molecularcharacterizationandsnpdetectionofcd14geneof...

SAGE-Hindawi Access to ResearchMolecular Biology InternationalVolume 2011, Article ID 507346, 13 pagesdoi:10.4061/2011/507346

Research Article

Molecular Characterization and SNP Detection of CD14 Gene ofCrossbred Cattle

Aruna Pal,1 Arjava Sharma,1 T. K. Bhattacharya,2 P. N. Chatterjee,3 and A. K. Chakravarty4

1 Animal Genetics Division, Indian Veterinary Research Institute, Izatnagar, Pin-243122, India2 Project Directorate on Poultry, Rajendranagar, Hyderabad, India3 Animal Nutrition Division, Indian Veterinary Research Institute, Izatnagar, Pin-243122, India4 Dairy Cattle Breeding Division, National Dairy Research Institute, Karnal, Haryana, Pin-132001, India

Correspondence should be addressed to Aruna Pal, [email protected]

Received 27 April 2011; Revised 19 July 2011; Accepted 19 July 2011

Academic Editor: Andrzej Kloczkowski

Copyright © 2011 Aruna Pal et al. This is an open access article distributed under the Creative Commons Attribution License,which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

CD14 is an important molecule for innate immunity that can act against a wide range of pathogens. The present paper hascharacterized CD14 gene of crossbred (CB) cattle (Bos indicus×Bos taurus). Cloning and sequence analysis of CD14 cDNA revealed1119 nucleotide long open reading frame encoding 373 amino acids protein and 20 amino acids signal peptide. CB cattle CD14gene exhibited a high percentage of nucleotide identity (59.3–98.1%) with the corresponding mammalian homologs. Cattle andbuffalo appear to have diverged from a common ancestor in phylogenetic analysis. 25 SNPs with 17 amino acid changes were newlyreported and the site for mutational hot-spot was detected in CB cattle CD14 gene. Non-synonymous substitutions exceedingsynonymous substitutions indicate the evolution of this protein through positive selection among domestic animals. Predictedprotein structures obtained from deduced amino acid sequence indicated CB cattle CD14 molecule to be a receptor with horseshoe-shaped structure. The sites for LPS binding, LPS signalling, leucine-rich repeats, putative N-linked glycosylation, O-linkedglycosylation, glycosyl phosphatidyl inositol anchor, disulphide bridges, alpha helix, beta strand, leucine rich nuclear export signal,leucine zipper and domain linker were predicted. Most of leucine and cysteine residues remain conserved across the species.

1. Introduction

Manipulation of the host immune response is the most pre-cise and effective tool to lower down the disease incidencesand to nullify the limitations associated with antibiotictreatment or vaccination. CD14 is an important molecule forinnate immunity. CD molecule ranges from 1 to 166 withdifferential structure and functions [1], of these CD14 is themost important molecule known so far, playing a vital roleagainst several enterotoxigenic bacteria. Its pattern recogni-tion receptor binds mainly with LPS (lipopolysaccharide),lipotechoic acid, arachidonic acid and thus releases variouscytokines which act for body’s defence. Body’s immunitythus can act against a wide range of pathogens includinggram-negative bacteria and gram positive as Mycobacteriumsp., Pseudomonas sp. and Staphylococcus aureus. SolubleCD14-enriched bovine colostrums and milk induces B cellgrowth and differentiation [2]. CD14 functions both as a cell

membrane receptor and a soluble receptor for bacterial LPS.It has been considered as an important molecule for its roleon various diseases, like mastitis [3], treponemiasis [4] andglomerulonephritis [5].

CD14 gene may be manipulated in various ways fordisease management. Recombinant protein may be used astherapeutic agent; cloned gene insertion may be utilized forsomatic gene therapy and by the development of transgenicdisease resistant animals. Detection of SNP is useful foranalysis of the evolutionary history of species develop-ment, assessment of biodiversity, associative studies betweenpolymorphisms, and disease-resistance. Scanty reports areavailable so far for genetic polymorphism of CD14 gene in ananimal at coding region; however, CD14 gene polymorphismstudy at promoter region is available in human [6–8].

In recent days, crossbred (CB) cattle are gaining muchimportance being high milk yielder compared to indigenouscattle in developing countries. CB cattle arise due to crossing

2 Molecular Biology International

of low yielding Bos indicus with high yielding Bos taurus,preferably Holstein Friesian or Jersey. In India, CB cattleconstitute 13.3% of the total cattle population with highgrowth rate for CB milch cattle (34.4%), whereas indigenousmilch cattle has decreased by 6.1% [9]. There is a tremendousincrease in the CB cattle in the country that is, 22.8% but theindigenous cattle declined by 10.2% [9]. However, the majordrawback was that CB cattle are poor in adaptability anddisease resistance compared to indigenous cattle. So there isan immediate need to improve disease resistance trait in CBcattle. Scanty reports are available regarding CD14 gene inBos taurus [10, 11]. So far no reports are available regardingmolecular characterization of CD14 gene in CB cattle or itsprotein structure.

Keeping the above facts in mind, the present investigationhas been planned to clone and sequence the CD14 geneof crossbred cattle, study of CD14-derived peptide usingbioinformatics tools, to compare the sequence homologywith other species, and to identify the SNP of CD14 gene ofCB cattle.

2. Materials and Methods

2.1. Animals, Sample Collection, and RNA Isolation. Bloodwas collected aseptically by jugular vein puncture over2.7% ethylenediamine tetraacetic acid from healthy CBcattle. Peripheral blood mononuclear cells (PBM cells) wereisolated from whole blood by density gradient centrifugationusing Lymphocyte Separation Media (LSM) (Himedia) [12].The total RNA was isolated from separated cells usingTRIzol (Life Technologies, USA), following manufacturer’sinstructions and was further used for cDNA synthesis.

2.2. Synthesis and Confirmation of cDNA PCR Amplificationof CD14 Gene. The 20 μL reaction mixture contained 5 μgof total RNA, 0.5 μg of oligo dT primer (16–18 mer), 40 Uof Ribonuclease inhibitor, 1000 M of dNTP mix, 10 mM ofDTT, and 5 U of MuMLV reverse transcriptase in reversetranscriptase buffer. The reaction mixture was gently mixedand incubated at 37◦C for 1 hour. The reaction was stoppedby heating the mixture at 70◦C for 10 minutes and chilledon ice. The integrity of the cDNA checked by PCR. Toamplify full length open reading frame (ORF) of CD14gene sequence, a specific primers pair was designed basedon the CD14 mRNA sequences of cattle (Accession No-Acc No. AF141313) by DNASIS MAX software (HitachiMiraibio Inc., USA). The primers were Forward: CD14-1-FATGGTCTGCGTGCCCTACCTG and Reverse: CD14-70-1-R GGAGCCCGAGGCTTCGCGTAA. 25 μL reaction mixturecontained 80–100 ng cDNA, 3.0 μL 10X PCR assay buffer,0.5 μL of 10 mM dNTP, 1 U Taq DNA polymerase, 60 ng ofeach primer, and 2 mM MgCl2. PCR-reactions were carriedout in a thermocycler (PTC-200, MJ Research, USA) withcycling conditions as, initial denaturation at 94◦C for 3 min,denaturation at 94◦C for 30 sec, annealing at 61◦C for 35 sec,and extension at 72◦C for 3 min were carried out for 35 cyclesfollowed by final extension at 72◦C for 10 min.

2.3. cDNA Cloning and Sequencing. PCR amplicons verifiedby 1% agarose gel electrophoresis were purified from gelusing Gel extraction kit (Qiagen GmbH, Hilden, Germany)and ligated into pGEM-T easy cloning vector (Promega,Madison, WI, USA) following manufacturers’ instructions.The 10 μL of ligated product was directly added to 200 μLcompetent cells, and heat shock was given at 42◦C for45 sec. in a water bath, and cells were then immediatelytransferred on chilled ice for 5 min., and SOC was added.The bacterial culture was pelleted and plated on LB agarplate containing Ampicillin (100 mg/mL) added to agarplate @ 1 : 1000, IPTG (200 mg/mL) and X-Gal (20 mg/mL)for blue-white screening. Plasmid isolation from overnight-grown culture was done by small-scale alkaline lysis methoddescribed by Sambrook and Russell [13]. Recombinant plas-mids were characterized by PCR using gene-specific pri-mers and restriction enzyme digestion based on reportednucleotide sequence for cattle. The enzyme EcoR I (MBIFermentas, USA) isused for fragment release. CD14 genefragment insert in recombinant plasmid was sequencedby automated sequencer (ABI prism) using dideoxy chaintermination method with T7 and SP6 primers (ChromousBiotech, Bangalore).

