UNIVERSITY OF OULU P .O. Box 8000 F I -90014 UNIVERSITY OF OULU FINLAND

A C T A U N I V E R S I T A T I S O U L U E N S I S

University Lecturer Tuomo Glumoff

University Lecturer Santeri Palviainen

Postdoctoral researcher Jani Peräntie

University Lecturer Anne Tuomisto

University Lecturer Veli-Matti Ulvinen

Planning Director Pertti Tikkanen

Professor Jari Juga

University Lecturer Anu Soikkeli

University Lecturer Santeri Palviainen

Publications Editor Kirsti Nurkkala

ISBN 978-952-62-2641-5 (Paperback)ISBN 978-952-62-2642-2 (PDF)ISSN 0355-3221 (Print)ISSN 1796-2234 (Online)

U N I V E R S I TAT I S O U L U E N S I S

MEDICA

ACTAD

D 1575

AC

TAM

ahmoud Sobhy E

lkhwanky

OULU 2020

D 1575

Mahmoud Sobhy Elkhwanky

REGULATION OF VITAMIN D METABOLISM BY METABOLIC STATE IN MICE AND HUMANSDISCOVERY OF MOLECULAR FACTORS REPRESSING VITAMIN D BIOACTIVATION AND INDUCING DEFICIENCY IN DIABETES

UNIVERSITY OF OULU GRADUATE SCHOOL;UNIVERSITY OF OULU,FACULTY OF MEDICINE;MEDICAL RESEARCH CENTER OULU;BIOCENTER OULU

ACTA UNIVERS ITAT I S OULUENS I SD M e d i c a 1 5 7 5

MAHMOUD SOBHY ELKHWANKY

REGULATION OF VITAMIN D METABOLISM BY METABOLIC STATE IN MICE AND HUMANSDiscovery of molecular factors repressing vitamin D bioactivation and inducing deficiency in diabetes

Academic dissertation to be presented with the assentof the Doctoral Training Committee of Health andBiosciences of the University of Oulu for public defencein Auditorium F202 of the Faculty of Medicine (Aapistie5 B), on 29 May 2020, at 12 noon

UNIVERSITY OF OULU, OULU 2020

Copyright © 2020Acta Univ. Oul. D 1575, 2020

Supervised byProfessor Jukka Hakkola

Reviewed byProfessor Roger BouillonProfessor Carsten Carlberg

ISBN 978-952-62-2641-5 (Paperback)ISBN 978-952-62-2642-2 (PDF)

ISSN 0355-3221 (Printed)ISSN 1796-2234 (Online)

Cover DesignRaimo Ahonen

PUNAMUSTATAMPERE 2020

OpponentAssociate Professor Enikö Kallay

Elkhwanky, Mahmoud Sobhy, Regulation of vitamin D metabolism by metabolicstate in mice and humans. Discovery of molecular factors repressing vitamin Dbioactivation and inducing deficiency in diabetesUniversity of Oulu Graduate School; University of Oulu, Faculty of Medicine; MedicalResearch Center Oulu; Biocenter OuluActa Univ. Oul. D 1575, 2020University of Oulu, P.O. Box 8000, FI-90014 University of Oulu, Finland

Abstract

Vitamin D deficiency, i.e., low circulating 25-hydroxyvitamin D (25(OH)D) level, has beenconsistently associated with the prevalence of metabolic diseases, including types 1 and 2diabetes. However, the causal link between low vitamin D and metabolic disturbances remainsuncertain.

In the present thesis, I report novel findings indicating that vitamin D metabolism is under strictcontrol by the metabolic state. Specifically, obesity represses the expression of cytochrome P450(CYP) 2R1, the major vitamin D 25-hydroxylase responsible for the first bioactivation step in bothmice and humans. Interestingly, in humans, weight loss induced by gastric bypass surgeryincreased CYP2R1 expression in the white adipose tissue.

In mouse liver, Cyp2r1 and vitamin D bioactivation was suppressed by fasting, and both type1 and type 2 diabetes. This may consequently cause low plasma 25(OH)D levels. On the otherhand, fasting induced expression of the vitamin D catabolic enzyme CYP24A1 in the kidney.

Mechanistically, we discovered that Cyp2r1 and vitamin D bioactivation are repressed bymolecular pathways activated physiologically by fasting or pathologically in diabetes, namely, theperoxisome proliferator-activated receptor-gamma coactivator 1-α and estrogen-related receptorα (PGC-1α-ERRα), and the glucocorticoid receptor pathways. Moreover, the PGC-1α-ERRαpathway is crucial for mediating the Cyp24a1 induction by fasting in the kidney.

In the current thesis, we uncover a molecular mechanism for the vitamin D deficiency observedin diabetic patients and reveal a novel negative feedback mechanism controlling the crosstalkbetween energy homeostasis and the vitamin D pathway. Importantly, our data propose thatvitamin D deficiency is a consequence, and not the cause of diabetes.

Keywords: 25-hydroxyvitamin D, adipose tissue, CYP24A1, CYP2R1, diabetes, GR,human, liver, mice, obesity, PGC-1α, vitamin D

Elkhwanky, Mahmoud Sobhy, Metabolinen tila säätelee D-vitamiinin aineen-vaihduntaa hiiressä ja ihmisessä. D-vitamiinin bioaktivaatiota estävien ja puutostaaiheuttavien molekyylimekanismien osoittaminenOulun yliopiston tutkijakoulu; Oulun yliopisto, Lääketieteellinen tiedekunta; Medical ResearchCenter Oulu; Biocenter OuluActa Univ. Oul. D 1575, 2020Oulun yliopisto, PL 8000, 90014 Oulun yliopisto

Tiivistelmä

D-vitamiinin puutteen eli veren matalan 25-hydroksi-D-vitamiinin (25(OH)D) pitoisuuden onhavaittu toistuvasti assosioituvan metabolisten sairauksien, kuten tyypin 1 ja 2 diabeteksen,ilmenemiseen. Tästä huolimatta D-vitamiinin puutteen ja metabolisten häiriöiden välinenkausaalinen yhteys on epävarma.

Tässä väitöskirjatyössä raportoimme uusia löydöksiä, jotka osoittavat elimistön metabolisentilan tehokkaasti säätelevän D-vitamiinin aineenvaihduntaa. Tarkemmin ottaen lihavuus repres-soi sytokromi P450 (CYP) 2R1:ta, D-vitamiinin tärkeintä 25-hydroksylaasia ja ensimmäistä bio-aktivaatiovaihetta sekä hiirissä että ihmisissä. Mielenkiintoinen havainto oli, että ihmisillä maha-laukun ohitusleikkaukseen liittyvä painonlasku sai aikaan CYP2R1:n ilmenemisen nousun val-keassa rasvakudoksessa. Hiiren maksassa sekä tyypin 1 ja 2 diabetes että paastoaminen vähensi-vät Cyp2r1:n ilmentymistä ja D-vitamiinin bioaktivaatiota. Tämä voi johtaa plasman 25(OH)Dpitoisuuden alentumiseen. Toisaalta paastoaminen indusoi D-vitamiinin kataboliaentsyymiä,CYP24A1, munuaisessa.

Mekanistisella tasolla havaitsimme, että Cyp2r1 ilmentymistä ja D-vitamiinin bioaktivaatio-ta estävät sellaiset molekylaariset säätelytiet, jotka aktivoituvat fysiologisesti paaston aikana japatologisesti diabeteksessa. Tällaisia ovat peroksisomi-proliferaattori-aktivaattori-reseptori γ:nkoaktivaattori 1 α:n ja estrogeeniin kaltainen reseptori α:n (PGC-1α-ERRα) sekä glukokortikoi-direseptorin välittämät säätelytiet. PGC-1α-ERRα säätelee tämän lisäksi myös Cyp24a1:n induk-tiota munuaisessa paaston aikana.

Tässä väitöskirjatyössä tunnistimme molekylaarisen mekanismin, joka selittää diabeetikoillahavaitun D-vitamiinin puutteen ja löysimme aiemmin tuntemattoman negatiivisen palautemeka-nismin, joka välittää energiahomeostaasin ja D-vitamiinijärjestelmän välistä vuorovaikutusta.Löydöksien perusteella voidaan tehdä tärkeä johtopäätös, että D-vitamiinin puutos on diabetek-sen seuraus, ei syy.

Asiasanat: 25-hydroksi-D-vitamiini, CYP24A1, CYP2R1, D-vitamiini, diabetes, GR,liikalihavuus, maksa, maksa, PGC-1α

“…always be guided by the light of knowledge and wisdom to shape your future, the future of your country, and the future of the world” - Professor Ahmed Zewil (l946-2016),

Egyptian-American Scientist, and Nobel laureate 1999 in Chemistry.

“My education, from primary school to the doctorate level, was full of tough challenges. If I had given up in the middle, I would not be able to write these lines here. Therefore, my advice is this. Do not ever give up on your dream! Believe it, and you can do it”

- Mahmoud Sobhy Elkhwanky, Oulu, 24thApril 2020

8

9

Acknowledgments First and foremost, I would like to humbly thank the Almighty God, for helping me not just in this work, but in everything in my life.

This work was carried out at the Research Unit of Biomedicine (Pharmacology and Toxicology), Faculty of Medicine, University of Oulu, Finland, during the years 2015 – 2019. For this fortunate period of my life, I would like to express my most profound respect and sincerest gratitude to my supervisor Professor Jukka Hakkola. Thank you for your valuable mentorship. Your wisdom, enthusiasm, open-mindedness, dedication, and encouragement were an inspiration to me. Your insightful guidance, comments, and support during my PhD work deserves to be highly acknowledged. Jukka! You gave me the opportunity to learn and grow, for which I am forever grateful, Todella paljon kiitoksia.

The thesis was thoroughly reviewed by Professor Roger Bouillon (Katholieke Universiteit Leuven, Belgium) and Professor Carsten Carlberg (University of Eastern Finland). I am grateful to them for their critical and constructive comments, which improved my final thesis significantly. I am grateful to Professor Enikö Kallay (Medical University of Vienna) for accepting to be my opponent. I also wish to thank Dr. Deborah Kaska for the expert language revision.

I would like to express my most profound appreciation to my follow-up committee, Professor Olli Vuolteenaho, Professor Risto Kerkelä, and Professor Sylvain Sebert for their valuable comments, discussion of my research work and support during my PhD study.

I gratefully acknowledge my coauthors, and dear colleagues, Dr. Sanna-Mari Aatsinki, Dr. Outi Kummu, Dr. Mikko Karpale, Dr. Marcin Buler, and Dr. Pirkko Viitala. Special thanks to Dr. Outi Kummu for the expert help in all the animal experiments. I owe my sincere thanks to our national and international collaborators, Professor Terhi T. Piltonen (Oulu), MD Johanna Laru (Oulu), Professor Laure Morin-Papunen (Oulu), Valtteri Rinne (Admescope), Dr. Maija Mutikainen (Kuopio), Professor Pasi Tavi (Kuopio), Professor Andras Franko (Germany), Dr. Kari T. Chambers (USA), and Professor Brian N. Fink (USA).

I am incredibly grateful to Ritva Tauriainen for the very skillful technical help in my PhD as well as help in learning Finnish. I also wish to thank my fellows in my lab, Dr. Anja Konzack, and MSc Piia Lassila. Many thanks to Dr. Fatemeh Hassani for her help, and for the tasty Iranian food. I also wish to thank my F112 officemates, Orvokki Mattila and Marja Tölli, for the always nice and interesting discussions. My gratitude extends to Esa Kerttula and Pirkko Viitala for taking care

10

of technical and practical issues in Farmis. I also wish to thank the students I mentored during my PhD study, medical student Anni Louhimo, and MSc Eevasisko Mehtätalo. My thanks extend to all my former and current fellows in the Research Unit of Biomedicine. Special thanks to Maikki for keeping our place clean and perfect for working. I would also like to thank all the IT teams who helped me in solving many technical and software issues. I am grateful to the cofounders of the Collaboration bank platform, and dear friends, Khaled, Shiva, Abdo, and Heba, for their dedication and the excellent teamwork. I also want to thank Niina Karvinen, for her help and for supporting our business.

I also wish to thank Professor Hanna-Marja Voipio, the director of the laboratory animal center (KEKS) and Dr. Sakari Laaksonen, for the continuous help in all the animal work. Special thanks go to Sirpa Tausta, for the professional help in all of my animal experiments and to Seija Seljänperä for helping in training for several types of injections.

In 2018, I had a great opportunity of visiting and working with prominent scientist Professor Norbert Perrimon at Harvard Medical School (Boston, USA). I am grateful to him for the unforgettable and valuable experience I got in his lab. I would also like to extend my sincere thanks to all Perrimon´s lab members, especially Dr. Arpan Ghosh, for allowing me to work on his project, and for encouragement, and constructive criticism. I also wish to thank Dr. Rich Binari for his professional technical help and his kind gift. I would also like to thank Dr. Leena Kaikkonen for helping me to settle down in Boston and for the valuable advice and discussions.

I would like to extend my sincere thanks to my first mentor in science from Finland, Professor Kalervo Hiltunen, for his valuable mentorship while working in his lab. I wish to thank all my former colleagues in Kalervo´s lab, especially Dr. Anne Mäkelä, for her enormous help in all my work there. I would also like to express my sincere gratitude to Professor Lloyd Ruddock, the first scientist I met in Oulu for his kind help, encouragement and constant support during my master’s study, and for Professor Thomas Kietzmann, who taught me a lot about science and research and most importantly how to critically read the scientific literature, and for Professor Rik Wierenga for his kind help at the very end of my master’s study when he taught me two courses in his office.

My sincere thanks and gratitude to all personnel of the Välkkylän päiväkoti, Tuula, Sinikka, Marita, Taina, Ritu, Anu, Marianne, Riitta, Tarja, Riitta, Sirpa, Heli, and Janita, for taking care of my kids during the years which made it possible to concentrate on work fully.

11

I want to sincerely thanks my friends in Oulu, Dr. Atef Hamada, Dr. Khaled Abass, Dr. Mamdouh Omran, Dr. Amr Hamada, Dr. Mohammed Salah, Dr. Shiva Shah Teli, Dr. Ehsanul Hoque Apu and Dr. Ghulam Raza; my friends in Egypt, Dr. Ahmed Masoud, Dr. Ahmed Hassan, Ahmed Saad, Mahmoud Ibrahim, and Mostafa Karamany for their valuable friendship, and support. Special thanks to Dr. Atef Hamada, Dr. Walaa Abbas and their beautiful family, for their help, kind hospitality, and for supporting me when I came to Oulu. I also wish to thank our friend Anna Mikkola for help in learning Finnish.

I also wish to thank Dr. Badr Elbalawy, the director of Al-Sharq health institute (Saudi Arabia), for having me in his team, and for helping me to get prepared for my trip to Finland back then in 2012. I also wish to extend my thanks to all my former fellows in the institute, Dr. Khedr Elamin, Dr. Rami, Dr. Mahmoud, Mr. Mohammed Abo Arab, Mr. Saleh, and Mr. Reda.

I would also like to extend my deepest gratitude to many people whose earlier impact on my life is reflected in this thesis, but space is not sufficient to mention them all. One of those people was my teacher Khaled Mostafa Rezk, to whom I am incredibly grateful for his help in a challenging time in my life when I was about to get into the high school. Without his help, most probably, I would not have been even able to get into high school and continue my higher education to this level.

All my doctoral research could not be possible without the support from several funding agencies: importantly, the Academy of Finland, Diabetes Research Foundation, the Scholarship Fund of the University of Oulu (Tyyni Tani Fund), and the University of Oulu graduate school. For them I am incredibly grateful.

I cannot begin to express my thanks to my parents, the cause of my existence in life. I am deeply indebted to my mom, Leila (ليلي), the uneducated woman, who taught me how important education is for the human being. Thank you, my mom, for your endless love, and for believing in me. My father, who taught me the love of doing good and serving people and taught me how to care for my family and my relatives. My father and my mother, without your unconditional love, your hard work, your sacrifices, your encouragement, your concern, I wouldn't have achieved anything in my life. To my mother and my father, I owe everything in my life.

بي، سبب وجودي في الحياة، ال أجد من الكلمات ما يكفي لشكركم علي كل ما قدمتموه لي طوال حياتي. أمي وأ أمي وأبي، من غيرحبكم،عملكم الشاق، تضحياتكم، تشجيعكم، وإهتمامكم، لم أكن ألحقق أي شئ في حياتي.

في عمركم ومتعكم بالصحة أمي وأبي، انا مدين لكم بكل شئ في حياتي وإليكم أهدي رسالتي هذه. أطال هللا .والعافية وجزاكم هللا عني خيرالجزاء

12

I am extremely grateful to my father & mother-in-law for their love, support, and encouragement. أود تقديم الشكر الجزيل ألبي الثاني نبيل وأمي الثانية ماما وداد، علي حبهم ودعمهم

وأهدي رسالتي هذه لروح عم نبيل هللا يرحمه لي طوال هذه السنين . I want to extend my thanks to all my family, my sister Hanaa and my brothers, Mohammed, Mostafa, Ibrahim, and Islam, my sisters-in-law, Soheir, Hadeer, and Aya, and my brothers-in-law, Alaa, Mohammed and Adel, for their love, encouragement, and support.

Finally, I’m deeply indebted to my best friend and my beloved wife, Heba, for being in my life, and for her endless love, supporting, advising, encouraging, and motivating. I really enjoyed our daily morning discussion with a warm cup of coffee and pulla. This work has been as much yours as it has been mine. Words are not enough to thank you, my darling. Suhail and Elias! My beloved kids, thank you for the joy you added to my life and for teaching me many lessons in life. I think the most important lesson so far is that I must live every single moment in my life with joy and smile, and not to think about the past or to worry about the future. Thank you, my kids, for being here with me in my journey on earth.

Oulu, May 2020 Mahmoud Sobhy Elkhwanky

13

Abbreviations 7-DHC 7-dehydrocholesterol Ad adenovirus BAT brown adipose tissue cAMP cyclic adenosine monophosphate CRP C-reactive protein CD cluster of differentiation CVD cardiovascular disease CYP cytochrome P450 ERRα estrogen-related receptor alpha EURODIAB European diabetes study FGF23 fibroblast growth factor 23 G6Pase glucose-6-phosphatase GI gastrointestinal tract GLUT4 glucose transporter 4 GR glucocorticoid receptor HOMA-IR homeostasis model assessment for insulin resistance IFN interferon IL interleukin IRS1 insulin receptor substrate 1 JNK c-Jun N-terminal kinase KO knockout LADA latent autoimmune diabetes in adults LTA lymphotoxin alpha, also called TNF-β LXR liver X receptor MAPK mitogen-activated protein kinase NEFAS non-esterified fatty acids NF-κB nuclear factor-kB NHANES National Health and Nutrition Examination Survey NOD non-obese diabetic OGTT oral glucose tolerance test PEPCK phosphoenolpyruvate carboxykinase PGC-1α peroxisome-proliferator activated receptor gamma coactivator

1alpha PKA protein kinase A PKC protein kinase C

14

PPARγ peroxisome proliferator-activated receptor gamma PTH parathyroid hormone PXR pregnane X receptor ROS reactive oxygen species RANK receptor-activator of NF-κB RANKL RANK ligand RXR retinoid X receptor SCAP sterol regulatory element-binding protein cleavage-activating

protein SREBPs sterol regulatory element-binding proteins STZ streptozotocin TAG triacylglyceride TCA tricarboxylic acid TNF tumor necrosis factor Th1 T helper 1 TRPV6 transient receptor potential cation channel subfamily V

member 6 UVB ultraviolet B UCP2 uncoupling protein 2 VDBP vitamin D binding protein VDR vitamin D receptor VDRE vitamin D response element VLDL very low-density lipoprotein

15

List of original publications This thesis is based on the following publications, which are referred to throughout the text by their Roman numerals:

I Aatsinki SM*, Elkhwanky MS*, Kummu O, Karpale M, Buler M, Viitala P, Rinne V, Mutikainen M, Tavi P, Franko A, Wiesner RJ, Chambers KT, Finck BN & Hakkola J (2019) Fasting-Induced Transcription Factors Repress Vitamin D Bioactivation, a Mechanism for Vitamin D Deficiency in Diabetes. Diabetes 68(5): 918-931.

II Elkhwanky MS, Kummu O, Piltonen TT, Laru J, Morin-Papunen L, Mutikainen M, Tavi P & Hakkola J (2019) Obesity represses CYP2R1, the vitamin D 25-hydroxylase in the human and mouse tissues (Submitted manuscript).

*Equal contribution

Additional unpublished data are also presented.

16

17

Contents Abstract Tiivistelmä Acknowledgments 9 Abbreviations 13 List of original publications 15 Contents 17 1 Introduction 19 2 Review of the literature 21

2.1 Basics of vitamin D ................................................................................. 21 2.1.1 Vitamin D in research, statistics ................................................... 21 2.1.2 Vitamin D, general aspects ........................................................... 21 2.1.3 D-hormone and/or D-vitamin? ..................................................... 23 2.1.4 Factors affecting the vitamin D status and the challenges

to make universal guidelines for vitamin D supplementation ........................................................................... 23

2.1.5 What does vitamin D deficiency mean? ....................................... 23 2.2 Molecular biology of vitamin D .............................................................. 24

2.2.1 Cytochrome P450s involved in vitamin D metabolism ................ 24 2.2.2 The vitamin D receptor ................................................................. 30

2.3 Functions of vitamin D ........................................................................... 32 2.3.1 Skeletal functions ......................................................................... 32 2.3.2 Non-skeletal functions .................................................................. 34

2.4 The interplay between vitamin D and diabetes ....................................... 37 2.4.1 Vitamin D and type 1 diabetes ...................................................... 38 2.4.2 Vitamin D and type 2 diabetes ...................................................... 41

2.5 Liver as a key player in the body’s energy metabolism .......................... 46 2.5.1 PGC-1α as a key energy sensor in the liver .................................. 47 2.5.2 GR pathway in the regulation of hepatic energy

metabolism. .................................................................................. 49 3 Aims of the present study 51 4 Materials and Methods 53

4.1 Sketch of the study design ...................................................................... 53 4.2 Reagents and materials ............................................................................ 54 4.3 Animal experiments ................................................................................ 55 4.4 Human study ........................................................................................... 55 4.5 Cell cultures ............................................................................................ 56

18

4.5.1 Mouse primary hepatocytes .......................................................... 56 4.5.2 Continuous cell lines .................................................................... 56

4.6 Adenoviral treatment ............................................................................... 56 4.7 Analysis of gene expression .................................................................... 57

4.7.1 mRNA analysis ............................................................................. 57 4.7.2 Protein analysis ............................................................................. 58

4.8 The microsomal vitamin D 25-hydroxylase activity measurements .......................................................................................... 59

4.9 Measurement of the plasma levels of the 25-hydroxyvitamin D ............. 59 4.10 Bioinformatic analysis ............................................................................ 59 4.11 Statistical analysis ................................................................................... 59

5 Results and Discussion 61 5.1 Vitamin D metabolism is under strict control by the metabolic

state in mice and human .......................................................................... 61 5.1.1 Fasting represses the vitamin D bioactivation in the liver

and induces the catabolism in the kidney (I) ................................ 61 5.1.2 Fasting regulates vitamin D metabolism in extrahepatic

tissues ........................................................................................... 63 5.1.3 Metabolic disturbances, i.e., type 1 diabetes, obesity and

type 2 diabetes repress the Cyp2r1 and vitamin D bioactivation in the liver and reduce the plasma 25(OH)D levels (I-II) .................................................................................... 65

5.1.4 Obesity regulates the Cyp2r1 expression in the mouse extrahepatic tissues (II) ................................................................. 67

5.1.5 Human obesity represses CYP2R1 and vitamin D bioactivation in WAT (II) .............................................................. 69

5.2 Fasting-activated molecular pathways regulate vitamin D metabolism .............................................................................................. 71 5.2.1 PGC-1α-ERRα pathway represses Cyp2r1 expression (I) ............ 71 5.2.2 Activation of GR represses Cyp2r1 in the liver and kidney

(I-II) .............................................................................................. 72 5.2.3 PGC-1α-ERRα pathway mediates the fasting-mediated

induction of the Cyp24a1 in the kidney (I) ................................... 73 6 Concluding remarks and future direction 75 List of references 79 Original publications 107

19

1 Introduction Vitamin D is an endocrine hormone and a regulator of calcium homeostasis and bone formation and maintenance. However, in recent years evidence has accumulated, which demonstrates that vitamin D has pleiotropic functions (Bouillon et al., 2019; Charoenngam, Shirvani, & Holick, 2019). The health consequences of vitamin D deficiency include poor bone development and health as well as increased risk for many diseases, including types 1 and 2 diabetes, multiple sclerosis, cardiovascular diseases, and cancer (Muscogiuri et al., 2017). Interestingly, vitamin D deficiency is considered one of the most prevalent medical health problems worldwide (Holick, 2017).

Exposing the skin to solar UVB light is the primary source for vitamin D; however, it can also be obtained to a lesser extent from diet and/or supplements. Both the synthesized or the ingested vitamin D is a prohormone which requires two enzymatic activation steps, i.e., 25-hydroxylation in the liver and 1α-hydroxylation in the kidney, to produce the full active vitamin D hormone, i.e., 1α,25-dihydroxyvitamin D (1α,25(OH)2D) (Christakos, Dhawan, Verstuyf, Verlinden, & Carmeliet, 2016). Vitamin D status is usually evaluated by determining the main circulating vitamin D metabolite, i.e., 25-hydroxyvitamin D (25(OH)D) because of the relatively long half-life (about 2 weeks) (Jones KS et al., 2014).

The 25-hydroxylation step takes place primarily in the liver and is catalyzed mainly by the cytochrome P450 2R1 (CYP2R1) enzyme ( Zhu JG, Ochalek, Kaufmann, Jones, & DeLuca, 2013). Recent evidence has indicated that CYP2R1 is the predominant vitamin D 25-hydroxylase in the liver (Cheng, Levine, Bell, Mangelsdorf, & Russell, 2004; Zhu JG et al., 2013). In humans, a defect in the CYP2R1 gene has been found to cause an inherited form of vitamin D deficiency and rickets in children (Molin et al., 2017; Thacher & Levine, 2017). Genome-wide studies have identified CYP2R1 gene variants as one of the major genetic determinants of low 25(OH)D levels (Manousaki et al., 2017; Wang TJ et al., 2010).

The dogma in the vitamin D field about CYP2R1 and vitamin D-25-hydroxylation in the liver has been that CYP2R1 is constitutively expressed and is not under efficient metabolic control. This means that it should not be affected by the metabolic state in the liver. Therefore, the plasma level of 25(OH)D reflects the amount of vitamin D synthesis or intake (Zhu J & Deluca, 2012).

A growing body of evidence has shown that there is a strong association between vitamin D deficiency and metabolic diseases, but the causal link is still unclear. For example, 1) almost all diabetic patients have vitamin D deficiency at

20

the time of diagnosis (Pittas, Lau, Hu, & Dawson-Hughes, 2007; SZEP et al., 2011) although the molecular mechanisms are unknown; 2) vitamin D deficiency is quite prevalent in obese subjects in epidemiological studies (Censani et al., 2013; Samuel & Borrell, 2014; Stein et al., 2009); and 3) clinical trials aiming to prevent the development of diabetes with vitamin D supplementation have been disappointing (Pittas et al., 2019; Van Belle, Gysemans, & Mathieu, 2013). Moreover, an intense debate is ongoing in the field regarding whether vitamin D deficiency causes diabetes or whether diabetes causes vitamin D deficiency.

In the present thesis, we studied the cross-talk between energy homeostasis and vitamin D metabolism. Additionally, the study aimed to uncover the molecular mechanism(s) behind the vitamin D deficiency observed in diabetic patients. Indeed, maintaining a healthy level of vitamin D is considered to be a vital factor in attenuating the disease and improving the quality of life of diabetic patients.

21

2 Review of the literature

2.1 Basics of vitamin D

2.1.1 Vitamin D in research, statistics

Vitamin D is a hot topic in research. A search with the term “vitamin D” in PubMed returns about 66,725 publications. Out of that number, more than 5000 are publications only about vitamin D and diabetes, with over 1000 in the last two years.

2.1.2 Vitamin D, general aspects

Vitamin D is a fat-soluble secosteroid hormone with two main forms: vitamin D2, or ergocalciferol, and vitamin D3, or cholecalciferol (Fig. 1) (Chen, Lu, & Holick, 2010). Vitamin D2 is the plant-derived form, and it can be synthesized in response to ultraviolet irradiation in plants, yeast, fungi, and mushrooms (Horst, Reinhardt, & Reddy, 2005). Vitamin D3 is the animal-derived form, which can be synthesized non-enzymatically from the 7-dehydrocholesterol (7-DHC) precursor by exposure to sunlight UVB (wavelength 280-320 nm). When UVB hits the skin, it breaks the 7-DHC ring leading to the production of pre-vitamin D, which is an unstable intermediate thermally converted into vitamin D3 (Chen et al., 2010). Vitamin D may be also be obtained to a lesser extent from various foods such as salmon, tuna, and cod liver oil or as a supplement. The fortification of foods with vitamin D is another common source of vitamin D (Pludowski et al., 2017). The ingested and/or dietary vitamin D is absorbed in the small intestine through chylomicrons (Blomhoff et al., 1984; Silva & Furlanetto, 2018), while the vitamin D produced by sunlight goes directly into the circulation.

