Supplementary material
Table S1: Biologically relevant differentially expressed genes. The 130 biologically relevant genes (pertaining to fear conditioning and extinction, anxiety and stress-
related disorders, as identified by the BORG analyses tool) that were significantly differentially expressed between the FEAR + DCS WA and the FEAR + SALINE MA
group; negative fold changes indicate that genes were downregulated in the FEAR + DCS WA group compared to the FEAR + SALINE MA group, positive fold changes
indicate that genes were upregulated in the FEAR + DCS WA group compared to the FEAR + SALINE MA group.
Biologically relevant genes downregulated in the FEAR + DCS WA group compare to the FEAR + SALINE MA group
Gene Name Fold change Function
Mmp12 matrix metallopeptidase 12 -inf * abnormal myelination; decreased oligodendrocyte number
Spp1 secreted phosphoprotein 1 -8.26 demyelination; increased neuron number; abnormal microglial cell morphology; abnormal substantia
nigra morphology; increased neuron number; abnormal striatum morphology; abnormal microglial
cell morphology; decreased susceptibility to dopaminergic neuron neurotoxicity
Serpina3n serine (or cysteine) peptidase inhibitor, clade A, member -7.89 implicated_in disease: dementia, Alzheimer's disease
Clec7a C-type lectin domain family 7, member A -6.63 positive regulation of tumor necrosis factor production
Kng1 kininogen 1 -6.60 positive regulation of cytosolic calcium ion concentration
Cxcl13 chemokine (C-X-C motif) ligand 13 -6.28 positive regulation of cytosolic calcium ion concentration
Ccl7 chemokine (C-C motif) ligand 7 -5.86 cellular calcium ion homeostasis
Msr1 macrophage scavenger receptor 1 -5.61 amyloid beta deposits; neuron degeneration
Lgals3 lectin, galactoside-binding, soluble, 3 -5.50 positive regulation of calcium ion import; brain inflammation
C6 complement component 6 -5.18 prion diseases pathway
Cd8a CD8a molecule -5.12 positive regulation of calcium-mediated signaling; demyelination
Hmox1 Heme oxygenase (decycling) 1 -4.80 Negative regulation of neuron apoptotic process (GO:0043524)
(http://www.ncbi.nlm.nih.gov/pubmed/19177228) / response to oxidative stress (GO:0006979)
(http://www.ncbi.nlm.nih.gov/pubmed/17020887) / increased inflammatory response (MP:0001846)
(http://www.ncbi.nlm.nih.gov/pubmed/22075990)
Ccl2 chemokine (C-C motif) ligand 2 -4.81 cellular calcium ion homeostasis; neuron degeneration; demyelination; abnormal microglial cell
physiology; abnormal action potential; decreased nerve conduction velocity; abnormal action
potential; abnormal conditioned taste aversion behavior; retinal photoreceptor degeneration;
decreased susceptibility to neuronal excitotoxicity
Ccl6 chemokine (C-C motif) ligand 6 -4.55 cellular calcium ion homeostasis
Cd36 CD36 molecule -4.49 positive regulation of tumor necrosis factor production; positive regulation of interleukin-6 amd
IL12 production; abnormal myelination; abnormal peripheral nervous system regeneration;
abnormal microglial cell physiology; positive regulation of macrophage cytokine production
Cxcl9 chemokine (C-X-C motif) ligand 9 -4.43 positive regulation of release of sequestered calcium ion into cytosol
Gpnmb glycoprotein -4.39 retinal ganglion cell degeneration; optic nerve atrophy
Il1rn interleukin 1 receptor antagonist -4.29 learning or memory; implicated_in disease: endogenous depression
Runx3 runt-related transcription factor 3 -4.11 abnormal nervous system electrophysiology; abnormal sensory neuron morphology; decreased
spinal cord size ; abnormal sensory neuron innervation pattern; abnormal spinal cord dorsal column
morphology; abnormal excitatory postsynaptic potential; absent muscle spindles
Kcnn4 potassium intermediate/small conductance calcium-activated
channel, subfamily N, member 4
-4.05 calcium ion transport
S100a4 S100 calcium-binding protein A4 -3.77 calcium/calcium-mediated signalling pathway
Ccl3 chemokine (C-C motif) ligand 3 -3.75 calcium-mediated signalling; cellular calcium ion homeostasis; calcium ion transport; positive
regulation of tumor necrosis factor production; abnormal spatial learning; CNS inflammation;