2.4. Sequence Analysis. The nucleotide sequence so obtainedwas analyzed for protein translation, sequence alignments,and contigs comparisons by DNASTAR Version 4.0, Inc.,USA. Novel sequence was submitted to the NCBI Genbankand accession number (GU368102) was obtained which isavailable in public domain now.

2.5. Phylogenetic Analysis. Phylogenetic analysis was alsoperformed to determine the evolutionary relationship ofCB cattle with other species. Nucleotides sequences werethen aligned with that of the reported CD14 sequences ofdifferent species including Bubalus bubalis (DQ457089), Bostaurus (NM 174008), Canis familiaris (XP 848746), Caprahircus (DQ457090), Homo sapiens (NM 000591), monkey(XP 517975), Mus musculus (NM 009841), Rattus norvegicus(NP 068512), Gallus gallus (AM933591), Equus caballus(AF200416), Macaca mulatta (NM 001130433) Sus scrofa(EF051626), Ovis aries (AY289201), and Oryctolagus cunicu-lus (M85233.1) using the ClusterW method of multiplealignment which is slow and accurate (MegAlign Programmeof Lasergene Software, DNASTAR).

2.6. Study of Predicted CB Cattle CD14 Protein Using Bioin-formatics Tools. Predicted peptide sequence of CD14 geneof CB cattle was derived by Edit sequence (LasergeneSoftware, DNASTAR) and then aligned with the CD14peptide of other livestock and avian using Megalignsequence Programme of Lasergene Software (DNASTAR).Prediction of signal peptide of CD14 gene was conductedusing the software (Signal P 3.0 Sewer-prediction results,Technical University of Denmark). Leucine percentagewas calculated manually from predicted peptide sequence.Di-sulphide bonds were predicted using suitable soft-ware (http://bioinformatics.bc.edu/clotelab/DiANNA/) and

Molecular Biology International 3

1122 bp

1 2 3 Mbp

30002000150012001031

500

Figure 1: Amplification of 1122 bp fragment of CD14 gene ofcrossbred cattle by RT-PCR. Lanes 1 and 2: Amplified product fromcDNA of CD14 gene. Lane 3: Confirmation of insert by plasmidPCR. Lane M: 100 bp DNA ladder plus.

by homology search with other species CD14 polypeptide[14].

Protein sequence level analysis study was carried outwith specific software (http://www.expasy.org./tools/blast/)for determination of leucine rich repeats (LRR), leucinezipper, N-linked glycosylation sites, detection of Leucine-rich nuclear export signals (NES), and detection of theposition of GPI anchor. Detection of Leucine-rich nuclearexport signals (NES) was carried out with NetNES 1.1Server, Technical university of Denmark. Analysis of O-linked glycosylation sites was carried out using NetOGlyc3.1 server (http://www.expassy.org/), whereas N-linked gly-cosylation site were detected by NetNGlyc 1.0 software(http://www.expassy.org/). Regions for alpha helix and betasheet were predicted using NetSurfP-Protein Surface Acces-sibility and Secondary Structure Predictions, Technical Uni-versity of Denmark [15]. Domain linker prediction was doneaccording to the software developed [16]. LPS-binding site[17] as well as LPS-signaling sites [18] were predicted basedon homology studies with other species CD14 polypeptide.3D model of CD14 polypeptide was predicted based onSwissmodel repository [19].

3. Results and Discussion

3.1. Cloning and Characterization of CD14 cDNA. CD14 geneof CB cattle was observed to be 1.12 kb when checked in1% agarose gel electrophoresis (Figure 1). The fragment wascloned into pGEM-T Easy Vector. For the confirmation ofinsert, the transformants were screened using colony PCRfollowed by plasmid PCR and RE digestion of plasmidwith EcoR-I as restriction enzyme released the insert ofapproximately 1.12 kb from the plasmid (Figure 2).

M1 M2 1 2 3

bp

30002000150012001031

500

Figure 2: Release of 1122 bp insert of CD14 gene by EcoRIdigestion. Lane M1: 100 bp DNA ladder. Lane M2: 100 bp DNAladder plus. Lane 1: Release of 1122 bp insert of CD14 gene byplasmid PCR. Lane 2: Release of 1122 bp insert of CD14 gene byplasmid after RE digestion. Lane 3: Control representing Originalplasmid without recombinant CD14 insert.

CD14 gene of CB cattle amplified was observed to be1122 bp. Since this is the first report for study of CD14 genein CB cattle, comparison was not possible. However, similarnucleotide length was observed in Bos taurus [11, 20, 21],Capra hircus [22], and Bubalus bubalis [23].

The DNA insert of CD14 gene was found to be exactly1122 bp with ATG as start codon followed by an open readingframe of 1119 nucleotides, after sequencing of a selectedrepresentative clone (Figure 3). The comparison of obtainednucleotide sequence and derived amino acid sequence usingmultiple alignment (Cluster W, slow and accurate) withavailable CD14 nucleotide sequence of cattle and buffaloconfirmed that the insert was CD14 gene. GC content of CBcattle CD14 gene was found to be as high as 62.57%, similarto Bos taurus (62.75%). This is slightly more than Bubalusbubalis (62.3%) and Capra hircus (62.2%), slightly less thanHomo sapiens (62.94%). GC content of CB cattle is muchhigher than Rattus norvegicus (56.12%) and lower than Canisfamiliaris (64.07%).

3.2. Phylogenetic Analysis of CD14 Gene of CB Cattle withOther Species. CB cattle CD14 gene is 98.1, 96.0, 94.7, 90.5,81.5, 81.1, 78.2, 78.1, 76.5, 70.6, 68.5, 59.3, 11.0% identicalto Bos taurus, Bubalus bubalis, Ovis aries, Capra hircus,Sus scrofa, Equus caballus, Homo sapiens, Canis familiaris,Oryctolagus cuniculus, Mus musculus, Rattus norvegicus,Macaca mulatta, and Gallus gallus CD14 gene (Table 1).Phylogenetic analysis of CB cattle with Bos taurus and otherspecies indicates that CB cattle and Bos taurus are geneticallythe most similar followed by Bubalus bubalis (Figure 4).Phylogenetic closeness of buffalo with cattle as observed in


ORIGIN

1 a t g g t g t g c g t g c c c t a c c t g c t g c t g c t g c t g c t g c c g t c a c t g c t g c g t g t g t c t g c g

6 1 g a c a c a a c a g a a c c c t g c g a g c t g g a c g a c g a c g a t t t c c g t t g t g t c t g c a a c t t c a c g

1 2 1 g a t c c g a a g c c t g a c t g g t c t a g c g c c g t t c a g t g t a t g g t t g c c g t c g a g g t g g a g a t c

1 8 1 a g t g c c g g c g g c c g c a g c c t g g a a c a g t t t c t c a a g g g a g c c g a c a c c a c c c c g a a g c a g

2 4 1 t a t g c t g a c a c a a t c a a g g c t c t g c g c g t t c g g c g a c t c a a g c t g g g c g c t g c a c a g g t t

3 0 1 c c t g c t c a g c t t c t g g t c g c c g t t c t g c g c g c g c t c g g g t a c t c t c g t c t c a a g g a a c t g

3 6 1 a c c c t t g a g g a c c t g g a g g t a a c c g g c c c a a c g c c c c c g a c g c c t c t g g a a c c c g c t g g g

4 2 1 c c t g c a c t c c c c a c c c t c a c t c t c c g t a a c g t a t c g t g g a c a a c a g g a g g t g c c t g g c t c

4 8 1 g g c g a a c t g c a g c a g t g g c t c a a g c c t g g g c t c a g g g t g c t g a a c a t t g c c c a a g t a g a c