Importantly, either synthesized or dietary obtained vitamin D is an inactive prohormone which is hydroxylated and activated further in liver and kidney, to produce the 25(OH)D, and 1α,25(OH)2D, respectively (Christakos et al., 2016). In fact, both vitamin D2 and D3 were shown to be metabolized in a similar manner. In the blood, vitamin D and its metabolites are circulating bound with a plasma protein called vitamin D binding protein (VDBP) (Carpenter et al., 2013; Wang TJ et al., 2010). In general, the affinity of 25(OH)D to bind VDBP is higher than both vitamin D itself and 1α,25(OH)2D (Bouillon, Schuit, Antonio, & Rastinejad, 2019). The 25(OH)D2 has a lower binding affinity to VDBP, and therefore, its half-life is

22

shorter than the 25(OH)D3 (Jones KS et al., 2014). Moreover, the majority of vitamin D-related physiological functions are mediated by the 1α,25(OH)2D.

Fig. 1. Chemical structures of vitamin D2 (Left) and vitamin D3 (Right).

Fig. 2. Overview of the pathways for vitamin D synthesis, bioactivation, and inactivation. Part of the Fig. was drawn with the help of Servier Medical Art (www.servier.com).

23

2.1.3 D-hormone and/or D-vitamin?

A vitamin is classically defined as an essential micronutrient which our body cannot synthesize. Therefore, a vitamin must be taken through diet and/or supplement. On the other hand, a hormone is a compound which can be synthesized in the body in the endocrine glands and secreted into the circulation. Since vitamin D was initially discovered as an essential nutrient for maintaining the skeleton, several foods such as milk have been fortified with vitamin D, which has helped to eliminate the epidemics of rickets. Thus, it was embraced as a vitamin. However, vitamin D should not be considered only a vitamin, but it should be recognized as a pro-hormone produced normally in the skin by photolysis of 7-DHC through the sun’s UVB light.

2.1.4 Factors affecting the vitamin D status and the challenges to make universal guidelines for vitamin D supplementation

Vitamin D levels may vary depending on several clinical and environmental factors such as sunlight exposure, skin pigmentation, clothing, cultural habits, latitude, and diet (Grant et al., 2015; Haq, Wimalawansa, Pludowski, & Anouti, 2018; Płudowski et al., 2013; Wimalawansa, 2018b). Also, genetics can play a role in determining the vitamin D level. For example, large-scale genetic studies have identified CYP2R1 gene variants as one of the major genetic determinants of low 25(OH)D levels (Manousaki et al., 2017; Wang TJ et al., 2010). Altogether, all these factors make it difficult to make universal guidelines for vitamin D supplementation. Therefore, it is recommended that every country make its own guidelines. For example, in Finland, 400 IU/day (10 µg/day) is recommended for most age groups, except 800 IU/day (20 µg/day) is recommended for people over age 75 (Finnish Food Authority, https://www.ruokavirasto.fi/en/themes/healthy-diet/nutrition-and-food-recommendations/special-instructions-and-restrictions/).

A major concern about vitamin D supplementation is an increased risk of hypercalcemia and tissue calcifications, which is a rare condition and usually results from taking extremely high doses of vitamin D over a long period of time.

2.1.5 What does vitamin D deficiency mean?

Vitamin D status is usually evaluated by measuring the level of 25(OH)D in the blood. The reason behind this is the rather long half-life of 25(OH)D of about two

24

weeks (Jones KS et al., 2014). Furthermore, the 25-hydroxylation step has been considered not to be under efficient metabolic control, and 25(OH)D should thus reflect the intake of vitamin D (Zhu J & Deluca, 2012). However, in the current thesis, we challenge this dogma and show that metabolic regulators strictly control vitamin D 25-hydroxylation in the liver and extrahepatic tissues.

In general, vitamin D deficiency means that there is a lower level of 25(OH)D in the blood. In fact, there is no consensus about the normal 25(OH)D concentration (Bouillon, 2017). Currently, there are several guidelines: for example, it has been suggested the vitamin D status could be defined as vitamin D deficiency if 25(OH)D is below 20 ng/ml, insufficiency if 25(OH)D is 21 – 29 ng/ml, and sufficiency if 25(OH)D is 30 – 100 ng/ml (Table 1) (Holick et al., 2011). In contrast, other guidelines from the Institute of Medicine (IOM) suggested that the serum 25(OH)D between 16 - 20 ng/ml (40 – 50 nmol/l, respectively) is considered to be vitamin D sufficiency and levels above 50 ng/ml (125 nmol/l) should be considered for potential adverse effects (Table 1) (Ross et al., 2011).

Table 1. The range of plasma 25(OH)D levels suggested by the Endocrine Society and the Institute of Medicine.

Vitamin D status Endocrine Society Institute of Medicine

Deficient Below 20 ng/ml

(50 nmol/l)

Below 16 ng/ml

(40 nmol/l)

Insufficient 21 – 29 ng/ml

(52 – 72 nmol/l)

Sufficient 30 – 100 ng/ml

(75 – 250 nmol/l)

16 – 20 ng/ml

(40 – 50 nmol/l)

2.2 Molecular biology of vitamin D

2.2.1 Cytochrome P450s involved in vitamin D metabolism

Distinct CYP enzymes play critical roles in vitamin D bioactivation and degradation, namely CYP2R1, CYP27B1, and CYP24A1. Both CYP2R1 and CYP27B1 are responsible for bioactivation of vitamin D, while the CYP24A1 is responsible for the catabolism of vitamin D (Fig. 2).

25

25-hydroxylation and CYP2R1

Several cytochrome P450 enzymes have been proposed to catalyze the vitamin D 25-hydroxylation, such as CYP2R1, CYP27A1, CYP2D25, CYP2C11, and CYP3A4. However, strong evidence from genetic studies, expression data, and catalytic properties all suggest that CYP2R1 is the major vitamin D-25-hydroxylase in the liver (Cheng et al., 2004; Zhu JG et al., 2013).

CYP2R1 is located in the endoplasmic reticulum (Zhu JG et al., 2013). A genetic defect in the CYP2R1 gene has been shown to cause an inherited form of vitamin D deficiency and rickets in children (Molin et al., 2017; Thacher & Levine, 2017). These patients responded poorly to vitamin D supplementation but could benefit from 25(OH)D supplementation. Furthermore, genome-wide studies have identified CYP2R1 gene variants as one of the key determinants of low 25(OH)D levels (Manousaki et al., 2017; Wang TJ et al., 2010). In mice, Cyp2r1 knockout resulted in a 50% reduction of the plasma 25(OH)D, indicating that the CYP2R1 is the major but not the exclusive vitamin D 25-hydroxylase (Zhu JG et al., 2013). Interestingly, in the same study, knockout of the Cyp27a1, one of the suggested vitamin D 25-hydroxylases, had no further effect on the plasma 25(OH)D levels (Zhu JG et al., 2013).

Despite the importance of CYP2R1 in the 25-hydroxylation step of vitamin D, its transcriptional regulation is poorly characterized. Recently, there is increasing evidence that suggests the epigenetic regulation of the genes involved in vitamin D metabolism, including CYP2R1 (Fetahu, Höbaus, & Kállay, 2014; Parsanathan & Jain, 2019; Zhou Y et al., 2014). Interestingly, the promoter of the CYP2R1 gene was shown to have CpG sites which could be methylated, leading to silencing the CYP2R1 expression (Zhou Y et al., 2014). Importantly, the methylation status of the promoters of both CYP2R1 and CYP24A1 was suggested to predict the response to vitamin D supplementation (Zhou Y et al., 2014). Furthermore, it has been recently demonstrated that the Cyp2r1 gene promoter was hypermethylated in the livers of high-fat diet (HFD) treated mice, which consequently, caused lower Cyp2r1 expression (Parsanathan & Jain, 2019). The study also suggested that the hypermethylation of the Cyp2r1 gene in the liver of HFD-mice is linked to glutathione deficiency (Parsanathan & Jain, 2019).

Besides, a few reports demonstrated the regulation of CYP2R1 expression in cells. For example, treating dermal fibroblast cells with phenobarbital, efavirenz, as well as 1α,25(OH)2D has been shown to repress CYP2R1 (Ellfolk, Norlin,

26

Gyllensten, & Wikvall, 2009). Moreover, treating testis Leydig cells with osteocalcin modulates CYP2R1 expression (De Toni et al., 2014).

The 25(OH)D is generally believed to be an inactive metabolite and precursor for producing the full active metabolite, i.e., 1α,25(OH)2D (Bouillon et al., 2019; Charoenngam et al., 2019; Christakos et al., 2016). However, in recent years, several studies suggested that 25(OH)D can exert biological functions independent of 1α,25(OH)2D. Interestingly, Asano et al., demonstrated that 25(OH)D inhibits the activation of sterol regulatory element-binding proteins (SREBP) by inhibition of the SREBP partner SCAP in vitro (Asano et al., 2017). SREBPs are transcription factors that are key regulators of lipid homeostasis by inducing the expression of lipogenic genes (Shimano & Sato, 2017). The liver is the primary expression target of SREBPs, and they are key players during the fed response (Shimano & Sato, 2017). Importantly, this suggests that the intrahepatic 25(OH)D might regulate the lipid homeostasis in the liver. Although this might indicate some biological activity of 25(OH)D, future studies are required to address the physiological functions of 25(OH)D in vivo.

1α-Hydroxylation and CYP27B1

The mitochondrial CYP27B1 is the sole vitamin D 1α-hydroxylase responsible for the last activation step to produce the fully active hormone (Hewison et al., 2007). It has been demonstrated that the main site for CYP27B1 expression is the kidney, but it is expressed locally in several tissues such as skin, colon, bone, and parathyroid gland (Hewison et al., 2007). Although the kidney is the main contributor to the circulating 1α,25(OH)2D, there is evidence to support extra-renal production of 1α,25(OH)2D. For example, in an anephric patient with sarcoidosis, the patient had high levels of 1α,25(OH)2D (Barbour, Coburn, Slatopolsky, Norman, & Horst, 1981). Moreover, hypercalcemia in a lymphoma patient has been observed along with elevated levels of the circulating 1α,25(OH)2D (Rosenthal et al., 1985).

Indeed, a genetic mutation in CYP27B1 causes vitamin D-dependent rickets (Type I) (Kitanaka et al., 1999; Sawada, Sakaki, Kitanaka, Kato, & Inouye, 2001). The regulation of CYP27B1 is the most studied step in vitamin D metabolism. For more details, see the next chapter below.

27

24-hydroxylation, CYP24A1, and catabolism of vitamin D

CYP24A1 is referred to as the 1α,25(OH)2D-24-hydroxylase, and is located in the mitochondria (Jones G, Prosser, & Kaufmann, 2014). CYP24A1 has been established as the key enzyme responsible for vitamin D catabolism. Though it was initially thought to catalyze the 24-hydroxylation of both 25(OH)D3 and 1α,25(OH)2D3, it is now shown to catalyze also the hydroxylation reaction at Carbon 23 (Fig. 2) (Knutson & DeLuca, 1974; Prosser & Jones, 2004). Additionally, CYP24A1 catalyzes the hydroxylation of vitamin D2 to produce polyhydroxylated products (Masuda, Strugnell, Knutson, St-Arnaud, & Jones, 2006). CYP24A1 controls the amount of active vitamin D by reducing the amount of 1α,25(OH)2D when there is an elevated level in the circulation (Jones G et al., 2014). Furthermore, CYP24A1 limits the amount of 25(OH)D available for activation by CYP27B1 (Jones G et al., 2014).

The CYP24A1 gene is expressed mainly in the kidney; however, recent studies showed that the CYP24A1 gene is also expressed in all cells and tissues containing the vitamin D receptor (VDR) (Jones G et al., 2014). Thus, CYP24A1 could also modulate the intracellular levels of 1α,25(OH)2D. In fact, 50% of Cyp24a1 null mice die very early before the age of 3 weeks, and the other 50% had high levels of 1α,25(OH)2D, and had intramembranous bone lesions (St-Arnaud et al., 2000). Those bone lesions were resolved when the Cyp24a1/Vdr null mouse model was generated, which suggests they are mediated through VDR (St-Arnaud et al., 2000).

The 24-hydroxylated metabolites of vitamin D are generally believed to be inactive metabolites. However, recent studies suggest a physiological role of the 24-hydroxyvitamin D metabolite in bone development (Christakos et al., 2016; Jones G et al., 2014). Supporting that, Cyp24a1 null mice were shown to have impaired bone fracture healing, which suggested that the 24-hydroxylated metabolites of vitamin D are necessary for bone fracture healing (St-Arnaud, 2010). Interestingly, in a recent report, the fracture repair in the Cyp24a1 null mice was improved by administration of 24,25(OH)2D, and not the 1α,25(OH)2D (Martineau et al., 2018).

In humans, inactivating bi-allelic mutations in the CYP24A1 gene caused infantile hypercalcemia (Pronicka et al., 2017; Schlingmann et al., 2011). Furthermore, CYP24A1 mutations have been identified in adult humans and caused hypercalcemia, hypercalciuria, and recurrent nephrolithiasis (Cappellani et al., 2019; Molin et al., 2015; Tebben et al., 2012).

28

The CYP24A1 is working in balance with CYP27B1 to regulate vitamin D and calcium homeostasis. In general, the expression of CYP24A1 is mainly dependent on 1α,25(OH)2D. In the absence of 1α,25(OH)2D, the CYP24A1 gene is not expressed, while in the presence of 1α,25(OH)2D through activation of VDR, CYP24A1 is expressed highly in the kidney (Christakos et al., 2016).

Mechanistically, it has been demonstrated that mouse Cyp24a1 expression is upregulated by 1α,25(OH)2D through the VDR/RXR which bind to enhancer elements located in the proximal promoter and in the distal region downstream of the gene (Meyer, Goetsch, & Pike, 2010; Pike & Meyer, 2012). Binding of the active VDR/RXR complex to the distant enhancer elements facilitates the recruitment of several coactivators and chromatin modifiers, which increase the accessibility of chromatin. Finally, the VDR/RXR complex with the help of several mediators forms a loop to set up the transcription machinery around the transcriptional start site (TSS) to induce the transcription of the Cyp24a1 gene (Fig. 4) (Meyer et al., 2010; Pike & Meyer, 2012).

Interestingly, in the Vdr knockout mice, the clearance of 1α,25(OH)2D decreased dramatically, because of lack of ligand-activated VDR upregulation of the Cyp24a1 (Kato et al., 1999; Li YC et al., 1997; Van Cromphaut et al., 2001; Yoshizawa et al., 1997). This supported the concept that VDR is the key player regulating Cyp24a1 expression and verifies the catabolic role of the enzyme in limiting the biological activity of vitamin D.

Both CYP27B1 and CYP24A1 are under stringent control by the hormones involved in the regulation of bone and mineral homeostasis, namely, 1α,25(OH)2D, PTH, and FGF23 (Fig. 3). In the case of low calcium levels in the blood, i.e., hypocalcemia, PTH is secreted from the parathyroid gland (PT) into the circulation and stimulates the renal production of CYP27B1, and consequently 1α,25(OH)2D (Conigrave, 2016). 1α,25(OH)2D through activation of the VDR mediates the intestinal absorption of calcium (Fleet & Schoch, 2010). Moreover, 1α,25(OH)2D suppresses the PTH production in the PT gland directly at the transcriptional level (Demay, Kiernan, DeLuca, & Kronenberg, 1992; Koszewski, Alimov, Park-Sarge, & Malluche, 2004; Mackey, Heymont, Kronenberg, & Demay, 1996; Russell, Ashok, & Koszewski, 1999) and indirectly through elevation of the blood calcium levels (Canaff & Hendy, 2002). Additionally, 1α,25(OH)2D controls its own production by inhibiting CYP27B1 (Bikle D, 2017). Moreover, 1α,25(OH)2D mediates the induction of CYP24A1 to limit 1α,25(OH)2D production (Jones G, Prosser, & Kaufmann, 2012).

29

PTH has been shown to attenuate the 1α,25(OH)2D-mediated CYP24A1 induction in the kidney through the cAMP/PKA signaling pathway (Reinhardt & Horst, 1990; Shinki et al., 1992; Zierold, Reinholz, Mings, Prahl, & DeLuca, 2000). However, PTH, in contrast to the kidney, stimulates CYP24A1 synthesis through the cAMP-pathway in osteoblastic cells, which might prevent bone abnormalities as a result of high levels of 1α,25(OH)2D in bones (Armbrecht et al., 1998; Huening, Yehia, Molina, & Christakos, 2002; Yang, Hyllner, & Christakos, 2001).

FGF23 also plays a crucial role in bone and mineral homeostasis and regulates the expression of genes involved in the regulation of serum phosphate as well as vitamin D metabolism (Bergwitz & Jüppner, 2010; Ramon, Kleynen, Body, & Karmali, 2010). When there is an increase in serum phosphate, FGF23 is induced in the osteocytes and osteoblasts. FGF23 reduces serum phosphate levels directly by inhibiting phosphate reabsorption in the kidney (Perwad, Zhang, Tenenhouse, & Portale, 2007; Shimada et al., 2004; Shimada et al., 2005), and indirectly by inhibiting CYP27B1 expression in the kidney which limits 1α,25(OH)2D production (Perwad et al., 2007; Shimada et al., 2004; Shimada et al., 2005). Furthermore, FGF23 reduces the circulating levels of 1α,25(OH)2D by inducing CYP24A1 expression in the kidney partially through VDR (Bai, Miao, Goltzman, & Karaplis, 2003; Inoue et al., 2005; Larsson et al., 2004; Perwad et al., 2007; Shimada et al., 2005). In addition to the role of vitamin D and VDR in the regulation of the CYP24A1, it has been shown that the xenobiotic sensor pregnane X receptor (PXR) might regulate the expression of CYP24A1 (Pascussi et al., 2005).

In the current thesis, we discovered a completely novel mechanism that regulates the expression of Cyp24a1 at the transcriptional level and is independent of the VDR action. This mechanism is discussed extensively in the original publication I (Aatsinki et al., 2019) and in the Results and Discussion sections.

30

Fig. 3. Regulation of expression of CYP27B1 and CYP24A1 by 1α,25(OH)2D, PTH, and FGF23.

2.2.2 The vitamin D receptor

It is now believed that vitamin D controls about 3% of the human or mouse genome directly or indirectly (Heikkinen et al., 2011; Kriebitzsch et al., 2009; Ramagopalan et al., 2010; Wang T et al., 2005). It is also believed that most of the genomic functions of vitamin D are mediated through binding and activation of the VDR in the target tissues (Carlberg, Seuter, & Heikkinen, 2012). Moreover, it has been estimated that 1α,25(OH)2D via its receptor VDR regulates the expression of about 2000 genes, which are involved in many physiological pathways inside the cells (Hossein-Nezhad, Spira, & Holick, 2013). This might also explain the non-calcemic pleiotropic effect of vitamin D (Bouillon et al., 2019; Charoenngam et al., 2019).

The VDR is primarily located in the nucleus (Haussler et al., 2013) and preferentially binds as a heterodimer with the retinoid X receptor (RXR) to the vitamin D responsive element (VDRE), i.e., A/GGG/TTC/GA in the promoters and/or enhancers of its target genes (Carlberg et al., 1993). In the absence of the VDR ligand, i.e., 1α,25(OH)2D, VDR represses its target genes through association with different co-repressors and histone deacetylases (Polly et al., 2000).

31

The genomic VDR signaling starts with binding of the 1α,25(OH)2D to VDR bound to the enhancer region within the accessible chromatin leading to dissociation of co-repressors and recruiting several coactivators (Fig. 4) (Nurminen, Seuter, & Carlberg, 2019). The VDR then increases the accessibility of chromatin around these enhancer regions with the help of chromatin modifiers and other mediators (Nurminen et al., 2019). Finally, the VDR with the help of several mediators forms a loop which helps to activate the enhancer region around the TSS and stimulate the transcription of the primary vitamin D target gene (Fig. 4) (Nurminen et al., 2019)

Investigations with Vdr-null mice proved that VDR is essential for vitamin D functions, especially in maintaining the calcium homeostasis (Y. C. Li et al., 1997; Yoshizawa et al., 1997). Furthermore, 1α,25(OH)2D was demonstrated to have a rapid and non-genomic response which can be seen, for example, on the effect on the calcium and chloride transport in the intestine, osteoblasts, and Sertoli cells, as well as insulin secretion (Haussler, Jurutka, Mizwicki, & Norman, 2011). The 1α,25(OH)2D has a very short half-life because of the rapid inactivation by the VDR-responsive Cyp24a1.

Fig. 4. Simple illustration of the VDR genomic action (Nurminen et al., 2019). The Fig. was drawn with the help of Servier Medical Art (www.servier.com).

32

2.3 Functions of vitamin D

2.3.1 Skeletal functions

The classical manifestation of vitamin D deficiency is bone deformation diseases, including rickets in children and osteomalacia in adults. This provides strong evidence that vitamin D is required for maintaining the skeleton (Fig. 5). In both cases, the mineralization of bones is impaired because of inadequate calcium and phosphate (Bell, Demay, & Burnett-Bowie, 2010; Bikle DD, 2012; Suda, Masuyama, Bouillon, & Carmeliet, 2015; Weaver & Peacock, 2011). The most well-known function of vitamin D is to maintain the calcium and phosphorus homeostasis in the blood (Fig. 5) (Bell et al., 2010; Bikle DD, 2012; Suda et al., 2015; Weaver & Peacock, 2011). Additionally, PTH and FGF23 play key roles in that function (Jones G, 2012; Norman, 2008). Normal serum calcium levels in humans are maintained in a very narrow range (about 2,2-2,5 mM) (Blaine, Chonchol, & Levi, 2015).

Vitamin D is unlikely to control the mineralization process directly. However, instead, it elevates the plasma calcium and phosphorus concentrations in the blood, and in turn, these elements precipitate on the bones (Fig. 5) (Bell et al., 2010; Bikle DD, 2012; Suda et al., 2015). Moreover, this would protect against hypocalcemia tetany (Gittoes, 2013). Vitamin D, through binding and activation of the VDR, mediates the effect on calcium homeostasis (Fig. 5). The key vitamin D target tissues related to calcium homeostasis are intestine, kidney, and bone (Bell et al., 2010; Bikle DD, 2012; Suda et al., 2015). When the ionized calcium level drops in the blood, several anti-hypocalcemic mechanisms are activated to restore the normal calcium level (Bell et al., 2010; Bikle DD, 2012).

The intestine is a key player in maintaining calcium homeostasis. Vitamin D increases the intestinal absorption of calcium and phosphorus (Christakos, Dhawan, Porta, Mady, & Seth, 2011). Studies in the Vdr null mice demonstrated that vitamin D maintains the bone mineral homeostasis mainly through increasing the calcium absorption in the intestine (Li YC et al., 1997; Van Cromphaut et al., 2001; Yoshizawa et al., 1997). Interestingly, the rickets phenotype in the Vdr null mice could be rescued by feeding mice with a rich calcium diet (Kaufmann, Lee, Pike, & Jones, 2015). 1α,25(OH)2D through its genomic action stimulates the intestinal absorption of calcium, which involves for example, calcium influx through TRPV6, intracellular calcium transfer by calbindin (CaBP), and calcium extrusion by the plasma membrane calcium ATPase (Calcium pump) (Christakos et al., 2011).

33

In case the intestinal absorption of calcium is not enough to maintain the normal calcium levels in the blood, PTH increases the activation of vitamin D (25(OH)D to 1α,25(OH)2D) (Bell et al., 2010; Bikle DD, 2012; Suda et al., 2015). 1α,25(OH)2D with PTH in the kidney increases the renal reabsorption of calcium (Bell et al., 2010; Bikle DD, 2012; Suda et al., 2015).

Additionally, 1α,25(OH)2D, and PTH could control bone turnover. In osteoblasts, vitamin D via binding to the VDR induces the expression of several genes, most importantly the RANKL gene (receptor-activating nuclear factor ligand) (Haussler et al., 2013; van de Peppel & van Leeuwen, Johannes P T M, 2014). Moreover, RANKL via binding with its receptor RANK on the monocyte lineage induces the formation of multinucleated mature osteoclasts (bone deforming cells) (Haussler et al., 2013; van de Peppel & van Leeuwen, Johannes P T M, 2014). Osteoclasts bind with the bone surface and secrete collagenases and hydrochloric acid, leading to degradation of collagen and release calcium into the bloodstream (Haussler et al., 2013; van de Peppel & van Leeuwen, Johannes P T M, 2014).

To prevent 1α,25(OH)2D-mediated hypercalcemia and its complications, 1α,25(OH)2D induces the expression of CYP24A1 to inactivate both 25(OH)D and 1α,25(OH)2D which are consequently secreted in the bile (Cashman et al., 2015).

34

Fig. 5. Overview of the role of vitamin D in maintaining the calcium homeostasis. Reprinted from (Legarth, Grimm, Wehland, Bauer, & Krüger, 2018) which is the Creative Commons Attribution License.

2.3.2 Non-skeletal functions

There is a growing body of evidence for the extra-skeletal actions and benefits of vitamin D (Fig. 6) (Bouillon et al., 2008; Bouillon et al., 2019; Charoenngam et al., 2019; Morris & Anderson, 2010). In general, it is supported by the observation that the components of the vitamin D endocrine system, for example, VDR and CYP27B1 exist in tissues that are not related to calcium homeostasis. It has been shown that VDR is expressed in cells and tissues such as keratinocytes, monocytes, islet cells of the pancreas, lymphocytes, promyelocytes, and ovarian cells (Cianferotti, Cox, Skorija, & Demay, 2007; Hummel et al., 2014; Nurminen et al., 2019; Ooi, Chen, & Cantorna, 2012; Silvagno et al., 2010). In humans, VDR is expressed in almost all tissues and cells (Wang Y, Zhu, & DeLuca, 2012) (Human protein atlas, https://www.proteinatlas.org/ENSG00000111424-VDR/tissue). Additionally, many cell types express CYP27B1, which reflects the ability of those cells to produce 1α,25(OH)2D locally (Bikle DD, Patzek, & Wang, 2018; Jones G, 2013). Additionally, this also reflects the extra-renal production of active vitamin

35

D (Adams & Hewison, 2012; Bikle DD et al., 2018; Jones G, 2013). Interestingly, the regulation of CYP27B1 expression in extra-renal tissues does not depend on calcium input but is regulated by several factors such as inflammatory molecules (Adams et al., 2014; Esteban, Vidal, & Dusso, 2004; Stoffels et al., 2006; Stoffels, Overbergh, Bouillon, & Mathieu, 2007). Moreover, several extra-renal tissues express CYP24A1, which reflects the ability of those tissues to catabolize and inhibit the activity of both 1α,25(OH)2D, and 25(OH)D (Adams & Hewison, 2012).

Interestingly, vitamin D deficiency has been shown to associate with the prevalence of many acute and chronic diseases such as autoimmune disease, infectious diseases, cardiovascular diseases, some cancers, and neurodegenerative diseases (Table 2).

Several pieces of evidence suggest that vitamin D is a key player in the regulation of immunity (Bouillon et al., 2008; Norlin et al., 2016). The first considerable finding was that vitamin D could induce the differentiation of pro-myelocytes into monocytes, which suggested a crucial role of vitamin D in regulating immunity (Miyaura et al., 1981). This was also supported by the high expression of VDR in T and B-lymphocytes, macrophages, and dendritic cells.

Interestingly, infection with a bacterial agent, for example, Mycobacterium tuberculosis (TB), was shown to induce the expression of VDR and CYP27B1 in monocytes/macrophages (Baeke, Takiishi, Korf, Gysemans, & Mathieu, 2010; Campbell & Spector, 2012; Sly, Lopez, Nauseef, & Reiner, 2001). The ligand-activated VDR, in turn, induced the expression of cathelicidin, which is a peptide capable of inducing the destruction of the TB (Baeke et al., 2010; Campbell & Spector, 2012; Sly et al., 2001). Additionally, the 1α,25(OH)2D produced locally in the monocyte, may act on other immune cells such as activated T- & B-lymphocytes to regulate the cytokine and synthesis of immunoglobulin, respectively (Baeke et al., 2010; Campbell & Spector, 2012; Sly et al., 2001). Furthermore, it has been shown that treatment with vitamin D hormone could block the development of multiple sclerosis in experimental animals (Sintzel et al., 2018). However, the molecular mechanisms are poorly understood.

Altogether, these findings support the idea that vitamin D may be crucial for fighting against infections and protect against autoimmunity and chronic inflammation (Antico, Tampoia, Tozzoli, & Bizzaro, 2012; Bergman et al., 2012; Iruretagoyena, Hirigoyen, Naves, & Burgos, 2015; Sabetta et al., 2010).

1α,25(OH)2D has been demonstrated to be a vital factor in several critical biological processes such as cell proliferation, and hormone secretion (Fig. 6). The 1α,25(OH)2D was shown to inhibit the expression and synthesis of PTH (Segersten

36

et al., 2002). In addition, 1α,25(OH)2D was shown to inhibit renin production in the kidney, which suggested that vitamin D might be crucial for maintaining the blood pressure (Li et YC al., 2002). Interestingly, 1α,25(OH)2D was also demonstrated to stimulate insulin secretion from the β-cells of the pancreas.

Moreover, vitamin D could suppress the proliferation of cancer cells and induce their differentiation, raising the hope that vitamin D may be beneficial in treating several malignancies (Jeon & Shin, 2018). Vitamin D could also inhibit the proliferation of keratinocytes, so it is used to treat psoriasis (Barrea et al., 2017).

Fig. 6. Non-skeletal functions of vitamin D (Wacker & Holick, 2013). Part of the Fig. was drawn with the help of Servier Medical Art (www.servier.com).

37

Table 2. Observations supporting the role of vitamin D in immunity, cardiovascular system, cancer, and neurodegenerative diseases

Biological system Observations

Immunity Individuals with higher levels of 25(OH)D have a lower incidence of acute

viral respiratory infections (Sabetta et al., 2010).