positive regulation of interleukin-1 beta secretion; release of sequestered calcium ion into cytosol by
sarcoplasmic reticulum; abnormal astrocyte physiology; abnormal long term spatial reference
memory; abnormal microglial cell activation; abnormal conditioned taste aversion behavior
Lbp lipopolysaccharide binding protein -3.61 positive regulation of cytokine production (TNF, IL6, IL8); positive regulation of chemokine
production
Cxcl10 chemokine (C-X-C motif) ligand 10 -3.57 CNS inflammation; positive regulation of release of sequestered calcium ion into cytosol;
demyelination
Cybb cytochrome b-245, beta polypeptide -3.53 neurodegeneration; abnormal spatial learning; axon degeneration; abnormal long term potentiation;
decreased post-tetanic potentiation; implicated_in disease:Alzheimer's disease
Trh thyrotropin releasing hormone -3.50 abnormal pituitary gland development
Gngt2 guanine nucleotide binding protein (G protein), gamma
transducing activity polypeptide 2
-3.48 glutamate signaling pathway (excitatory synaptic transmission pathway)
S100a9 S100 calcium binding protein A9 -3.46 implicated_in disease:Alzheimer's disease
Cd14 CD14 molecule -3.42 positive regulation of tumor necrosis factor production
Pf4 platelet factor 4 -3.42 positive regulation of tumor necrosis factor production
Il20rb interleukin 20 receptor beta -3.28 positive regulation of cytokine production (Il4/Il10)
Itgal integrin, alpha L -3.06 positive regulation of calcium-mediated signalling
Il1b interleukin 1 beta -3.02 learning or memory; positive regulation of cytokine production (IL6, IL8, IFNg); positive regulation
of granulocyte macrophage colony-stimulating factor production; positive regulation vascular
endothelial growth factor production; memory; positive regulation of cytosolic calcium ion
concentration; abnormal myelination; abnormal blood-brain barrier function; Alzheimer disease
pathway; prion diseases pathway; positive regulation of monocyte chemotactic protein-1 production;
abnormal oligodendrocyte morphology
St14 suppression of tumorigenicity 14 (colon carcinoma) -3.02 abnormal neural tube morphology/development; exencephaly; spina bifida
Hspb1 heat shock protein 1 -2.99 positive regulation of interleukin-1 beta production
Serpine1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator
inhibitor type 1), member 1
-2.95 positive regulation of interleukin-8 production; p53 signaling pathway
Cdk1 cyclin-dependent kinase 1 -2.92 p53 signaling pathway/stress response pathway
RT1-Bb RT1 class II, locus Bb -2.88 abnormal neuron proliferation
Tspo translocator protein -2.84 behavioral response to pain; positive regulation of calcium ion transport; implicated_in disease:
panic disorder
Anxa1 annexin A1 -2.83 abnormal pituitary gland morphology
F5 coagulation factor V -2.76 intracranial haemorrhage
Ccnb2 cyclin B2 -2.74 p53 stress response signaling pathway
Tagln transgelin -2.74 intracranial hemorrhage;
Calcb calcitonin-related polypeptide, beta -2.73 cellular calcium ion homeostasis
Slc11a1 solute carrier family 11 (proton-coupled divalent metal ion
transporter), member 1
-2.68 positive regulation of cytokine production (Ifg)
Vim vimentin -2.67 increased anxiety-related response; abnormal nervous system morphology; intracranial hemorrhage;
abnormal spinal cord morphology; abnormal motor learning; neurodegeneration; abnormal neuron
differentiation; gliosis; abnormal CNS glial cell morphology; brain inflammation; astrocytosis;
Purkinje cell degeneration; decreased brain weight; hippocampal neuron degeneration
Cenpa centromere protein A -2.63 abnormal neural tube morphology/development; abnormal forebrain morphology
Ctsc cathepsin C -2.60 decreased prepulse inhibition
Olr59 olfactory receptor 59 -2.60 abnormal olfactory bulb development; abnormal olfactory sensory neuron morphology
Mt2A metallothionein 2A -2.60 abnormal learning/memory/conditioning; abnormal microglial cell physiology; tonic-clonic seizures;
increased neuron apoptosis; abnormal astrocyte morphology; increased susceptibility to
pharmacologically induced seizures
C1qc complement component 1, q subcomponent, C chain -2.57 prion diseases pathway
Bcl3 B-cell CLL/lymphoma 3 -2.57 positive regulation of interferon-gamma production