5 4 1 t c g c t t g c c t t t c c g a g c g c a g g g c t c t c c a c c t t c g g g g c g c c c a c c a c c c t a g a c c t g

6 0 1 t t t g a c a a t c c c a g t c t c g g c g a c a c g a g g c t g a g g g c a g c t c t c t g t c c g a a c a a g t t c

6 6 1 c c g g c c c t c c a a t a t c t a g c g c t a c g c a a c g c g g g g a t g g a g a c g c c g a g c g g c g t g t g c

7 2 1 g c g g c g c t g g c g g c a g c g a g g g a g c a g c c c c a a a g c c t g g a c c t c a g c c a c a a c t c g g t g

7 8 1 c g g g t c a c c c t c c c c g g g t g t a c c c g a t g t g t c t g g c c c a g t g c a c t a a g g t c t c t c a a t

8 4 1 t t g t c g t t c g c t g g g c t g g a g c a a g t g c c t a a g g g a c t g c c c c c t a a g c t c a g c g t g c t t

9 0 1 g a t c t c a g c t g c a a c a a g c t a a g c a g g g a g c c g c g g c g a g a c g a g c t g c c c g a g g t a a a t

9 6 1 g a c c t g a c t c t g g a c g g a a a t c c c t t t c t g g a c c c t g g a g c c c t c c a g c a c c a a a a t g a c

1 0 2 1 c c g a t g a t c t c c g g c g t g g t c c c a g c c t g t g c g c g t t t t g c c t t g a c c a t g g g g g t g t c a

1 0 8 1 g g a g c c t t g g c g c t g c t t c a a g g a g c c c g a g g c t t c g c g t a a

/ t r a n s l a t i o n = " MVCVP YL L L L L L P S L L RVS ADTTE P CE L DDDDF RCVCNF TDP KP D

W S S AVQCMVAVE VE I S AGGRS L E QF L KGADTTP KQYADTI KAL RVRRL KL GAAQVP AQ

L LVAVL RAL GYS RL KE L TL E DL E VTGP TP P TP L E P AGP AL P TL TL RNVS WTTGGAWLG

E LQQWL KP GL RVL NI AQVDS L AF P S AGL S TF GAP TTL DL F DNP S L GDTRL RAAL CP NK

F PA LQYL AL RNAGMETP S GVCAAL AAARE QP QS L DL S HNS VRVTL P GCTRCVWP S AL R

S LNL SF AGL E QVP KGL P P KL S VL DL S CNKL S RE P RRDE L P E VNDL TL DGNP F L DP GALQHQNDPMI S GVVP ACARF AL TMGVS GAL AL L QGARGF A"

Figure 3: Nucleotide and amino acid sequence of CD14 gene of cattle (GU368102).

the present study has also been reported while studying othergenes like growth hormone gene [24]. Bos taurus CD14 genesequence when compared to other species, also revealed thatcattle was phylogenetically close to buffalo [20]. Comparativesequencing of nucleotide sequences of crossbred cattle (Bosindicus X Bos taurus) with Bubalus bubalis revealed similarresults [23, 25]. Phylogenetic analysis of CB cattle withBos taurus and other species indicates that CB cattle andBos taurus are genetically most similar (98.1%), and thusgrouped together. 1.9% dissimilarity between CB cattle andBos taurus may be due to the inheritance of Bos indicus in CBcattle.

In other words, ruminants were found to be phylogenet-ically close and genetically similar. CB cattle were found to

be the most distant to mouse and rat among the mammalianspecies studied. Thus it is evident that CB cattle has evolvedfrom an ancestor which is genetically much distant than thatof Rattus norvegicus or Mus musculus. Canis familiaris andHomo sapiens were also genetically distant from CB cattle.Gallus gallus has been found to be genetically most distant toCB cattle.

3.3. Study of Predicted CB Cattle CD14 Protein Using Bioin-formatics Tools. The predicted peptide sequence of CD14gene of crossbred cattle revealed 373 amino acids precursorcorresponding to coding sequence of CD14 gene (Figure 3)and a 20 amino acid signal peptide. This is similar to Bostaurus [11] and Capra hircus [22], where CD14 peptide also


Bos taurus

Bubalus bubalisCapra hircusOvis ariesSus scrofaCanis familiarisHomo sapiensMacaca mulattaMus musculusRattus norvegicusOryctolagus caniculusEquus caballusGallus gallus

49.1

051015202530354045

Nucleotide substitutions (×

Bos taurus Bos indicusX

100)

Figure 4: Phylogenetic analysis of crossbred cattle (Bos indicus X Bos taurus) with other species.

Table 1: Percent identity of CD14 gene of crossbred cattle with other species.

∗∗∗ 98.1 98.0 11.3 79.3 92.5 82.7 79.5 60.2 71.7 82.8 77.5 69.5 96.7 Bos taurus

2.3 ∗∗∗ 96.0 11.0 78.1 90.5 81.1 78.2 59.3 70.6 81.5 76.5 68.5 94.7 CB CATTLE

2.0 4.2 ∗∗∗ 19.0 78.7 92.0 82.3 79.5 60.1 71.7 82.6 77.2 69.4 96.3 Bubalus bubalis

83.5 86.5 82.7 ∗∗∗ 16.8 10.2 12.0 11.5 5.0 4.4 18.4 11.4 9.0 18.4 Gallus gallus

24.0 25.9 24.6 77.9 ∗∗∗ 75.7 81.6 77.8 53.1 68.0 79.5 75.5 68.0 80.3 Canis familiaris

7.9 10.3 8.5 83.2 29.2 ∗∗∗ 79.4 76.0 58.1 69.5 78.7 74.6 62.1 93.5 Capra hircus

20.7 23.3 21.1 79.8 20.8 25.2 ∗∗∗ 81.4 62.9 71.8 81.6 79.4 69.9 83.2 Equus caballus

24.5 26.6 24.2 79.2 26.3 29.4 22.0 ∗∗∗ 95.8 73.6 78.3 81.1 72.3 80.0 Homo sapiens

25.7 27.6 25.7 84.1 27.5 32.0 22.5 1.1 ∗∗∗ 57.0 59.6 62.6 57.0 60.5 MONKEY

36.6 39.0 36.7 97.2 39.2 41.0 34.5 33.1 33.5 ∗∗∗ 70.9 72.7 89.5 70.6 Mus musculus

19.9 22.2 20.1 75.8 24.6 25.9 22.7 26.9 28.4 38.6 ∗∗∗ 76.5 69.4 83.1 Sus scrofa

26.4 28.2 26.5 81.7 28.2 30.5 25.2 21.9 23.2 34.5 28.5 ∗∗∗ 70.1 78.2 Oryctolagus cuniculus

39.3 41.5 39.6 98.1 41.3 44.6 37.5 34.6 34.6 11.3 41.2 38.8 ∗∗∗ 69.7 Rattus norvegicus

3.4 5.7 3.8 81.0 22.7 7.0 20.1 24.0 25.7 36.6 19.6 25.0 39.2 ∗∗∗ Ovis aries

Pair Distances of FINAL CB.meg ClustalW (Slow/Accurate, IUB); Percent Similarity in upper triangle; Percent Divergence in lower triangle.

contains 373 amino acids. CB cattle CD14 peptide is ofhigher Mol wt. (39939.29 Daltons) than Bos taurus (39679.96Daltons) and Bubalus bubalis (39705.07 Daltons). CB cattleCD14 peptide sequence was characterized by the presence oftwo extra strongly basic amino acids and one extra stronglyacidic amino acid than Bos taurus, whereas less by onehydrophobic and one polar amino acid than Bos taurus.

