgery and post-operative drugs didn’t

elicit any behavioural effects. There was no difference in the behaviours measured during the

L/D avoidance test and OFT between CTRL + SALINE animals compared to naïve animals

(that didn’t undergo any surgery).

1.3 BioOntological Relationship Graph (BORG) database

While bioinformatics tools for identifying differentially expressed genes from RNA

sequencing data and for identifying overrepresented functional categories are quite mature, it

is more complicated to predict an individual transcript’s impact at a cellular or organismal

level, and still more difficult to implicate them in a disease of interest. In order to further

prioritize differentially expressed genes for further investigation and hypothesis generation,

we have developed a semantic network model of fear extinction in our in-house

BioOntological Relationship Graph (BORG) database (in press). The system seamlessly

integrates hundreds of thousands of facts about human, mouse and rat genes and their known

functions, disease and phenotype associations, and pathway membership into a large on-disk

semantic network. Several bio-ontologies act as ‘anchors’ for integration. The hierarchical

structure of the ontologies enables a gene associated with a very specific term e.g.

“behavioural despair” to be automatically transitively linked to a parent term that we defined

as being relevant, e.g. “abnormal depression-related behaviour”. This maximizes the amount

of relevant information obtained from querying the database when searching for evidence to

implicate a gene in a disease, phenotype or treatment response of interest. Furthermore,

storing the information as a directed network allows rat genes to ‘inherit’ knockout

phenotypes from mouse genes and disease annotations from human genes through transitive

association (thick arrows in Figure 2). We built a semantic model of fear extinction by

inserting cross-ontology semantic links between relevant terms from either of the phenotype,

GO or pathway ontologies to the “anxiety disorder” term in the disease ontology (dotted

arrows in Figure 2). This enables rapid and unbiased discovery of transitive associations

between genes and disease based on their known involvement in

phenotypes/functions/pathways relevant to the disease.

By way of summary, when used for finding links between genes and anxiety disorder, for

example, the system performs a directed ‘walk’ on the semantic network to find all relevant

paths between a candidate gene of interest and the disease term in the database. Reports are

produced on a per-gene basis and are particularly useful when filtering a large list of

candidates, since only genes that have at least one path leading to the disease will be returned.

Furthermore, the report contains information from multiple knowledge domains, which can

be used to further manually prioritize the remaining candidates based on the automatically

discovered evidence. This ‘guilt-by-indirect-association’ semantic discovery concept finds

links between gene and disease that would likely have been missed when directly consulting

the literature or individual databases.

1.4 Gene expression analyses

Cummerbund was used to generate dispersion, scatter, count distribution and density plots to

assess data quality, and to perform a principal component analysis (PCA) for identifying

potentially outlier samples in each group.

Figure S1: Principal component analysis indicating four potential outliers based on global expression

profiles

1.5 SYBR Green real-time qPCR gene expression analysis

A calibrator sample was prepared by pooling equal amounts of cDNA from each sample for

the construction of a standard curve. The calibrator cDNA sample was serially diluted 2-fold

per dilution, to produce a seven-point standard curve, with cDNA concentrations ranging

from 800 ng to 12.5 ng. Each of the LDH cDNA samples was diluted to 200 ng for use in

subsequent real-time qPCR analyses. Each 20 µl reaction consisted of 1 × KAPA

SYBR®FAST Master Mix ABI Prism™ (KAPA Biosystems, Massachusetts, USA) and

forward and reverse primers (IDT, Iowa, USA) (Supplementary Material, Table S2). Selected

reference genes, that were verified to be stably expressed in the LDH cDNA samples, were:

β-actin (ACTB), cyclophilin A (Cyc A), glyceraldehyde-3-phosphate dehydrogenase

(GAPDH) and phosphoglycerate kinase (PGK). Each sample was analysed in triplicate in

order to eliminate technical variability. Following the amplification of serial dilutions, a

linear plot of the quantification cycle (Cq) versus the log value of the input amount of DNA

(standard curve) was constructed using ABI’s SDS v.2.3 software (Applied Biosystems,

California, USA). The PCR efficiency was subsequently calculated from the standard curve

for each individual primer set. Software-determined default threshold and baseline values

were used.

Table S2: Primers for SYBR Green real-time qPCR differential expression analysis.

Primer sequences, melting temperatures (Tm), annealing temperatures (Ta) and concentration

of primers in each 20 µl SYBR Green real-time qPCR reaction.

Gene Primer sequences (5’ – 3’)Tm

(°C)

Ta

(°C)

Final primer

concentrations

(µM)

SPP1 F TGTGTCCTCTGAAGAAACGG 54.654 0.12

SPP1 R GGTGAGATTCGTCAGATTCATCC 55.2

IL1RN F GGGATACTAACCAGAAGACC 51.756 0.2

IL1RN R CGAAAGTCAATAGGCACC 50.7

TRH F CCTAACTGGTATCCCTGAATCC 54.361 0.4

TRH R GATGCTGGCGTTTCTCAG 53.8

CYBB F CCAGGTATCCAAGCTAGAGTG 53.854 0.2

CYBB R GTCACAATATTTGTACCAG 45.6

MMP9 F CCTGTACCGCTATGGTTACACTC 56.958 0.2

MMP9 R GATGACAATGTCTGCTTCGAGC 56.2

MT2A F GAACTCTACAGCGATCTCTCG 54.454 0.12

MT2A R CGAAGCCTCTTTGCAGATG 53.9

CXCL13 F CTGGACCAAGGCCAAGAAAGC 58.861 0.6

CXCL13 R CGAGCAGGGATTAAGAAAGGGTG 57.7

S100A4 F CACAAATACTCAGGCAACGAGG 56.058 0.6

S100A4 R GCCCAACACTTCATCTGAGGAG 57.7

NPY F CAGCCCTGAGACACTGATTTC 55.6 56 0.2

NPY R CAACGACAACAAGGGAAATGG 54.6

ACTB F* TGTCACCAACTGGGACGATA 55.754 0.2

ACTB R* GGGGTGTTGAAGGTCTCAAA 55.0

CYC A F* TATCTGCACTGCCAAGACTGAGTG 58.754 0.2

CYC A R* CTTCTTGCTGGTCTTGCCATTCC 58.6

GAPDH F* ACCACAGTCCATGCCATCAC 57.755 0.12

GAPDH R* TCCACCACCCTGTTGCTGTA 58.6

PGK F* ATGCAAAGACTGGCCAAGCTAC 58.054 0.2

PGK R* AGCCACAGCCTCAGCATATTTC 57.6

CRHR2 F CCGAAGAGCTGCTTTTGG 54.160 0.2

CRHR2 R GTCGTGTTGTACTTGATGCC 53.9

HTR2C F GCGTCCATCATGCACCTCTG 58.760 0.2

HTR2C R CGAAGTTGGGGTCATTGAGC 56.3

*Primers designed to amplify regions of the reference genes ACTB, CYC A, GAPDH and PGK. Primer sequences for reference gene amplification were obtained from previously published reports (β-actin (ACTB), cyclophilin A (Cyc A) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Bonefeld et al. (2008), Langnaese et al. (2008)