Ncf1 neutrophil cytosolic factor 1 -2.53 impaired cued conditioning behavior; abnormal spatial learning; enhanced long term potentiation
RT1-Da RT1 class II, locus Da -2.49 implicated_in disease: bipolar disorder
Pttg1 pituitary tumor-transforming 1 -2.44 abnormal neural tube morphology/development;
Cp ceruloplasmin (ferroxidase) -2.43 abnormal neuron morphology; neurodegeneration; abnormal astrocyte physiology; abnormal brain
iron level; neuron degeneration; abnormal Purkinje cell morphology; demyelination; abnormal
fourth ventricle morphology; abnormal astrocyte morphology; decreased motor neuron number;
retinal photoreceptor degeneration; abnormal cerebellar granule layer morphology; abnormal
cerebellar granule layer morphology
C3ar1 complement component 3a receptor 1 -2.41 positive regulation vascular endothelial growth factor production (cytokine production); positive
regulation of cytosolic calcium ion concentration; demyelination
Cox6a2 cytochrome c oxidase subunit VIa polypeptide 2 -2.40 neurodegenerative disease pathway: Parkinson, Alzheimer & Huntington disease pathway
Ptprc protein tyrosine phosphatase, receptor type, C -2.39 release of sequestered calcium ion into cytosol; abnormal myelination; abnormal oligodendrocyte
morphology
Slc6a5 solute carrier family 6 (neurotransmitter transporter), member 5 -2.38 abnormal neuron physiology; abnormal CNS synaptic transmission; abnormal miniature inhibitory
postsynaptic currents; abnormal neuromuscular synapse morphology; abnormal miniature inhibitory
postsynaptic currents; implicated_in disease: bipolar disorder
Cd44 Cd44 molecule -2.37 abnormal miniature inhibitory postsynaptic currents; abnormal phrenic nerve morphology; abnormal
miniature excitatory postsynaptic currents
Ccna2 cyclin A2 -2.36 p53 stress response signaling pathway
Ripk3 receptor-interacting serine-threonine kinase 3 -2.33 positive regulation of type I interferon production
Cd300a Cd300a molecule -2.27 negative regulation of serotonin secretion
A2m alpha-2-macroglobulin -2.25 Alzheimer disease pathway, neurodegenerative disease pathway; implicated_in disease:Alzheimer's
disease
C1qb complement component 1, q subcomponent, B chain -2.23 prion diseases pathway
Mmp9 matrix metallopeptidase 9 -2.23 impaired contextual conditioning behavior; abnormal blood-brain barrier function; abnormal
myelination; decreased susceptibility to ischemic brain injury; decreased neuron apoptosis; reduced
long term potentiation; decreased oligodendrocyte number
Pla2g2a phospholipase A2, group IIA -2.18 long term depression; glutamate signaling pathway; implicated_in disease: vascular dementia,
Alzheimer's disease, endogenous depression
Plau plasminogen activator, urokinase -2.16 implicated_in disease:Alzheimer's disease
Cd86 CD86 molecule -2.15 abnormal nervous system morphology; abnormal meninges morphology; brain inflammation;
abnormal nerve conduction; abnormal action potential; demyelination; decreased nerve conduction
velocity; abnormal ventral/dorsal spinal root morphology; abnormal myelin sheath morphology
Pycard PYD and CARD domain containing -2.10 positive regulation of cytokine production (TNF, IL6, Ifg, IL1B); positive regulation of chemokine
secretion
Mt1a metallothionein 1a -2.07 abnormal learning/memory/conditioning ; abnormal microglial cell physiology; tonic-clonic
seizures; clonic seizures; increased neuron apoptosis; abnormal microglial cell morphology;
abnormal astrocyte morphology; increased susceptibility to pharmacologically induced seizures
Nos2 nitric oxide synthase 2, inducible -2.02 amyloid beta deposits; abnormal brain interneuron morphology; abnormal brain wave pattern;
abnormal long term spatial reference memory; amyloid beta deposits; neuron degeneration;
abnormal central nervous system regeneration; abnormal peripheral nervous system regeneration;
loss of hippocampal neurons; decreased cerebral infarction size; increased susceptibility to
pharmacologically induced seizures; abnormal hippocampus CA3 region morphology
Fes feline sarcoma oncogene -2.00 enlarged lateral ventricles/ enlarged lateral ventricles