Protein sequence level analysis study revealed thatnine leucine rich repeats (LRR) have been identified inpredicted peptide sequence of CB cattle CD14 cDNA(Table 2, Figure 5). These LRRs are considered to participatein receptor and ligand interactions and have various cellularfunctions during early phases of the immune response [26].Comparison of CB cattle CD14 gene with other spp. revealedthat Homo sapiens, Mus musculus, Bos taurus, Capra hircus,and Bubalus bubalis was reported to have 10, 10, 10, 7, and6 LRR, respectively [23, 27]. It has already been reportedthat LRR in extracellular domain is responsible for therecognition of pathogens. Crystal structure of Mus musculusCD14 gene has been depicted with the grooves responsiblefor receptor recognition and binding [14]. Since CD14

molecules can bind to a wide range of substances includinglipopolysaccharides from gram-negative bacteria, lipoarabi-nomannan of mycobacteria, mannuronic acid polymers ofPseudomonas sp., and to peptidoglycans of Staphylococcusaureus, it is expected that there should be sufficient variabilityin the pathogen recognition and receptor binding site, whichis primarily comprised of LRR region of the CD14 molecule.Thus, the presence of LRR coding region may be the regionfor maximum variability to enable the CD14 molecule tobind with a wide range of substances. From the sequencealignment studies for the derived amino acid sequences fordifferent species, it was observed that the particular aminoacid leucine was almost unaltered within the leucine richrepeats, and the variations were observed for other aminoacids. Although there are no reports regarding the numberof LRR and its relation to disease susceptibility, a trend hasbeen observed with more the species is resistant, less the no.of LRR. Buffaloes were reported to have least number of LRRamong the species under study. As reported from a separatestudy, buffalo is most resistant [28] among common farmanimals, namely, cattle, goat, sheep, and buffalo. So, it may be


* *

M V R V P Y L L L L L L P P L L H V S A D T P E P C E L D D Majority-------------------------------------------------------------------------------------------------

* * * * * * * * * * * * * * * * * * * * * * * * * * * * *

1 M V C V P Y L L L L L L P S L L R V S A D T T E P C E L D D Bos taurus X Bos indicus (CB cattle)1 M V C V P Y L L L L L L P P L L R V S A D T T E P C E L D D Bubalus bubalis (Buffalo)1 M V C V P Y L L L L L L S A L L R V T A D K R E P C E L D P Capra hircus (Goat)

1 - M R T P C L L L L L L P P V L C V S E T S L E P C E V D D Canis familiaris (Dog)1 M E R A S C L L L L L L P - L V H V S A T T P E P C E L D D Homo sapiens (Human)1 M E R V L G L L L L - - - L L V H A S P A P P E P C E L D E Mus musculus (Mouse)1 M K L M L G L L L L P L - T L V H A S P A T P E P C E L D Q Rattus norvegicus (Rat)

D D - - F R C V C N F T D P K P D W S S A F Q C M V A V E V Majority------------------------------------------------------------------------------------------------

* * * * * * * * * *

3 1 D D - - F R C V C N F T D P K P D W S S A V Q C M V A V E V Bos taurus X Bos indicus 3 1 D D - - F R C V C N F T D P K P D W S S A V Q C M V A V E V Bubalus bubalis3 1 Q H - - F R C V C N F T D P K P D W S S A V Q C M V A V E V Capra hircus

3 0 D D - - F R C F C N F T D P Q P D W S S A F Q C M I A V E V Canis familiaris 3 0 E D - - F R C V C N F S E P Q P D W S E A F Q C V S A V E V Homo sapiens2 8 E S - - - - C S C N F S D P K P D W S S A F N C L G A A D V Mus musculus3 0 D E E S V R C Y C N F S D P Q P N W S S A F L C A G A E D V Rattus norvegicus

E I S G G G R S L E Q F L K - - G A D A D P K Q Y A D T I K Majority-----------------------------------------------------------------------------------------------------

* *

5 9 E I S A G G R S L E Q F L K - - G A D T T P K Q Y A D T I K cB cattle 5 9 E I S G G G R S L E Q F L K - - G A D T N P K Q Y A D T I K buffalo5 9 E I R G G G H S L D Q F L K - - G A N T D P K Q Y A D T I K goat5 8 E I H G G G R S L E Q F L K - - G A D A D P K Q Y A D M V R dog5 8 E I H A G G L N L E P F L K R V D A D A D P R Q Y A D T V K human

5 4 E L Y G G G R S L E Y L L K R V D T E A D L G Q F T D I I K mouse6 0 E F Y G G G R S L E Y L L K R V D T E A N L G Q Y T D I I R rat

• A L R V R R L T V G A A Q V P A Q L L V A V L R A L G Y S R Majority• ------------------------------------------------------------------------------------------------

• * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *

• 8 7 A L R V R R L K L G A A Q V P A Q L L V A V L R A L G Y S R

L R A L G Y S R

cB cattle • 8 7 A L R V R R L K L G A A Q V P A Q L L V A V buffalo

• 8 7 A L R V R R L K L G A A Q V P A Q L L V A V L R A L G Y S R goat.• 8 6 A L R L R R L T V A S A Q V P A V L V T A F L R A L G Y S R dog• 8 8 A L R V R R L T V G A A Q V P A Q L L V G A L R V L A Y S R human• 8 4 S L S L K R L T V R A A R I P S R I L F G A L R V L G I S G mouse• 9 0 S L P L K R L T V R S A R V P T Q I L F G T L R V L G Y S G rat

Green colour depicts signal peptide

Blue colour depicts LPS binding sites

Cysteine residues have been indicated in pink

Di-sulphide bridges have been indicated by broken blue lines

Site for LPS signalling have been enclosed within orange box or orange coloured

Leucine zipper has been indicated in red

Domain linker have been indicated black overlined

Leucine rich repeat have been indicated by

Site for GPI anchor has been indicated by black arrow

Regions for alpha helix have been depicted by underline

Purple arrow indicates the sites for Beta sheet

Red arrow indicates the site for N-linked glycosylation

Green arrow indicates the site for O-linked glycosylation

(a)

Figure 5: Continued.


• L K E L T L E D L E V T G T A P P P P L E A T G P A L T T L Majority• --------------------------------------------------------------------------------------------------

• * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *

• 1 1 7 L K E L T L E D L E V T G P T P P T P L E A A G P A L T T L cB cattle

• 1 1 7 L K E L T L E D L E V T G P M P P K P L E A T G P A F T T L buffalo • 1 1 7 L K E L T L E D L E V T G P T P P A P L E A T G P A L T T L goat• 1 1 6 L K E L T L Q D L E V N G - - - - - T A A A A G - - - - - - dog.• 1 1 8 L K E L T L E D L K I T G T M P P L P L E A T G L A L S S L human• 1 1 4 L Q E L T L E N L E V T G T A P P P L L E A T G P D L N I L mouse

• 1 2 0 L R E L T L E N L E V T G T A L S P L L D A T G P D L N T L rat

• S L R N V S W A T G G A W L G E L Q Q W L K P G L R V L S I Majority• -------- ----------------------------------------------------------------------------------------

• * * * * * * * * * * * *

• 1 4 7 S L R N V S W T T G G A W L G E L Q Q W L K P G L R V L N I cB cattle• 1 4 7 S L R N V S W A T G G A W L G E L Q Q W L K P G L R V L N I buffalo• 1 4 7 S L R N V S G T T G G A W L G E L Q P W L K P G L R A L N I goat. • 1 3 5 - - - - - - - - S G S H W A C A V H P - -H P P E R V V - - dog

• 1 4 8 R L R N V S W A T G R S W L A E L Q Q W L K P G L K V L S I human• 1 4 4 N L R N V S W A T R D A W L A E L Q Q W L K P G L K V L S I mouse• 1 5 0 S L R N V S W A T T D T W L A E L Q Q W L K P G L K V L S I rat

• A Q A H S L A F S C A G V S T F E A L T T L D L S D N P S L Majority

• -------------------------------------------------------------------------------------------------

• * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *

• 1 7 7 A Q A H S L A F P C A G L S T F E A L T T L D L S D N P S L cB cattle

• 1 7 7 A Q A H S L A F P C A G L S T F E A L T T L D L S D N P S L buffalo

1 7 7 A Q A H S L A F P C A G L S T F E A L T T L D L S D N P S L goat.

