RGMa, RGMb and RGMc are skeletal muscle proteins, and RGMa promotes cellular hypertrophy and is necessary for myotube fusion

Aline Fagundes Martins1, José Xavier Neto2,3, Ana Azambuja3, Maria Lorena Sereno4, Antonio Figueira4, Paulo Henrique Campos-Junior1, Millor Fernandes Rosário5, Cristiane Bittencourt Barroso Toledo¹, Gerluza Aparecida Borges Silva1, Gregory Thomas Kitten1, Luiz Lehmann Coutinho6, Susanne Dietrich7, Erika Cristina Jorge1*

1Universidade Federal de Minas Gerais – Departamento de Morfologia, Av. Antônio Carlos, 6627, Belo Horizonte, MG, 31270-901, Brazil;2Centro Nacional de Pesquisa em Energia e Materiais (CNPEM) – Laboratório Nacional de Biociências (LNBio), Rua Giuseppe Máximo Scolfaro, 10.000, Campinas, SP, 13083-970, Brazil;3Universidade de São Paulo – Hospital das Clínicas da Faculdade de Medicina – Instituto do Coração, Av. Dr. Enéas de Carvalho Aguiar, 44, São Paulo, SP, 05403-900, Brazil;4Universidade de São Paulo – Centro de Energia Nuclear na Agricultura, Av. Centenário, 303, Piracicaba, SP, 13400-970, Brazil;5Universidade Federal de São Carlos – Centro de Ciências Naturais, Campus Lagoa do Sino, Rodovia Lauri Simões de Barros, km 12, SP-189, Buri, SP, Brazil;6Universidade de São Paulo – Escola Superior de Agricultura Luiz de Queiroz, Departamento de Zootecnia, Av. Pádua Dias, 11, Piracicaba, SP, 13418-900, Brazil;7University of Portsmouth – School of Pharmacy & Biomedical Sciences, St. Michael’s Building, PO1 2DT, Portsmouth, UK.

*Correspondence to: Erika Cristina Jorge, Universidade Federal de Minas Gerais, Departamento de Morfologia, Laboratório de Biologia Oral e do Desenvolvimento, Av. Antônio Carlos, 6627, CEP 31270-901, Belo Horizonte, MG, Brazil. ecjorge@icb.ufmg.br

1

Abstract

Repulsive guidance molecules (RGMs) compose a family of

glycosylphosphatidylinositol (GPI)-anchor axon guidance molecules

and perform several functions during neural development. New

evidence has suggested possible new roles for these axon guidance

molecules during skeletal muscle development, which has not been

investigated thus far. In the present study, we show that RGMa,

RGMb and RGMc are all induced during skeletal muscle differentiation

in vitro. Immunolocalization performed on adult skeletal muscle cells

revealed that RGMa, RGMb and RGMc are sarcolemma proteins.

Additionally, RGMa was found to be a sarcoplasmic protein with a

surprisingly striated pattern. RGMa co-localization with known

sarcoplasmic proteins suggested that this axon guidance molecule is

a skeletal muscle sarcoplasmic protein. Western blot analysis

revealed two RGMa fragments of 60 and 33 kDa, respectively, in adult

skeletal muscle samples. RGMa phenotypes in skeletal muscle cells

(C2C12 and primary myoblasts) were also investigated. RGMa over-

expression produced hypertrophic cells, whereas RGMa knockdown

resulted in the opposite phenotype. RGMa knockdown also blocked

myoutbe formation in both skeletal muscle cell types. Our results are

the first to show an axon guidance molecule as a skeletal muscle

2

sarcoplasmic protein and to include RGMa in a system that regulates

skeletal muscle cell size and differentiation.

Keywords: Axon guidance, skeletal muscle, sarcomere proteins,

C2C12 and primary cultures.

Introduction

Repulsive guidance molecules (RGM) are a family of GPI-anchor

proteins composed of RGMa, RGMb (also known as DRAGON), RGMc

(also known as Hemojuvelin, HJV, and HFE2), and RGMd. In addition

to the GPI-anchor at the C-terminal region, RGM proteins also present

an N-terminal signal peptide and a partial von Willebrand type D

domain, which includes a catalytic cleavage site (Monnier et al., 2002;

Samad et al., 2004). Both RGMa and RGMc also present the putative

RGD motif (Arg-Gly-Asp), which is possibly associated with a cell-cell

adhesion mechanism.