Tyrobp Tyro protein tyrosine kinase binding protein -2.00 abnormal myelination; abnormal neuron morphology; reduced sensorimotor gating; abnormal
microglial cell morphology; abnormal axon morphology; abnormal excitatory/inhibitory
postsynaptic currents; enhanced long term potentiation; decreased prepulse inhibition
Fcer1g Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide -1.99 positive regulation of tumor necrosis factor production/interleukin-6 production/ interleukin-10
production; decreased platelet calcium level; positive regulation of mast cell cytokine production
C1qa complement component 1, q subcomponent, A chain -1.97 seizures; prion diseases pathway; abnormal hippocampus pyramidal cell morphology; abnormal
inhibitory postsynaptic currents; nonconvulsive seizures; abnormal CNS synaptic transmission;
abnormal synaptic bouton morphology
Irf7 interferon regulatory factor 7 -1.96 positive regulation of type I interferon production (alpha & beta); MDA-5 signaling pathway
Cdc20 cell division cycle 20 -1.94 positive regulation of synapse maturation
Btk Bruton agammaglobulinemia tyrosine kinase -1.92 calcium-mediated signalling
Lgals1 lectin, galactoside-binding, soluble, 1 -1.92 abnormal postnatal subventricular zone morphology; abnormal sensory neuron morphology;
abnormal postnatal subventricular zone morphology; abnormal mechanoreceptor morphology;
abnormal nociceptor morphology; abnormal neuromuscular synapse morphology; abnormal
olfactory nerve morphology; abnormal mechanoreceptor morphology; abnormal dorsal root ganglion
morphology
Prlhr prolactin releasing hormone receptor -1.91 enhanced conditioned place preference behaviour
Fermt3 fermitin family member 3 -1.89 intracranial haemorrhage
Slc39a4 solute carrier family 39 (zinc transporter), member 4 -1.88 hydroencephaly; exencephaly
Cd74 Cd74 molecule, major histocompatibility complex, class II -1.88 positive regulation of chemokine (C-X-C motif) ligand 2 production; GO:positive regulation of
invariant chain macrophage cytokine production
Ptpn6 protein tyrosine phosphatase, non-receptor type 6 -1.86 regulation of release of sequestered calcium ion into cytosol
Tlr2 toll-like receptor 2 -1.85 positive regulation of cytokine production (IL6, IL8, TNF, Il18, IL12, IL10); positive regulation of
chemokine production; impaired passive avoidance behavior; amyloid beta deposits; abnormal
myelination; CNS ischemia; abnormal glial cell physiology; abnormal long term spatial reference
memory; decreased neuron apoptosis
Tnfrsf1b tumor necrosis factor receptor superfamily, member 1b -1.85 abnormal nervous system physiology; CNS inflammation; abnormal neuron physiology; abnormal
glial cell physiology; seizures; amyotrophic lateral sclerosis disease pathway; demyelination;
abnormal oligodendrocyte apoptosis; abnormal glutamate-mediated receptor currents; increased
susceptibility to neuronal excitotoxicity; decreased susceptibility to dopaminergic neuron
neurotoxicity
Cd4 Cd4 molecule -1.85 positive regulation of calcium-mediated signaling; brain inflammation; demyelination
Spi1 spleen focus forming virus (SFFV) proviral integration
oncogene
-1.82 motor neuron degeneration; decreased motor neuron number; abnormal microglial cell morphology;
abnormal astrocyte morphology
Slc22a3 solute carrier family 22 (organic cation transporter), member 3 -1.78 abnormal dopamine level; increased susceptibility to dopaminergic neuron neurotoxicity;
implicated_in disease: obsessive-compulsive disorder
S100a10 S100 calcium binding protein A10 -1.78 abnormal depression-related behavior; increased thigmotaxis; decreased single cell response
intensity; implicated_in disease: mental depression
Lilrb3l leukocyte immunoglobulin-like receptor, subfamily B (with TM
and ITIM domains), member 3-like
-1.78 negative regulation of serotonin secretion; negative regulation of calcium ion transport
Casp1 caspase 1 -1.77 learning and memory; amyotrophic lateral sclerosis disease pathway; positive regulation of
interleukin-1 beta and interleukin-1 alpha secretion; decreased susceptibility to ischemic brain
injury; decreased neuron apoptosis
Arhgdib Rho, GDP dissociation inhibitor (GDI) beta -1.75 neurotrophic factor signaling pathway