• 1 5 3 G N G K C L A R R T A A V A E A G P Q - - - D L S D N P G L dog

• 1 7 8 A Q A H S P A F S C E Q V R A F P A L T S L D L S D N P G L human

• 1 7 4 A Q A H S L N F S C E Q V R V F P A L S T L D L S D N P E L mouse

• 1 8 0 A Q A H S L N F S C K Q V G V F P A L A T L D L S D N P E L rat

• G E S G L M A A L C P N K F P A L Q Y L A L R N A G M E T P Majority

• ------------------------------------------------------------------------------------------------

• * * * * * * * * * * * * * * * * * * * * * * * * * *

• 2 0 7 G D S G L M A A L C P N K F P A L Q Y L A L R N A G M E T P cB cattle• 2 0 7 G D S G L M A A L C P N K F P A L Q Y L A L R N A G M E S L buffalo

• 2 0 7 G D S G L M A A L C P N K F R A P Q Y L A L R N A G M E A A goat.

• 1 8 0 G E H G L A S A L C P Q K F P A L Q A L V L R N A G M H T P dog

• 2 0 8 G E R G L M A A L C P H K F P A I Q N L A L R N T G M E T P human

• 2 0 4 G E R G L I S A L C P L K F P T L Q V L A L R N A G M E T P mouse

• 2 1 0 G E K G L I S A L C P H K F P T L Q V L A L R N A G M E T T rat

•

• S G V C A A L A A A R V Q P Q S L D L S H N S L R V T A - P Majority• 2 5 0 2 6 0 2 7 0• --------------------------------------------------------------------------------------------

• * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *

• 2 3 7 S G V C A A L A A A R V Q P Q S L D L S H N S L R V T A - P cB cattle

• 2 3 7 S G V C A A L A A A R V Q P Q S L D L S H N S L R V T A - P buffalo• 2 3 7 T R P C A P L A A A R V Q P Q N L D L S H N S L R V T A - P goat.• 2 1 0 N G V C A A M A V A G V Q P R H L D L S H N S L R A T A - P dog• 2 3 8 T G V C A A L A A A G V Q P H S L D L S H N S L R A T V N P human• 2 3 4 S G V C S A L A A A R V Q L Q G L D L S H N S L R D A A - - mouse

• 2 4 0 S G V C S A L A A A R V P L Q A L D L S H N S L R D T A - - rat

• G A P R C V W P S A L N S L N L S F A G L E Q V P K G L P A Majority• --------------------------------------------------------------------------------------------------

(b)

Figure 5: Continued.


• 2 6 6 G A T R C V W P S A L R S L N L S F A G L E Q V P K G L P P cB cattle• 2 6 6 G A T R C V W P S A L S S L N L S F A G L E Q V P K G L P P buffalo• 2 6 6 G A T R C V W P S A I S S L N C S F A G L E Q V P K G L P P goat.• 2 3 9 G A P A C V W P S A L D S L N L S F S G L G Q V P K G L P A dog• 2 6 8 S A P R C M W S S A L N S L N L S F A G L E Q V P K G L P A human• 2 6 2 G A P S C D W P S Q L N S L N L S F T G L K Q V P K G L P A mouse• 2 6 8 G T P S C D W P S Q L N S L N L S F T G L E H V P K G L P A rat

• K L S V L D L S C N K L S R E P R R D E L P E V N N L T L D Majority• -------------------------------------------------------------------------------------------------

•

•

* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *

• 2 9 6 K L S V L D L S C N K L S R E P R R D E L P E V N D L T L D cB cattle• 2 9 6 K L S V L D L S C N K L S R E P R R D E L P E V N D L T L D buffalo• 2 9 6 K L S V L D L S C N K L S R E P R R D E L P Y V N V L T V N goat. • 2 6 9 R L S V L D L R C N K L N R E P R L E E L P K V S N L T L D dog • 2 9 8 K L R V L D L S C N R L N R A P Q P D E L P E V D N L T L D human• 2 9 2 K L S V L D L S Y N R L D R N P S P D E L P Q V G N L S L K mouse• 2 9 8 K L S V L D L S Y N R L D R K P R P E E L P E V G S L S L T rat

• G N P F L D P G A L Q S Q N D P M I S G V V P A C A R S A L Majority• ------------------------------------------------------------------------------------------------

* * * * * * * * * * * * * * * * * *

• 3 2 6 G N P F L D P G A L Q H Q N D P M I S G V V P A C A R S A L cB cattle• 3 2 6 G N P F L D P G A L Q R Q N D P M I S G V V P A C A R S A L buffalo• 3 2 6 G N P F L D P G A L Q H Q N D P M I S R M I P D R A P P S L goat • 2 9 9 G N P F L D P E A P K Y Q E N P T T S G V V P S C A R S G L dog• 3 2 8 G N P F L V P G T A L P H E G S M N S G V V P A C A R S T L human• 3 2 2 G N P F L D S - - - E S H S E K F N S G V V T A G A P S S Q mouse• 3 2 8 G N P F L H S - - - E S Q S E A Y N S G V V I A T A L S P G rat

• A V G V S G T L A L L Q G A R G F A - Majority• ------------------------------------------------------• 3 5 6 T M G V S G A L A L L Q G A R G F A . cB cattle• 3 5 6 T M G V S G A L A L L Q G A R G F A . buffalo• 3 5 6 V I G V S G A L V L Y Q G A R G F A . goat.• 3 2 9 A V G M S G T L A V L Q R V G G F A . dog• 3 5 8 S V G V S G T L V L L Q G A R G F A . human• 3 4 9 A V A L S G T L A L L L G D R L F V . mouse• 3 5 5 S A G L S G T L A L L L G H R L F V . rat

• * * * * * * * * * * * * * * * * * ** * * * * * * * * * * * * * * * * * * * * * * *

(c)

Figure 5: Alignment of CB cattle CD14 derived peptide with other species.

Table 2: Leucine-rich repeats detected in derived peptide sequence of CD14 gene of crossbred cattle.

Repeat From To Fragment

LRR 12 35 LPSLLRVSADTTEPCELDDDDFRC

LRR 86 107 KALRVRRLKLGAA.QVPAQLLVA

LRR 114 138 YSRLKELTLEDLEVTGPTPPTPLEP

LRR 176 200 IAQVDSLAFPSAGLSTFGAPTTLDL

LRR 220 242 FPALQYLALRNAGM.ETPSGVCAA

LRR 247 271 REQPQSLDLSHNSVRVTLPGCTRCV

LRR 273 296 PSALRSLNLSFAGLEQVPKGLPPK

LRR 298 316 SVLDLSCNKLSREPRRDEL

LRR 317 337 PEVNDLTLDGNPF..LDPGALQH


Table 3: N-linked glycosylation sites for derived CD14 peptide ofcrossbred cattle.

Position Sequence

38 NFTD

150 NVSW

203 NPSL

280 NLSF

possible that the lesser number of LRR, the more it is resistantto diseases. However, further studies the species possess areneeded for its confirmation.

The CD14 derived-peptide sequence of crossbred cattlecontained 4 putative N-linked glycosylation sites (Figure 5,Table 3) whereas, there is report of three, five, four, five,and four glycosylation sites for N-linked glycosylation inBos Taurus [29], Mus musculus [30], Homo sapiens [30],Rattus norvegicus [31], Bubalus bubalis [23], respectively. N-linked glycosylation is vital for the molecule as it supportsthe molecule to be present either in membranous or solubleform.

CB cattle contain 5 sites for O-linked glycosylation(Figure 5) at amino acid positions 128, 131, 134, 145,147, which differs from Bubalus bubalis containing 3 sites[23]. However, O-linked glycosylation was reported to beabsent in Homo sapiens purified native CD14 molecule[32]. Glycosylation is needed when hydrophilic clusters ofcarbohydrates alter the polarity and solubility of protein orprotein folding.

Protein sequence level analysis study revealed that inCB cattle, there was a glycosyl phosphatidyl inositol (GPI)anchor located at C-terminus near 345th position of theCD14 molecule (Figure 5). It differs from Bubalus bubaliscontaining glycosyl phosphatidyl inositol (GPI) anchorlocated at C-terminus near 353rd position of the CD14molecule [23]. Similar findings were reported by Wright [33]in other species like and Mus musculus. GPI anchor is vital forthe molecule as the basic function of GPI in mammalian cellsystem is to make a bridge between CD14 and cell surface.However, in case of avains, CD14 is trans-membrane ratherthan GPI anchored [34].