*Vitamin D supplementation protected from respiratory tract infections,

which decreases the number of antibiotic prescriptions (Bouillon et al.,

2008; Norlin et al., 2016).

*Vitamin D deficiency may cause multiple sclerosis (Sintzel et al., 2018).

Cardiovascular system Vitamin D-related components are abundant in blood vessels as well as

in the heart.

*Seasonal associated prevalence of CVD (Marti-Soler et al., 2014).

*The Young Finns Study, lower 25(OH)D in childhood, increases the risk of

developing intima-media thickness (IMT), a marker for structural

atherosclerosis (Juonala et al., 2015).

Cancer Women with high levels of the 25(OH)D have a lower risk of any

invasive cancer (excluding skin cancer) (McDonnell et al., 2018).

*Vitamin D may reduce the risk of having cancer, for instance, breast and

colorectal cancers (Young & Xiong, 2018).

Neurodegenerative

diseases

older people with severe vitamin D deficiency had an accelerated risk of

cognitive decline over a 6-year period (Llewellyn et al., 2010). *In older women, severe vitamin D deficiency predicted the onset of non-

Alzheimer´s dementia over a 7-year period (Annweiler et al., 2011).

*Higher intake of vitamin D was associated with a lower risk of developing

Alzheimer’s disease (Annweiler et al., 2012).

2.4 The interplay between vitamin D and diabetes

Diabetes is a complex and heterogeneous disease. There are several factors, including genetic, lifestyle, environmental, and nutritional factors that contribute to the disease. However, how these factors interact to cause the disease is not clear. The number of people diagnosed with diabetes is continuously increasing and is expected to reach about 600 million by 2030 (Saeedi et al., 2019). Therefore, it is necessary to identify easily modifiable risk factors that can be used for the primary prevention of diabetes. There is a vast amount of evidence that suggests that vitamin D deficiency is a strong risk factor for the onset of diabetes (Alam, Arul-Devah, Javed, & Malik, 2016; Mitri, Muraru, & Pittas, 2011; Palomer, González-Clemente, Blanco-Vaca, & Mauricio, 2008; Takiishi, Gysemans, Bouillon, & Mathieu, 2010; Wimalawansa, 2018a). However, the causal link is still uncertain.

38

In the next chapters, the interplay between vitamin D and type 1 and type 2 diabetes will be discussed.

2.4.1 Vitamin D and type 1 diabetes

Type 1 diabetes is a heterogeneous and chronic disease that is known to result from gradual autoimmune destruction of insulin-producing β-cells (Burrack, Martinov, & Fife, 2017). This leads to hyperglycemia because of severe deficiency or the total absence of insulin (Burrack et al., 2017). The auto-destruction of the β-cells involves the process of activation of several types of immune cells, such as macrophages, dendritic cells, CD4+, CD8+, and B lymphocytes (Burrack et al., 2017). This results in an uncontrolled autoimmune response causing insulitis with activated CD8+ cytotoxic T lymphocytes, which are usually detected in infiltrates of pancreatic islets (Burrack et al., 2017). At the time of clinical diagnosis of type 1 diabetes, 20% of the β-cell mass is usually found.

Finland has the world highest incidence of type 1 diabetes (Tuomilehto, 2013). It has been shown that particular environmental exposure can trigger the autoimmunity of type 1 diabetes in individuals who are genetically susceptible to the disease. Several studies proposed a strong association between the incidence of type 1 diabetes and certain types of environmental elements, but the causality remains uncertain (Rewers & Ludvigsson, 2016). For example, dietary habits, vitamin D deficiency, and viral exposure are associated with the incidence of type 1 diabetes (Knip et al., 2010; Rewers & Ludvigsson, 2016). Moreover, inadequate vitamin D has been strongly associated with both type 1 and type 2 diabetes and autoimmune diseases (Baeke et al., 2010; D. D. Bikle, 2011; Hyppönen, 2010). It is also supported by several epidemiological studies that associated living at a high latitude with decreased sun exposure and a higher incidence of type 1 diabetes (Baggerly et al., 2015; Bikle DD, 2011; Staples, Ponsonby, Lim, & McMichael, 2003). In fact, vitamin D levels were shown to be lower in newly diagnosed type 1 diabetic patients compared to matched healthy controls (Munger et al., 2013).

Polymorphism in the vitamin D system-related genes are associated with type 1 diabetes

Vitamin D system-related genes have been associated with several diseases (Penna-Martinez & Badenhoop, 2017). For example, polymorphism of the CYP27B1 gene has been associated with type 1 diabetes and other autoimmune diseases (Fichna et

39

al., 2010; Lopez et al., 2004; Shahijanian et al., 2014). Additionally, the variant C (-1260) of the CYP27B1 gene promoter has been frequently detected in children with type 1 diabetes, and it was also found more frequently in patients with autoimmune endocrinopathies (Lopez et al., 2004). Furthermore, polymorphisms in the VDR gene have been associated with bone mineral density and autoimmunity disorders, for instance, type 1 diabetes (McDermott et al., 1997; Mukhtar, Batool, Wajid, & Qayyum, 2017). Additionally, VDR polymorphisms have been associated with type 1 diabetes in several studies in several populations, such as Caucasians (Fassbender et al., 2002), Bangladeshi Indians (McDermott et al., 1997), Pakistanis (Mukhtar et al., 2017), Japanese (Ban et al., 2001) and in Kuwaiti (Rasoul, Haider, Al-Mahdi, Al-Kandari, & Dhaunsi, 2019). However, in other studies, the association was not established, such as in the Finnish population and in another study of three European countries (Nejentsev et al., 2004; Turpeinen et al., 2003). Importantly, a polymorphism in the CYP2R1 gene has been associated with susceptibility to type 1 diabetes (Penna-Martinez & Badenhoop, 2017; Ramos-Lopez, Bruck, Jansen, Herwig, & Badenhoop, 2007).

Vitamin D modulates the immune cells

Vitamin D has been shown to affect the innate as well as adaptive immunity, which could potentially be used both in the prevention and in treatment of the autoimmunity occurring in type 1 diabetes (Badenhoop, Kahles, & Penna-Martinez, 2012). Interestingly, VDR expression has been detected in almost all cells of the immune system, for instance, macrophages, dendritic cells, and activated T cells, which support the role of vitamin D in regulating immunity (Bikle DD, 2011; Bruce & Cantorna, 2011; Tiosano et al., 2013). Furthermore, some immune cells are able to synthesize active vitamin D 1α,25(OH)2D (Hewison, 2010).

Moreover, vitamin D was shown to act as an immunosuppressive agent in vitro, where it can suppress lymphocyte proliferation and cytokine production (Hewison, 2010; Saggese, Federico, Balestri, & Toniolo, 1989). Therefore, it was logical to predict its role in preventing the development of type 1 diabetes, which is known to be an autoimmune disease (Bach, 1994).

Mechanistically, vitamin D has been shown to suppress the production of several cytokines, which are crucial for the recruitment and activation of T-cells. 1α,25(OH)2D inhibits the production of IL-12, which is the major driving cytokine toward T helper 1 (Th1) (D'Ambrosio et al., 1998). Indeed, 1α,25(OH)2D suppresses the maturation of Th1 by inhibiting the Th1 cytokines such as IL-2 and

40

IFN-gamma and stimulates the Th2 cytokines such as IL-4 (Boonstra et al., 2001; Overbergh et al., 2000; Takeuchi et al., 1998). Moreover, it modifies both T-cell differentiation and dendritic cell action, as well as cytokine secretion (Mathieu & Badenhoop, 2005). In general, vitamin D has been shown to shift the immune balance towards anti-inflammatory regulator T-cells. The overall consequence of this regulation would be the protection of insulin β-cells from auto-destruction by the immune system and thus protect against the development of type 1 diabetes.

Vitamin D protects against the development of type 1 diabetes in mouse models of type 1 diabetes

Pharmacological treatment with 1α,25(OH)2D was shown to modulate the immune system and delay the onset of diabetes in animal models (Nejentsev et al., 2004; Zella, McCary, & DeLuca, 2003). Vitamin D deficiency in NOD mice, a model for type 1 diabetes, caused oral glucose intolerance and increased the incidence of developing diabetes (Giulietti et al., 2004). Interestingly, treatment with 1α,25(OH)2D reduces the incidence of both insulitis and diabetes in NOD mice (Mathieu et al., 1992; Mathieu, Waer, Laureys, Rutgeerts, & Bouillon, 1994). Indeed, 1α,25(OH)2D, or its analogs can achieve disease prevention when combined with a short course of an anti-T-cell immunosuppressant (e.g., cyclosporine A) (Casteels et al., 1998). Generally, it appeared that the maximum protection with 1α,25(OH)2D can be achieved before the onset of the disease, which means before the autoimmune destruction is initiated.

Moreover, treatment with 1α-OH-D, the precursor for 1α,25(OH)2D, has been shown to partially protect against the development of type 1 diabetes induced by streptozotocin in mice (Inaba et al., 1992). In another study, treatment of NOD mice with 1α,25(OH)2D protected the mice against the development of diabetes through inhibition of IL-12, blocking of pancreatic infiltration of Th1 cells, and enhancing the regulatory CD4+CD8+ cells (Gregori, Giarratana, Smiroldo, Uskokovic, & Adorini, 2002). Furthermore, vitamin D also has anti-apoptotic effects on β-cells (Gysemans et al., 2005; Riachy et al., 2001; Takeda et al., 2012).

A very recent study demonstrated that Vdr expression in the islet of Langerhans is modulated by glucose (Morró et al., 2020). Additionally, the Vdr expression was decreased in the islets isolated from both type 1 and type 2 diabetic mice (Morró et al., 2020). Remarkably, transgenic mice overexpressing Vdr were protected against the development of streptozotocin-induced type 1 diabetes (Morró et al., 2020).

41

Altogether, these data suggest that vitamin D might be a vital factor protecting against type 1 diabetes.

Vitamin D may protect against the development of type 1 diabetes in human

In humans, vitamin D supplementation during childhood may protect against type 1 diabetes in later life (EURODIAB Substudy 2 Study Group, 1999). In the Finnish birth cohort, it has been shown that the dietary vitamin D intake in children was associated with reduced risk of type 1 diabetes (Hyppönen, Läärä, Reunanen, Järvelin, & Virtanen, 2001). Additionally, children with suspected rickets had a higher risk of developing type 1 diabetes (Hyppönen et al., 2001).

In another study, the combination of vitamin D with metformin and sitagliptin improved the prognosis of a LADA (latent autoimmune diabetes in adults) patient with improved glycemic markers such as glucose levels and HbA1c (Rapti et al., 2016). The patient was able to maintain a very good blood glucose profile for two years (Rapti et al., 2016). Additionally, it has also been shown that the combination of 1-α-hydroxyvitamin D with insulin therapy helps in the preservation of the β-cell mass in a patient with LADA (Li X et al., 2009). In a recent clinical trial with two patients with type 1 diabetes, the combination of vitamin D supplementation and sitagliptin achieved a clinical remission for 4 years (Pinheiro, Pinheiro, & Torres, 2016; Pinheiro, Pinheiro, & Trabachin, 2018).

Altogether, vitamin D might be a promising factor modifying the risk for developing type 1 diabetes; however, further studies are needed to reveal the causality between lower vitamin D and the development of the disease.

2.4.2 Vitamin D and type 2 diabetes

Type 2 diabetes is a very heterogeneous and complex disease and is now one of the most epidemic diseases in the world. Type 2 diabetes is characterized by three main features that worsen the disease: 1) insulin resistance, which means the failure of the body to respond to insulin, 2) failure to produce insulin in response to glucose stimulus, 3) an increase in glucose synthesis, i.e., gluconeogenesis and secretion by the liver. Insulin resistance is considered the main driver for the disease, and it usually precedes the onset of the disease, a condition known as the prediabetic state. Interestingly, vitamin D has been shown to modify the major contributors to the

42

pathogenesis of type 2 diabetes, i.e., insulin resistance, systemic inflammation, and impaired pancreatic β-cell function (Matfin & Pratley, 2010).

Vitamin D deficiency is associated with the prevalence of type 2 diabetes

Several epidemiological studies have shown an association between vitamin D deficiency and the prevalence of type 2 diabetes; however, the causality has been not established (Pittas et al., 2007; SZEP et al., 2011). Curiously, the glycemic control in T2DM is worse in the winter, when lower vitamin D is also reported (Mitri et al., 2011). Additionally, an inverse association between 25(OH)D and glycemic control or type 2 diabetes was reported (Alkhatatbeh & Abdul-Razzak, 2018; Dalgård, Petersen, Weihe, & Grandjean, 2011; Husemoen et al., 2012). However, it was not consistent (Robinson et al., 2011).

Furthermore, in a large cross-sectional study from the National Health and Nutrition Examination Survey (NHANES), an inverse association was reported between serum 25(OH)D and the occurrence of diabetes in a dose-dependent manner in non-Hispanic whites and Mexican-Americans (Scragg, Sowers, & Bell, 2004). Additionally, the 25(OH)D levels were correlated with insulin resistance (Scragg et al., 2004). Moreover, an inverse association between vitamin D intake and serum 25(OH)D, and the prevalence of metabolic syndrome was reported (Lee et al., 2019).

Interestingly, there is some evidence that vitamin D supplementation could prevent the onset of diabetes (Li X, Liu, Zheng, Wang, & Zhang, 2018; Sentinelli et al., 2016; Sergeev, 2016). For example, people with higher vitamin D supplementation had a lower risk for the incidence of diabetes compared to lower intake (Pittas et al., 2007; Scragg et al., 2004). In contrast, in a very recent randomized, placebo-controlled trial, vitamin D supplementations in people with high risk for type 2 diabetes, did not significantly lower the risk of diabetes compared to Placebo (Pittas et al., 2019).

Thus, despite the strong association between low 25(OH)D levels and the prevalence of diabetes, the causality appears not to exist. Importantly, the current study proposes that vitamin D deficiency associated with diabetes is a consequence and not the cause of the disease.

43

Vitamin D deficiency is associated with the prevalence of obesity

Obesity is pandemic worldwide, with serious health consequences. Obesity is a chronic disease that reduces the quality of life and life expectancy (Kitahara et al., 2014). Several chronic metabolic diseases are also epidemic along with obesity, for instance, type 2 diabetes, dyslipidemia, and non-alcoholic fatty liver diseases. In general, the excess amount of the adipose tissue adversely affects almost all organs throughout the body, such as liver, heart, muscle, and pancreas.

A strong association between Vitamin D deficiency and obesity has been demonstrated in many epidemiological studies (De Souza Silva, Pereira, Saboya Sobrinho, & Ramalho, 2016; Harel, Flanagan, Forcier, & Harel, 2011; Kumar, Muntner, Kaskel, Hailpern, & Melamed, 2009; Oliveira et al., 2014; Pereira-Santos, Costa, Assis, Santos, C. a. S. T., & Santos, 2015; Smotkin-Tangorra et al., 2007; Turer, Lin, & Flores, 2013). Moreover, it has been shown that higher BMI might lead to lower 25(OH)D in the blood and not vice versa (Vimaleswaran et al., 2013). There are several explanations for that. For example, vitamin D is lipophilic and can be stored in the large fat depots (Rosenstreich, Rich, & Volwiler, 1971). Another explanation is the volumetric dilution because of the large body size in obesity (Drincic, Armas, Van Diest, & Heaney, 2012).

Vitamin D may retard the onset of weight gain by promoting energy expenditure through increasing fatty acid oxidation and mitochondrial metabolism (Marcotorchino et al., 2014). Interestingly, vitamin D has been shown to modulate adipocytes' lipid metabolism and adipogenesis; however, the effect varies between species and cell models (Abbas, 2017; Bouillon et al., 2014). Mice with the knockout of Cyp27b1 or Vdr are resistant to high-fat diet-induced obesity and display a lean phenotype with decreased fat mass (Narvaez, Matthews, Broun, Chan, & Welsh, 2009). This is likely because of increasing energy expenditure (Bouillon et al., 2014; Narvaez et al., 2009). However, in humans, lower vitamin D is associated with obesity. More studies are required to investigate the molecular links between energy homeostasis and vitamin D.

Vitamin D deficiency might lead to insulin resistance

The early phase of type 2 diabetes begins with insulin resistance, which means that the body is not responding to insulin appropriately. In epidemiological studies, there was an association between vitamin D and insulin sensitivity. For example, in one study, a significant positive association was found between the serum

44

25(OH)D and the insulin sensitivity index for the oral glucose tolerance test (OGTT) (Kayaniyil et al., 2011). In addition, there was a significant association between the serum 25(OH)D and the homeostasis model assessment for insulin resistance (HOMA-IR) (Kayaniyil et al., 2011). In another study, the 25(OH)D was a significant and independent predictor of both β-cell function and insulin sensitivity (Kayaniyil et al., 2010). Moreover, the VDR polymorphism has been associated with insulin resistance (Chiu, Chuang, & Yoon, 2001). On the other hand, some studies found no association between vitamin D deficiency and insulin action parameters (Gulseth et al., 2010).

Moreover, both VDR and CYP27B1 are expressed in both adipose tissues and skeletal muscles, which play major roles in glucose homeostasis (Nimitphong, Holick, Fried, & Lee, 2012; Srikuea, Zhang, Park-Sarge, & Esser, 2012). The peripheral insulin resistance mainly affects these two tissues leading to higher blood glucose in diabetes (Berridge, 2017). Altogether, this suggests that vitamin D might affect the glucose homeostasis through its effect on muscles and adipose tissue.

The molecular link between vitamin D deficiency and insulin resistance is not completely clear. However, there are several proposed mechanisms for how vitamin D deficiency could cause insulin resistance. For example, vitamin D deficiency may result in elevated intracellular calcium levels (Björklund, Lansner, & Grill, 2000), which leads to the deactivation of the insulin signaling, for example, through dephosphorylation of glycogen synthase and Glut4 (Björklund et al., 2000). Vitamin D deficiency causes excessive secretion of PTH, which in turn elevates intracellular calcium (Khundmiri, Murray, & Lederer, 2016). Moreover, sustained high intracellular calcium may lead to deactivation of the insulin target cells (Kang et al., 2017). Interestingly, it has been demonstrated that high intracellular calcium acts as a negative regulator of insulin signaling through inhibition of insulin-stimulated AKT phosphorylation (Kang et al., 2017). Furthermore, high intracellular calcium enhances the binding of calcium-binding protein, i.e., calmodulin, to the insulin receptor substrate 1 (IRS-1) (Li Z, Joyal, & Sacks, 2000). This binding interferes with insulin-stimulated tyrosine phosphorylation and PI3-kinase activation (Barsony & Marx, 1988; Edelman, Thil, Garabédian, Anagnostopoulos, & Balsan, 1983). Additionally, high intracellular calcium deactivates GLUT4, the major glucose transporter in muscle, and adipose tissue (Reusch, Begum, Sussman, & Draznin, 1991; Worrall & Olefsky, 2002).

Interestingly, in cultured myocytes, vitamin D treatment inhibits the insulin resistance caused by free-fatty acids and improves the glucose uptake in a dose-

45

dependent matter through reduction of JNK activation (Zhou QG et al., 2008). Moreover, it was thought that vitamin D might affect insulin resistance via the renin-angiotensin-aldosterone system (Griz, Bandeira, Gabbay, Dib, & Carvalho, 2014). Angiotensin II might inhibit insulin action in the vascular tissues and skeletal muscle and reduce glucose uptake (Sowers, 2004).

Vitamin D modifies the systemic inflammation

Inflammation is another main contributor to the pathogenesis of type 2 diabetes (Donath & Shoelson, 2011; Rehman & Akash, 2016). Inflammatory factors might contribute to insulin resistance or β-cell dysfunction (Donath & Shoelson, 2011; Rehman & Akash, 2016). It has been shown that many alterations in several inflammatory markers, such as tumor necrosis factor TNF and lymphotoxin A (LTA), are associated with the disease (Donath & Shoelson, 2011; Rehman & Akash, 2016). Interestingly, adipokines, such as TNF, IL-6, and adiponectin, have been proposed to be mediators between obesity and diabetes (Ozfirat & Chowdhury, 2010; Pearce & Cheetham, 2010). Other inflammatory markers, i.e., IL-6, CRP, and PAI-1, have been observed several years before the onset of type 2 diabetes (Donath & Shoelson, 2011; Rehman & Akash, 2016). Importantly, vitamin D has been reported to modify this systemic inflammation through the reduction of the production of several inflammatory markers such as IL-2, IL-6, and IL-12, INFγ, TNF, and LTA (Ozfirat & Chowdhury, 2010; Pearce & Cheetham, 2010). Altogether, vitamin D might be a promising factor to reduce the systemic inflammation preceding the onset of diabetes.

The role of vitamin D in the regulation of insulin secretion

There are several observations suggesting that vitamin D might play a role in insulin homeostasis, for example, the presence of VDR and 1α-hydroxylase in the pancreatic β-cells (Bland et al., 2004; Johnson, Grande, Roche, & Kumar, 1994). Moreover, a VDR response element has been found in the promoter of the human insulin gene (Maestro, Dávila, Carranza, & Calle, 2003). Interestingly, 1α,25(OH)2D has been shown to directly stimulate the transcription of the human insulin gene receptor (Maestro, Molero, Bajo, Dávila, & Calle, 2002).

In vitamin D deficient animals, insulin secretion is reduced and can be normalized by vitamin D supplementation (Norman, Frankel, Heldt, & Grodsky, 1980; Nyomba et al., 1986). A Vdr mutation in mice disrupted vitamin D signaling

46

and impaired insulin secretion accompanied by glucose intolerance (Zeitz et al., 2003). This phenomenon was explained by a reduction in the insulin gene expression and impaired insulin secretion (Zeitz et al., 2003). Furthermore, 1α,25(OH)2D has been shown to increase insulin synthesis in rat pancreatic islet cells (Bischoff et al., 2001). Of note, the mouse genetic background has been shown to be crucial, since Vdr-/- in a different background showed normal insulin homeostasis (Mathieu et al., 2001). Vitamin D may enhance insulin secretion and sensitivity through its effect on intracellular calcium (Alvarez & Ashraf, 2010). However, the mechanism is poorly understood and requires further investigation.

2.5 Liver as a key player in the body’s energy metabolism

The liver is a central player in regulating the body’s energy homeostasis (Chiang, 2014). The liver acts as a metabolic hub to connect several tissues, including adipose and skeletal tissues.

Postprandial, digested food in the form of glucose, fatty acids, and amino acids are absorbed in the gastrointestinal tract (GI) and transported in the blood stream to the liver through the hepatic portal vein. Glucose is either further metabolized to produce energy, or polymerized in the form of glycogen, and/or converted into amino acids and fatty acids in the liver. Fatty acids are usually stored in the form of triacylglyceride (TAG) after esterification with glycerol-3-phosphate. In turn, TAG is secreted into the circulation in the form of very-low-density lipoprotein (VLDL). Amino acids are usually used to synthesize new proteins. Additionally, amino acids can be further metabolized to produce energy or used to synthesize other biomolecules such as glucose.

On the other hand, during fasting, the balance is shifted toward catabolic reactions to sustain the energy supply to the liver and other organs. The liver is a major supplier of energy fuel in the form of glucose and TAG, which are secreted into the blood and go to the brain, skeletal muscles, and other organs. Adipose tissue also plays a key role during fasting by releasing non-esterified fatty acids (NEFAS) and glycerol via lipolysis. Moreover, muscles degrade the glycogen and protein and release alanine and lactate, which are transported to the liver to be further converted into glucose via the gluconeogenesis pathway. Additionally, liver also metabolizes the NEFAs and generates ketone bodies, which are then released to the circulation and used as energy fuel during starvation periods (Chiang, 2014).

The energy metabolism in the liver is tightly controlled by multiple hormonal, nutritional, energy, and neuronal signals (Chiang, 2014). Dysregulation of the

47

hepatic energy metabolism is involved in the development of several pathologies such as non-alcoholic liver diseases and type 2 diabetes. There are several factors in the liver that sense the nutritional status and energy homeostasis and subsequently regulate critical cell functions. Among these factors, the peroxisome proliferator-activated receptor-gamma (PPARγ) coactivator 1 alpha (PGC-1α) and the glucocorticoid receptor (GR) play a key role.

2.5.1 PGC-1α as a key energy sensor in the liver

PGC-1α is a transcriptional coactivator and a member of the PGC-1 coactivator family (Puigserver et al., 1998). PGC-1α is a crucial player in regulating cellular energy metabolism, including the metabolism of carbohydrates, fatty acids, and oxidative metabolism in various cell types. PGC-1α was originally discovered as a coactivator of PPARγ, which regulates the thermogenesis in brown adipose tissue (BAT) (Puigserver et al., 1998). It is highly expressed in the high-energy tissues such as muscles, brown adipose tissue, and heart (Esterbauer, Oberkofler, Krempler, & Patsch, 1999). Furthermore, PGC-1α has been shown to be a master regulator of mitochondrial biogenesis, respiration, and reactive oxygen species (ROS) compensation mechanisms (Liu & Lin, 2011).

PGC-1α does not possess the ability to bind directly to DNA; instead, it activates nuclear receptors and other transcription factors, which in turn can bind with the promoter sequences of the target genes (Fig. 7). There are several nuclear receptors which can be activated by PGC-1α, for example, the hepatocyte nuclear factor 4α (HNF-4 α) (Yoon et al., 2001), estrogen-related receptor alpha (ERRα), PPARγ (Puigserver et al., 1998), liver X receptor (LXR) (Oberkofler, Schraml, Krempler, & Patsch, 2003), and PXR (Bhalla, Ozalp, Fang, Xiang, & Kemper, 2004).

Under normal circumstances, PGC-1α expression in the liver may be low to moderate (Puigserver et al., 1998). However, during fasting and uncontrolled diabetes, PGC-1α is highly induced in the liver (Yoon et al., 2001). PGC-1α is a crucial player in the regulation of glucose homeostasis in the liver. PGC-1α can activate the glucose synthesis pathway, i.e., hepatic gluconeogenesis, by inducing the expression of the rate-limiting enzymes, i.e., phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G6Pase) (Yoon et al., 2001).

The dysregulation, genetic mutations, and polymorphisms of PGC-1α have been associated with the onset of glucose impairment and type 2 diabetes (Ek et al., 2001; Hara et al., 2002; Oberkofler et al., 2003). Moreover, there is a considerable

48

amount of data suggesting the involvement of PGC-1α in the pathology of the disease. In the whole body Pgc-1α knockout in mouse, the isolated primary hepatocytes did not respond to the hormonal stimulation of gluconeogenesis, as expected. Indeed, the expression of the two limiting enzymes, i.e., Pepck and G6pase, were significantly lower than in wild type hepatocytes. Furthermore, the liver-specific Pgc-1α knockout mouse model repressed the constitutive activity of the gluconeogenic genes in response to fasting, which clearly established the key role of PGC-1α in regulating hepatic glucose synthesis (Handschin et al., 2005).

ERRα belongs to the orphan family of the ERR family (Xia, Dufour, & Giguère, 2019). ERRs are key players in energy homeostasis (Xia et al., 2019). The ERRs regulate gene expression through binding to a specific DNA sequence, i.e., TCAAGGTCA in promoters of target genes (Sladek, Bader, & Giguère, 1997). To date, no natural ligand has been identified to activate ERRα. It has been shown that the activity of those nuclear receptors depends on the interaction with other cofactors (Xia et al., 2019). PGC-1α is known to be a crucial coactivator for ERRα (Gaillard et al., 2006; Schreiber et al., 2004).

Like PGC-1α, ERRα is ubiquitously expressed in metabolically active tissues, for example, heart, liver, kidney, and brown adipose tissue. The PGC-1α-ERRα pathway regulates the expression of genes involved in mitochondrial biogenesis, fatty acid oxidation, TCA cycle, and oxidative phosphorylation (Fig. 7) (Gaillard et al., 2006; Schreiber et al., 2004).

49

Fig. 7. ERRα, through interaction with transcriptional coactivator PGC-1α, regulates several pathways in the liver. Part of the Fig. was drawn with the help of Servier Medical Art (www.servier.com).

2.5.2 GR pathway in the regulation of hepatic energy metabolism.

GR is a nuclear receptor regulating diverse biological actions through activation by cortisol (Oakley & Cidlowski, 2013). Glucocorticoids are steroid hormones secreted from the adrenal gland to maintain basal and stress-related homeostasis (Gensler, 2013). Indeed, they have a profound effect on many physiological functions (Oakley & Cidlowski, 2013). Pharmacological doses of glucocorticoids are usually used as a potent immunosuppressant for treating several diseases, including inflammatory, autoimmune, and lympho-proliferative diseases (Oakley & Cidlowski, 2013).

It is estimated that about 3-10% of the human genome is regulated directly or indirectly by GR, which is ubiquitously expressed in most if not all tissues and organs (Kino, 2000). The unliganded GR is predominantly located in the cytoplasm in a large multiprotein complex. Upon activation by binding by glucocorticoids, the GR shuttles into the nucleus and regulates the expression of target genes by binding to the glucocorticoid response elements (GRE), which are composed of inverted hexameric palindromes separated by three nucleotide pairs (PuGNACANNNTGTNCPy) (Kino, 2000).

50

GR in the liver has a crucial role in regulating glycogen metabolism and gluconeogenesis (Whirledge & DeFranco, 2017). Liver-specific Gr KO in mice caused a dramatic reduction in body size (Tronche et al., 2004). Moreover, mice with liver-specific Gr KO showed normal glucose levels under normal conditions; however, they developed severe hypoglycemia upon prolonged fasting (Opherk et al., 2004). In another model of liver-specific Gr KO, mice showed increased insulin sensitivity and a reduced capacity for glycogen storage compared to the wildtype controls (Bose, Hutson, & Harris, 2016). Additionally, the GR in the liver was shown to be necessary for hepatocyte proliferation during hepatic regeneration (Shteyer, Liao, Muglia, Hruz, & Rudnick, 2004).