Irf8 interferon regulatory factor 8 -1.75 positive regulation of cytokine production (IL12/IFg)
Fas Fas cell surface death receptor -1.75 CNS inflammation; abnormal spatial learning; p53 signaling pathway; Alzheimer disease pathway;
demyelination; abnormal retinal ganglion cell morphology; decreased neuron apoptosis; abnormal
cerebellum morphology; decreased Purkinje cell number; decreased brain weight; small cerebellum;
abnormal cerebellar foliation; implicated_in disease:Alzheimer's disease
Tlr7 toll-like receptor 7 -1.74 positive regulation of cytokine production (IL6, IL8, TNF, Il18, IL12, IL10); positive regulation of
chemokine production;
Grn granulin -1.74 abnormal nervous system physiology; increased thigmotaxis; increased anxiety-related response;
abnormal neuron physiology; abnormal brain morphology; abnormal spatial learning;; abnormal
neurite morphology; impaired synaptic plasticity; microgliosis; loss of dopaminergic neurons;
astrocytosis; reduced long term potentiation; increased susceptibility to dopaminergic neuron
neurotoxicity
Pik3ap1 phosphoinositide-3-kinase, regulatory subunit 5 -1.73 neurotrophic factor signaling pathway
Hpgds hematopoietic prostaglandin D synthase -1.73 abnormal astrocyte morphology
Mafb v-maf avian musculoaponeurotic fibrosarcoma oncogene
homolog B
-1.71 abnormal nervous system physiology; abnormal brainstem morphology; abnormal neural tube
morphology/development; abnormal hindbrain development; abnormal rhombomere morphology
Actg2 actin, gamma 2, smooth muscle, enteric -1.70 actin, gamma 2, smooth muscle, enteric
Sema3a sema domain, immunoglobulin domain -1.68 abnormal neuronal migration /differentiation; abnormal cerebral cortex pyramidal cell morphology;
abnormal sensory neuron innervation pattern; abnormal spinal nerve morphology ; abnormal enteric
nervous system morphology; decreased neuron number; abnormal neuronal migration; abnormal
axon fasciculation; decreased brain size; abnormal vagus nerve morphology
Pla2g2d phospholipase A2, group IID -1.67 long term depression; glutamate signaling pathway
Spta1 spectrin, alpha, erythrocytic 1 (elliptocytosis 2) -1.67 abnormal brain morphology;
Itga5 integrin, alpha 5 -1.65 learning or memory; abnormal spatial learning; abnormal neuronal migration; kinked neural tube;
reduced long term potentiation; abnormal cerebral cortex morphology; abnormal cerebral cortex
morphology
Casp4 caspase 4, apoptosis-related cysteine peptidase -1.65 positive regulation of interleukin-1 beta secretion; implicated_in disease:Alzheimer's disease
Cmklr1 chemokine-like receptor 1 -1.63 regulation of calcium-mediated signalling
Bard1 BRCA1 associated RING domain 1 -1.62 open neural tube
Espl1 extra spindle pole bodies homolog 1 (S. cerevisiae) -1.61 abnormal neural tube morphology/development
B4galt1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, -1.60 abnormal pituitary gland morphology
polypeptide 1
Ada adenosine deaminase -1.59 calcium-mediated signalling
Plek pleckstrin -1.59 negative regulation of calcium-mediated signaling
Pla2g5 phospholipase A2, group V -1.59 long term depression; glutamate signaling pathway
Serpinf1 serpin peptidase inhibitor, clade F -1.59 learning or memory; short-term memory; decreased retinal ganglion cell number
Capn3 calpain 3 -1.59 positive regulation of release of sequestered calcium ion into cytosol
Igf1 insulin-like growth factor 1 -1.55 regulation of calcium ion transport; abnormal nervous system physiology; long term depression;
calcium ion transport; learning or memory; abnormal myelination; p53 signaling pathway; positive
regulation of calcineurin-NFAT signaling cascade; abnormal sensory neuron innervation pattern;
decreased motor neuron number; increased neuron apoptosis; abnormal cochlear ganglion
morphology; abnormal olfactory bulb layer morphology; implicated_in disease: dementia,
Alzheimer's disease
Tgif1 TGFB-induced factor homeobox 1 -1.53 abnormal brain development; hydroencephaly; abnormal hindbrain development; abnormal forebrain
development; holoprosencephaly; abnormal brain ventricle morphology; exencephaly; abnormal
brain development; abnormal folding of telencephalic vesicles