Alignment of derived peptide sequence of CB cattle withother species (Figure 5) revealed that leucine residues areconserved across the species (Figure 5). Cystine residue hasalso been observed to be conserved across species (Figure 5).Similar observations were also observed for Mus musculus[14].

Five disulphide bridges have been predicted betweencysteine residues in CD14 polypeptide of CB cattle of whichonly four were visualized in Figure 5. Since Cys287 is atyrosine in the mouse CD14 sequence, in the homology studyof CD14 sequences for different species (Figure 5), the fifthdisulphide bond is not visualized. Disulphide bridges areresponsible for protein folding. Protein folding in turn givesrise to groove formation for binding site for ligand. Homosapiens CD14 also contains 5 disulphide bonds [32]. Musmusculus CD14 molecules were reported with 4 disulphide

bonds [14]. The crystal structure of mouse CD14 also shedslight on the sites of cotranslational modifications of humanCD14. Similar five disulfide bonds are implicated from thebiochemical studies in human [35]. In human CD14, adifferential impact is observed for the five disulfide bondson CD14 folding, with the first two being indispensable,the third and fourth being important, and the last (Cys287–Cys333) being dispensable. When mapped to the crystalstructure of mouse CD14, the first two disulfide bonds arefound in the β sheets in the inner concave surface (the“core” structure), whereas the third and fourth disulfidebonds are in the loops and helices on the outer surface (the“peripheral” structure). The last disulfide bond (Cys287–Cys333) is not seen in the structure, because the constructused for crystallization has the truncation of C-terminal 33amino acids, and Cys287 is a tyrosine in the mouse CD14sequence [14]. The first disulfide bond is therefore essentialfor the structural and functional integrity of CD14. Thethird and fourth disulfide bonds contribute to but do notdetermine CD14 folding, because the substitutions of thesecysteines with alanines decrease but do not abrogate CD14secretion. The last disulfide bond (Cys287–Cys333) has noeffect on CD14 folding [32].

In CB cattle, four LPS-binding sites were depicted from29th–32nd, 44th–47th, 55th–59th, and 75th–80th aminoacid positions (Figure 5). LPS-binding site region I overlapswith LRR. The structural characteristics of the binding sitemay explain the broad ligand specificity of CD14. Althoughthe hydrophobic bottom and walls of the pocket are rigid, thegenerous size of the pocket may allow structural variation inthe hydrophobic portion of the ligand. Structural diversity inthe hydrophilic part of the ligands could be explained by theconsiderable flexibility of the hydrophilic rim combined withthe multiplicity of grooves available for ligand binding. Thisis also the case of Mus musculus CD14 molecule reported bySambrook and Russell [13]. LPS-binding site is in agreementwith the present study that N-terminal region of Homosapiens CD14 molecule is responsible for LPS binding [36].

Three LPS signaling sites were predicted for aminoacid positions as 27th–33th, 109th–119th, and 169th–171thamino acid (Figure 5). Similar observations were reported bySambrook and Russell [13] in Mus musculus with four LPS-binding sites and three LPS signaling sites. Region I for LPSsignaling site overlaps with LPS binding site. LPS signalingsite also overlaps with LRR. This is similar to Mus musculusCD14 molecule, as reported by Sambrook and Russell [13].

In terms of secondary structure prediction, five regionswere detected for α helix conformation as 4–12, 67–73,241–244, 343–346, and 360–368, and eleven regions wereidentified for β strand conformation as 60-61, 118–122,145–147, 173–176, 181-182, 197–199, 225–227, 252–254,278–280, 299–301, 321–324 amino acid positions (Figure 5).However, in Mus musculus, 7 alpha helix, and 13 betasheets were identified [13]. The monomeric subunit of CD14contains eleven β strands, and 9 of them, from β2, β4to β11, overlap with conserved leucine-rich repeats (LRRs)(Figure 5).

Leucine-rich nuclear export signals were detected for 7sites at amino acid positions 12, 15, 16, 17, 117, 122, 127


Table 4: SNP detection in CD14 gene of CB cattle and the amino acid changes.

Position of SNP Synm/Nonsynm Bos taurus Bos taurus X Bos indicus Type of mutation Resulting amino acid change

1 A230C Non-Synm A C Transversion N77T

2 G363C Synm G C Transversion

3 G412C Non-synm G C Transversion A138P

4 G426A Synm G A Transition

5 A430C Non-synm A C Transversion T144P

6 G440C Non-synm G C Transversion S147T

7 C536T Non-synm C T Transition A179V

8 C538G Non-synm C G Transversion H180D

9 T556A Non-synm T A Transversion C186S

10 A578G Synm A G Transition E193G

11 T584C Non-synm T C Transition L195P

12 C602T Non-synm C T Transition S201F

13 G626C Non-synm G∗ C Transversion S209T∗∗

14 C627G Non-synm C∗ G Transversion -do-

15 G628A Non-synm G A Transition G210R

16 T635G Non-synm T G Transversion M212R

17 T743A Non-synm T A Transversion V248E

18 C778G Non-synm C G Transversion L260V

19 C783G Synm C G Transversion

20 G790C Non-synm G C Transversion A264L

21 C791T Non-synm C T Transition A264L

22 G795C Synm G C Transversion

23 T798G Synm T G Transversion

24 G799T Non-synm G T Transversion A267C

25 C800G Non-synm C G Transversion A267C

26 C1058T Non-synm C T Transition S353F

27 C1087T Synm C T Transition∗

This nucleotide is present in cattle sequences gene bank Acc no. EU 148609, EU148610, EU148611, whereas cattle sequences NM174008, AF141313 containthe nucleotide sequence as in crossbred cattle. This SNP is already reported.∗∗Amino acid Serine is present in cattle sequences protein id Acc no. AAD32215, ABV68571, ABV68570, ABV68569, NP776433, ADB92696 (CB cattle).

(Figure 5). A nuclear export signal (NES) is a short aminoacid sequence of 4 hydrophobic residues in a protein thattargets it for export from the cell nucleus to the cytoplasmthrough the nuclear pore complex [37]. However, it is the firstreport of prediction of the site of leucine-rich nuclear exportsignal in CD14 gene in animal.

DNA-binding motif as leucine zipper pattern wasdetected from amino acid position 279 of CB CD14 peptide(Figure 5), which is reported here for the first time inCD14 molecule. Leucine scissors [38] is a common three-dimensional structural motif in proteins. These motifs areusually found as part of a DNA-binding domain in varioustranscription factors and are therefore involved in regulatinggene expression. The leucine zipper is a supersecondarystructure that functions as a dimerization domain, and itspresence generates adhesion forces in parallel alpha helices[39]. However, the site of leucine zipper in CD14 gene ispredicted here for the first time in any animal.

Domain linker site was predicted for amino acidpositions 121–146 and 283–334 (Figure 5). Domain linkersequences are loop sequences connecting two structuraldomains [40]. linker are likely to act as a scaffold to

prevent unfavourable interactions between folding domains[41]. Recent advances in protein engineering have comefrom creating multifunctional chimeric proteins containingmodules from various proteins. These modules are typicallyjoined via an oligopeptide linker, the correct design of whichis crucial for the desired function of the chimeric protein.Analysis of the properties of naturally occurring interdomainlinkers is useful with the aim to design linkers for domainfusion leading to chimeric protein formation [41].

CB cattle CD14 molecule is predicted to be mostlyexpressed on cell membrane or cell surface. Since CD14is a receptor molecule, it is obvious to be expressed oncell surface. Moreover, in the present study, CD14 cDNAwas prepared from mRNA expressed on cells of liver tissue.CD14 exists in two forms as membranous and solubleform [42, 43]. In the present study, CD14 cDNA cloned isthe membranous form as it contains GPI anchor for theattachment with cell membrane as well as glycosylated form[42, 43].