51

3 Aims of the present study The major objective of the study was to uncover the cross-talk between the metabolic state and vitamin D metabolism. Vitamin D deficiency has been consistently identified in diabetic patients at the time of diagnosis; however, the molecular mechanism(s) behind this is still unknown. Thus, it is utterly vital to uncover the molecular mechanism(s) behind the vitamin D deficiency in diabetics. Indeed, maintaining a healthy level of vitamin D is considered to be a vital factor in attenuating the disease and improving the quality of life of diabetic patients. Furthermore, this could help to develop novel therapies that could be used to maintain a healthy level of vitamin D and improve the treatment of diabetes.

The broad hypothesis of this thesis is that the metabolic state regulates vitamin D bioactivation and, consequently, the vitamin D status in the blood.

Specifically, the aims of the study were

1. To study how the metabolic state in the case of fasting, type 1 diabetes, obesity, and type 2 diabetes affects the expression of Cyp2r1 and vitamin D bioactivation in the liver.

2. To study how human obesity and weight loss affect vitamin D metabolism in the white adipose tissue (WAT).

3. To elucidate the molecular mechanism involved in the fasting and diabetes mediated repression of Cyp2r1 in the liver and extrahepatic tissue, i.e., kidney.

4. To elucidate the molecular mechanism involved in the fasting mediated induction of Cyp24a1 in the kidney.

52

53

4 Materials and Methods

4.1 Sketch of the study design

Fig. 8. Part 1 of the study. To investigate the effect of the metabolic state on vitamin D metabolism, rodent (mice and rats) model of fasting, mouse models of type 1, obesity, and type 2 diabetes were utilized. Furthermore, to study the effect of human obesity, adipose tissue samples were taken from female obese subjects before and after the gastric bypass surgery.

54

Fig. 9. Part 2 of the study. To investigate molecular mechanisms involved in the regulation of vitamin D metabolism, in vivo mouse models and in vitro cellular experiments were utilized.

4.2 Reagents and materials

Chemicals: All chemicals were purchased from Sigma-Aldrich. Animal diets: Regular chow and High-fat diet (Envigo TD.06414, 60% of

calories from fat) were purchased from Envigo Teklad Diets, USA. Cell culture work: Dulbecco´s modified Eagle medium (DMEM), Penicillin-

streptomycin antibiotics, fetal bovine serum (FBS), Trypsin, phosphate-buffered saline (PBS), and cell culture plates were purchased from Gibco, Life technologies. For the mouse primary hepatocytes, William´s E medium was purchased from Sigma-Aldrich. FuGENE® HD Transfection Reagent (E2311) and Dual-Glo(R) Luciferase Assay System (E2940) were purchased from Promega (Madison, WI, USA).

qPCR: All qPCR primers were purchased from Sigma-Aldrich. Taqman gene expression assays were purchased from Applied Biosystems, Life Technologies (Carlsbad, CA, USA).

55

Western blot: Antibodies: Rabbit polyclonal CYP2R1 antibody (#T2849) was purchased from Epitomics (Burlingame, CA, USA). Rabbit polyclonal CYP2R1 antibody (Center, SAB1300955), and mouse monoclonal β-actin antibody (A1978) were purchased from Sigma-Aldrich. Rabbit polyclonal CYP24A1 antibody (H-87, sc-66851), and Goat anti-rabbit IgG-HRP were purchased from Santa-Cruz Biotechnology (Santa Cruz, CA, USA). Anti-mouse IgG-HRP was purchased from GE Healthcare (Little Chalfont, UK). Amersham ECL Prime Blocking Reagent (RPN418) and Amersham ECL start Western Blotting Detection Reagent were purchased from GE Healthcare, UK.

Further detailed information about all chemicals and reagents used throughout the study can be found in the original publications.

4.3 Animal experiments

All the animal experiments were approved by the national or local animal welfare agencies. Throughout the study, C57BL/6 mice were used, except the 12 and 24 h experiments in the original publication (I) were conducted using DBA/2 male mice. Sprague-Dawley rats aged 8-12 weeks were either fed or fasted for 24 h (I); wildtype male mice or PGC-1α KO mice aged 3-4 months were used in the fasting experiment. All mice were male in the publication (I), while in the publication (II), male and female mice were used. For all animal studies done at the University of Oulu, animals were obtained from the Laboratory Animal Center (KEKS), University of Oulu, Oulu, Finland.

4.4 Human study

Samples from the subcutaneous adipose tissue were taken from four morbidly obese female patients who underwent the Roux-en-Y gastric bypass (RYGB) surgery. The samples were collected before and 11-19 months after the surgery and analyzed after obtaining informed consent from all the patients. The study was approved by the Ethics Committee of the Northern Ostrobothnia District (decision number 265/2016).

56

4.5 Cell cultures

4.5.1 Mouse primary hepatocytes

Mouse primary hepatocytes were prepared by a two-step collagenase liver perfusion protocol as described previously (Salonpää et al., 1994). Briefly, after perfusion, the cells were filtered and centrifuged at 400 rpm for 4 minutes, after which the cells were counted using a hemocytometer and cultured in William`s E medium containing (10% FBS, 1% penicillin-streptomycin antibiotics, 2 g/L D-glucose and ITS (insulin 5 mg/L, transferrin 5 mg/L, sodium selenite 5 µg/L). In the experiments, cells were usually cultured into 6-well plates in the same medium but serum-free.

4.5.2 Continuous cell lines

HepG2 cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were cultured in DMEM medium (4.5 g/L glucose) containing 10% FBS and 1% penicillin-streptomycin. The QBI-239A (derivative of HEK-239A) cells were used for viral amplification and were obtained from Qbiogene Inc. (Carlsbad, CA, USA).

4.6 Adenoviral treatment

PGC-1α wildtype and mutant viruses, i.e., PGC-1α-2X9-Ad and PGC-1α-L2L3-Ad, were prepared in our lab as described (Arpiainen et al., 2008). All adenoviruses were amplified in QBI-239A cells (Q-Biogen). The cells were collected by centrifugation, usually 48 h after infection. The viral particles were then released from cells by thawing and freezing cycles (3X). The viral particles were then purified by density gradient ultracentrifugation using iodixanol (Optiprep, Axis-Shield PoC AS, Oslo, Norway). All other adenoviruses for overexpression or knockdown genes of interest were purchased from Vector Biolabs, Malvern, PA, USA.

57

4.7 Analysis of gene expression

4.7.1 mRNA analysis

Total RNAs were extracted with the cesium chloride (CsCl) centrifugation method (Chirgwin, Przybyla, MacDonald, & Rutter, 1979) or TRI Reagent or RNAzol reagent (Sigma-Aldrich) according to the manufacturer’s protocol. One µg of RNA was reverse transcribed to produce cDNA using p(dN)6 random primers (Roche Diagnostics, Mannheim, Germany) and M-MLV reverse transcriptase (Promega, Madison, WI, USA) or RevertAid reverse transcriptase (Thermo Fisher Scientific, Waltham, MA, USA).

Gene expression was quantified by real time-quantitative PCR by using either SYBR Green chemistry or TaqMan chemistry (Applied Biosystems, Foster City, CA). The sequences for the primers and TaqMan probe sets used can be found in Table 3. The qPCR reactions were performed on an ABI7300 or QuantStudio qPCR system from Thermo Fisher Scientific. The resulting fluorescence values of the qPCR products were corrected by the fluorescence signals of the passive reference dye (ROX). The expression levels of genes of interest were normalized against 18S, GAPDH, or TBP control levels using the comparative CT (ΔΔCT) method.

Table 3. Sequences of the qPCR primers

Gene Forward (5’-3’) Reverse (5’- 3’) Pgc-1α GCAGGTCGAACGAAACTGAC CTCAGCCTGGGAACACGTTA TCCTCCTCATAAAGCCAACC GCCTTGGGTACCAGAACACT AGCCGTGACCACTGACAACGAG GCTGCATGGTTCTGAGTGCTAAG Errα ATCTGCTGGTGGTTGAACCTG AGAAGCCTGGGATGCTCTTG Atp5b GGTTCATCCTGCCAGAGACTA AATCCCTCATCGAACTGGACG Cycs CCAAATCTCCACGGTCTGTTC ATCAGGGTATCCTCTCCCCAG Cyp2r1 AAACTACAACCAATGTGCTCCG CTTCCCAAGAAGGCCTCCTGT

Pgc-1β CTCCAGGCAGGTTCAACCC GGGCCAGAAGTTCCCTTAGG

Gr (Nr3c1) AGCTCCCCCTGGTAGAGAC GGTGAAGACGCAGAAACCTTG

Tat TGCTGGATGTTCGCGTCAATA CGGCTTCACCTTCATGTTGTC

Nr1d1 TCCCCAAGAGAGAGAAGCAA CTGAGAGAAGCCCACCAAAG Cyp27b1 TCCTGGCTGAACTCTTCTGC GGCAACGTAAACTGTGCGAA

Cyp24a1 CTGCCCCATTGACAAAAGGC CTCACCGTCGGTCATCAGC Vdr GAATGTGCCTCGGATCTGTGG GGTCATAGCGTTGAAGTGGAA Pparγ CTCCAAGAATACCAAAGTGCGA CCTGATGCTTTATCCCCACA Acaca CTTCCTGACAAACGAGTCTGG CTGCCGAAACATCTCTGGGA

58

Gene Forward (5’-3’) Reverse (5’- 3’) Ucp1 CCATCTGCATGGGATCA GTCGTCCCTTTCCAAAGTG Ucp2 ATGGTTGGTTTCAAGGCCACA CGGTATCCAGAGGGAAAGTGAT Vdbp CCTGCTGGCCTTAGCCTTT TGCTCAAATGTGCTACTGGAAA Pepck GGTGTTTACTGGGAAGGCATC CAATAATGGGGCACTGGCTG 18S rRNA CGCCGCTAGAGGTGAAATTC CCAGTCGGCATCGTTTATGG Tbp GAATATAATCCCAAGCGATTTG CACACCATTTTTCCAGAACTG Gapdh GGTCATCATCTCCGCCCC TTCTCGTGGTTCACACCCATC CYP2R1 GCCTCAGCTACCTCAGCATTT CCATGAAAAGAATCGCCCACC CYP27B1 TCCATCCTGGGAAATGTGACA ACAGGGTACAGTCTTAGCACTT CYP24A1 GATTTTCCGCATGAAGTTGGGT CCTTCCACGGTTTGATCTCCA VDR CCTTCAGGGATGGAGGCAAT GCAGCCTTCACAGGTCATAGC PPARG CCACTATGGAGTTCATGCTTGTG

AAGG TGCAGCGGGGTGATGTGTTTGAACTTG

ACACA AGTGGGTCACCCCATTGTT TTCTAACAGGAGCTGGAGCC UCP1 AGGATCGGCCTCTACGACAC GCCCAATGAATACTGCCACTC UCP2 CCCCGAAGCCTCTACAATGG CTGAGCTTGGAATCGGACCTT GAPDH GAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG TBP CCCGAAACGCCGAATATAAT ATCAGTGCCGTGGTTCGT

4.7.2 Protein analysis

The Western blot technique was used throughout the study to quantify the levels of the proteins of interest. For the CYP2R1 western blots, the microsomal fraction from liver or kidney tissues were extracted by differential centrifugation (Raunio et al., 1990). For CYP24A1 Western blots, total proteins were extracted from kidneys as described previously (Lämsä et al., 2010).

After protein extraction, the concentrations were measured using the Bradford reagent (Bio-Rad, Hercules, CA, USA). The protein samples (10 – 50 µg) were subjected to SDS-PAGE electrophoresis (10-12%), after which the protein was transferred to either polyvinylidene fluoride (PVDF) or nitrocellulose using a semi-dry device (Bio-Rad). The membranes were blocked using 5% skimmed milk or Amersham ECL Prime Blocking Reagent in Tris-buffered saline. Membranes were then treated with the antibodies against the protein of interest (primary antibodies) usually overnight, followed by the HRP-conjugated secondary antibody incubation for 1 h. The membranes were then treated with the chemiluminescent reagent, and bands were visualized using Odyssey Fc (LI-COR Biosciences GmbH, Germany) and quantified by Image Studio software (LI-COR Biosciences GmbH, Germany).

59

The quantity of the protein of interest was normalized against β-actin protein intensity.

4.8 The microsomal vitamin D 25-hydroxylase activity measurements

The microsomal fraction from the mouse liver tissue was prepared as described above. 0.5 mg/ml microsomes were incubated with 2 µM vitamin D3, followed by induction of the reaction by adding 0.5 mM NADPH and incubation with shaking for 40 minutes at 37 ℃. To stop the reaction, ice-cold acetonitrile was added (1:1 ratio). The produced 25(OH)D was quantified using reverse-phase liquid chromatography (Waters Acquity UPLC instrument, Milford, MA, USA) combined with mass spectrometric detection (Waters XEVO T-QS triple quadrupole mass spectrometer, Milford MA, USA).

4.9 Measurement of the plasma levels of the 25-hydroxyvitamin D

25(OH)D in the mouse EDTA-plasma was measured using a Vitamin Ds EIA kit (Immunodiagnostic system, Tyne & Wear, UK) either by the ValiFinn company (Oulu, Finland) (I) or by us (II) according to the manufacturer’s protocol.

4.10 Bioinformatic analysis

4 kb upstream from the transcriptional start site of the mouse Cyp2r1 gene were scanned for ERRα binding sites using MatInspector software, Genomatix. According to the analysis, one potential ERRα binding site was identified in the proximal part. The published chromatin immunoprecipitation sequencing (ChIP-seq) were retrieved and analyzed by using the Cistrome database and visualized using the University of California, Santa Cruz (UCSC) genome browser.

4.11 Statistical analysis

The statistical data analysis was performed using GraphPad Prism software (La Jolla, CA, USA). The comparison of means of two groups was performed using the Student’s two-tailed t-test, whereas multiple groups were compared by one-way ANOVA followed by Tukey’s post hoc test. The paired t-test was used to compare

60

CYP2R1 expression before and after gastric bypass surgery. Differences were considered significant at P < 0.05.

61

5 Results and Discussion In this chapter, the key findings are presented, and the full results are presented and discussed in the original publications. Furthermore, some additional unpublished data are presented.

5.1 Vitamin D metabolism is under strict control by the metabolic state in mice and human

There are several observations supporting cross-talk between energy metabolism and vitamin D metabolism. For example, vitamin D deficiency, namely lower 25(OH)D, is consistently associated with the prevalence of diabetes; however, a causal link is still uncertain (Pittas et al., 2007; Scragg et al., 2004). Moreover, low 25(OH)D is consistently observed in obese subjects in epidemiological studies (Censani et al., 2013; Samuel & Borrell, 2014; Stein et al., 2009).

Therefore, in the present study, we aimed to study how the metabolic state affects vitamin D metabolism by utilizing mouse models of fasting, type 1 diabetes, obesity, and type 2 diabetes. To extend our study to humans, we also studied how obesity and weight loss induced by gastric bypass surgery affect the vitamin D metabolism in adipose tissue samples taken before and after the surgery. Herein are the main results.

5.1.1 Fasting represses the vitamin D bioactivation in the liver and induces the catabolism in the kidney (I)

We observed that Cyp2r1 was repressed significantly at mRNA and protein levels in the liver during fasting (I, Fig. 1A, C). Consistent with the mRNA and protein levels, fasting significantly reduces the liver microsomal vitamin D 25-hydroxylase activity (I, Fig. 1D). Interestingly, refeeding of the mice after 24 h fasting with high sucrose (60% calories) for 16 h normalized the Cyp2r1 expression in the liver (Fig. 10). Altogether, this indicates that the Cyp2r1 expression in the liver is sensitive to the nutritional status.

Although it was clear that fasting suppresses the vitamin D bioactivation at all levels, namely mRNA, protein, and functional levels, fasting did not affect the plasma 25(OH)D levels (I, Supplementary Fig. 1B). This is likely because of the long half-life of the 25(OH)D, about 2 weeks (Jones KS et al., 2014). Therefore, short term fasting is unlikely to have a systemic effect on vitamin D levels. Similar

62

to mice, fasting repressed the Cyp2r1 in the liver of rats compared to fed controls (I, Fig. 1E).

Fig. 10. Refeeding the mice after 24 h fasting normalizes the Cyp2r1 expression in the liver. Fasting and refeeding experiments have been described in (Chambers et al., 2012). n= 4 mice/group. The box-and-whisker plots indicate the minimum, the 25th percentile, the median, the 75th percentile, and the maximum. In addition, the mean is indicated with +. Data were analyzed with the Student t-test. The Cyp2r1 mRNA was normalized against the reference 18S rRNA.

On the other hand, we observed induction of Cyp24a1, the leading vitamin D catabolic enzyme, in the kidney during fasting (I, Fig. 5A). This agreed with a previous report (Hagenfeldt-Pernow, Ohyama, Sudjana-Sugiaman, Okuda, & Björkhem, 1994). CYP24A1 inactivates both 25(OH)D and 1α,25(OH)2D. Therefore, the induction of Cyp24a1 would limit the amount of both 25(OH)D and 1α,25(OH)2D, and, consequently, limit the activation of the vitamin D receptor (Christakos et al., 2016).

Altogether, these data showed that Cyp2r1 expression and vitamin D bioactivation in the liver and Cyp24a1 expression and vitamin D catabolism are under strict control by the nutritional and metabolic status. Furthermore, repression of Cyp2r1 in the liver and induction of Cyp24a1 in the kidney would suppress

63

vitamin D signaling in a synergistic way. The physiological consequence(s) are currently unknown and warrant future studies.

Vitamin D has been shown to be a potential regulator of energy homeostasis (Bouillon et al., 2014). Thus, the suppression of vitamin D bioactivation by fasting might be a possible adjustment mechanism the animal body uses to prepare for a longer starvation-period and could have been of evolutionary benefit during periods of prolonged starvation.

The majority of vitamin D functions are mediated through binding to the cognate receptor VDR. Moreover, 25(OH)D, to a lesser extent, can bind and activate the VDR in the VDR target tissues. However, the liver is known not to be a VDR target tissue. Consistent with this view, VDR was not detected in the mouse liver. Thus, the intrahepatic 25(OH)D may have unknown physiological functions independent of the classical VDR signaling.

During the fed period, hepatic 25(OH)D might interact with other nutritional and metabolic sensors to adapt the liver physiology. Consistent with this idea, a recent study demonstrated that 25(OH)D inhibits the activation of SREBP by inhibition of the SREBP partner SCAP (Asano et al., 2017). SREBPs are transcription factors that are key regulators of lipid homeostasis by inducing the expression of lipogenic genes (Shimano & Sato, 2017). The liver is the major expression target of SREBPs, and they are key players during the fed response (Shimano & Sato, 2017). In this study, all work was done in the CHO-K1 (Chinese hamster ovary) cell line. Therefore, it still needs to be confirmed in hepatocytes and in the liver in vivo. Altogether, this suggests that the intrahepatic 25(OH)D might regulate lipid homeostasis in the liver.

5.1.2 Fasting regulates vitamin D metabolism in extrahepatic tissues

Interestingly, we observed that fasting not only represses Cyp2r1 in the liver but also in extrahepatic tissues. Fasting repressed Cyp2r1 in the kidney, visceral-gonadal-WAT (WATvc), and BAT by 23%, 57%, and 53%, respectively, compared to fed control mice (II, Fig. 6A) (Fig. 11A, B). Moreover, fasting had no effect on the expression of the sole vitamin D 1α-hydroxylase Cyp27b1 in the kidney (Fig. 12). Cyp27b1 was not detected in WATvc and BAT.

To further study the effect of fasting on vitamin D biology, we analyzed the effect of fasting on the expression of Vdr in the kidney, WATvc, and BAT. Kidney, WAT, and BAT are well-known VDR target tissues, and Vdr was abundant in these tissues. Interestingly, fasting significantly and consistently induced Vdr in kidney

64

and BAT up to 1.5-fold, 1.9-fold, respectively (Fig. 13A, B). In the WATvc, the Vdr was induced on average up to 1.7-fold but did not reach statistical significance (Fig. 13C).

We also investigated the effect of fasting on the Cyp24a1, which is a well-known VDR target gene. Cyp24a1 mRNA was abundant in the kidney but could not be reliably detected in either BAT or WATvc. As mentioned in chapter 5.1.1, Cyp24a1 was induced by fasting in the kidney (I, Fig. 5A).

Fig. 11. Fasting significantly repressed the Cyp2r1 in visceral white and brown adipose tissues. n= 8 mice/group. Note, both fed and fasted mice were part of other experiments and were injected with vehicle (Corn oil plus DMSO) two times i.p. (12 h interval) before starting the fasting period. The box-and-whisker plots indicate the minimum, the 25th percentile, the median, the 75th percentile, and the maximum. In addition, the mean is indicated with +. All data were analyzed with the two-tailed t-test. The Cyp2r1 mRNA was normalized against three references, i.e., 18S rRNA, Tbp, and Gapdh.

Since fasting represses Cyp2r1 in the kidney, BAT, and WATvc, this could limit the local 25(OH)D levels and VDR activity. However, surprisingly, the Vdr was induced in the three tissues. Therefore, the interpretation of these results in the context of the classical vitamin D system is difficult. It is still possible the VDR activity might depend mainly on the systematic supply of 25(OH)D. Moreover, 25(OH)D may have some unknown local function independent of the classical VDR action. Further studies are needed to clarify the physiological functions of this phenomenon.

65

5.1.3 Metabolic disturbances, i.e., type 1 diabetes, obesity and type 2 diabetes repress the Cyp2r1 and vitamin D bioactivation in the liver and reduce the plasma 25(OH)D levels (I-II)

Suppression of vitamin D bioactivation in the liver by fasting activated mechanisms has important implications in the context of metabolic diseases in humans. Molecular pathways activated physiologically during fasting in the liver are abnormally hyperactivated in diabetes (Wu et al., 2016). The classical consequence is an increase in glucose synthesis in the liver, namely gluconeogenesis, causing fasting hyperglycemia.

To investigate the effect of diabetes on vitamin D bioactivation in the liver, we utilized mouse models of high-fat diet-induced obesity and streptozotocin-induced type 1 diabetes. The mouse model of HFD-induced obesity is usually used to study the effect of obesity, insulin resistance, and type 2 diabetes. The diet-induced obesity model was developed by feeding the mice with the HFD for 16 weeks. The mouse model of type 1 diabetes was developed by injecting streptozotocin (STZ) intraperitoneally (i.p.) (60 mg/kg) once daily for 5 consecutive days. The mice were kept without any further treatment for a total period of 13 weeks. Streptozotocin chemically resembles 2-deoxy-D-glucose but with an N-methyl-N-nitrosourea side-chain group. STZ accumulates preferentially in the β-cells through the glucose transporter 2 (GLUT2) and causes β-cell cytotoxicity and finally causes severe insulin deficiency and type 1 diabetes (Goyal et al., 2016). The STZ induced type 1 diabetes model is the most common model for human type 1 diabetes since the pathological alterations observed in STZ-induced diabetes resemble those alterations observed in human type 1 diabetes (Goyal et al., 2016).

The HFD induced obesity reduced the plasma 25(OH)D levels significantly in both male and female mice compared to chow controls (I, Fig. 1G) (II, Fig. 3A). Consistent with that, Cyp2r1 expression was suppressed significantly at the mRNA and protein levels by HFD feeding (I, Fig. 1F) (II, Fig. 3B). This was in agreement with recent studies as well (Roizen et al., 2019). Interestingly, the HFD had no effect on the expression of Vdbp, which is a crucial determinant of the vitamin D levels in the plasma (II, Fig. 3D). Thus, VDBP had no role in the observed reduction in the plasma 25(OH)D levels.

In addition to obesity, type 1 diabetes induced by STZ repressed Cyp2r1 at mRNA and protein levels (I, Fig. 1H, I). It was not possible to investigate the effect of STZ induced diabetes on plasma 25(OH)D because of the limited amount of plasma.

66

Fig. 12. Fasting did not affect the Cyp27b1 expression in the mouse kidney. n= 8 mice/group. Note, both fed and fasted mice were part of other experiments and were injected with vehicle (Corn oil plus DMSO) two times, i.p. (12 h interval) before starting the fasting period. Data were analyzed with the Student t-test. The Cyp27b1 mRNA was normalized against three references, i.e., 18S rRNA, Tbp, and Gapdh.

Fig. 13. Fasting induces the expression of Vdr in the kidney, BAT, and WATvc. n= 8 mice/group. Note, both fed and fasted mice were part of other experiments and were injected with vehicle (Corn oil plus DMSO) two times, i.p. (12 h interval) before starting the fasting period. All data were analyzed with the two-tailed t-test. The Vdr mRNA was normalized against three references, i.e., 18S rRNA, Tbp, and Gapdh.

As discussed earlier, low 25(OH)D, namely vitamin D deficiency, is quite prevalent in type 1, obesity, and type 2 diabetes; however, the molecular explanations are not

67

known. So far, there are several explanations for the observed low plasma 25(OH)D in obese subjects. For example, trapping of vitamin D in the large adipose tissue because of its hydrophobicity would reduce the available vitamin D for further hydroxylation by the liver and the kidney (Wortsman, Matsuoka, Chen, Lu, & Holick, 2000). Moreover, volumetric dilution of vitamin D into the large body size in obese subjects has been recently proposed to be a key cause of lower plasma 25(OH)D levels (Drincic et al., 2012). Regarding type 1 diabetes, the causes of lower vitamin D levels are not unknown, but they are probably related to genetic, dietary, and environmental factors (Knip et al., 2010; Rewers & Ludvigsson, 2016).

The current study adds a novel cause for the observed low plasma 25(OH)D levels by suppression of Cyp2r1 function at the transcriptional level in the liver. This might have a practical implication for correcting the poor vitamin D status in obese or diabetic patients (Bassatne, Chakhtoura, Saad, & Fuleihan, 2019; Quesada-Gomez & Bouillon, 2018). Therefore, our study raises the question about the current guidelines for vitamin D supplementation in metabolically ill patients. Those patients are likely in need of a higher dose of vitamin D supplementation to overcome the suppression of the vitamin D 25-hydroxylation. Furthermore, supplementation with 25(OH)D might be a good way to restore vitamin D functions in diabetic patients (Quesada-Gomez & Bouillon, 2018). Whether current diabetic therapies restore vitamin D bioactivation is another important question that remains to be answered. Future studies are required to address these questions.

5.1.4 Obesity regulates the Cyp2r1 expression in the mouse extrahepatic tissues (II)

CYP2R1 was reported to be the major microsomal vitamin D 25-hydroxylase with the highest expression in liver and testis and much lower expression in other tissues (Cheng, Motola, Mangelsdorf, & Russell, 2003). In contrast to mouse, in humans, the CYP2R1 seems to be rather ubiquitously expressed in most tissues according to the human protein atlas (Uhlén et al., 2015) (II, Supplementary Fig. 1).

According to our digital droplet PCR analysis, we observed that Cyp2r1 is broadly expressed and could be detected in all tissues studied (II, Fig. 4). The liver has the highest expression of Cyp2r1, and the level was similar in both male and female mice (II, Fig. 4). In the male, the testis was the organ with the second-highest expression level of Cyp2r1 (II, Fig. 4). Interestingly, the kidney was the third most highly Cyp2r1 expressing organ in the male mice, and the second in the female mice. The Cyp2r1 expression was about 10% of the liver expression level,

68

and the amount of Cyp2r1 mRNA level was comparable in all fat depots studied, i.e., subcutaneous (inguinal) and visceral (gonadal) WAT as well as in BAT (II, Fig. 4). The intestinal tract, i.e., duodenum, ileum, and colon, had the lowest expression (II, Fig. 4).

We then analyzed the effect of obesity on Cyp2r1 expression in extrahepatic tissues, i.e., subcutaneous and visceral WAT, BAT, kidney, and the intestinal tract.

Interestingly, the HFD feeding did not affect Cyp2r1 in the visceral WAT either in the male or female mice compared to chow control mice (II, Fig. 5A). This contrasts with other studies demonstrating the induction of Cyp2r1 in the visceral adipose tissue (Bonnet et al., 2019). On the other hand, Cyp2r1 was induced in the subcutaneous WAT of some male mice, but the effect was not significant (II, Fig. 5B). There was no effect of the HFD on Cyp2r1 in the subcutaneous WAT of female mice (II, Fig. 5B). In the BAT, the HFD induced obesity remarkably repressed Cyp2r1 in both the male and female mice (II, Fig. 5C).

In the kidney, the HFD induced obesity significantly repressed Cyp2r1 in both the male and female mice (II, Fig. 5E). Consistently, the CYP2R1 protein was reduced significantly in the kidney of male mice by HFD feeding (II, Fig. 5E). Surprisingly, the CYP2R1 protein was not detected in the female kidney despite higher CYP2R1 expression than in male mice. The reason for this is not currently clear.

In the intestinal tract, the HFD induced obesity did not affect Cyp2r1 expression in the duodenum (II, Fig. 5F), while it repressed CYP2R1 in the colon of male and female mice (II, Fig. 5H). In the ileum, the HFD had the opposite effect on Cyp2r1 in male and female mice (II, Fig. 5G).

In testis, the HFD induced obesity modestly but significantly repressed Cyp2r1 (II, Fig. 5I). In contrast, HFD induced obesity did not affect Cyp2r1 expression in the ovary (II, Fig. 5J).