Col13a1 collagen, type XIII, alpha 1 -1.52 abnormal miniature endplate potential; abnormal synaptic vesicle morphology; abnormal
neuromuscular synapse morphology; abnormal endplate potential; abnormal synaptic acetylcholine
release
Lat2 linker for activation of T cells family, member 2 -1.51 calcium-mediated signalling
Biologically relevant genes upregulated in the FEAR + DCS WA group compare to the FEAR + SALINE MA group
Gene Name Fold change Function
P2ry4 pyrimidinergic receptor P2Y, G-protein coupled, 4 2.91 positive regulation of cytosolic calcium ion concentration
Gabrq gamma-aminobutyric acid (GABA) A receptor, theta 2.46 decreased prepulse inhibition;
Galr1 galanin receptor 1 2.09 positive regulation of cytosolic calcium ion concentration
Gnb3 guanine nucleotide binding protein (G protein), beta polypeptide
3
2.04 glutamate signaling pathway; abnormal retinal rod bipolar cell morphology; implicated_in disease:
endogenous depression
Crhr2 corticotropin releasing hormone receptor 2 1.66 increased anxiety-related response; positive regulation of serotonin secretion; corticotropin-releasing
hormone signaling pathway; negative regulation of calcium ion import; positive regulation of
interleukin-6 production; behavioral despair; implicated_in disease: panic disorder; implicated_in
disease: endogenous depression
Trhr thyrotropin releasing hormone receptor 1.64 increased anxiety-related response; positive regulation of cytosolic calcium ion concentration ;
behavioral despair
Lrp2 low density lipoprotein receptor-related protein 2 1.61 decreased circulating calcium level; abnormal brain morphology; exencephaly; abnormal embryonic
neuroepithelium morphology; holoprosencephaly; delayed neural tube closure
rno-mir-9b-1 Rat microRNA-9b-1 (previous ID mir-3597-1 ) Inf* decreased expression in the hippocampal CA1 region under acute or chronic stress
Htr2c 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled 1.58 serotonin binding; positive regulation of acetylcholine secretion, neurotransmission; cellular calcium
ion homeostasis; behavioral fear response; abnormal response to new environment; abnormal spatial
learning; sporadic seizures; reduced long term potentiation; increased susceptibility to
pharmacologically induced seizures implicated_in disease: anxiety disorder; implicated_in disease:
bipolar disorder; implicated_in disease: Alzheimer's disease
Plagl1 pleiomorphic adenoma gene-like 1 1.57 abnormal neural tube closure
*-Inf: FKPM value for Mmp12 and rno-mir-9b-1 in the FEAR + DCS WA group was zero, therefore dividing the FKPM of Mmp12 in the FEAR + SALINE MA group with
zero results in an infinite fold change. FEAR + DCS WA – fear-conditioned + DCS well-adapted, FEAR + SALINE MA - fear-conditioned + saline maladapted, BORG -
Bio-Ontological Relationship Graph
1.1 Modified contextual fear conditioning protocol
The modified contextual fear conditioning protocol used in this study was based on a PTSD
mouse model originally described by Siegmund and Wotjak (2007). In the current study, ten
repetitive footshocks (each lasting one second) over a period of one minute were used during
fear conditioning instead of the single two second electric footshocks described in the
original model (Siegmund and Wotjak, 2007), and male Sprague-Dawley rats were used
instead of mice (C57BL/6N [B6N] and C57BL/6JOla [B6JOla]) as in the original
publication. Rat pups were weaned at PND 21 and were subjected to regular manual
handling. Animals were housed according to standard laboratory conditions as stipulated by
the Ethical Guidelines of the University for Housing Experimental Animals.
A single electric footshock (intensity 1.5 mA; duration 1 second; ten repetitive shocks over a
period of one minute) was used during fear conditioning. The footshock was administered via
a chamber with a metal grid floor, connected to an electrical current supply. Following the
footshock, rats remained in the chamber for an additional 60 s, after which they were returned
to their home cages. Control animals were placed in the shock chamber, but did not receive
the electric footshock. Fear conditioning commenced on PND 61 (Fig. 1).