3D model of CD14 molecule of CB cattle was predictedfrom amino acid position 24 to 331 (Figure 6), withhorseshoe-shaped structure, with alternating alpha helix


α helix

Amino terminalpocket

Concavesurfacecontainingβ sheets

LPS-binding site,

Figure 6: 3D structure of CD14 peptide of crossbred cattle. It is ahorse shoe shaped structure when exist as dimer. Since it is receptormolecule, presence of pockets and grooves for ligand binding. Blueend represents amino acid terminal with a pocket.Residue range:24 to 331 amino acid of CD14 molecule. Model info: modelledresidue range: 24 to 331 based on template 1wwlB (2.50 A) SequenceIdentity (%): 62.581.

and beta chains. CD14 exists as dimmer with the help ofleucine zipper when acting as a receptor molecule. Thefinding is similar to study conducted by Sambrook andRussell [13], where they studied crystal structure of CD14molecule of Mus musculus. The amino terminal pocketalong with grooves is responsible for ligand binding. SinceCD14 is a receptor, ligand binding is an important factor.Based on homology study for CD14 3D structure with Musmusculus [14] and Homo sapiens [32], LPS-binding pocketwas predicted at the amino terminal end of CB cattle CD14molecule, α helix were located at the convex surface, andβ strand were located at the concave surface of horse-shoeshaped CD14 structure, represented in Figure 6.

3.4. SNP Study of CD14 Gene in Crossbred Cattle. CB cattlehas resulted from the cross of Bos taurus and Bos indicus.As expected, 27 nucleotide changes were observed, whencompared with the published sequences of CD14 gene of Bostaurus, out of which 25 were newly reported. 6 synonymouschanges and 18 amino acid changes were reported out ofwhich 17 were new changes (Table 4). Two SNPs for Bostaurus were reported previously [21]. Similar higher degreesof mutations have been observed in some other genes as 25SNPs in Leptin gene in Korean cattle [44], 96 SNPs fromTLRs, and their associated intracellular signaling molecules[45] in human.

Nonsynonymous substitutions exceeding synonymoussubstitutions indicate the evolution of this protein throughpositive selection among domestic animals. SNP for theCD14 gene of crossbred cattle was reported here for the firsttime.

An interesting observation is that the CD14 nucleotidesequence from 1 to 258 has no major SNP detected, exceptone A230C. This may be the reason that 1 to 60 nucleotidecodes for signal peptide, when no variation is expected.The present finding is similar to Bubalus bubalis, whenmonomorphism was reported for this nucleotide region [20]except for one nucleotide change that is too within LPS-binding site. This variant containing threonine may be thespecies specific characteristics particular to CB cattle. Thisallele is most probably contributed by Bos indicus, since noneof the Bos taurus contains this allele.

Another interesting observation is that about 50% ofthe nucleotide changes, including 3 synonymous changeshave been reported from 602nd to 800th nucleotide regionof CD14 gene of CB cattle, that is, within 199 nucleotide.So, this region may be the hyper-variable region containingmutational hot spot. Similar findings were also reportedin Bubalus bubalis, where 42 SNP were identified with 39nonsynonymous changes, leading to 23 amino acid changes[20]. This region may be considered as the hypervariableregion for buffalo also.

4. Conclusion

CD14 gene of crossbred cattle (Bos indicus crossed with Bostaurus) has been characterized for the first time in the presentstudy. 25 SNPs with 17 amino acid changes were newlyreported, and the site for mutational hot-spot, detected in CBcattle CD14 gene. CB cattle has been phylogenetic closestto Bos taurus. Cattle was observed to be phylogeneticallyclosest to Bubalus bubalis. Hyper-variable regions containingmutational hot spot have been reported from 602nd to 800thnucleotide region of CD14 gene of CB cattle, that is, within199 nucleotide. Further research need to be directed to findout the association of allelic variants with traits related todisease incidences, to establish it as marker. Gene insertcontaining the resistant variety of CD14 gene of CB cattlecan be used for somatic gene therapy, particularly againstmastitis. Transgenic animal production with CB cattle CD14gene insert may provide the scope for future research todevelop disease-resistant stock.

Acknowledgments

The financial assistance and technical support provided byIndian Veterinary Research Institute, Izatnagar, U.P andNational Dairy Research Institute, Karnal, Haryana is greatlyacknowledged.

References

[1] R. A. Goldsby, T. J. Kindt, and B. A. Osborne, Kuby Immunol-ogy, W.H. Freeman, New York, NY, USA, 4th edition, 2000.

[2] D. Filipp, K. Alizadeh-Khiavi, C. Richardson et al., “SolubleCD14 enriched in colostrum and milk induces B cell growthand differentiation,” Proceedings of the National Academy ofSciences of the United States of America, vol. 98, no. 2, pp. 603–608, 2001.


[3] J. W. Lee, M. J. Paape, T. H. Elsasser, and X. Zhao, “Recom-binant soluble CD14 reduces severity of intramammaryinfection by Escherichia coli,” Infection and Immunity, vol. 71,no. 7, pp. 4034–4039, 2003.

[4] N. W. J. Schroder, B. Opitz, N. Lamping et al., “Involvementof lipopolysaccharide binding protein, CD14, and toll-likereceptors in the initiation of innate immune responses byTreponema glycolipids,” Journal of Immunology, vol. 165, no.5, pp. 2683–2693, 2000.

[5] H. J. Yoon, J. H. Shin, S. H. Yang et al., “Association ofthe CD14 gene-159C polymorphism with progression of IgAnephropathy,” Journal of Medical Genetics, vol. 40, no. 2, pp.104–108, 2003.

[6] J. A. Hubacek, J. Pit’ha, Z. Skodova, V. Stanek, and R.Poledne, “C(-260) → T polymorphism in the promoter of theCD14 monocyte receptor gene as a risk factor for myocardialinfarction,” Circulation, vol. 99, no. 25, pp. 3218–3220, 1999.

[7] C. Hartel, D. Finas, P. Ahrens et al., “Polymorphisms ofgenes involved in innate immunity: association with pretermdelivery,” Molecular Human Reproduction, vol. 10, no. 12, pp.911–915, 2004.

[8] S. Guerra, I. C. Lohman, T. D. LeVan, A. L. Wright, F. D.Martinez, and M. Halonen, “The differential effect of geneticvariation on soluble CD14 levels in human plasma and milk,”American Journal of Reproductive Immunology, vol. 52, no. 3,pp. 204–211, 2004.

[9] 17th Indian Livestock Census.All India Summary report.Livestock, Poultry, Agricultural machinery and implementsand Fishery Statistics. Government of India. Ministry ofAgriculture. Department of Animal Husbandry and Dairy-ing.Krishi Bhavan, New Delhi, India, 2003.

[10] A. Ikeda, M. Takata, T. Taniguchi, and K. Sekikawa, “Molec-ular cloning of bovine CD14 gene,” Journal of VeterinaryMedical Science, vol. 59, no. 8, pp. 715–719, 1997.

[11] G. Diamond, J. P. Russell, and C. L. Bevins, “Inducibleexpression of an antibiotic peptide gene in lipopolysaccharide-challenged tracheal epithelial cells,” Proceedings of the NationalAcademy of Sciences of the United States of America, vol. 93, no.10, pp. 5156–5160, 1996.

[12] P. E. Baker and K. F. Knoblock, “Bovine costimulator. II. Gen-eration and maintenance of a bovine costimulator-dependentbovine lymphoblastoid cell line,” Veterinary Immunology andImmunopathology, vol. 3, no. 4, pp. 381–397, 1982.

[13] J. Sambrook and D. W. Russell, Molecular Cloning: A Labo-ratory Manual, vol. 1, Cold Spring Harbor Laboratory, NewYork, NY, USA, 3rd edition, 2001.

[14] J. I. Kim, J. L. Chang, S. J. Mi et al., “Crystal structure of CD14and its implications for lipopolysaccharide signaling,” TheJournal of Biological Chemistry, vol. 280, no. 12, pp. 11347–11351, 2005.

[15] B. Petersen, T. N. Petersen, P. Andersen, M. Nielsen, and C.Lundegaard, “A generic method for assignment of reliabilityscores applied to solvent accessibility predictions,” BMCStructural Biology, vol. 9, article 51, 2009.

[16] T. Ebina, H. Toh, and Y. Kuroda, “Loop-length-dependentSVM prediction of domain linkers for high-throughputstructural proteomics,” Biopolymers, vol. 92, no. 1, pp. 1–8,2009.