The functional studies available thus far have revealed RGMa and

RGMb phenotypes primarily in neural tissues. RGMa mutant mice

showed an exencephalic phenotype (Niederkofler et al., 2004). RGMa

was also found to be a regulator of neural cell proliferation,

differentiation, and survival (Matsunaga et al., 2004; Matsunaga et al.,

2006). RGMa is also produced by microglia/macrophages in sites of

central nervous system injuries (Kitayama et al., 2011); significant

axon regeneration can be observed when RGMa is blocked (Hata et

3

al., 2006). Likewise, RGMa inhibition was associated with

neuroprotection after cerebral ischemia (Kong et al., 2013) and with

the improvement of afferent synapse formation with auditory hair

cells (Brugeaud et al., 2013). The functional diversity of RGMa

observed in the nervous system is based on its capacity to undergo

posttranslational modifications in specific cleavage sites by the

proprotein convertases Subtilisin Kexin Isozyme 1 (SKI-1), Furin and

phospholipases, which result in four membrane-bound and three

soluble possible RGMa forms in this system (Tassew et al., 2012).

RGMb was found to induce the adhesion of the dorsal root ganglia

neurons (Samad et al., 2004). However, RGMb knockout mice die

without apparent neural defects (Mueller et al., 2006). In contrast,

RGMc was found in skeletal muscle, liver, bone and cartilage

(Schmidtmer & Engelkamp, 2004; Samad et al., 2004; Niederkofler et

al., 2004; Papanikolaou et al., 2004; Rodriguez et al., 2007; Kanomata

et al., 2009). The lack of a functional RGMc causes a disorder known

as hereditary hemochromatosis that accumulates iron in the heart,

liver, skeletal muscle, endocrine glands, joints and skin cells

(Pietrangelo, 2007). No function has been assigned to RGMd thus far.

New evidence has suggested possible roles for RGMs during skeletal

muscle development. RGMa, RGMb and RGMc transcripts were

detected during the induced differentiation of C2C12 myoblast cells

(Kanomata et al., 2009). The functional information available for

RGMs thus far in this tissue was performed with a focus on RGMc

4

because RGMc is known as the skeletal muscle form of RGM. RGMc

over-expression in C2C12 cells promoted myoblast differentiation and

recruitment into myotubes (Kang et al., 2004; Bae et al., 2009).

Additionally, RGMa and RGMb were both detected outside the nervous

system, particularly at the somites of chicken embryos (Jorge et al.,

2012). RGMa transcripts were found in domains known to be the

origin site of skeletal muscle pioneer and stem cells, and later, RGMa

was found at the myotome (Jorge et al., 2012). RGMb was found to

overlap at sites of differentiated muscle cells, and at later stages, at

craniofacial, limb and body muscles (Jorge et al., 2012). Possible

phenotypes of RGMa and RGMb in skeletal muscle cells have not been

investigated thus far.

In the present study, we show new evidence of RGMa, RGMb, and

RGMc as skeletal muscle proteins and suggest an association of RGMa

with the system that regulates skeletal muscle cell size and

differentiation.

Material and Methods

Animals

Male Swiss mice (60 days old; weight: ±30 g) were obtained from

University Central vivarium (CEBIO/UFMG). All animal procedures

were conducted following the instructions of the university’s ethics

5

committee (CEUA/UFMG, ethical approval 18/2011) and the Brazilian

laws for the use of animals in scientific experiments.

Cell Culture

C2C12 myoblasts were maintained in growth medium [Dulbecco’s

modified Eagle’s medium (DMEM) with high glucose and L-glutamine

(Gibco)], supplemented with 10% fetal bovine serum (Gibco), and a

1% penicillin/streptomycin/amphotericin B solution (Gibco) at 37 °C

and 5% CO2. Myogenic differentiation was induced by culturing cells

at low serum conditions [differentiation medium: DMEM with high

glucose, L-glutamine, and 2% horse serum (Gibco, Life

Technologies)]. The medium was replaced every two days.