1.2 Intrahippocampal DCS administration
The cannulas were surgically implantated on postnatal day (PND) 59. Briefly, rats were
anaesthetized by intraperitoneal injection of a combination of ketamine hydrochloride
(Anaket-V, Bayer Healthcare, South Africa) and medetomide hydrochloride (Domitor, Pfizer,
South Africa) at a dose of 0.1 ml/100 g. Anaesthetised rats were then placed in a David Kopf
stereotaxic instrument. After exposing the skull, holes were drilled the precise coordinates
corresponding to the target area (dorsal hippocampus). The coordinates were obtained from
the rat brain atlas of Paxinos and Watson (http://www.scribd.com/doc/22822097/Rat-Brain-
Atlas). Guide cannulas were then positioned at these coordinates, and 2 jewellers screws and
dental cement were used to anchor these cannulas. For drug or saline infusions, 32 gauge
needles were lowered into the dorsal hippocampus. DCS (Aspen Pharmacare, Durban, South
Africa) was prepared fresh daily (immediately before administration), by dissolving it in
physiological saline to a concentration of 15 mg/kg per rat (Yang and Lu, 2005). A needle
was subsequently inserted into the guide cannula for the administration of DCS or saline;
10μl of either DCS or saline was infused over a period of 2 minutes and the needle was left in
place for a further two minutes to allow diffusion from the tip of the needle into the
hippocampus.
To ensure full recovery, animals received post-operative antibiotics (Trimethoprim
sulfadiazine 30 mg/kg once daily for 5 days) and analgesia (Flunixin meglumine 2.5 mg/kg
once daily for 3 days). The rats were allowed to rest for one day following surgery (PND 60).
To assess the rats’ wellbeing, they were examined twice daily, in their cages, for signs of
distress. These signs included checking the quality of the animals’ coat (pilorection), their
food and water intake as well as general locomotor activity. It was not anticipated that the
experimental procedures and/or the DCS would induce illness. Data generated during the
behavioural tests also indicated that the anesthetics, surgery and post-operative drugs didn’t
elicit any behavioural effects. There was no difference in the behaviours measured during the
L/D avoidance test and OFT between CTRL + SALINE animals compared to naïve animals
(that didn’t undergo any surgery).
1.3 BioOntological Relationship Graph (BORG) database
While bioinformatics tools for identifying differentially expressed genes from RNA
sequencing data and for identifying overrepresented functional categories are quite mature, it
is more complicated to predict an individual transcript’s impact at a cellular or organismal
level, and still more difficult to implicate them in a disease of interest. In order to further
prioritize differentially expressed genes for further investigation and hypothesis generation,
we have developed a semantic network model of fear extinction in our in-house
BioOntological Relationship Graph (BORG) database (in press). The system seamlessly
integrates hundreds of thousands of facts about human, mouse and rat genes and their known
functions, disease and phenotype associations, and pathway membership into a large on-disk
semantic network. Several bio-ontologies act as ‘anchors’ for integration. The hierarchical
structure of the ontologies enables a gene associated with a very specific term e.g.
“behavioural despair” to be automatically transitively linked to a parent term that we defined
as being relevant, e.g. “abnormal depression-related behaviour”. This maximizes the amount
of relevant information obtained from querying the database when searching for evidence to
implicate a gene in a disease, phenotype or treatment response of interest. Furthermore,
storing the information as a directed network allows rat genes to ‘inherit’ knockout
phenotypes from mouse genes and disease annotations from human genes through transitive
association (thick arrows in Figure 2). We built a semantic model of fear extinction by
inserting cross-ontology semantic links between relevant terms from either of the phenotype,
GO or pathway ontologies to the “anxiety disorder” term in the disease ontology (dotted
arrows in Figure 2). This enables rapid and unbiased discovery of transitive associations
between genes and disease based on their known involvement in
phenotypes/functions/pathways relevant to the disease.
By way of summary, when used for finding links between genes and anxiety disorder, for
example, the system performs a directed ‘walk’ on the semantic network to find all relevant
paths between a candidate gene of interest and the disease term in the database. Reports are
produced on a per-gene basis and are particularly useful when filtering a large list of
candidates, since only genes that have at least one path leading to the disease will be returned.
Furthermore, the report contains information from multiple knowledge domains, which can
be used to further manually prioritize the remaining candidates based on the automatically
discovered evidence. This ‘guilt-by-indirect-association’ semantic discovery concept finds
links between gene and disease that would likely have been missed when directly consulting
the literature or individual databases.
1.4 Gene expression analyses
Cummerbund was used to generate dispersion, scatter, count distribution and density plots to
assess data quality, and to perform a principal component analysis (PCA) for identifying
potentially outlier samples in each group.