Altogether, these results indicate that obesity is not just regulating the Cyp2r1 in the liver, but also the extrahepatic tissues. Moreover, the broad expression of Cyp2r1 in the extrahepatic tissues indicates that those tissues have the ability to locally convert vitamin D into 25(OH)D, which may contribute to the autocrine and paracrine actions (Morris & Anderson, 2010). Interestingly, the vitamin D 1α-hydroxylase Cyp27b1 was only detected and abundant in the kidney, which excludes the possibility of converting the local 25(OH)D into 1α,25(OH)2D in the extrarenal tissues. This might also indicate that the local 25(OH)D itself has unknown physiological functions independent of 1α,25(OH)2D, which might be

69

related to the regulation of energy homeostasis in those tissues. However, this hypothesis warrants further studies.

5.1.5 Human obesity represses CYP2R1 and vitamin D bioactivation in WAT (II)

Obesity in mice suppressed CYP2R1 and vitamin D 25-hydroxylation in the liver and consequently caused lower plasma 25(OH)D. It remains unknown how obesity affects CYP2R1 expression in humans. Indeed, it has been shown that higher BMI might lead to lower 25(OH)D in the blood and not vice versa (Vimaleswaran et al., 2013). Interestingly, there is consistent evidence that weight loss induced by diet restriction improves the vitamin D concentration (Christensen et al., 2012; Mason et al., 2011; Rock et al., 2012; Tzotzas et al., 2010).

We aimed to study how obesity and weight loss promoted by Roux-en-Y gastric bypass (RYGB) surgery affect the expression of genes involved in vitamin D metabolism, especially, CYP2R1. To achieve our aim, we utilized subcutaneous adipose tissue samples taken from four morbidly obese female subjects before and 11-19 months after the surgery.

Interestingly, CYP2R1 was significantly and consistently upregulated in the adipose tissue samples taken after the surgery compared to samples taken before (II, Fig. 1A). These results indicate that obesity in humans represses the CYP2R1 expression, and weight loss increases CYP2R1 expression in the adipose tissue.

We also analyzed the expression of other major genes involved in vitamin D metabolism, namely, CYP27B1 and CYP24A1. The vitamin D 1α-hydroxylase CYP27B1 was significantly and consistently repressed in the samples after the surgery (II, Fig. 1B). In contrast, weight loss did not have any effect on the expression of vitamin D catabolic enzyme CYP24A1 (II, Fig. 1C).

Whether CYP2R1 induction in the adipose tissue could contribute to the plasma 25(OH)D levels requires further studies. Analysis of CYP2R1 expression in the Human Protein Atlas revealed that CYP2R1 is rather ubiquitous in many human tissues (II, Supplementary Fig. 1). In mice, we observed that Cyp2r1 is broadly expressed in different tissues; however, the highest expression was detected in the liver, testis, and kidney (II, Fig. 4). Therefore, in mice, the repression of CYP2R1 in the liver by metabolic disturbances would play a significant role in the observed reduction of the plasma 25(OH)D levels. However, in humans, it seems that the liver CYP2R1 might play a less significant role in the plasma 25(OH)D level, and other extrahepatic tissues might also play a role. Consistent with this interpretation,

70

it has been reported that patients with unilateral orchiectomy, due to testicular cancer, have lower serum 25(OH)D levels (Foresta et al., 2013).

In humans, vitamin D is thought not to be evenly distributed between different fat depots. For example, vitamin D was recently reported to be accumulated more in the omental adipose tissue than subcutaneous abdominal adipose tissue (Carrelli et al., 2017). However, quantitively the amount of the subcutaneous adipose depots is much more than the visceral adipose tissue (Merlotti, Ceriani, Morabito, & Pontiroli, 2017). Thus, the subcutaneous adipose CYP2R1 could be biologically relevant. Since the weight loss did not affect the expression of the catabolic enzyme CYP24A1, we might exclude the possible degradation of the synthesized 25(OH)D.

Therefore, we consider that induction of CYP2R1 and repression of CYP27B1 by weight loss after surgery might direct the vitamin D metabolism toward producing more 25(OH)D. However, in our study, it was not possible to determine the effect of adipose tissue CYP2R1 on the plasma 25(OH)D levels because vitamin D deficiency is quite a common side effect of gastric bypass surgery because of the vitamin D malabsorption (Mangan, Le Roux, Miller, & Docherty, 2019). It is also possible the vitamin D 25-hydroxylation is of importance to the adipose tissue itself, as it might have autocrine/paracrine functions.

To analyze the effect of obesity and weight loss on vitamin D functions, we analyzed the expression of VDR in the adipose tissue before and after the surgery. The effect of weight loss on VDR expression was not clear. While there was a tendency for a decrease in the VDR expression in three patients, the effect did not reach statistical significance (II, Fig. 1D). Moreover, we did not observe any effect of the weight loss on any of the known VDR target genes in the adipose tissue, such as PPARG, acetyl-CoA carboxylase alpha (ACACA) and uncoupling protein (UCP) 1 and UCP2, (Matthews, D'Angelo, Drelich, & Welsh, 2016; Saini, Zhao, Petit, Gori, & Demay, 2017) (II, Supplemental Fig. 2).

In conclusion, we demonstrated that obesity repressed CYP2R1 in the adipose tissue and weight loss after the gastric bypass surgery rescued the CYP2R1 expression. This might contribute positively to the plasma 25(OH)D levels. However, supplementation with a large dose of vitamin D is likely needed to overcome vitamin D malabsorption after surgery (Carlin, Rao, Yager, Parikh, & Kapke, 2009).

71

5.2 Fasting-activated molecular pathways regulate vitamin D metabolism

5.2.1 PGC-1α-ERRα pathway represses Cyp2r1 expression (I)

PGC-1α is a key player in regulating cellular energy metabolism, including the metabolism of carbohydrates, fatty acids, and oxidative metabolism in the liver. Under normal circumstances, PGC-1α expression in the liver is low to moderate (Puigserver et al., 1998). However, during fasting and uncontrolled diabetes, PGC-1α is highly induced in the liver (Yoon et al., 2001). Therefore, we hypothesized that PGC-1α could mediate the repression of CYP2R1 by fasting in the liver.

In agreement with our hypothesis, Cyp2r1 was downregulated by PGC-1α overexpression strongly and dose-dependently in mouse primary hepatocytes (I, Fig. 2A). In fact, PGC-1α is a transcriptional coactivator and does not possess the ability to bind to DNA directly. Instead, PGC-1α must co-activate other nuclear receptors and transcription factors. Therefore, to explore the mechanism in more detail, we have transduced two PGC-1α mutants, i.e., PGC-1α-2X9 and PGC-1α-L2L3, into mouse hepatocytes. The PGC-1α-2X9 mutant could activate specific nuclear receptors, namely HNF-4α and ERRα only, while the PGC-1α-L2L3 mutant cannot bind or activate any nuclear receptor (Gaillard et al., 2006). Overexpression of PGC-1α-2X9 significantly repressed Cyp2r1, similar to the wildtype PGC-1α (I, Fig. 2B). On the other hand, PGC-1α-L2L3 did not affect Cyp2r1 and even caused a modest induction (I, Fig. 2B).

These results indicate that the activation of the nuclear receptor, most probably ERRα, by PGC-1α, is crucial for mediating the PGC-1α effect on CYP2R1. Supporting this hypothesis, several known ERRα target genes were induced in both the PGC-1α wildtype and the PGC-1α-2X9 mutant. Furthermore, the majority of the genes induced by PGC-1α-2X9 are ERRα dependent (Gaillard et al., 2006).

To test the potential role of the ERRα-PGC-1α interaction in the regulation of Cyp2r1, we used several approaches. We either knocked down the Errα mRNA by shRNA-Ad or inhibited the ERRα protein using the ERRα inverse agonist XCT790 combined with PGC-1α induction. In either case, abolishing the ERRα effect could abolish the repressive effect of PGC-1α induction on Cyp2r1 in mouse hepatocytes (I, Fig. 2C, D).

To verify the role of PGC-1α in vivo, we utilized Pgc-1α knockout (KO) mice and wild-type littermates fed, or 12 h fasted. As expected, in the wildtype mice,

72

fasting significantly repressed Cyp2r1 in the liver, but surprisingly, the Pgc-1α KO did not abolish the suppressive effect of fasting on Cyp2r1 (I, Fig. 2F).

We next considered that the chronic loss of Pgc-1α might be compensated by Pgc-1β, the close homolog to Pgc-1α, and the second member in the PGC-1 coactivators family (Lai et al., 2008). Supporting this idea, Pgc-1β is induced by fasting, and it was more induced in the livers of Pgc-1α KO mice (Lai et al., 2008) (I, Fig. 2G). In general, PGC-1α and PGC-1β are thought to regulate different pathways, but recent reports demonstrated some functional overlap (Lai et al., 2008). Thus, we hypothesize that PGC-1β could compensate for the chronic loss of Pgc-1α, or it could even play an independent role in the repression of Cyp2r1. To test this hypothesis, we utilized mice with liver-specific Pgc-1β knockout and wildtype littermates fed or 24 h fasted. Fasting again suppressed the Cyp2r1 in the livers of wild-type mice; however, the Pgc-1β KO in the liver did not abolish the effect of fasting (I, Fig. 2H).

Although the PGC-1α-ERRα pathway was shown to be a crucial regulator of Cyp2r1 in the mouse hepatocytes, the Pgc-1α knockout did not prevent Cyp2r1 suppression during fasting in vivo. This indicates that additional fasting activated molecular pathways are involved in the regulation of Cyp2r1 during fasting in the liver.

5.2.2 Activation of GR represses Cyp2r1 in the liver and kidney (I-II)

GR in the liver has a crucial role in regulating glycogen metabolism and gluconeogenesis (Whirledge & DeFranco, 2017). GR activated by cortisol is another key pathway controlling the fasting response in the liver and is also activated in diabetes (Whirledge & DeFranco, 2017). Thus, we hypothesized that activation of GR in the liver during fasting suppresses Cyp2r1. Additionally, we also tested if GR mediates the repression of Cyp2r1 in the fasted kidney. To test this hypothesis, we first pharmacologically activated the GR by injecting the mice with the synthetic cortisol analog, dexamethasone. Dexamethasone repressed Cyp2r1 in the liver at mRNA and protein levels (I, Fig. 3A, B).

Interestingly, dexamethasone induces Pgc-1α, which is also known to be an interacting partner for the GR (Yoon et al., 2001) (I, Fig. 3A). Moreover, dexamethasone repressed the Cyp2r1 in the kidney (II, Fig. 6B). Altogether, these results indicate that the GR might play a role in the regulation of Cyp2r1 in vivo.

To verify the role of the GR, we inhibited the GR function by the GR antagonist mifepristone during 12h fasting or dexamethasone treatment. Mifepristone partially

73

abolished the repression of Cyp2r1 by dexamethasone in the liver (I, Fig. 3C). However, in the kidney, mifepristone completely abolished the effect of dexamethasone on Cyp2r1 (II, Fig. 6B). In contrast, mifepristone did not completely abolish the repressive effect of fasting on Cyp2r1 in both liver and kidney (I, Fig. 3G) (II, Fig. 6C).

These results suggest that the GR is involved in the repression of Cyp2r1 during fasting in the liver and kidney; however, we cannot exclude an additional fasting activated mechanism involved in the regulation of Cyp2r1. This warrants future investigation. One important implication of this finding is that it might provide an explanation for the observed association between glucocorticoid use and lower 25(OH)D, i.e., vitamin D deficiency (Skversky, Kumar, Abramowitz, Kaskel, & Melamed, 2011).

5.2.3 PGC-1α-ERRα pathway mediates the fasting-mediated induction of the Cyp24a1 in the kidney (I)

The CYP24A1 controls the amount of active vitamin D by reducing the amount of 1α,25(OH)2D when there is an elevated level in the circulation (Jones G et al., 2014). Furthermore, CYP24A1 limits the amount of 25(OH)D available for activation by CYP27B1 (Jones G et al., 2014). The 24-hydroxylation takes place mainly in the kidney (Jones G et al., 2014).

In the current study, we discovered a novel molecular pathway that regulates the expression of Cyp24a1 in the kidney, namely the PGC-1α-ERRα pathway. Through microarray study after PGC-1α induction in mouse primary hepatocytes, we found that Cyp24a1 was among the highly induced genes (I, Table 2). The induction was PGC-1α-Ad dose-dependent (I, Fig. 4A).

CYP24A1 is regulated mainly by VDR (G. Jones et al., 2012), and the VDR is known to interact with PGC-1α (Savkur, Bramlett, Stayrook, Nagpal, & Burris, 2005). Therefore, we hypothesized that VDR mediates the induction of Cyp24a1 by PGC-1α. To test that hypothesis, we treated hepatocytes with 1α,25(OH)2D combined with overexpression of PGC-1α. As expected, 1α,25(OH)2D induced Cyp24a1, but PGC-1α induced Cyp24a1 very much more than 1α,25(OH)2D (I, Fig. 4B-D). Additionally, the combination of both did potentiate the effect (I, Fig. 4B). Interestingly, the CYP24A1 protein could be detected only after PGC-1α induction (I, Fig. 4E). These results indicate that VDR does not play a significant role in the regulation of Cyp24a1 in mouse primary hepatocytes.

74

Interestingly, in the mouse hepatocytes, knockdown of Errα abolished the Cyp24a1 induction by PGC-1α, which indicates that the PGC-1α-ERRα interaction is indispensable for this regulation (I, Fig. 4I).

Although Cyp24a1 was detected in the mouse primary hepatocytes after PGC-1α induction, it was not detected in the fasted liver in vivo. In fact, the Cyp24a1 was abundant in the kidney as expected, and it was induced by fasting (I, Fig. 5A).

To study the role of PGC-1α in the regulation of Cyp24a1 in the kidney, we analyzed kidney samples from wildtype and Pgc-1α KO mice fed or fasted. Again, 12 h fasting-induced Cyp24a1 in the kidney, and interestingly, Pgc-1α KO abolished the Cyp24a1 induction by fasting (I, Fig. 5B). This indicates that PGC-1α plays a crucial role in Cyp24a1 induction by fasting in the kidney. Moreover, inhibition of the ERRα by the ERRα antagonist XCT790 diminished the fasting mediated induction of Cyp24a1 (I, Fig. 5E).

Altogether, this indicates that fasting induces Cyp24a1 in the kidney solely through the PGC-1α-ERRα signaling pathway. The physiological consequences during fasting and in metabolic diseases warrant further investigation.

75

6 Concluding remarks and future direction In the current thesis, we reported novel findings indicating a previously unknown regulation of vitamin D metabolism by the metabolic state in both mice and humans (Fig. 14). By utilizing in vivo mouse models and cellular experiments, we demonstrated that molecular regulators activated physiologically by fasting or pathologically by diabetes regulate vitamin D bioactivation and catabolism (Fig. 14).

The concluding remarks of the study:

1. We demonstrated that CYP2R1 expression and vitamin D 25-hydroxylation are under strict regulation by the metabolic state. These data challenge the old dogma stating that vitamin D 25-hydroxylation is a stable step and not efficiently regulated. Thus, the 25(OH)D level reflects not only the vitamin D intake but may also be affected by the metabolic state.

2. We identified two novel molecular mechanisms regulating vitamin D metabolism, i.e., the PGC-1α-ERRα pathway and GR. Those molecular factors are key players in mediating the fasting response and are pathologically hyperactivated in diabetes. We propose that the newly identified molecular mechanisms are behind the vitamin D deficiency observed in diabetics.

3. We demonstrated that weight loss promoted by gastric bypass surgery upregulates CYP2R1 in the adipose tissue. We suggest that this represents recovery after the obesity-induced repression. This suggests that the adipose tissue actively regulates vitamin D metabolism during obesity.

4. Our data imply that the association between obesity and vitamin D deficiency is not coincidental, but obesity causes vitamin D deficiency.

5. Our study suggests that vitamin D deficiency associated with diabetes is a consequence, not the cause of the disease. This would be an important change of a paradigm and should have a significant effect on the research field.

Finally, future studies are required to investigate further the physiological significance of the fasting-mediated repression of Cyp2r1 in the liver and extrahepatic tissues. The hepatic expression of Cyp2r1 and the vitamin D 25-hydroxylation are nutrition-sensitive, which might indicate that the intrahepatic 25(OH)D may be a novel nutritional sensor. Further studies are required to investigate the role of the hepatic 25(OH)D in the regulation of the hepatic glucose, cholesterol, and lipid homeostasis. This might help to discover novel functions of

76

vitamin D in the context of human pathologies such as metabolic disorders. Indeed, our study raises the question of the efficacy of the current vitamin D supplementation regimes in metabolically ill patients. Whether the current diabetic therapies restore the vitamin D bioactivation and rescue the plasma 25(OH)D, is another important question for future studies.

77

Fig.

14.

Sum

mar

y of

the

PhD

stu

dy.

Met

abol

ic d

istu

rban

ces,

i.e.,

type

1, o

besi

ty, a

nd ty

pe 2

dia

bete

s, re

pres

s C

YP2

R1

and

vita

min

D b

ioac

tivat

ion

and

caus

e vi

tam

in D

def

icie

ncy,

nam

ely,

low

pla

sma

25(O

H)D

leve

ls. O

besi

ty in

hum

ans r

epre

sses

CYP

2R1

in W

AT. O

n th

e ot

her h

and,

w

eigh

t los

s pro

mot

ed b

y ga

stric

byp

ass s

urge

ry re

stor

es th

e C

YP2R

1 in

WAT

. Fur

ther

mor

e, o

besi

ty re

pres

sed

the

Cyp

2r1

in

mou

se e

xtra

hepa

tic ti

ssue

s, i.e

., te

stis

, kid

ney,

and

BAT

. Add

ition

ally

, Cyp

2r1

and

vita

min

D b

ioac

tivat

ion

are

repr

esse

d in

th

e liv

er o

f rod

ent m

odel

s of

fast

ing.

On

the

othe

r han

d, fa

stin

g in

duce

s C

yp24

a1 a

nd v

itam

in D

cat

abol

ism

in th

e ki

dney

. W

e de

mon

stra

te th

e in

volv

emen

t of t

wo

fast

ing-

activ

ated

mol

ecul

ar p

athw

ays,

nam

ely

PGC

-1α-

ERRα

and

GR

, in

med

iatin

g

78

the

fast

ing-

indu

ced

repr

essi

on o

f Cyp

2r1

in th

e liv

er. A

dditi

onal

ly, P

GC

-1α-

ERRα

is c

ruci

al fo

r the

fast

ing-

indu

ced

Cyp

24a1

in

the

kidn

ey. P

art o

f the

Fig

. was

dra

wn

with

the

help

of S

ervi

er M

edic

al A

rt (w

ww

.serv

ier.c

om).

79

List of references Aatsinki, S., Elkhwanky, M., Kummu, O., Karpale, M., Buler, M., Viitala, P., . . . Hakkola,

J. (2019). Fasting-induced transcription factors repress vitamin D bioactivation, a mechanism for vitamin D deficiency in diabetes. Diabetes, 68(5), 918-931. doi:10.2337/ db18-1050

Abbas, M. A. (2017). Physiological functions of vitamin D in adipose tissue. The Journal of Steroid Biochemistry and Molecular Biology, 165(Pt B), 369-381.

Adams, J. S., & Hewison, M. (2012). Extrarenal expression of the 25-hydroxyvitamin D-1-hydroxylase. Archives of Biochemistry and Biophysics, 523(1), 95-102. doi:10.1016/ j.abb.2012.02.016

Adams, J. S., Rafison, B., Witzel, S., Reyes, R. E., Shieh, A., Chun, R., . . . Liu, P. T. (2014). Regulation of the extrarenal CYP27B1-hydroxylase. Journal of Steroid Biochemistry and Molecular Biology, 144(PART A), 22-27. doi:10.1016/j.jsbmb.2013.12.009

Alam, U., Arul-Devah, V., Javed, S., & Malik, R. A. (2016). Vitamin D and diabetic complications: True or false prophet? Diabetes Therapy: Research, Treatment and Education of Diabetes and Related Disorders, 7(1), 11-26. doi:10.1007/s13300-016-0159-x

Alkhatatbeh, M. J., & Abdul-Razzak, K. K. (2018). Association between serum 25-hydroxyvitamin D, hemoglobin A1c and fasting blood glucose levels in adults with diabetes mellitus. Biomedical Reports, 9(6), 523-530. doi:10.3892/br.2018.1159

Alvarez, J. A., & Ashraf, A. (2010). Role of vitamin d in insulin secretion and insulin sensitivity for glucose homeostasis. International Journal of Endocrinology, 2010, 351385. doi:10.1155/2010/351385

Annweiler, C., Rolland, Y., Schott, A. M., Blain, H., Vellas, B., & Beauchet, O. (2011). Serum vitamin D deficiency as a predictor of incident non-alzheimer dementias: A 7-year longitudinal study. Dementia and Geriatric Cognitive Disorders, 32(4), 273-278. doi:10.1159/000334944

Annweiler, C., Rolland, Y., Schott, A. M., Blain, H., Vellas, B., Herrmann, F. R., & Beauchet, O. (2012). Higher vitamin D dietary intake is associated with lower risk of alzheimer's disease: A 7-year follow-up. Journals of Gerontology - Series A Biological Sciences and Medical Sciences, 67(11), 1205-1211. doi:10.1093/gerona/gls107

Antico, A., Tampoia, M., Tozzoli, R., & Bizzaro, N. (2012). Can supplementation with vitamin D reduce the risk or modify the course of autoimmune diseases? A systematic review of the literature. Autoimmunity Reviews, 12(2), 127-136. doi:10.1016/ j.autrev.2012.07.007

Armbrecht, H. J., Hodam, T. L., Boltz, M. A., Partridge, N. C., Brown, A. J., & Kumar, V. B. (1998). Induction of the vitamin D 24-hydroxylase (CYP24) by 1,25- dihydroxyvitamin D3 is regulated by parathyroid hormone in UMR106 osteoblastic cells. Endocrinology, 139(8), 3375-3381. doi:10.1210/endo.139.8.6134

80

Arpiainen, S., Järvenpää, S. M., Manninen, A., Viitala, P., Lang, M. A., Pelkonen, O., & Hakkola, J. (2008). Coactivator PGC-1alpha regulates the fasting inducible xenobiotic-metabolizing enzyme CYP2A5 in mouse primary hepatocytes. Toxicology and Applied Pharmacology, 232(1), 135-141. doi:10.1016/j.taap.2008.06.001

Asano, L., Watanabe, M., Ryoden, Y., Usuda, K., Yamaguchi, T., Khambu, B., . . . Uesugi, M. (2017). Vitamin D metabolite, 25-hydroxyvitamin D, regulates lipid metabolism by inducing degradation of SREBP/SCAP. Cell Chemical Biology, 24(2), 207-217. doi:10.1016/j.chembiol.2016.12.017

Bach, J. -. (1994). Insulin-dependent diabetes mellitus as an autoimmune disease. Endocrine Reviews, 15(4), 516-542. doi:10.1210/edrv-15-4-516

Badenhoop, K., Kahles, H., & Penna-Martinez, M. (2012). Vitamin D, immune tolerance, and prevention of type 1 diabetes. Current Diabetes Reports, 12(6), 635-642. doi:10.1007/s11892-012-0322-3

Baeke, F., Takiishi, T., Korf, H., Gysemans, C., & Mathieu, C. (2010). Vitamin D: Modulator of the immune system. Current Opinion in Pharmacology, 10(4), 482-496. doi:10.1016/j.coph.2010.04.001

Baggerly, C. A., Cuomo, R. E., French, C. B., Garland, C. F., Gorham, E. D., Grant, W. B., . . . Wunsch, A. (2015). Sunlight and vitamin D: Necessary for public health. Journal of the American College of Nutrition, 34(4), 359-365. doi:10.1080/ 07315724.2015.1039866

Bai, X. -., Miao, D., Goltzman, D., & Karaplis, A. C. (2003). The autosomal dominant hypophosphatemic rickets R176Q mutation in fibroblast growth factor 23 resists proteolytic cleavage and enhances in vivo biological potency. Journal of Biological Chemistry, 278(11), 9843-9849. doi:10.1074/jbc.M210490200

Ban, Y., Taniyama, M., Yanagawa, T., Yamada, S., Maruyama, T., Kasuga, A., & Ban, Y. (2001). Vitamin D receptor initiation codon polymorphism influences genetic susceptibility to type 1 diabetes mellitus in the japanese population. BMC Medical Genetics, 2(1), 7. doi:10.1186/1471-2350-2-7

Barbour, G. L., Coburn, J. W., Slatopolsky, E., Norman, A. W., & Horst, R. L. (1981). Hypercalcemia in an anephric patient with sarcoidosis: Evidence for extrarenal generation of 1,25-dihydroxyvitamin D. The New England Journal of Medicine, 305(8), 440-443. doi:10.1056/NEJM198108203050807

Barrea, L., Savanelli, M. C., Di Somma, C., Napolitano, M., Megna, M., Colao, A., & Savastano, S. (2017). Vitamin D and its role in psoriasis: An overview of the dermatologist and nutritionist. Reviews in Endocrine & Metabolic Disorders, 18(2), 195-205. doi:10.1007/s11154-017-9411-6

Barsony, J., & Marx, S. J. (1988). Receptor-mediated rapid action of 1 alpha,25-dihydroxycholecalciferol: Increase of intracellular cGMP in human skin fibroblasts. Proceedings of the National Academy of Sciences of the United States of America, 85(4), 1223-1226.

81

Bassatne, A., Chakhtoura, M., Saad, R., & Fuleihan, G. E. (2019). Vitamin D supplementation in obesity and during weight loss: A review of randomized controlled trials. Metabolism: Clinical and Experimental, 92, 193-205. doi:10.1016/ j.metabol.2018.12.010

Bell, T. D., Demay, M. B., & Burnett-Bowie, S. M. (2010). The biology and pathology of vitamin D control in bone. Journal of Cellular Biochemistry, 111(1), 7-13. doi:10.1002/jcb.22661

Bergman, P., Norlin, A., Hansen, S., Rekha, R. S., Agerberth, B., Björkhem-Bergman, L., . . . Andersson, J. (2012). Vitamin D3 supplementation in patients with frequent respiratory tract infections: A randomised and double-blind intervention study. BMJ Open, 2(6), e001663. doi:10.1136/bmjopen-2012-001663

Bergwitz, C., & Jüppner, H. (2010). Regulation of phosphate homeostasis by PTH, vitamin D, and FGF23. Annual Review of Medicine, 61, 91-104. doi:10.1146/ annurev.med.051308.111339

Berridge, M. J. (2017). Vitamin D deficiency and diabetes. The Biochemical Journal, 474(8), 1321-1332. doi:10.1042/BCJ20170042

Bhalla, S., Ozalp, C., Fang, S., Xiang, L., & Kemper, J. K. (2004). Ligand-activated pregnane X receptor interferes with HNF-4 signaling by targeting a common coactivator PGC-1alpha. functional implications in hepatic cholesterol and glucose metabolism. The Journal of Biological Chemistry, 279(43), 45139-45147. doi:10.1074/jbc.M405423200

Bikle, D. (2017). Vitamin D: Production, metabolism, and mechanisms of action. In K. R. Feingold, B. Anawalt, A. Boyce, G. Chrousos, K. Dungan, A. Grossman, . . . D. P. Wilson (Eds.), Endotext (). South Dartmouth (MA): MDText.com, Inc. Retrieved from http://www.ncbi.nlm.nih.gov/books/NBK278935/

Bikle, D. D. (2011). Vitamin D regulation of immune function. Vitamins and Hormones, 86, 1-21. doi:10.1016/B978-0-12-386960-9.00001-0

Bikle, D. D. (2012). Vitamin D and bone. Current Osteoporosis Reports, 10(2), 151-159. doi:10.1007/s11914-012-0098-z

Bikle, D. D., Patzek, S., & Wang, Y. (2018). Physiologic and pathophysiologic roles of extra renal CYP27b1: Case report and review. Bone Reports, 8, 255-267. doi:10.1016/ j.bonr.2018.02.004

Bischoff, H. A., Borchers, M., Gudat, F., Duermueller, U., Theiler, R., Stähelin, H. B., & Dick, W. (2001). In situ detection of 1,25-dihydroxyvitamin D3 receptor in human skeletal muscle tissue. The Histochemical Journal, 33(1), 19-24.

Björklund, A., Lansner, A., & Grill, V. E. (2000). Glucose-induced [Ca2+]i abnormalities in human pancreatic islets: Important role of overstimulation. Diabetes, 49(11), 1840-1848.