For the primary cell culture, muscles were harvested from the

hindlimbs of five neonatal mice (three days old) in DPBS (Gibco)

supplemented with a 1% penicillin/streptomycin/amphotericin B

solution and 1% gentamicin (Sigma-Aldrich). The cells were

dissociated by Collagenase I digestion (Gibco) and mechanically

during 45 min at 37 °C, followed by 0.25% Trypsin digestion, for 30

min at 37 °C. Primary cultures were enriched for myoblasts after

rounds of trypsinazation and selective adhesion. The cells were

seeded on 24-well plates at a cell density of 2×104 in growth medium

supplemented with 20% FBS onto matrigel (BD Biosciences) and kept

under standard conditions. Enrichment for myoblasts was confirmed

by immunofluoresce staining, using anti-Desmin and anti-Myosin

Heavy Chain antibodies. Differentiation induction was performed as

6

described for the C2C12 cell line.

RT-qPCR

C2C12 cells were seeded at a cell density of 2×104 in growth medium

and in duplicate in two 24-well plates (A and B biological replicates).

After 24 h of incubation, the medium was removed, and the cells from

two wells from each plate were harvested in TRIzol® Reagent (Life

Technologies), which was defined as day 0. The media from the other

wells were replaced to induce cell differentiation. The cells were

similarly harvested in TRIzol® Reagent every day for up to 5 days,

totaling 6 samples in duplicate. Total RNA was obtained from each

sample following the TRIzol® Reagent manufacturer’s instructions.

Total RNA was converted into cDNA from the poly(A) tail, following the

SuperScript® III First Strand Synthesis System instructions (Life

Technologies).

Primers were designed using Primer3 software

(http://bioinfo.ut.ee/primer3-0.4.0/) to allow the amplification of ca.

200 bp of each reference and target gene. The following mouse

genes were used as references for the quantitative analysis: Beta-

Actin (Actb: CGTTGACATCCGTAAAGACC; TAGAGCCACCAATCCACACA),

Beta 2-Microglobulin (B2M: CTCCCCAAATTCAAGTGT;

GTGAGCCAGGATGTAG), Glyceraldehyde 3-phosphate dehydrogenase

(GAPDH: GTGAAGGTCGGTGTGAACG; ATTTGATGTTAGTGGGGTCTCG)

and Ribosomal protein L7 (RPL7: GATAACTCCTTGGTTGCTC;

CCAGCGTCTCCACCTTCTAC). RGMa (CCACATCAGGAAGGCAGAAG;

7

GCGTAGCACTGGGTAGGAAG), RGMb (CTCAATGCCGAATCCAGAAA;

TGCCTAACACAGCAGAATGG), and RGMc (GCTTGACCTCGGGAAACA;

AGGAGCAGCAGGAGAGTGAG) were used as targets.

RT-qPCR was performed in a Rotor-Gene Q Real-time PCR system

(Qiagen) using 1X Platinum® SYBR® Green qPCR SuperMix-UDG (Life

Technologies) and 0.2-0.5 μM of each primer for a final volume of 10

μL. The samples were run in duplicate in 0.2 μL PCR tubes. The

cycling parameters were as follows: 50 °C × 2 min, 95 °C × 2 min,

followed by 40 cycles of 95 °C × 15 sec, 60-62 °C × 30 sec, and 72 °C ×

20 sec. The dissociation step was performed at the end of the

amplification step to allow the identification of the specific melting

temperature for each primer set.

Immunolocalization

Quadriceps, soleus and EDL (extensor digitorum longus) muscles

were harvested from five adult Swiss mice and cryopreserved in an

ultrafreezer. These muscles were specifically chosen in order to have

the description of RGMs pattern in different representatives of fiber

types. The muscles were embedded in Tissue-Tek OCT and cut into 6

µm thick cryosections. After 30 min of TBS-TC blocking, the sections

were incubated with primary antibodies at 4 °C overnight.