Figure S1: Principal component analysis indicating four potential outliers based on global expression
profiles
1.5 SYBR Green real-time qPCR gene expression analysis
A calibrator sample was prepared by pooling equal amounts of cDNA from each sample for
the construction of a standard curve. The calibrator cDNA sample was serially diluted 2-fold
per dilution, to produce a seven-point standard curve, with cDNA concentrations ranging
from 800 ng to 12.5 ng. Each of the LDH cDNA samples was diluted to 200 ng for use in
subsequent real-time qPCR analyses. Each 20 µl reaction consisted of 1 × KAPA
SYBR®FAST Master Mix ABI Prism™ (KAPA Biosystems, Massachusetts, USA) and
forward and reverse primers (IDT, Iowa, USA) (Supplementary Material, Table S2). Selected
reference genes, that were verified to be stably expressed in the LDH cDNA samples, were:
β-actin (ACTB), cyclophilin A (Cyc A), glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) and phosphoglycerate kinase (PGK). Each sample was analysed in triplicate in
order to eliminate technical variability. Following the amplification of serial dilutions, a
linear plot of the quantification cycle (Cq) versus the log value of the input amount of DNA
(standard curve) was constructed using ABI’s SDS v.2.3 software (Applied Biosystems,
California, USA). The PCR efficiency was subsequently calculated from the standard curve
for each individual primer set. Software-determined default threshold and baseline values
were used.
Table S2: Primers for SYBR Green real-time qPCR differential expression analysis.
Primer sequences, melting temperatures (Tm), annealing temperatures (Ta) and concentration
of primers in each 20 µl SYBR Green real-time qPCR reaction.
Gene Primer sequences (5’ – 3’)Tm
(°C)
Ta
(°C)
Final primer
concentrations
(µM)
SPP1 F TGTGTCCTCTGAAGAAACGG 54.654 0.12
SPP1 R GGTGAGATTCGTCAGATTCATCC 55.2
IL1RN F GGGATACTAACCAGAAGACC 51.756 0.2
IL1RN R CGAAAGTCAATAGGCACC 50.7
TRH F CCTAACTGGTATCCCTGAATCC 54.361 0.4
TRH R GATGCTGGCGTTTCTCAG 53.8
CYBB F CCAGGTATCCAAGCTAGAGTG 53.854 0.2
CYBB R GTCACAATATTTGTACCAG 45.6
MMP9 F CCTGTACCGCTATGGTTACACTC 56.958 0.2
MMP9 R GATGACAATGTCTGCTTCGAGC 56.2
MT2A F GAACTCTACAGCGATCTCTCG 54.454 0.12
MT2A R CGAAGCCTCTTTGCAGATG 53.9
CXCL13 F CTGGACCAAGGCCAAGAAAGC 58.861 0.6
CXCL13 R CGAGCAGGGATTAAGAAAGGGTG 57.7
S100A4 F CACAAATACTCAGGCAACGAGG 56.058 0.6
S100A4 R GCCCAACACTTCATCTGAGGAG 57.7
NPY F CAGCCCTGAGACACTGATTTC 55.6 56 0.2
NPY R CAACGACAACAAGGGAAATGG 54.6
ACTB F* TGTCACCAACTGGGACGATA 55.754 0.2
ACTB R* GGGGTGTTGAAGGTCTCAAA 55.0
CYC A F* TATCTGCACTGCCAAGACTGAGTG 58.754 0.2
CYC A R* CTTCTTGCTGGTCTTGCCATTCC 58.6
GAPDH F* ACCACAGTCCATGCCATCAC 57.755 0.12
GAPDH R* TCCACCACCCTGTTGCTGTA 58.6
PGK F* ATGCAAAGACTGGCCAAGCTAC 58.054 0.2
PGK R* AGCCACAGCCTCAGCATATTTC 57.6
CRHR2 F CCGAAGAGCTGCTTTTGG 54.160 0.2
CRHR2 R GTCGTGTTGTACTTGATGCC 53.9
HTR2C F GCGTCCATCATGCACCTCTG 58.760 0.2
HTR2C R CGAAGTTGGGGTCATTGAGC 56.3
*Primers designed to amplify regions of the reference genes ACTB, CYC A, GAPDH and PGK. Primer sequences for reference gene amplification were obtained from previously published reports (β-actin (ACTB), cyclophilin A (Cyc A) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Bonefeld et al. (2008), Langnaese et al. (2008)