Blaine, J., Chonchol, M., & Levi, M. (2015). Renal control of calcium, phosphate, and magnesium homeostasis. Clinical Journal of the American Society of Nephrology: CJASN, 10(7), 1257-1272. doi:10.2215/CJN.09750913

82

Bland, R., Markovic, D., Hills, C. E., Hughes, S. V., Chan, S. L. F., Squires, P. E., & Hewison, M. (2004). Expression of 25-hydroxyvitamin D3-1alpha-hydroxylase in pancreatic islets. The Journal of Steroid Biochemistry and Molecular Biology, 89-90(1-5), 121-125. doi:10.1016/j.jsbmb.2004.03.115

Blomhoff, R., Helgerud, P., Dueland, S., Berg, T., Pedersen, J. I., Norum, K. R., & Drevon, C. A. (1984). Lymphatic absorption and transport of retinol and vitamin D-3 from rat intestine. evidence for different pathways. Biochimica Et Biophysica Acta, 772(2), 109-116. doi:10.1016/0005-2736(84)90033-6

Bonnet, L., Hachemi, M. A., Karkeni, E., Couturier, C., Astier, J., Defoort, C., . . . Landrier, J. (2019). Diet induced obesity modifies vitamin D metabolism and adipose tissue storage in mice. The Journal of Steroid Biochemistry and Molecular Biology, 185, 39-46. doi:10.1016/j.jsbmb.2018.07.006

Boonstra, A., Barrat, F. J., Crain, C., Heath, V. L., Savelkoul, H. F. J., & O'Garra, A. (2001). 1a,25-dihydroxyvitamin D3 has a direct effect on naive CD4+ T cells to enhance the development of Th2 cells. Journal of Immunology, 167(9), 4974-4980. Retrieved from https://www.scopus.com/inward/record.uri?eid=2-s2.0-0035497752&partnerID=40& md5=c199e99998afd1d2763974dce80dde6e

Bose, S. K., Hutson, I., & Harris, C. A. (2016). Hepatic glucocorticoid receptor plays a greater role than adipose GR in metabolic syndrome despite renal compensation. Endocrinology, 157(12), 4943-4960. doi:10.1210/en.2016-1615

Bouillon, R., Carmeliet, G., Verlinden, L., Van Etten, E., Verstuyf, A., Luderer, H. F., . . . Demay, M. (2008). Vitamin D and human health: Lessons from vitamin D receptor null mice. Endocrine Reviews, 29(6), 726-776. doi:10.1210/er.2008-0004

Bouillon, R. (2017). Comparative analysis of nutritional guidelines for vitamin D. Nature Reviews. Endocrinology, 13(8), 466-479. doi:10.1038/nrendo.2017.31

Bouillon, R., Carmeliet, G., Lieben, L., Watanabe, M., Perino, A., Auwerx, J., . . . Verstuyf, A. (2014). Vitamin D and energy homeostasis: Of mice and men. Nature Reviews. Endocrinology, 10(2), 79-87. doi:10.1038/nrendo.2013.226

Bouillon, R., Marcocci, C., Carmeliet, G., Bikle, D., White, J. H., Dawson-Hughes, B., . . . Bilezikian, J. (2019). Skeletal and extraskeletal actions of vitamin D: Current evidence and outstanding questions. Endocrine Reviews, 40(4), 1109-1151. doi:10.1210/er.2018-00126

Bouillon, R., Schuit, F., Antonio, L., & Rastinejad, F. (2019). Vitamin D binding protein: A historic overview. Frontiers in Endocrinology, 10, 910. doi:10.3389/fendo.2019.00910

Bruce, D., & Cantorna, M. T. (2011). Intrinsic requirement for the vitamin D receptor in the development of CD8αα-expressing T cells. Journal of Immunology (Baltimore, Md.: 1950), 186(5), 2819-2825. doi:10.4049/jimmunol.1003444

Burrack, A. L., Martinov, T., & Fife, B. T. (2017). T cell-mediated beta cell destruction: Autoimmunity and alloimmunity in the context of type 1 diabetes. Frontiers in Endocrinology, 8, 343. doi:10.3389/fendo.2017.00343

Campbell, G. R., & Spector, S. A. (2012). Autophagy induction by vitamin D inhibits both mycobacterium tuberculosis and human immunodeficiency virus type 1. Autophagy, 8(10), 1523-1525. doi:10.4161/auto.21154

83

Canaff, L., & Hendy, G. N. (2002). Human calcium-sensing receptor gene. vitamin D response elements in promoters P1 and P2 confer transcriptional responsiveness to 1,25-dihydroxyvitamin D. The Journal of Biological Chemistry, 277(33), 30337-30350. doi:10.1074/jbc.M201804200

Cappellani, D., Brancatella, A., Kaufmann, M., Minucci, A., Vignali, E., Canale, D., . . . Marcocci, C. (2019). Hereditary hypercalcemia caused by a homozygous pathogenic variant in the CYP24A1 gene: A case report and review of the literature. Case Reports in Endocrinology, 2019 doi:10.1155/2019/4982621

Carlberg, C., Bendik, I., Wyss, A., Meier, E., Sturzenbecker, L. J., Grippo, J. F., & Hunziker, W. (1993). Two nuclear signalling pathways for vitamin D. Nature, 361(6413), 657-660. doi:10.1038/361657a0

Carlberg, C., Seuter, S., & Heikkinen, S. (2012). The first genome-wide view of vitamin D receptor locations and their mechanistic implications. Anticancer Research, 32(1), 271-282.

Carlin, A. M., Rao, D. S., Yager, K. M., Parikh, N. J., & Kapke, A. (2009). Treatment of vitamin D depletion after roux-en-Y gastric bypass: A randomized prospective clinical trial. Surgery for Obesity and Related Diseases: Official Journal of the American Society for Bariatric Surgery, 5(4), 444-449. doi:10.1016/j.soard.2008.08.004

Carpenter, T. O., Zhang, J. H., Parra, E., Ellis, B. K., Simpson, C., Lee, W. M., . . . Cole, D. E. C. (2013). Vitamin D binding protein is a key determinant of 25-hydroxyvitamin D levels in infants and toddlers. Journal of Bone and Mineral Research: The Official Journal of the American Society for Bone and Mineral Research, 28(1), 213-221. doi:10.1002/jbmr.1735

Carrelli, A., Bucovsky, M., Horst, R., Cremers, S., Zhang, C., Bessler, M., . . . Stein, E. M. (2017). Vitamin D storage in adipose tissue of obese and normal weight women. Journal of Bone and Mineral Research: The Official Journal of the American Society for Bone and Mineral Research, 32(2), 237-242. doi:10.1002/jbmr.2979

Cashman, K. D., Hayes, A., Galvin, K., Merkel, J., Jones, G., Kaufmann, M., . . . Sempos, C. T. (2015). Significance of serum 24, 25-dihydroxyvitamin D in the assessment of vitamin D status: A double-edged sword? Clinical Chemistry, 61(4), 636-645.

Casteels, K. M., Mathieu, C., Waer, D., Valckx, L., Overbergh, L., Laureys, J. M., & Bouillon, R. (1998). Prevention of type i diabetes in nonobese diabetic mice by late intervention with nonhypercalcemic analogs of 1, 25-dihydroxyvitamin D3 in combination with a short induction course of cyclosporin a. Endocrinology, 139(1), 95-102. doi:10.1210/endo.139.1.5641

Censani, M., Stein, E. M., Shane, E., Oberfield, S. E., McMahon, D. J., Lerner, S., & Fennoy, I. (2013). Vitamin D deficiency is prevalent in morbidly obese adolescents prior to bariatric surgery. ISRN Obesity, 2013 doi:10.1155/2013/284516

Chambers, K. T., Chen, Z., Crawford, P. A., Fu, X., Burgess, S. C., Lai, L., . . . Finck, B. N. (2012). Liver-specific PGC-1beta deficiency leads to impaired mitochondrial function and lipogenic response to fasting-refeeding. PloS One, 7(12), e52645.

84

Charoenngam, N., Shirvani, A., & Holick, M. F. (2019). Vitamin D for skeletal and non-skeletal health: What we should know. Journal of Clinical Orthopaedics and Trauma, 10(6), 1082-1093. doi:10.1016/j.jcot.2019.07.004

Chen, T. C., Lu, Z., & Holick, M. F. (2010). Photobiology of vitamin D. Vitamin D (pp. 35-60) Springer.

Cheng, J. B., Motola, D. L., Mangelsdorf, D. J., & Russell, D. W. (2003). De-orphanization of cytochrome P450 2R1: A microsomal vitamin D 25-hydroxilase. The Journal of Biological Chemistry, 278(39), 38084-38093. doi:10.1074/jbc.M307028200

Cheng, J. B., Levine, M. A., Bell, N. H., Mangelsdorf, D. J., & Russell, D. W. (2004). Genetic evidence that the human CYP2R1 enzyme is a key vitamin D 25-hydroxylase. Proceedings of the National Academy of Sciences of the United States of America, 101(20), 7711-7715. doi:10.1073/pnas.0402490101

Chiang, J. (2014). (2014). Liver physiology: Metabolism and detoxification. Paper presented at the doi:10.1016/B978-0-12-386456-7.04202-7

Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., & Rutter, W. J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry, 18(24), 5294-5299.

Chiu, K. C., Chuang, L. M., & Yoon, C. (2001). The vitamin D receptor polymorphism in the translation initiation codon is a risk factor for insulin resistance in glucose tolerant caucasians. BMC Medical Genetics, 2, 2.

Christakos, S., Dhawan, P., Porta, A., Mady, L. J., & Seth, T. (2011). Vitamin D and intestinal calcium absorption. Molecular and Cellular Endocrinology, 347(1-2), 25-29. doi:10.1016/j.mce.2011.05.038

Christakos, S., Dhawan, P., Verstuyf, A., Verlinden, L., & Carmeliet, G. (2016). Vitamin D: Metabolism, molecular mechanism of action, and pleiotropic effects. Physiological Reviews, 96(1), 365-408. doi:10.1152/physrev.00014.2015

Christensen, P., Bartels, E. M., Riecke, B. F., Bliddal, H., Leeds, A. R., Astrup, A., . . . Christensen, R. (2012). Improved nutritional status and bone health after diet-induced weight loss in sedentary osteoarthritis patients: A prospective cohort study. European Journal of Clinical Nutrition, 66(4), 504-509. doi:10.1038/ejcn.2011.201

Cianferotti, L., Cox, M., Skorija, K., & Demay, M. B. (2007). Vitamin D receptor is essential for normal keratinocyte stem cell function. Proceedings of the National Academy of Sciences of the United States of America, 104(22), 9428-9433. doi:10.1073/ pnas.0702884104

Conigrave, A. D. (2016). The calcium-sensing receptor and the parathyroid: Past, present, future. Frontiers in Physiology, 7, 563. doi:10.3389/fphys.2016.00563/full

Dalgård, C., Petersen, M. S., Weihe, P., & Grandjean, P. (2011). Vitamin D status in relation to glucose metabolism and type 2 diabetes in septuagenarians. Diabetes Care, 34(6), 1284-1288. doi:10.2337/dc10-2084

D'Ambrosio, D., Cippitelli, M., Cocciolo, M. G., Mazzeo, D., Di Lucia, P., Lang, R., . . . Panina-Bordignon, P. (1998). Inhibition of IL-12 production by 1,25-dihydroxyvitamin D3. involvement of NF-κB downregulation in transcriptional repression of the p40 gene. Journal of Clinical Investigation, 101(1), 252-262. doi:10.1172/JCI1050

85

De Souza Silva, J., Pereira, S. E., Saboya Sobrinho, C. J., & Ramalho, A. (2016). Obesity, related diseases and their relationship with vitamin D deficiency in adolescents. Nutricion Hospitalaria, 33(4), 381. doi:10.20960/nh.381

De Toni, L., De Filippis, V., Tescari, S., Ferigo, M., Ferlin, A., Scattolini, V., . . . Foresta, C. (2014). Uncarboxylated osteocalcin stimulates 25-hydroxy vitamin D production in leydig cell line through a GPRC6a-dependent pathway. Endocrinology, 155(11), 4266-4274. doi:10.1210/en.2014-1283

Demay, M. B., Kiernan, M. S., DeLuca, H. F., & Kronenberg, H. M. (1992). Sequences in the human parathyroid hormone gene that bind the 1,25-dihydroxyvitamin D3 receptor and mediate transcriptional repression in response to 1,25-dihydroxyvitamin D3. Proceedings of the National Academy of Sciences of the United States of America, 89(17), 8097-8101. doi:10.1073/pnas.89.17.8097

Donath, M. Y., & Shoelson, S. E. (2011). Type 2 diabetes as an inflammatory disease. Nature Reviews. Immunology, 11(2), 98-107. doi:10.1038/nri2925

Drincic, A. T., Armas, L. A. G., Van Diest, E. E., & Heaney, R. P. (2012). Volumetric dilution, rather than sequestration best explains the low vitamin D status of obesity. Obesity (Silver Spring, Md.), 20(7), 1444-1448. doi:10.1038/oby.2011.404

Edelman, A., Thil, C. L., Garabédian, M., Anagnostopoulos, T., & Balsan, S. (1983). Genome-independent effects of 1,25-dihydroxy vitamin D-3 on membrane potential. Biochimica Et Biophysica Acta, 732(1), 300-303.

Ek, J., Andersen, G., Urhammer, S. A., Gaede, P. H., Drivsholm, T., Borch-Johnsen, K., . . . Pedersen, O. (2001). Mutation analysis of peroxisome proliferator-activated receptor-gamma coactivator-1 (PGC-1) and relationships of identified amino acid polymorphisms to type II diabetes mellitus. Diabetologia, 44(12), 2220-2226. doi:10.1007/s001250100032

Ellfolk, M., Norlin, M., Gyllensten, K., & Wikvall, K. (2009). Regulation of human vitamin D(3) 25-hydroxylases in dermal fibroblasts and prostate cancer LNCaP cells. Molecular Pharmacology, 75(6), 1392-1399. doi:10.1124/mol.108.053660

Esteban, L., Vidal, M., & Dusso, A. (2004). 1α-hydroxylase transactivation by γ-interferon in murine macrophages requires enhanced C/EBPβ expression and activation. Journal of Steroid Biochemistry and Molecular Biology, 89-90, 131-137. doi:10.1016/ j.jsbmb.2004.03.092

Esterbauer, H., Oberkofler, H., Krempler, F., & Patsch, W. (1999). Human peroxisome proliferator activated receptor gamma coactivator 1 (PPARGC1) gene: cDNA sequence, genomic organization, chromosomal localization, and tissue expression. Genomics, 62(1), 98-102. doi:10.1006/geno.1999.5977

EURODIAB Substudy 2 Study Group. (1999). Vitamin D supplement in early childhood and risk for type I (insulin-dependent) diabetes mellitus. Diabetologia, 42(1), 51-54.

Fassbender, W. J., Goertz, B., Weismüller, K., Steinhauer, B., Stracke, H., Auch, D., . . . Bretzel, R. G. (2002). VDR gene polymorphisms are overrepresented in german patients with type 1 diabetes compared to healthy controls without effect on biochemical parameters of bone metabolism. Hormone and Metabolic Research, 34(6), 330-337. doi:10.1055/s-2002-33262

86

Fetahu, I. S., Höbaus, J., & Kállay, E. (2014). Vitamin D and the epigenome. Frontiers in Physiology, 5, 164. doi:10.3389/fphys.2014.00164

Fichna, M., Zurawek, M., Januszkiewicz-Lewandowska, D., Gryczyñska, M., Fichna, P., Sowiñski, J., & Nowak, J. (2010). Association of the CYP27B1 C(-1260)A polymorphism with autoimmune addison's disease. Experimental and Clinical Endocrinology & Diabetes: Official Journal, German Society of Endocrinology [and] German Diabetes Association, 118(8), 544-549. doi:10.1055/s-0029-1241206

Fleet, J. C., & Schoch, R. D. (2010). Molecular mechanisms for regulation of intestinal calcium absorption by vitamin D and other factors. Critical Reviews in Clinical Laboratory Sciences, 47(4), 181-195. doi:10.3109/10408363.2010.536429

Foresta, C., Selice, R., De Toni, L., Di Mambro, A., Carraro, U., Plebani, M., & Garolla, A. (2013). Altered bone status in unilateral testicular cancer survivors: Role of CYP2R1 and its luteinizing hormone-dependency. Journal of Endocrinological Investigation, 36(6), 379-384. doi:10.3275/8650

Gaillard, S., Grasfeder, L. L., Haeffele, C. L., Lobenhofer, E. K., Chu, T., Wolfinger, R., . . . McDonnell, D. P. (2006). Receptor-selective coactivators as tools to define the biology of specific receptor-coactivator pairs. Molecular Cell, 24(5), 797-803. doi:10.1016/ j.molcel.2006.10.012

Gensler, L. S. (2013). Glucocorticoids. The Neurohospitalist, 3(2), 92-97. doi:10.1177/194 1874412458678

Gittoes, N. (2013). Hypocalcaemia. Medicine, 41(10), 577-580. doi:10.1016/j.mpmed.20 13.07.002

Giulietti, A., Gysemans, C., Stoffels, K., Van Etten, E., Decallonne, B., Overbergh, L., . . . Mathieu, C. (2004). Vitamin D deficiency in early life accelerates type 1 diabetes in non-obese diabetic mice. Diabetologia, 47(3), 451-462. doi:10.1007/s00125-004-1329-3

Goyal, S. N., Reddy, N. M., Patil, K. R., Nakhate, K. T., Ojha, S., Patil, C. R., & Agrawal, Y. O. (2016). Challenges and issues with streptozotocin-induced diabetes - A clinically relevant animal model to understand the diabetes pathogenesis and evaluate therapeutics. Chemico-Biological Interactions, 244, 49-63. doi:10.1016/j.cbi.201 5.11.032

Grant, W. B., Wimalawansa, S. J., Holick, M. F., Cannell, J. J., Pludowski, P., Lappe, J. M., . . . May, P. (2015). Emphasizing the health benefits of vitamin D for those with neurodevelopmental disorders and intellectual disabilities. Nutrients, 7(3), 1538-1564. doi:10.3390/nu7031538

Gregori, S., Giarratana, N., Smiroldo, S., Uskokovic, M., & Adorini, L. (2002). A 1a,25-dihydroxyvitamin D3 analog enhances regulatory T-cells and arrests autoimmune diabetes in NOD mice. Diabetes, 51(5), 1367-1374. doi:10.2337/diabetes.51.5.1367

Griz, L. H. M., Bandeira, F., Gabbay, M. A. L., Dib, S. A., & Carvalho, E. F. d. (2014). Vitamin D and diabetes mellitus: An update 2013. Arquivos Brasileiros De Endocrinologia E Metabologia, 58(1), 1-8.

87

Gulseth, H. L., Gjelstad, I. M. F., Tierney, A. C., Lovegrove, J. A., Defoort, C., Blaak, E. E., . . . Birkeland, K. I. (2010). Serum vitamin D concentration does not predict insulin action or secretion in european subjects with the metabolic syndrome. Diabetes Care, 33(4), 923-925. doi:10.2337/dc09-1692

Gysemans, C. A., Cardozo, A. K., Callewaert, H., Giulietti, A., Hulshagen, L., Bouillon, R., . . . Mathieu, C. (2005). 1,25-dihydroxyvitamin D3 modulates expression of chemokines and cytokines in pancreatic islets: Implications for prevention of diabetes in nonobese diabetic mice. Endocrinology, 146(4), 1956-1964. doi:10.1210/en.2004-1322

Hagenfeldt-Pernow, Y., Ohyama, Y., Sudjana-Sugiaman, E., Okuda, K., & Björkhem, I. (1994). Short-term starvation increases calcidiol-24-hydroxylase activity and mRNA level in rat kidney. European Journal of Endocrinology, 130(6), 608-611.

Handschin, C., Lin, J., Rhee, J., Peyer, A., Chin, S., Wu, P., . . . Spiegelman, B. M. (2005). Nutritional regulation of hepatic heme biosynthesis and porphyria through PGC-1alpha. Cell, 122(4), 505-515. doi:10.1016/j.cell.2005.06.040

Haq, A., Wimalawansa, S. J., Pludowski, P., & Anouti, F. A. (2018). Clinical practice guidelines for vitamin D in the united arab emirates. Journal of Steroid Biochemistry and Molecular Biology, 175, 4-11. doi:10.1016/j.jsbmb.2016.09.021

Hara, K., Tobe, K., Okada, T., Kadowaki, H., Akanuma, Y., Ito, C., . . . Kadowaki, T. (2002). A genetic variation in the PGC-1 gene could confer insulin resistance and susceptibility to type II diabetes. Diabetologia, 45(5), 740-743. doi:10.1007/s00125-002-0803-z

Harel, Z., Flanagan, P., Forcier, M., & Harel, D. (2011). Low vitamin D status among obese adolescents: Prevalence and response to treatment. The Journal of Adolescent Health: Official Publication of the Society for Adolescent Medicine, 48(5), 448-452. doi:1 0.1016/j.jadohealth.2011.01.011

Haussler, M. R., Jurutka, P. W., Mizwicki, M., & Norman, A. W. (2011). Vitamin D receptor (VDR)-mediated actions of 1α,25(OH) 2vitamin D 3: Genomic and non-genomic mechanisms. Best Practice and Research: Clinical Endocrinology and Metabolism, 25(4), 543-559. doi:10.1016/j.beem.2011.05.010

Haussler, M. R., Whitfield, G. K., Kaneko, I., Haussler, C. A., Hsieh, D., Hsieh, J., & Jurutka, P. W. (2013). Molecular mechanisms of vitamin D action. Calcified Tissue International, 92(2), 77-98. doi:10.1007/s00223-012-9619-0

Heikkinen, S., Väisänen, S., Pehkonen, P., Seuter, S., Benes, V., & Carlberg, C. (2011). Nuclear hormone 1α,25-dihydroxyvitamin D3 elicits a genome-wide shift in the locations of VDR chromatin occupancy. Nucleic Acids Research, 39(21), 9181-9193. doi:10.1093/nar/gkr654

Hewison, M. (2010). Vitamin D and the immune system: New perspectives on an old theme. Endocrinology and Metabolism Clinics of North America, 39(2), 365-379. doi:10.1016/ j.ecl.2010.02.010

Hewison, M., Burke, F., Evans, K. N., Lammas, D. A., Sansom, D. M., Liu, P., . . . Adams, J. S. (2007). Extra-renal 25-hydroxyvitamin D3-1alpha-hydroxylase in human health and disease. The Journal of Steroid Biochemistry and Molecular Biology, 103(3-5), 316-321. doi:10.1016/j.jsbmb.2006.12.078

88

Holick, M. F. (2017). The vitamin D deficiency pandemic: Approaches for diagnosis, treatment and prevention. Reviews in Endocrine & Metabolic Disorders, 18(2), 153-165. doi:10.1007/s11154-017-9424-1

Holick, M. F., Binkley, N. C., Bischoff-Ferrari, H. A., Gordon, C. M., Hanley, D. A., Heaney, R. P., . . . Weaver, C. M. (2011). Evaluation, treatment, and prevention of vitamin D deficiency: An endocrine society clinical practice guideline. The Journal of Clinical Endocrinology and Metabolism, 96(7), 1911-1930. doi:10.1210/jc.2011-0385

Horst, R. L., Reinhardt, T. A., & Reddy, G. S. (2005). Vitamin D metabolism. Vitamin D, 1, 15-36.

Hossein-Nezhad, A., Spira, A., & Holick, M. F. (2013). Influence of vitamin D status and vitamin D3 supplementation on genome wide expression of white blood cells: A randomized double-blind clinical trial. PloS One, 8(3), e58725.

Huening, M., Yehia, G., Molina, C. A., & Christakos, S. (2002). Evidence for a regulatory role of inducible cAMP early repressor in protein kinase A-mediated enhancement of vitamin D receptor expression and modulation of hormone action. Molecular Endocrinology, 16(9), 2052-2064. doi:10.1210/me.2001-0260

Hummel, D., Aggarwal, A., Borka, K., Bajna, E., Kállay, E., & Horváth, H. C. (2014). The vitamin D system is deregulated in pancreatic diseases. The Journal of Steroid Biochemistry and Molecular Biology, 144, 402-409. doi:10.1016/j.jsbmb.2014.07.011

Husemoen, L. L. N., Thuesen, B. H., Fenger, M., Jørgensen, T., Glümer, C., Svensson, J., . . . Linneberg, A. (2012). Serum 25(OH)D and type 2 diabetes association in a general population: A prospective study. Diabetes Care, 35(8), 1695-1700. doi:10.2337/dc11-1309

Hyppönen, E. (2010). Vitamin D and increasing incidence of type 1 diabetes-evidence for an association? Diabetes, Obesity & Metabolism, 12(9), 737-743. doi:10.1111/j.1463-1326.2010.01211.x

Hyppönen, E., Läärä, E., Reunanen, A., Järvelin, M. R., & Virtanen, S. M. (2001). Intake of vitamin D and risk of type 1 diabetes: A birth-cohort study. Lancet (London, England), 358(9292), 1500-1503. doi:10.1016/S0140-6736(01)06580-1

Inaba, M., Nishizawa, Y., Song, K., Tanishita, H., Okuno, S., Miki, T., & Morii, H. (1992). Partial protection of 1a-hydroxyvitamin D 3 against the development of diabetes induced by multiple low-dose streptozotocin injection in CD-1 mice. Metabolism, 41(6), 631-635. doi:10.1016/0026-0495(92)90055-F

Inoue, Y., Segawa, H., Kaneko, I., Yamanaka, S., Kusano, K., Kawakami, E., . . . Miyamoto, K. -. (2005). Role of the vitamin D receptor in FGF23 action on phosphate metabolism. Biochemical Journal, 390(1), 325-331. doi:10.1042/BJ20041799

Iruretagoyena, M., Hirigoyen, D., Naves, R., & Burgos, P. I. (2015). Immune response modulation by vitamin D: Role in systemic lupus erythematosus. Frontiers in Immunology, 6 doi:10.3389/fimmu.2015.00513

Jeon, S., & Shin, E. (2018). Exploring vitamin D metabolism and function in cancer. Experimental & Molecular Medicine, 50(4), 20. doi:10.1038/s12276-018-0038-9

89

Johnson, J. A., Grande, J. P., Roche, P. C., & Kumar, R. (1994). Immunohistochemical localization of the 1,25(OH)2D3 receptor and calbindin D28k in human and rat pancreas. The American Journal of Physiology, 267(3 Pt 1), 356. doi:10.115 2/ajpendo.19 94.267.3.E356

Jones, G. (2013). Extrarenal vitamin D activation and interactions between vitamin D2, vitamin D3, and vitamin D analogs doi:10.1146/annurev-nutr-071812-161203 Retrieved from https://www.scopus.com/inward/record.uri?eid=2-s2.0-848 806 77 4 29&doi=10.1146%2fannurev-nutr-071812-161203&partnerID=40&md5= 297b7257ac9a632274c1f711f0d31d0c

Jones, G. (2012). Metabolism and biomarkers of vitamin D. Scandinavian Journal of Clinical and Laboratory Investigation, 72(sup243), 7-13.

Jones, G., Prosser, D. E., & Kaufmann, M. (2012). 25-hydroxyvitamin D-24-hydroxylase (CYP24A1): Its important role in the degradation of vitamin D. Archives of Biochemistry and Biophysics, 523(1), 9-18. doi:10.1016/j.abb.2011.11.003

Jones, G., Prosser, D. E., & Kaufmann, M. (2014). Cytochrome P450-mediated metabolism of vitamin D. Journal of Lipid Research, 55(1), 13-31. doi:10.1194/jlr.R031534

Jones, K. S., Assar, S., Harnpanich, D., Bouillon, R., Lambrechts, D., Prentice, A., & Schoenmakers, I. (2014). 25(OH)D2 half-life is shorter than 25(OH)D3 half-life and is influenced by DBP concentration and genotype. The Journal of Clinical Endocrinology and Metabolism, 99(9), 3373-3381.

Juonala, M., Voipio, A., Pahkala, K., Viikari, J. S. A., Mikkilä, V., Kähönen, M., . . . Raitakari, O. T. (2015). Childhood 25-OH vitamin D levels and carotid intima-media thickness in adulthood: The cardiovascular risk in young finns study. Journal of Clinical Endocrinology and Metabolism, 100(4), 1469-1476. doi:10.1210/jc.2014-3944

Kang, J. K., Kim, O., Hur, J., Yu, S. H., Lamichhane, S., Lee, J. W., . . . Oh, B. (2017). Increased intracellular [ca.sup.2+] concentrations prevent membrane localization of PH domains through the formation of [ca.sup.2+]-phosphoinositides. Proceedings of the National Academy of Sciences of the United States, 114(45), 11926. doi:10.1 073/pnas.1706489114

Kato, S., Takeyama, K., Kitanaka, S., Murayama, A., Sekine, K., & Yoshizawa, T. (1999). In vivo function of VDR in gene expression-VDR knock-out mice. The Journal of Steroid Biochemistry and Molecular Biology, 69(1-6), 247-251. doi:10.1016/s0960-0760(99)00042-4

Kaufmann, M., Lee, S. M., Pike, J. W., & Jones, G. (2015). A high-calcium and phosphate rescue diet and VDR-expressing transgenes normalize serum vitamin D metabolite profiles and renal Cyp27b1 and Cyp24a1 expression in VDR null mice. Endocrinology, 156(12), 4388-4397. doi:10.1210/en.2015-1664

Kayaniyil, S., Retnakaran, R., Harris, S. B., Vieth, R., Knight, J. A., Gerstein, H. C., . . . Hanley, A. J. (2011). Prospective associations of vitamin D with β-cell function and glycemia: The PROspective metabolism and ISlet cell evaluation (PROMISE) cohort study. Diabetes, 60(11), 2947-2953. doi:10.2337/db11-0465

90

Kayaniyil, S., Vieth, R., Retnakaran, R., Knight, J. A., Qi, Y., Gerstein, H. C., . . . Hanley, A. J. (2010). Association of vitamin D with insulin resistance and beta-cell dysfunction in subjects at risk for type 2 diabetes. Diabetes Care, 33(6), 1379-1381. doi:10.233 7/dc09-2321

Khundmiri, S. J., Murray, R. D., & Lederer, E. (2016). PTH and vitamin D. Comprehensive Physiology, 6(2), 561-601. doi:10.1002/cphy.c140071

Kino, T. (2000). Glucocorticoid receptor. In K. R. Feingold, B. Anawalt, A. Boyce, G. Chrousos, K. Dungan, A. Grossman, . . . D. P. Wilson (Eds.), Endotext (). South Dartmouth (MA): MDText.com, Inc. Retrieved from http://www.ncbi.nlm.nih.gov/ books/NBK279171/

Kitahara, C. M., Flint, A. J., Berrington de Gonzalez, A., Bernstein, L., Brotzman, M., MacInnis, R. J., . . . Hartge, P. (2014). Association between class III obesity (BMI of 40-59 kg/m2) and mortality: A pooled analysis of 20 prospective studies. PLoS Medicine, 11(7), e1001673. doi:10.1371/journal.pmed.1001673

Kitanaka, S., Murayama, A., Sakaki, T., Inouye, K., Seino, Y., Fukumoto, S., . . . Kato, S. (1999). No enzyme activity of 25-hydroxyvitamin D3 1alpha-hydroxylase gene product in pseudovitamin D deficiency rickets, including that with mild clinical manifestation. The Journal of Clinical Endocrinology and Metabolism, 84(11), 4111-4117. doi:10.1210/jcem.84.11.6131

Knip, M., Virtanen, S. M., Seppä, K., Ilonen, J., Savilahti, E., Vaarala, O., . . . Akerblom, H. K. (2010). Dietary intervention in infancy and later signs of beta-cell autoimmunity. The New England Journal of Medicine, 363(20), 1900-1908. doi:10.1056/ NEJMoa10 04809

Knutson, J. C., & DeLuca, H. F. (1974). 25-hydroxyvitamin D3-24-hydroxylase. subcellular location and properties. Biochemistry, 13(7), 1543-1548. doi:10.1021/bi00704a034

Koszewski, N. J., Alimov, A. P., Park-Sarge, O., & Malluche, H. H. (2004). Suppression of the human parathyroid hormone promoter by vitamin D involves displacement of NF-Y binding to the vitamin D response element. The Journal of Biological Chemistry, 279(41), 42431-42437. doi:10.1074/jbc.M407742200

Kriebitzsch, C., Verlinden, L., Eelen, G., Tan, B. K., Van Camp, M., Bouillon, R., & Verstuyf, A. (2009). The impact of 1,25(OH)2D3 and its structural analogs on gene expression in cancer cells--a microarray approach. Anticancer Research, 29(9), 3471-3483.