[17] M. D. Cunningham, R. A. Shapiro, C. Seachord, K. Ratcliffe,L. Cassiano, and R. P. Darveau, “CD14 employs hydrophilicregions to ’capture’ lipopolysaccharides,” Journal of Immunol-ogy, vol. 164, no. 6, pp. 3255–3263, 2000.

[18] M. Muroi, T. Ohnishi, and K. I. Tanamoto, “Regions of themouse CD14 molecule required for Toll-like receptor 2- and4-mediated activation of NF-κB,” The Journal of BiologicalChemistry, vol. 277, no. 44, pp. 42372–42379, 2002.

[19] F. Kiefer, K. Arnold, M. Kunzli, L. Bordoli, and T. Schwede,“The SWISS-MODEL Repository and associated resources,”Nucleic Acids Research, vol. 37, no. 1, pp. D387–D392, 2009.

[20] Y. Wang, D. S. Zarlenga, M. J. Paape, and G. E. Dahl,“Recombinant bovine soluble CD14 sensitizes the mammarygland to lipopolysaccharide,” Veterinary Immunology andImmunopathology, vol. 86, no. 1-2, pp. 115–124, 2002.

[21] E. M. Ibeagha-Awemu, J. W. Lee, A. E. Ibeagha, and X. Zhao,“Bovine CD14 gene characterization and relationship betweenpolymorphisms and surface expression on monocytes andpolymorphonuclear neutrophils,” BMC Genetics, vol. 9, article50, 2008.

[22] A. Pal and P. N. Chatterjee, “Molecular cloning and character-ization of CD14 gene in goat,” Small Ruminant Research, vol.82, no. 2-3, pp. 84–87, 2009.

[23] A. Pal, Molecular characterization and genetic polymorphism ofCD14 gene in riverine buffalo, Ph.D. thesis, Indian VeterinaryResearch Institute, Izatnagar, India, 2003.

[24] A. Pal and P. N. Chatterjee, “Molecular characterization ofgrowth hormone gene in riverine buffaloes,” Buffalo Bulletin,vol. 29, no. 4, 2010.

[25] A. Pal, A. Sharma, and T. K. Bhattacharya, “Molecularcharacterization of CD14 cDNA in Bubalus bubalis and Caprahircus,” Conference on Development of Dairy Cattle. NDRI,Eastern Regional Station, Kalyani, December 2008.

[26] S. Gordon, “Pattern recognition receptors: doubling up for theinnate immune response,” Cell, vol. 111, no. 7, pp. 927–930,2002.

[27] E. Ferrero, C. L. Hsieh, U. Francke, and S. M. Goyert, “CD14 isa member of the family of leucine-rich proteins and is encodedby a gene syntenic with multiple receptor genes,” Journal ofImmunology, vol. 145, no. 1, pp. 331–336, 1990.

[28] A. Pal and P. N. Chatterjee, “Comparative studies on diseaseresistance in cattle, buffalo, goat and sheep in hot aridregion of Birbhum district of West Bengal,” in Silver JubileeInternational conference on Physiological Capacity Building inLivestock under Changing Climatic Scenario, ociety of AnimalPhysiologist of India, IVRI, November 2010.

[29] M. H. Julius, D. Fillip, and K. A. Khiavi, “Bovine lactationassociated immunotropic protein (CD14) encoding gene andits application in the B cell activation,” Patent: JP 2001504695-A, 2002.

[30] M. Setoguchi, N. Nasu, S. Yoshida, Y. Higuchi, S. Akizuki,and S. Yamamoto, “Mouse and human CD14 (myeloid cell-specific leucine-rich glycoprotein) primary structure deducedfrom cDNA clones,” Biochimica et Biophysica Acta, vol. 1008,no. 2, pp. 213–222, 1989.

[31] N. Takai, M. Kataoka, Y. Higuchi, K. Matsuura, and S.Yamamoto, “Primary structure of rat CD14 and characteristicsof rat CD14, cytokine, and NO synthase mRNA expressionin mononuclear phagocyte system cells in response to LPS,”Journal of Leukocyte Biology, vol. 61, no. 6, pp. 736–744, 1997.

[32] J. Meng, P. Parroche, D. T. Golenbock, and C. J. McKnight,“The differential impact of disulfide bonds and N-linkedglycosylation on the stability and function of CD14,” TheJournal of Biological Chemistry, vol. 283, no. 6, pp. 3376–3384,2008.

[33] S. Viriyakosol and T. N. Kirkland, “The N-terminal half ofmembrane CD14 is a functional cellular lipopolysaccharidereceptor,” Infection and Immunity, vol. 64, no. 2, pp. 653–656,1996.


[34] Z. Wu, L. Rothwell, T. Hu, and P. Kaiser, “Chicken CD14,unlike mammalian CD14, is trans-membrane rather thanGPI-anchored,” Developmental and Comparative Immunology,vol. 33, no. 1, pp. 97–104, 2009.

[35] V. Bazil, V. Horejsi, and M. Baudys, “Biochemical character-ization of a soluble form of the 53-kDa monocyte surfaceantigen,” European Journal of Immunology, vol. 16, no. 12, pp.1583–1589, 1986.

[36] S. Viriyakosol and T. N. Kirkland, “A region of humanCD14 required for lipopolysaccharide binding,” The Journal ofBiological Chemistry, vol. 270, no. 1, pp. 361–368, 1995.

[37] T. La Cour, L. Kiemer, A. Mølgaard, R. Gupta, K. Skriver, andS. Brunak, “Analysis and prediction of leucine-rich nuclearexport signals,” Protein Engineering, Design and Selection, vol.17, no. 6, pp. 527–536, 2004.

[38] D. M. Glick, Ed., “Leucine scissors”. Glossary of Biochemistryand Molecular Biology, Portland Press, London, UK, Revisededition, 1977.

[39] W. H. Landschulz, P. F. Johnson, and S. L. McKnight, “Theleucine zipper: a hypothetical structure common to a newclass of DNA binding proteins,” Science, vol. 240, no. 4860, pp.1759–1764, 1988.

[40] T. Tanaka, Y. Kuroda, and S. Yokoyama, “Characteristicsand prediction of domain linker sequences in multi-domainproteins,” Journal of Structural and Functional Genomics, vol.4, no. 2-3, pp. 79–85, 2003.

[41] R. A. George and J. Heringa, “An analysis of protein domainlinkers: their classification and role in protein folding,” ProteinEngineering, vol. 15, no. 11, pp. 871–879, 2002.

[42] M. J. Paape, E. M. Lilius, P. A. Wiitanen, M. P. Kontio, and R.H. Miller, “Intramammary defense against infections inducedby Escherichia coli in cows,” American Journal of VeterinaryResearch, vol. 57, no. 4, pp. 477–482, 1996.

[43] S. D. Wright, R. A. Ramos, A. Hermanowski-Vosatka, P.Rockwell, and P. A. Detmers, “Activation of the adhesivecapacity of CR3 on neutrophils by endotoxin: dependenceon lipopolysaccharide binding protein and CD14,” Journal ofExperimental Medicine, vol. 173, no. 5, pp. 1281–1286, 1991.

[44] E. R. Chung, S. C. Shin, K. H. Shin, and K. Y. Chung,“SNP discovery in the leptin promoter gene and associationwith meat quality and carcass traits in Korean cattle,” Asian-Australasian Journal of Animal Sciences, vol. 21, no. 12, pp.1689–1695, 2008.

[45] N. Dhiman, I. G. Ovsyannikova, R. A. Vierkant et al.,“Associations between SNPs in toll-like receptors and relatedintracellular signaling molecules and immune responses tomeasles vaccine: preliminary results,” Vaccine, vol. 26, no. 14,pp. 1731–1736, 2008.

Submit your manuscripts athttp://www.hindawi.com

Hindawi Publishing Corporationhttp://www.hindawi.com Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation http://www.hindawi.com

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation http://www.hindawi.com Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttp://www.hindawi.com Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttp://www.hindawi.com

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research


International Journal of

Microbiology

molecularcharacterizationandsnpdetectionofcd14geneof...

Documents