Kumar, J., Muntner, P., Kaskel, F. J., Hailpern, S. M., & Melamed, M. L. (2009). Prevalence and associations of 25-hydroxyvitamin D deficiency in US children: NHANES 2001-2004. Pediatrics, 124(3), 362. doi:10.1542/peds.2009-0051

Lai, L., Leone, T. C., Zechner, C., Schaeffer, P. J., Kelly, S. M., Flanagan, D. P., . . . Kelly, D. P. (2008). Transcriptional coactivators PGC-1alpha and PGC-lbeta control overlapping programs required for perinatal maturation of the heart. Genes & Development, 22(14), 1948-1961. doi:10.1101/gad.1661708

91

Lämsä, V., Levonen, A., Leinonen, H., Ylä-Herttuala, S., Yamamoto, M., & Hakkola, J. (2010). Cytochrome P450 2A5 constitutive expression and induction by heavy metals is dependent on redox-sensitive transcription factor Nrf2 in liver. Chemical Research in Toxicology, 23(5), 977-985. doi:10.1021/tx100084c

Larsson, T., Marsell, R., Schipani, E., Ohlsson, C., Ljunggren, Ö, Tenenhouse, H. S., . . . Jonsson, K. B. (2004). Transgenic mice expressing fibroblast growth factor 23 under the control of the α1(I) collagen promoter exhibit growth retardation, osteomalacia, and disturbed phosphate homeostasis. Endocrinology, 145(7), 3087-3094. doi:10.1210/ en.2003-1768

Lee, S. J., Lee, E. Y., Lee, J. H., Kim, J. E., Kim, K. J., Rhee, Y., . . . Kim, C. O. (2019). Associations of serum 25-hydroxyvitamin D with metabolic syndrome and its components in elderly men and women: The korean urban rural elderly cohort study. BMC Geriatrics, 19 doi:10.1186/s12877-019-1118-y

Legarth, C., Grimm, D., Wehland, M., Bauer, J., & Krüger, M. (2018). The impact of vitamin D in the treatment of essential hypertension. International Journal of Molecular Sciences, 19(2) doi:10.3390/ijms19020455

Li, X., Liao, L., Yan, X., Huang, G., Lin, J., Lei, M., . . . Zhou, Z. (2009). Protective effects of 1-alpha-hydroxyvitamin D3 on residual beta-cell function in patients with adult-onset latent autoimmune diabetes (LADA). Diabetes/Metabolism Research and Reviews, 25(5), 411-416. doi:10.1002/dmrr.977

Li, X., Liu, Y., Zheng, Y., Wang, P., & Zhang, Y. (2018). The effect of vitamin D supplementation on glycemic control in type 2 diabetes patients: A systematic review and meta-analysis. Nutrients, 10(3), 375. doi:10.3390/nu10030375

Li, Y. C., Pirro, A. E., Amling, M., Delling, G., Baron, R., Bronson, R., & Demay, M. B. (1997). Targeted ablation of the vitamin D receptor: An animal model of vitamin D-dependent rickets type II with alopecia. Proceedings of the National Academy of Sciences of the United States of America, 94(18), 9831-9835.

Li, Y. C., Kong, J., Wei, M., Chen, Z., Liu, S. Q., & Cao, L. (2002). 1,25-dihydroxyvitamin D3 is a negative endocrine regulator of the renin-angiotensin system. The Journal of Clinical Investigation, 110(2), 229-238. doi:10.1172/JCI15219

Li, Z., Joyal, J. L., & Sacks, D. B. (2000). Binding of IRS proteins to calmodulin is enhanced in insulin resistance. Biochemistry, 39(17), 5089-5096. doi:10.1021/bi992623z

Liu, C., & Lin, J. D. (2011). PGC-1 coactivators in the control of energy metabolism. Acta Biochimica Et Biophysica Sinica, 43(4), 248-257. doi:10.1093/abbs/gmr007

Llewellyn, D. J., Lang, I. A., Langa, K. M., Muniz-Terrera, G., Phillips, C. L., Cherubini, A., . . . Melzer, D. (2010). Vitamin D and risk of cognitive decline in elderly persons. Archives of Internal Medicine, 170(13), 1135-1141. doi:10.1001/ archinternmed.201 0.173

Lopez, E. R., Zwermann, O., Segni, M., Meyer, G., Reincke, M., Seissler, J., . . . Badenhoop, K. (2004). A promoter polymorphism of the CYP27B1 gene is associated with addison's disease, hashimoto's thyroiditis, graves' disease and type 1 diabetes mellitus in germans. European Journal of Endocrinology, 151(2), 193-197. doi:10.1530/eje.0.1510193

92

Mackey, S. L., Heymont, J. L., Kronenberg, H. M., & Demay, M. B. (1996). Vitamin D receptor binding to the negative human parathyroid hormone vitamin D response element does not require the retinoid x receptor. Molecular Endocrinology (Baltimore, Md.), 10(3), 298-305. doi:10.1210/mend.10.3.8833658

Maestro, B., Molero, S., Bajo, S., Dávila, N., & Calle, C. (2002). Transcriptional activation of the human insulin receptor gene by 1,25-dihydroxyvitamin D(3). Cell Biochemistry and Function, 20(3), 227-232. doi:10.1002/cbf.951

Maestro, B., Dávila, N., Carranza, M. C., & Calle, C. (2003). Identification of a vitamin D response element in the human insulin receptor gene promoter. The Journal of Steroid Biochemistry and Molecular Biology, 84(2-3), 223-230. doi:10.1016/s0960-0760(03)0 0032-3

Mangan, A., Le Roux, C. W., Miller, N. G., & Docherty, N. G. (2019). Iron and vitamin D/calcium deficiency after gastric bypass: Mechanisms involved and strategies to improve oral supplement disposition. Current Drug Metabolism, 20(3), 244-252. doi:10.2174/1389200219666181026160242

Manousaki, D., Dudding, T., Haworth, S., Hsu, Y., Liu, C., Medina-Gómez, C., . . . Richards, J. B. (2017). Low-frequency synonymous coding variation in CYP2R1 has large effects on vitamin D levels and risk of multiple sclerosis. American Journal of Human Genetics, 101(2), 227-238.

Marcotorchino, J., Tourniaire, F., Astier, J., Karkeni, E., Canault, M., Amiot, M., . . . Landrier, J. (2014). Vitamin D protects against diet-induced obesity by enhancing fatty acid oxidation. Journal of Nutritional Biochemistry, 25(10), 1077-1083. doi:10.101 6/j.jnutbio.2014.05.010

Martineau, C., Naja, R. P., Husseini, A., Hamade, B., Kaufmann, M., Akhouayri, O., . . . St-Arnaud, R. (2018). Optimal bone fracture repair requires 24R,25-dihydroxyvitamin D3 and its effector molecule FAM57B2. The Journal of Clinical Investigation, 128(8), 3546-3557. doi:10.1172/JCI98093

Marti-Soler, H., Gonseth, S., Gubelmann, C., Stringhini, S., Bovet, P., Chen, P., . . . Marques-Vidal, P. (2014). Seasonal variation of overall and cardiovascular mortality: A study in 19 countries from different geographic locations. PLoS ONE, 9(11) doi:10.1371/journal.pone.0113500

Mason, C., Xiao, L., Imayama, I., Duggan, C. R., Bain, C., Foster-Schubert, K. E., . . . McTiernan, A. (2011). Effects of weight loss on serum vitamin D in postmenopausal women. The American Journal of Clinical Nutrition, 94(1), 95-103. doi:10.3945/ ajcn.111.015552

Masuda, S., Strugnell, S. A., Knutson, J. C., St-Arnaud, R., & Jones, G. (2006). Evidence for the activation of 1α-hydroxyvitamin D 2 by 25-hydroxyvitamin D-24-hydroxylase: Delineation of pathways involving 1α,24-dihydroxyvitamin D 2 and 1α,25-dihydroxyvitamin D 2. BBA - Molecular and Cell Biology of Lipids, 1761(2), 221-234. doi:10.1016/j.bbalip.2006.01.004

Matfin, G., & Pratley, R. E. (2010). Advances in the treatment of prediabetes. London, England: SAGE Publications. doi:10.1177/2042018810366429

93

Mathieu, C., Laureys, J., Sobis, H., Vandeputte, M., Waer, M., & Bouillon, R. (1992). 1,25-dihydroxyvitamin D3 prevents insulitis in NOD mice. Diabetes, 41(11), 1491-1495. doi:10.2337/diab.41.11.1491

Mathieu, C., Van Etten, E., Gysemans, C., Decallonne, B., Kato, S., Laureys, J., . . . Bouillon, R. (2001). In vitro and in vivo analysis of the immune system of vitamin D receptor knockout mice. Journal of Bone and Mineral Research, 16(11), 2057-2065. doi:10.1359/jbmr.2001.16.11.2057

Mathieu, C., Waer, M., Laureys, J., Rutgeerts, O., & Bouillon, R. (1994). Prevention of autoimmune diabetes in NOD mice by 1,25 dihydroxyvitamin D3. Diabetologia, 37(6), 552-558. doi:10.1007/BF00403372

Mathieu, C., & Badenhoop, K. (2005). Vitamin D and type 1 diabetes mellitus: State of the art. Trends in Endocrinology and Metabolism: TEM, 16(6), 261-266. doi:10.1016/ j.tem.2005.06.004

Matthews, D. G., D'Angelo, J., Drelich, J., & Welsh, J. (2016). Adipose-specific vdr deletion alters body fat and enhances mammary epithelial density. The Journal of Steroid Biochemistry and Molecular Biology, 164, 299-308. doi:10.1016/j.jsbmb.2015.09.035

McDermott, M. F., Ramachandran, A., Ogunkolade, B. W., Aganna, E., Curtis, D., Boucher, B. J., . . . Hitman, G. A. (1997). Allelic variation in the vitamin D receptor influences susceptibility to IDDM in indian asians. Diabetologia, 40(8), 971-975. doi:10.1007/ s001250050776

McDonnell, S. L., Baggerly, C. A., French, C. B., Baggerly, L. L., Garland, C. F., Gorham, E. D., . . . Heaney, R. P. (2018). Serum 25-hydroxyvitamin D concentrations ≥40 ng/ml are associated with >65% lower cancer risk: Pooled analysis of randomized trial and prospective cohort study.11(4), e0152441. doi:10.5281/zenodo.1299363

Merlotti, C., Ceriani, V., Morabito, A., & Pontiroli, A. E. (2017). Subcutaneous fat loss is greater than visceral fat loss with diet and exercise, weight-loss promoting drugs and bariatric surgery: A critical review and meta-analysis. International Journal of Obesity (2005), 41(5), 672-682. doi:10.1038/ijo.2017.31

Meyer, M. B., Goetsch, P. D., & Pike, J. W. (2010). A downstream intergenic cluster of regulatory enhancers contributes to the induction of CYP24A1 expression by 1alpha,25-dihydroxyvitamin D3. The Journal of Biological Chemistry, 285(20), 15599-15610. doi:10.1074/jbc.M110.119958

Mitri, J., Muraru, M. D., & Pittas, A. G. (2011). Vitamin D and type 2 diabetes: A systematic review. European Journal of Clinical Nutrition, 65(9), 1005-1015. doi:10.1038/ ejcn.2011.118

Miyaura, C., Abe, E., Kuribayashi, T., Tanaka, H., Konno, K., Nishii, Y., & Suda, T. (1981). 1α,25-dihydroxyvitamin D3 induces differentiation of human myeloid leukemia cells. Biochemical and Biophysical Research Communications, 102(3), 937-943. doi:10.1 016/0006-291X(81)91628-4

Molin, A., Baudoin, R., Kaufmann, M., Souberbielle, J. C., Ryckewaert, A., Vantyghem, M. C., . . . Kottler, M. -. (2015). CYP24A1 mutations in a cohort of hypercalcemic patients: Evidence for a recessive trait. The Journal of Clinical Endocrinology and Metabolism, 100(10), 1343. doi:10.1210/jc.2014-4387

94

Molin, A., Wiedemann, A., Demers, N., Kaufmann, M., Do Cao, J., Mainard, L., . . . Feillet, F. (2017). Vitamin D-dependent rickets type 1B (25-hydroxylase deficiency): A rare condition or a misdiagnosed condition? Journal of Bone and Mineral Research: The Official Journal of the American Society for Bone and Mineral Research, 32(9), 1893-1899.

Morris, H. A., & Anderson, P. H. (2010). Autocrine and paracrine actions of vitamin D. Clin Biochem Rev, 31(4), 129-138.

Morró, M., Vilà, L., Franckhauser, S., Mallol, C., Elias, G., Ferré, T., . . . Casellas, A. (2020). Vitamin D receptor overexpression in β-cells ameliorates diabetes in mice. Diabetes, doi:10.2337/db19-0757

Mukhtar, M., Batool, A., Wajid, A., & Qayyum, I. (2017). Vitamin D receptor gene polymorphisms influence T1D susceptibility among pakistanis. International Journal of Genomics, 2017, 4171254. doi:10.1155/2017/4171254

Munger, K. L., Levin, L. I., Massa, J., Horst, R., Orban, T., & Ascherio, A. (2013). Preclinical serum 25-hydroxyvitamin D levels and risk of type 1 diabetes in a cohort of US military personnel. American Journal of Epidemiology, 177(5), 411-419. doi: 10.1093/aje/kws243

Muscogiuri, G., Altieri, B., Annweiler, C., Balercia, G., Pal, H. B., Boucher, B. J., . . . Colao, A. (2017). Vitamin D and chronic diseases: The current state of the art. Archives of Toxicology, 91(1), 97-107. doi:10.1007/s00204-016-1804-x

Narvaez, C. J., Matthews, D., Broun, E., Chan, M., & Welsh, J. (2009). Lean phenotype and resistance to diet-induced obesity in vitamin D receptor knockout mice correlates with induction of uncoupling protein-1 in white adipose tissue. Endocrinology, 150(2), 651-661. doi:10.1210/en.2008-1118

Nejentsev, S., Cooper, J. D., Godfrey, L., Howson, J. M. M., Rance, H., Nutland, S., . . . Todd, J. A. (2004). Analysis of the vitamin D receptor gene sequence variants in type 1 diabetes. Diabetes, 53(10), 2709-2712. doi:10.2337/diabetes.53.10.2709

Nimitphong, H., Holick, M. F., Fried, S. K., & Lee, M. (2012). 25-hydroxyvitamin D3 and 1,25-dihydroxyvitamin D3 promote the differentiation of human subcutaneous preadipocytes. PloS One, 7(12), e52171. doi:10.1371/journal.pone.0052171

Norlin, A., Hansen, S., Wahren-Borgstrom, E., Granert, C., Bjorkhem-Bergman, L., & Bergman, P. (2016). Vitamin D.sub.3 supplementation and antibiotic consumption - results from a prospective, observational study at an immune-deficiency unit in sweden. PLoS ONE, 11(9), e0163451. doi:10.1371/journal.pone.0163451

Norman, A. W. (2008). From vitamin D to hormone D: Fundamentals of the vitamin D endocrine system essential for good health. American Journal of Clinical Nutrition, 88(2), 491S-499S. Retrieved from https://www.scopus.com/inward/record.uri?eid=2-s2.0-49449100141&partnerID=40&md5=4bcfcbf5b2a5867b14f0ce87c0e44c5a

Norman, A. W., Frankel, B. J., Heldt, A. M., & Grodsky, G. M. (1980). Vitamin D deficiency inhibits pancreatic secretion of insulin. Science, 209(4458), 823-825. doi:10.1126/ science.6250216

Nurminen, V., Seuter, S., & Carlberg, C. (2019). Primary vitamin D target genes of human monocytes. Frontiers in Physiology, 10 doi:10.3389/fphys.2019.00194

95

Nyomba, B. L., Auwerx, J., Bormans, V., Peeters, T. L., Pelemans, W., Reynaert, J., . . . De Moor, P. (1986). Pancreatic secretion in man with subclinical vitamin D deficiency. Diabetologia, 29(1), 34-38. doi:10.1007/BF02427278

Oakley, R. H., & Cidlowski, J. A. (2013). The biology of the glucocorticoid receptor: New signaling mechanisms in health and disease. The Journal of Allergy and Clinical Immunology, 132(5), 1033-1044. doi:10.1016/j.jaci.2013.09.007

Oberkofler, H., Schraml, E., Krempler, F., & Patsch, W. (2003). Potentiation of liver X receptor transcriptional activity by peroxisome-proliferator-activated receptor γ co-activator 1α. The Biochemical Journal, 371(Pt 1), 89-96. doi:10.1042/BJ20021665

Oliveira, R. M. S., Novaes, J. F., Azeredo, L. M., Azeredo, L. M., Cândido, A. P. C., & Leite, I. C. G. (2014). Association of vitamin D insufficiency with adiposity and metabolic disorders in brazilian adolescents. Public Health Nutrition, 17(4), 787-794. doi:1 0.1017/S1368980013001225

Ooi, J. H., Chen, J., & Cantorna, M. T. (2012). Vitamin D regulation of immune function in the gut: Why do T cells have vitamin D receptors? Molecular Aspects of Medicine, 33(1), 77-82. doi:10.1016/j.mam.2011.10.014

Opherk, C., Tronche, F., Kellendonk, C., Kohlmüller, D., Schulze, A., Schmid, W., & Schütz, G. (2004). Inactivation of the glucocorticoid receptor in hepatocytes leads to fasting hypoglycemia and ameliorates hyperglycemia in streptozotocin-induced diabetes mellitus. Molecular Endocrinology (Baltimore, Md.), 18(6), 1346-1353. doi:1 0.1210/me.2003-0283

Overbergh, L., Decallonne, B., Waer, M., Rutgeerts, O., Valckx, D., Casteels, K. M., . . . Mathieu, C. (2000). 1a,25-dihydroxyvitamin D3 induces an autoantigen-specific T-helper 1/T-helper 2 immune shift in NOD mice immunized with GAD65 (p524-543). Diabetes, 49(8), 1301-1307. doi:10.2337/diabetes.49.8.1301

Ozfirat, Z., & Chowdhury, T. A. (2010). Vitamin D deficiency and type 2 diabetes. Postgraduate Medical Journal, 86(1011), 18-25; quiz 24. doi:10.1136/ pgmj.2009.078 626

Palomer, X., González-Clemente, J. M., Blanco-Vaca, F., & Mauricio, D. (2008). Role of vitamin D in the pathogenesis of type 2 diabetes mellitus. Diabetes, Obesity & Metabolism, 10(3), 185-197. doi:10.1111/j.1463-1326.2007.00710.x

Parsanathan, R., & Jain, S. K. (2019). Glutathione deficiency induces epigenetic alterations of vitamin D metabolism genes in the livers of high-fat diet-fed obese mice. Scientific Reports, 9(1), 14784. doi:10.1038/s41598-019-51377-5

Pascussi, J. M., Robert, A., Nguyen, M., Walrant-Debray, O., Garabedian, M., Martin, P., . . . Vilarem, M. J. (2005). Possible involvement of pregnane X receptor-enhanced CYP24 expression in drug-induced osteomalacia. The Journal of Clinical Investigation, 115(1), 177-186. doi:10.1172/JCI21867

Pearce, S. H. S., & Cheetham, T. D. (2010). Diagnosis and management of vitamin D deficiency. BMJ (Clinical Research Ed.), 340, b5664. doi:10.1136/bmj.b5664

Penna-Martinez, M., & Badenhoop, K. (2017). Inherited variation in vitamin D genes and type 1 diabetes predisposition. Genes, 8(4) doi:10.3390/genes8040125

96

Pereira-Santos, M., Costa, P. R. F., Assis, A. M. O., Santos, C. a. S. T., & Santos, D. B. (2015). Obesity and vitamin D deficiency: A systematic review and meta-analysis. Obesity Reviews: An Official Journal of the International Association for the Study of Obesity, 16(4), 341-349. doi:10.1111/obr.12239

Perwad, F., Zhang, M. Y. H., Tenenhouse, H. S., & Portale, A. A. (2007). Fibroblast growth factor 23 impairs phosphorus and vitamin D metabolism in vivo and suppresses 25-hydroxyvitamin D-1α-hydroxylase expression in vitro. American Journal of Physiology - Renal Physiology, 293(5), F1577-F1583. doi:10.1152/ajprenal.00463.2006

Pike, J. W., & Meyer, M. B. (2012). Regulation of mouse Cyp24a1 expression via promoter-proximal and downstream-distal enhancers highlights new concepts of 1,25-dihydroxyvitamin D(3) action. Archives of Biochemistry and Biophysics, 523(1), 2-8. doi:10.1016/j.abb.2011.12.003

Pinheiro, M. M., Pinheiro, F. M. M., & Torres, M. A. (2016). Four-year clinical remission of type 1 diabetes mellitus in two patients treated with sitagliptin and vitamin D3. Endocrinology, Diabetes & Metabolism Case Reports, 2016(1), 1-6. doi:10.1530/EDM-16-0099

Pinheiro, M. M., Pinheiro, F. M. M., & Trabachin, M. L. (2018). Dipeptidyl peptidase-4 inhibitors (DPP-4i) combined with vitamin D3: An exploration to treat new-onset type 1 diabetes mellitus and latent autoimmune diabetes in adults in the future. International Immunopharmacology, 57, 11-17. doi:10.1016/j.intimp.2018.02.003

Pittas, A. G., Dawson-Hughes, B., Sheehan, P., Ware, J. H., Knowler, W. C., Aroda, V. R., . . . Staten, M. (2019). Vitamin D supplementation and prevention of type 2 diabetes. The New England Journal of Medicine, 381(6), 520-530. doi:10.1056 /NEJMoa1900 906

Pittas, A. G., Lau, J., Hu, F. B., & Dawson-Hughes, B. (2007). The role of vitamin D and calcium in type 2 diabetes. A systematic review and meta-analysis. The Journal of Clinical Endocrinology and Metabolism, 92(6), 2017-2029. doi:10.1210/jc.2007-0298

Pludowski, P., Holick, M. F., Grant, W. B., Konstantynowicz, J., Mascarenhas, M. R., Haq, A., . . . Wimalawansa, S. J. (2017). Vitamin D supplementation guidelines. Journal of Steroid Biochemistry and Molecular Biology, doi:10.1016/j.jsbmb.2017.01.021

Płudowski, P., Karczmarewicz, E., Bayer, M., Carter, G., Chlebna-Sokół, D., Czech-Kowalska, J., . . . Zmijewski, M. A. (2013). Practical guidelines for the supplementation of vitamin D and the treatment of defcits in central europe - recommended vitamin D intakes in the general population and groups at risk of vitamin D deficiency. End okr- ynologia Polska, 64(4), 319-327. doi:10.5603/EP.2013.0012

Polly, P., Herdick, M., Moehren, U., Baniahmad, A., Heinzel, T., & Carlberg, C. (2000). VDR-alien: A novel, DNA-selective vitamin D(3) receptor-corepressor partnership. FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology, 14(10), 1455-1463. doi:10.1096/fj.14.10.1455

97

Pronicka, E., Ciara, E., Halat, P., Janiec, A., Wójcik, M., Rowińska, E., . . . Litwin, M. (2017). Biallelic mutations in CYP24A1 or SLC34A1 as a cause of infantile idiopathic hypercalcemia (IIH) with vitamin D hypersensitivity: Molecular study of 11 historical IIH cases. Journal of Applied Genetics, 58(3), 349-353. doi:10.1007/s13353-017-0397-2

Prosser, D. E., & Jones, G. (2004). Enzymes involved in the activation and inactivation of vitamin D. Trends in Biochemical Sciences, 29(12), 664-673. doi:S0968-0004(04)0 0270-1 [pii]

Puigserver, P., Wu, Z., Park, C. W., Graves, R., Wright, M., & Spiegelman, B. M. (1998). A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell, 92(6), 829-839. doi:10.1016/s0092-8674(00)81410-5

Quesada-Gomez, J. M., & Bouillon, R. (2018). Is calcifediol better than cholecalciferol for vitamin D supplementation? Osteoporosis International: A Journal Established as Result of Cooperation between the European Foundation for Osteoporosis and the National Osteoporosis Foundation of the USA, 29(8), 1697-1711. doi:10.1007/s00198-018-4520-y

Ramagopalan, S. V., Heger, A., Berlanga, A. J., Maugeri, N. J., Lincoln, M. R., Burrell, A., . . . Knight, J. C. (2010). A ChIP-seq defined genome-wide map of vitamin D receptor binding: Associations with disease and evolution. Genome Research, 20(10), 1352-1360. doi:10.1101/gr.107920.110

Ramon, I., Kleynen, P., Body, J. -., & Karmali, R. (2010). Fibroblast growth factor 23 and its role in phosphate homeostasis. European Journal of Endocrinology, 162(1), 1-10. doi:10.1530/EJE-09-0597

Ramos-Lopez, E., Bruck, P., Jansen, T., Herwig, J., & Badenhoop, K. (2007). CYP2R1 (vitamin D 25-hydroxylase) gene is associated with susceptibility to type 1 diabetes and vitamin D levels in germans. Diabetes/Metabolism Research and Reviews, 23(8), 631-636. doi:10.1002/dmrr.719 [doi]

Rapti, E., Karras, S., Grammatiki, M., Mousiolis, A., Tsekmekidou, X., Potolidis, E., . . . Kotsa, K. (2016). Combined treatment with sitagliptin and vitamin D in a patient with latent autoimmune diabetes in adults. Endocrinology, Diabetes & Metabolism Case Reports, 2016, 150136. doi:10.1530/EDM-15-0136

Rasoul, M. A., Haider, M. Z., Al-Mahdi, M., Al-Kandari, H., & Dhaunsi, G. S. (2019). Relationship of four vitamin D receptor gene polymorphisms with type 1 diabetes mellitus susceptibility in kuwaiti children. BMC Pediatrics, 19(1), 71. doi:10.1186/s12887-019-1448-0

Raunio, H., Valtonen, J., Honkakoski, P., Lang, M. A., Ståhlberg, M., Kairaluoma, M. A., . . . Pelkonen, O. (1990). Immunochemical detection of human liver cytochrome P450 forms related to phenobarbital-inducible forms in the mouse. Biochemical Pharm- acology, 40(11), 2503-2509.

Rehman, K., & Akash, M. S. H. (2016). Mechanisms of inflammatory responses and development of insulin resistance: How are they interlinked? Journal of Biomedical Science, 23 doi:10.1186/s12929-016-0303-y

98

Reinhardt, T. A., & Horst, R. L. (1990). Parathyroid hormone down-regulates 1, 25-dihydroxyvitamin D receptors (VDR) and VDR messenger ribonucleic acid in vitro and blocks homologous up-regulation of VDR in vivo. Endocrinology, 127(2), 942-948. doi:10.1210/endo-127-2-942

Reusch, J. E., Begum, N., Sussman, K. E., & Draznin, B. (1991). Regulation of GLUT-4 phosphorylation by intracellular calcium in adipocytes. Endocrinology, 129(6), 3269-3273. doi:10.1210/endo-129-6-3269

Rewers, M., & Ludvigsson, J. (2016). Environmental risk factors for type 1 diabetes. Lancet (London, England), 387(10035), 2340-2348. doi:10.1016/S0140-6736(16)30507-4

Riachy, R., Vandewalle, B., Belaich, S., Kerr-Conte, J., Gmyr, V., Zerimech, F., . . . Pattou, F. (2001). Beneficial effect of 1,25 dihydroxyvitamin D3 on cytokine-treated human pancreatic islets. The Journal of Endocrinology, 169(1), 161-168.

Robinson, J. G., Manson, J. E., Larson, J., Liu, S., Song, Y., Howard, B. V., . . . Watts, N. (2011). Lack of association between 25(OH)D levels and incident type 2 diabetes in older women. Diabetes Care, 34(3), 628-634. doi:10.2337/dc10-1632

Rock, C. L., Emond, J. A., Flatt, S. W., Heath, D. D., Karanja, N., Pakiz, B., . . . Thomson, C. A. (2012). Weight loss is associated with increased serum 25-hydroxyvitamin D in overweight or obese women. Obesity (Silver Spring, Md.), 20(11), 2296-2301. doi:10.1038/oby.2012.57

Roizen, J. D., Long, C., Casella, A., O'Lear, L., Caplan, I., Lai, M., . . . Levine, M. A. (2019). Obesity decreases hepatic 25-hydroxylase activity causing low serum 25-hydroxyvitamin D. Journal of Bone and Mineral Research: The Official Journal of the American Society for Bone and Mineral Research, 34(6), 1068-1073. doi:10.1002/ jbmr.3686

Rosenstreich, S. J., Rich, C., & Volwiler, W. (1971). Deposition in and release of vitamin D3 from body fat: Evidence for a storage site in the rat. The Journal of Clinical Investigation, 50(3), 679-687. doi:10.1172/JCI106538

Rosenthal, N., Insogna, K. L., Godsall, J. W., Smaldone, L., Waldron, J. A., & Stewart, A. F. (1985). Elevations in circulating 1,25-dihydroxyvitamin D in three patients with lymphoma-associated hypercalcemia. The Journal of Clinical Endocrinology and Metabolism, 60(1), 29-33. doi:10.1210/jcem-60-1-29

Ross, A. C., Manson, J. E., Abrams, S. A., Aloia, J. F., Brannon, P. M., Clinton, S. K., . . . Shapses, S. A. (2011). The 2011 report on dietary reference intakes for calcium and vitamin D from the institute of medicine: What clinicians need to know. The Journal of Clinical Endocrinology and Metabolism, 96(1), 53-58. doi:10.1210/jc.2010-2704

Russell, J., Ashok, S., & Koszewski, N. J. (1999). Vitamin D receptor interactions with the rat parathyroid hormone gene: Synergistic effects between two negative vitamin D response elements. Journal of Bone and Mineral Research: The Official Journal of the American Society for Bone and Mineral Research, 14(11), 1828-1837. doi:10.1 359/jbmr.1999.14.11.1828

Sabetta, J. R., DePetrillo, P., Cipriani, R. J., Smardin, J., Burns, L. A., & Landry, M. L. (2010). Serum 25-hydroxyvitamin d and the incidence of acute viral respiratory tract infections in healthy adults. PloS One, 5(6), e11088. doi:10.1371/journal.pone.0011088

99

Saeedi, P., Petersohn, I., Salpea, P., Malanda, B., Karuranga, S., Unwin, N., . . . Williams, R. (2019). Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the international diabetes federation diabetes atlas, 9th edition. Diabetes Research and Clinical Practice, 157, 107843. doi:10.1016/ j.diabres.2 019.107843

Saggese, G., Federico, G., Balestri, M., & Toniolo, A. (1989). Calcitriol inhibits the PHA-induced production of IL-2 and IFN-gamma and the proliferation of human peripheral blood leukocytes while enhancing the surface expression of HLA class II molecules. Journal of Endocrinological Investigation, 12(5), 329-335.

Saini, V., Zhao, H., Petit, E. T., Gori, F., & Demay, M. B. (2017). Absence of vitamin D receptor (VDR)-mediated PPARγ suppression causes alopecia in VDR-null mice. FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology, 31(3), 1059-1066. doi:10.1096/fj.201600863R

Salonpää, P., Pelkonen, O., Kojo, A., Pasanen, M., Negishi, M., & Raunio, H. (1994). Cytochrome P4502A5 expression and inducibility by phenobarbital is modulated by cAMP in mouse primary hepatocytes. Biochemical and Biophysical Research Communications, 205(1), 631-637. doi:10.1006/bbrc.1994.2712

Samuel, L., & Borrell, L. N. (2014). The effect of body mass index on adequacy of serum 25-hydroxyvitamin D levels in US adults: The national health and nutrition examination survey 2001 to 2006. Annals of Epidemiology, 24(10), 781-784. doi:10.1016/j.annep idem.2014.07.016

Savkur, R. S., Bramlett, K. S., Stayrook, K. R., Nagpal, S., & Burris, T. P. (2005). Coactivation of the human vitamin D receptor by the peroxisome proliferator-activated receptor gamma coactivator-1 alpha. Molecular Pharmacology, 68(2), 511-517. doi: 10.1124/mol.105.012708

Sawada, N., Sakaki, T., Kitanaka, S., Kato, S., & Inouye, K. (2001). Structure-function analysis of CYP27B1 and CYP27A1. studies on mutants from patients with vitamin D-dependent rickets type I (VDDR-I) and cerebrotendinous xanthomatosis (CTX). European Journal of Biochemistry, 268(24), 6607-6615. doi:10.1046/j.0014-2956. 2001.02615.x

Schlingmann, K. P., Kaufmann, M., Weber, S., Irwin, A., Goos, C., John, U., . . . Konrad, M. (2011). Mutations in CYP24A1 and idiopathic infantile hypercalcemia. The New England Journal of Medicine, 365(5), 410-421. doi:10.1056/NEJMoa1103864

Schreiber, S. N., Emter, R., Hock, M. B., Knutti, D., Cardenas, J., Podvinec, M., . . . Kralli, A. (2004). The estrogen-related receptor alpha (ERRalpha) functions in PPARgamma coactivator 1alpha (PGC-1alpha)-induced mitochondrial biogenesis. Proceedings of the National Academy of Sciences of the United States of America, 101(17), 6472-6477. doi:10.1073/pnas.0308686101

Scragg, R., Sowers, M., & Bell, C. (2004). Serum 25-hydroxyvitamin D, diabetes, and ethnicity in the third national health and nutrition examination survey. Diabetes Care, 27(12), 2813-2818. doi:10.2337/diacare.27.12.2813

100

Segersten, U., Correa, P., Hewison, M., Hellman, P., Dralle, H., Carling, T., . . . Westin, G. (2002). 25-hydroxyvitamin D(3)-1alpha-hydroxylase expression in normal and pathological parathyroid glands. The Journal of Clinical Endocrinology and Metabolis- m, 87(6), 2967-2972. doi:10.1210/jcem.87.6.8604

Sentinelli, F., Bertoccini, L., Barchetta, I., Capoccia, D., Incani, M., Pani, M. G., . . . Cavallo, M. G. (2016). The vitamin D receptor (VDR) gene rs11568820 variant is associated with type 2 diabetes and impaired insulin secretion in italian adult subjects, and associates with increased cardio-metabolic risk in children. Nutrition, Metabolism, and Cardiovascular Diseases: NMCD, 26(5), 407-413. doi:10.1016/j.numecd.2016.02.004

Sergeev, I. N. (2016). 1,25-dihydroxyvitamin D3 and type 2 diabetes: Ca2+-dependent molecular mechanisms and the role of vitamin D status. Hormone Molecular Biology and Clinical Investigation, 26(1), 61-65. doi:10.1515/hmbci-2015-0069

Shahijanian, F., Parnell, G. P., McKay, F. C., Gatt, P. N., Shojoei, M., O'Connor, K. S., . . . Booth, D. R. (2014). The CYP27B1 variant associated with an increased risk of autoimmune disease is underexpressed in tolerizing dendritic cells. Human Molecular Genetics, 23(6), 1425-1434. doi:10.1093/hmg/ddt529

Shimada, T., Hasegawa, H., Yamazaki, Y., Muto, T., Hino, R., Takeuchi, Y., . . . Yamashita, T. (2004). FGF-23 is a potent regulator of vitamin D metabolism and phosphate homeostasis. Journal of Bone and Mineral Research, 19(3), 429-435. doi:10.1359/ JBMR.0301264

Shimada, T., Yamazaki, Y., Takahashi, M., Hasegawa, H., Urakawa, I., Oshima, T., . . . Yamashita, T. (2005). Vitamin D receptor-independent FGF23 actions in regulating phosphate and vitamin D metabolism. American Journal of Physiology - Renal Physiology, 289(5 58-5), F1088-F1095. doi:10.1152/ajprenal.00474.2004

Shimano, H., & Sato, R. (2017). SREBP-regulated lipid metabolism: Convergent physiology - divergent pathophysiology. Nature Reviews. Endocrinology, 13(12), 710-730. doi: 10.1038/nrendo.2017.91

Shinki, T., Cheng, H. J., Nishimura, A., Nagai, Y., Ohyama, Y., Noshiro, M., . . . Suda, T. (1992). Parathyroid hormone inhibits 25-hydroxyvitamin D3-24-hydroxylase mRNA expression stimulated by 1α,25-dihydroxyvitamin D3 in rat kidney but not in intestine. Journal of Biological Chemistry, 267(19), 13757-13762.

Shteyer, E., Liao, Y., Muglia, L. J., Hruz, P. W., & Rudnick, D. A. (2004). Disruption of hepatic adipogenesis is associated with impaired liver regeneration in mice. Hepatology (Baltimore, Md.), 40(6), 1322-1332. doi:10.1002/hep.20462

Silva, M. C., & Furlanetto, T. W. (2018). Intestinal absorption of vitamin D: A systematic review. Nutrition Reviews, 76(1), 60-76. doi:10.1093/nutrit/nux034

Silvagno, F., Poma, C. B., Realmuto, C., Ravarino, N., Ramella, A., Santoro, N., . . . Zola, P. (2010). Analysis of vitamin D receptor expression and clinical correlations in patients with ovarian cancer. Gynecologic Oncology, 119(1), 121-124. doi:10.1016/j.ygyno.2 010.06.008

Sintzel, M., Sintzel, M., Rametta, M., Rametta, M., Reder, A., & Reder, A. (2018). Vitamin D and multiple sclerosis: A comprehensive review. Neurology and Therapy, 7(1), 59-85. doi:10.1007/s40120-017-0086-4

101

Skversky, A. L., Kumar, J., Abramowitz, M. K., Kaskel, F. J., & Melamed, M. L. (2011). Association of glucocorticoid use and low 25-hydroxyvitamin D levels: Results from the national health and nutrition examination survey (NHANES): 2001-2006. The Journal of Clinical Endocrinology and Metabolism, 96(12), 3838-3845.

Sladek, R., Bader, J. A., & Giguère, V. (1997). The orphan nuclear receptor estrogen-related receptor alpha is a transcriptional regulator of the human medium-chain acyl coenzyme A dehydrogenase gene. Molecular and Cellular Biology, 17(9), 5400-5409. doi: 10.11 28/mcb.17.9.5400

Sly, L. M., Lopez, M., Nauseef, W. M., & Reiner, N. E. (2001). 1alpha,25-dihydroxyvitamin D3-induced monocyte antimycobacterial activity is regulated by phosphatidylinositol 3-kinase and mediated by the NADPH-dependent phagocyte oxidase. The Journal of Biological Chemistry, 276(38), 35482-35493. doi:10.1074/jbc.M102876200

Smotkin-Tangorra, M., Purushothaman, R., Gupta, A., Nejati, G., Anhalt, H., & Ten, S. (2007). Prevalence of vitamin D insufficiency in obese children and adolescents. Journal of Pediatric Endocrinology & Metabolism: JPEM, 20(7), 817-823.

Sowers, J. R. (2004). Insulin resistance and hypertension. American Journal of Physiology. Heart and Circulatory Physiology, 286(5), 1597. doi:10.1152/ajpheart.00026.2004

Srikuea, R., Zhang, X., Park-Sarge, O., & Esser, K. A. (2012). VDR and CYP27B1 are expressed in C2C12 cells and regenerating skeletal muscle: Potential role in suppression of myoblast proliferation. American Journal of Physiology. Cell Physiology, 303(4), 396. doi:10.1152/ajpcell.00014.2012

Staples, J. A., Ponsonby, A., Lim, L. L. -., & McMichael, A. J. (2003). Ecologic analysis of some immune-related disorders, including type 1 diabetes, in australia: Latitude, regional ultraviolet radiation, and disease prevalence. Environmental Health Perspec- tives, 111(4), 518-523. doi:10.1289/ehp.5941

St-Arnaud, R., Arabian, A., Travers, R., Barletta, F., Raval-Pandya, M., Chapin, K., . . . Glorieux, F. H. (2000). Deficient mineralization of intramembranous bone in vitamin D-24-hydroxylase-ablated mice is due to elevated 1,25-dihydroxyvitamin D and not to the absence of 24,25-dihydroxyvitamin D. Endocrinology, 141(7), 2658-2666. doi: 10.1 210/endo.141.7.7579

St-Arnaud, R. (2010). CYP24A1-deficient mice as a tool to uncover a biological activity for vitamin D metabolites hydroxylated at position 24. The Journal of Steroid Biochemistry and Molecular Biology, 121(1-2), 254-256. doi:10.1016/j.jsbmb.2010.02.002

Stein, E. M., Strain, G., Sinha, N., Ortiz, D., Pomp, A., Dakin, G., . . . Silverberg, S. J. (2009). Vitamin D insufficiency prior to bariatric surgery: Risk factors and a pilot treatment study. Clinical Endocrinology, 71(2), 176-183. doi:10.1111/j.1365-2265.2008.03470.x

Stoffels, K., Overbergh, L., Bouillon, R., & Mathieu, C. (2007). Immune regulation of 1α-hydroxylase in murine peritoneal macrophages: Unravelling the IFNγ pathway. Journal of Steroid Biochemistry and Molecular Biology, 103(3-5), 567-571. doi:10.1016/ j.jsbmb.2006.12.091

Stoffels, K., Overbergh, L., Giulietti, A., Verlinden, L., Bouillon, R., & Mathieu, C. (2006). Immune regulation of 25-hydroxyvitamin-D3-1a-hydroxylase in human monocytes. Journal of Bone and Mineral Research, 21(1), 37-47. doi:10.1359/JBMR.050908

102

Suda, T., Masuyama, R., Bouillon, R., & Carmeliet, G. (2015). Physiological functions of vitamin D: What we have learned from global and conditional VDR knockout mouse studies. Current Opinion in Pharmacology, 22, 87-99. doi:10.1016/j.coph.2015.04.001

SZEP, Z., GUARALDI, G., SHAH, S. S., Vincent, L. R., RATCLIFFE, S. J., ORLANDO, G., . . . TEBAS, P. (2011). Vitamin D deficiency is associated with type 2 diabetes mellitus in HIV infection. AIDS (London, England), 25(4), 525-529. doi:10.1097/ QAD.0b013e328342fdfd

Takeda, Y., Fujita, Y., Honjo, J., Yanagimachi, T., Sakagami, H., Takiyama, Y., . . . Haneda, M. (2012). Reduction of both beta cell death and alpha cell proliferation by dipeptidyl peptidase-4 inhibition in a streptozotocin-induced model of diabetes in mice. Diabetologia, 55(2), 404-412. doi:10.1007/s00125-011-2365-4

Takeuchi, A., Reddy, G. S., Kobayashi, T., Okano, T., Park, J., & Sharma, S. (1998). Nuclear factor of activated T cells (NFAT) as a molecular target for 1a,25-dihydroxyvitamin D3-mediated effects. Journal of Immunology, 160(1), 209-218. Retrieved from https://www.scopus.com/inward/record.uri?eid=2-s2.0-0031883711&partnerID=40&md5=651bc5761e1c2e72003f742f6b7f7a4e

Takiishi, T., Gysemans, C., Bouillon, R., & Mathieu, C. (2010). Vitamin D and diabetes. Endocrinology and Metabolism Clinics of North America, 39(2), 419-446, table of contents. doi:10.1016/j.ecl.2010.02.013

Tebben, P. J., Milliner, D. S., Horst, R. L., Harris, P. C., Singh, R. J., Wu, Y., . . . Kumar, R. (2012). Hypercalcemia, hypercalciuria, and elevated calcitriol concentrations with autosomal dominant transmission due to CYP24A1 mutations: Effects of ketoconazole therapy. The Journal of Clinical Endocrinology and Metabolism, 97(3), 423. doi:10.121 0/jc.2011-1935

Thacher, T. D., & Levine, M. A. (2017). CYP2R1 mutations causing vitamin D-deficiency rickets. The Journal of Steroid Biochemistry and Molecular Biology, 173, 333-336. doi:10.1016/j.jsbmb.2016.07.014

Tiosano, D., Wildbaum, G., Gepstein, V., Verbitsky, O., Weisman, Y., Karin, N., & Eztioni, A. (2013). The role of vitamin D receptor in innate and adaptive immunity: A study in hereditary vitamin D-resistant rickets patients. The Journal of Clinical Endocrinology and Metabolism, 98(4), 1685-1693. doi:10.1210/jc.2012-3858

Tronche, F., Opherk, C., Moriggl, R., Kellendonk, C., Reimann, A., Schwake, L., . . . Schütz, G. (2004). Glucocorticoid receptor function in hepatocytes is essential to promote postnatal body growth. Genes & Development, 18(5), 492-497. doi:10.1101/gad.2 84704

Tuomilehto, J. (2013). The emerging global epidemic of type 1 diabetes. Current Diabetes Reports, 13(6), 795-804. doi:10.1007/s11892-013-0433-5

Turer, C. B., Lin, H., & Flores, G. (2013). Prevalence of vitamin D deficiency among overweight and obese US children. Pediatrics, 131(1), 152. doi:10.1542/peds.2012-1711

103

Turpeinen, H., Hermann, R., Vaara, S., Laine, A. -., Simell, O., Knip, M., . . . Ilonen, J. (2003). Vitamin D receptor polymorphisms: No association with type 1 diabetes in the finnish population. European Journal of Endocrinology, 149(6), 591-596. doi:10.1 530/eje.0.1490591

Tzotzas, T., Papadopoulou, F. G., Tziomalos, K., Karras, S., Gastaris, K., Perros, P., & Krassas, G. E. (2010). Rising serum 25-hydroxy-vitamin D levels after weight loss in obese women correlate with improvement in insulin resistance. The Journal of Clinical Endocrinology and Metabolism, 95(9), 4251-4257. doi:10.1210/jc.2010-0757

Uhlén, M., Fagerberg, L., Hallström, B. M., Lindskog, C., Oksvold, P., Mardinoglu, A., . . . Pontén, F. (2015). Proteomics. tissue-based map of the human proteome. Science (New York, N.Y.), 347(6220), 1260419. doi:10.1126/science.1260419

Van Belle, T. L., Gysemans, C., & Mathieu, C. (2013). Vitamin D and diabetes: The odd couple. Trends in Endocrinology and Metabolism: TEM, 24(11), 561-568. doi:10.1 016/j.tem.2013.07.002

Van Cromphaut, S. J., Dewerchin, M., Hoenderop, J. G. J., Stockmans, I., Van Herck, E., Kato, S., . . . Carmeliet, G. (2001). Duodenal calcium absorption in vitamin D receptor–knockout mice: Functional and molecular aspects. Proceedings of the National Academy of Sciences of the United States of America, 98(23), 13324-13329. doi:10.1073/pnas.231474698

van de Peppel, J., & van Leeuwen, Johannes P T M. (2014). Vitamin D and gene networks in human osteoblasts. Frontiers in Physiology, 5, 137. doi:10.3389/fphys.2014.00137

Vimaleswaran, K. S., Berry, D. J., Lu, C., Tikkanen, E., Pilz, S., Hiraki, L. T., . . . Hyppönen, E. (2013). Causal relationship between obesity and vitamin D status: Bi-directional mendelian randomization analysis of multiple cohorts. PLoS Medicine, 10(2), e10 013 83. doi:10.1371/journal.pmed.1001383

Wacker, M., & Holick, M. F. (2013). Vitamin D — effects on skeletal and extraskeletal health and the need for supplementation. Nutrients, 5(1), 111-148. doi:10.3390 /nu50 10111

Wang, T. J., Zhang, F., Richards, J. B., Kestenbaum, B., van Meurs, J. B., Berry, D., . . . Spector, T. D. (2010). Common genetic determinants of vitamin D insufficiency: A genome-wide association study. Lancet (London, England), 376(9736), 180-188.

Wang, T., Tavera-Mendoza, L. E., Laperriere, D., Libby, E., MacLeod, N. B., Nagai, Y., . . . White, J. H. (2005). Large-scale in silico and microarray-based identification of direct 1,25-dihydroxyvitamin D3 target genes. Molecular Endocrinology (Baltimore, Md.), 19(11), 2685-2695. doi:10.1210/me.2005-0106

Wang, Y., Zhu, J., & DeLuca, H. F. (2012). Where is the vitamin D receptor? Archives of Biochemistry and Biophysics, 523(1), 123-133. doi:10.1016/j.abb.2012.04.001

Weaver, C. M., & Peacock, M. (2011). Calcium1 American Society for Nutrition. doi:10.3945/an.111.000463

Whirledge, S., & DeFranco, D. B. (2017). Glucocorticoid signaling in health and disease: Insights from tissue-specific GR knockout mice. Endocrinology, 159(1), 46-64. doi:10.1210/en.2017-00728

104

Wimalawansa, S. J. (2018a). Associations of vitamin D with insulin resistance, obesity, type 2 diabetes, and metabolic syndrome. The Journal of Steroid Biochemistry and Molecular Biology, 175, 177-189. doi:10.1016/j.jsbmb.2016.09.017

Wimalawansa, S. J. (2018b). Non-musculoskeletal benefits of vitamin D. Journal of Steroid Biochemistry and Molecular Biology, 175, 60-81. doi:10.1016/j.jsbmb.2016.09.016

Worrall, D. S., & Olefsky, J. M. (2002). The effects of intracellular calcium depletion on insulin signaling in 3T3-L1 adipocytes. Molecular Endocrinology (Baltimore, Md.), 16(2), 378-389. doi:10.1210/mend.16.2.0776

Wortsman, J., Matsuoka, L. Y., Chen, T. C., Lu, Z., & Holick, M. F. (2000). Decreased bioavailability of vitamin D in obesity. The American Journal of Clinical Nutrition, 72(3), 690-693. doi:10.1093/ajcn/72.3.690

Wu, H., Deng, X., Shi, Y., Su, Y., Wei, J., & Duan, H. (2016). PGC-1α, glucose metabolism and type 2 diabetes mellitus. The Journal of Endocrinology, 229(3), R99-R115.

Xia, H., Dufour, C. R., & Giguère, V. (2019). ERRα as a bridge between transcription and function: Role in liver metabolism and disease. Frontiers in Endocrinology, 10, 206. doi:10.3389/fendo.2019.00206

Yang, W., Hyllner, S. J., & Christakos, S. (2001). Interrelationship between signal transduction pathways and 1,25(OH)2D3 in UMR106 osteoblastic cells. American Journal of Physiology - Endocrinology and Metabolism, 281(1 44-1), E162-E170.

Yoon, J. C., Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., . . . Spiegelman, B. M. (2001). Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature, 413(6852), 131-138. doi:10.1038/35093050 [doi]

Yoshizawa, T., Handa, Y., Uematsu, Y., Takeda, S., Sekine, K., Yoshihara, Y., . . . Kato, S. (1997). Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning. Nature Genetics, 16(4), 391-396. doi:10.1038/ng0897-391

Young, M. R. I., & Xiong, Y. (2018). Influence of vitamin D on cancer risk and treatment: Why the variability? Trends in Cancer Research, 13, 43-53.

Zeitz, U., Weber, K., Soegiarto, D. W., Wolf, E., Balling, R., & Erben, R. G. (2003). Impaired insulin secretory capacity in mice lacking a functional vitamin D receptor. FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology, 17(3), 509-511. doi:10.1096/fj.02-0424fje

Zella, J. B., McCary, L. C., & DeLuca, H. F. (2003). Oral administration of 1,25-dihydroxyvitamin D3 completely protects NOD mice from insulin-dependent diabetes mellitus. Archives of Biochemistry and Biophysics, 417(1), 77-80. doi:10.1016/S0003-9861(03)00338-2

Zhou, Q. G., Hou, F. F., Guo, Z. J., Liang, M., Wang, G. B., & Zhang, X. (2008). 1,25-dihydroxyvitamin D improved the free fatty-acid-induced insulin resistance in cultured C2C12 cells. Diabetes/Metabolism Research and Reviews, 24(6), 459-464. doi:10.1002/dmrr.873

105

Zhou, Y., Zhao, L., Xu, X., Ye, A., Travers-Gustafson, D., Zhou, B., . . . Lappe, J. M. (2014). DNA methylation levels of CYP2R1 and CYP24A1 predict vitamin D response variation, The Journal of Steroid Biochemistry and Molecular Biology, 144PA, 207-214. doi:10.1016/j.jsbmb.2013.10.004

Zhu, J. G., Ochalek, J. T., Kaufmann, M., Jones, G., & DeLuca, H. F. (2013). CYP2R1 is a major, but not exclusive, contributor to 25-hydroxyvitamin D production in vivo. Proceedings of the National Academy of Sciences of the United States of America, 110(39), 15650-15655. doi:10.1073/pnas.1315006110

Zhu, J., & Deluca, H. F. (2012). Vitamin D 25-hydroxylase - four decades of searching, are we there yet? Archives of Biochemistry and Biophysics, 523(1), 30-36. doi:10.1016 /j.abb.2012.01.013

Zierold, C., Reinholz, G. G., Mings, J. A., Prahl, J. M., & DeLuca, H. F. (2000). Regulation of the porcine 1,25-dihydroxyvitamin D3-24-hydroxylase (CYP24) by 1,25-dihydroxyvitamin D3 and parathyroid hormone in AOK-B50 cells. Archives of Biochemistry and Biophysics, 381(2), 323-327. doi:10.1006/abbi.2000.1964

106

107

Original publications I Aatsinki SM*, Elkhwanky MS*, Kummu O, Karpale M, Buler M, Viitala P, Rinne V,

Mutikainen M, Tavi P, Franko A, Wiesner RJ, Chambers KT, Finck BN & Hakkola J (2019) Fasting-Induced Transcription Factors Repress Vitamin D Bioactivation, a Mechanism for Vitamin D Deficiency in Diabetes. Diabetes 68(5): 918-931.

II Elkhwanky MS, Kummu O, Piltonen TT, Laru J, Morin-Papunen L, Mutikainen M, Tavi P & Hakkola J (2019) Obesity represses CYP2R1, the vitamin D 25-hydroxylase in the human and mouse tissues (Submitted manuscript).

Reprinted with permission from Diabetes, the American Diabetes Association (I)

Original publications are not included in the electronic version of the dissertation

108

A C T A U N I V E R S I T A T I S O U L U E N S I S

Book orders:Virtual book store

http://verkkokauppa.juvenesprint.fi

S E R I E S D M E D I C A

1561. Kilpiö, Teemu (2020) Circulating factors in regulation of cardiac function andstress response

1562. Tiulpin, Aleksei (2020) Deep learning for knee osteoarthritis diagnosis andprogression prediction from plain radiographs and clinical data

1563. Konstari, Sanna (2020) Systemic and dietary risk factors for knee osteoarthritis :associations of serum vitamin D, metabolic syndrome, dietary magnesium intakeand serum C-reactive protein with the risk of knee osteoarthritis

1564. Julku, Johanna (2020) Early and later timed cervical headgear treatment : arandomized controlled trial

1565. Tonttila, Panu (2020) Multiparametric magnetic resonance imaging for thedetection and characterisation of prostate cancer

1566. Tölli, Marja (2020) Identification and characterization of small moleculemodulators of cardiac hypertrophy

1567. Heikkala, Eveliina (2020) Co-occurrence of unhealthy behaviours andpsychosocial problems among adolescents, with special reference to low back andmultisite musculoskeletal pains during adolescence and labour market exclusionin early adulthood

1568. Kinnunen, Sini (2020) The interaction of transcription factors GATA4 and NKX2-5 and the effect of interaction-targeted small molecules on the heart

1569. Yu, Jia (2020) Effects of loading, estrogen level, and aging on rat mandibularcondylar cartilage

1570. Korhonen, Linda (2020) Pediatric forearm fractures with special reference tooperatively treated shaft fractures and ulnar styloid process nonunion

1571. Similä, Toni (2020) Tooth loss among middle-aged adults in the Northern FinlandBirth Cohort 1966 : associations with tobacco smoking and diabetes

1572. Korpi, Riikka (2020) Nanoparticles as magnetic resonance imaging contrastagents : Feasibility studies on cell labelling, acute myocardial infarct imaging andarticular cartilage imaging

1573. Korpela, Nelli (2020) Determinants of cardiovascular autonomic regulation andcardiac structure in a middle-aged population : Influence of early growth relatedfactors and life course physical activity

1574. Haque, Md Sanaul (2020) Persuasive mHealth behavioural change interventions topromote healthy lifestyle

UNIVERSITY OF OULU P .O. Box 8000 F I -90014 UNIVERSITY OF OULU FINLAND

A C T A U N I V E R S I T A T I S O U L U E N S I S

University Lecturer Tuomo Glumoff

University Lecturer Santeri Palviainen

Postdoctoral researcher Jani Peräntie

University Lecturer Anne Tuomisto

University Lecturer Veli-Matti Ulvinen

Planning Director Pertti Tikkanen

Professor Jari Juga

University Lecturer Anu Soikkeli

University Lecturer Santeri Palviainen

Publications Editor Kirsti Nurkkala

ISBN 978-952-62-2641-5 (Paperback)ISBN 978-952-62-2642-2 (PDF)ISSN 0355-3221 (Print)ISSN 1796-2234 (Online)

U N I V E R S I TAT I S O U L U E N S I S

MEDICA

ACTAD

D 1575

AC

TAM

ahmoud Sobhy E

lkhwanky

OULU 2020

D 1575

Mahmoud Sobhy Elkhwanky

REGULATION OF VITAMIN D METABOLISM BY METABOLIC STATE IN MICE AND HUMANSDISCOVERY OF MOLECULAR FACTORS REPRESSING VITAMIN D BIOACTIVATION AND INDUCING DEFICIENCY IN DIABETES

UNIVERSITY OF OULU GRADUATE SCHOOL;UNIVERSITY OF OULU,FACULTY OF MEDICINE;MEDICAL RESEARCH CENTER OULU;BIOCENTER OULU