Corresponding fluorescent secondary antibodies were incubated for

90 min at RT. Antibodies were used as follows. Primary antibodies

were diluted at 1:100 in PBS. Goat polyclonal against the C-terminal

RGMa (Santa Cruz Biotechnology), rabbit polyclonal against the N-

8

terminal RGMa (Abcam), rabbit polyclonal RGMb (Santa Cruz

Biotechnology), rabbit polyclonal RGMc (Santa Cruz Biotechnology),

mouse monoclonal Titin (Developmental Studies Hybridoma Bank),

mouse monoclonal Desmin (Cell Marque) and mouse monoclonal

Dystrophin (Developmental Studies Hybridoma Bank). Secondary

antibodies were coupled to a fluorochrome, either Alexa 555 or 488

(Molecular Probes), at a 1:500 dilution. Negative controls were

determined in the absence of the respective primary antibodies on

each slide.

Immunohistochemistry

Quadriceps, soleus and EDL (extensor digitorum longus) muscles

were collected from five adult Swiss mice, fixed in cold

methanol/DMSO (80% methanol and 20% DMSO). Six micrometer

sections were blocked with TBS-TC for 30 min and incubated with

antibodies against the C- and N-termini of RGMa diluted in PBS 1:100.

An LSAB System-HRP kit was used following the manufacturer’s

instructions (Dako). The signals were detected using 3,30-

diaminobenzidine (DAB, Dako), and the sections were counterstained

with Harris´ hematoxylin.

Western Blot

Mouse adult quadriceps, brain and primary myoblasts were used as

samples. Primary myoblasts were harvested from five neonate mice

hindlimbs (3 days old) seeded at a density of 8×104 cells/well, grown

9

for 2 days in growth medium and incubated a further 3 days after

transfection and induction of differentiation (see procedures below).

The samples were homogenized with protease inhibitors (Sigma-

Aldrich) as follows: Fluoret Fenylmethano Sulfonyl, Pepstatin A, EDTA,

E-64 {N-[N-(L-3-trans-carboxyirane-2-carbonyl)-L-leucyl]-agmatine;[1-

[N-[(L-3-trans-carboxyoxirane-2-carbonyl)-L-leucyl]amino]-4-

guanidinobutane]}, orthovanadate sodium. After sonication, the

lysates were centrifuged at 14,000×g for 30 min, and the

supernatants were diluted 1:2 in 10% SDS, glycerol, and 10%

bromophenol blue in 0.5 M Tris buffer (pH 6.8) and boiled for 5 min.

Aliquots (20 µl) of each protein were separated in denatured 12%

SDS-polyacrylamide minigels and transferred onto Hybond-ECL

nitrocellulose membranes (GE Healthcare) at 100 mA for 75 min.

Blocking was performed with TBS-TC buffer for 30 min at RT. The

membranes were incubated for 120 min at RT with primary antibodies

against the C- and N-termini of RGMa (1:500) and a mouse β-actin

antibody (1:5000) (Abcam) as the control. After washing, the

membranes were incubated for 1 h with the following secondary

antibodies, diluted in PBS 1:1000: biotinylated anti-goat IgG antibody

(Abcam), biotinylated anti-rabbit IgG antibody (Abcam), and

biotinylated anti-mouse IgG antibody (Abcam), followed by incubation

with a streptavidin solution (Thermo Fisher Scientific) for 15 min at

RT. The signals were detected using DAB (Sigma-Aldrich),

chloramphenicol (Sigma-Aldrich) and hydrogen peroxide (Sigma-

10

Aldrich) for 1 min at RT. Images were obtained using an Epson

Perfection 4990 photo scanner.

Plasmids

Chicken RGMa CDS (GenBank accession number AY128507) was

cloned into the bicistronic plasmid pCAB-IRES-eGFP (Alvares et al.,

2003) at the ClaI and EcoRI sites. The empty vector was used for

control experiments. Short interfering RNAs (siRNA) to promote

RGMa knockdown and control siRNAs were gifts from Dr. Alain

Chédotal (Centre de Recherche Institut de la Vision, Paris, France).

The U6 promoter associated with the RGMa siRNA was subcloned into

the pcDNA3-eGFP (Addgene) expression vector at the EcoRI and KpnI

sites.

Cell transfections

Myoblast cells were transfected after 24 h of seeding using 0.8 μg of

plasmids and Lipofectamine 2000 Reagent (Life Technologies) in Opti-

MEM (Gibco) following the manufacturers’ instructions. After 5 h of

incubation at 37 °C and 5% CO2, the medium was replaced with fresh

growth medium. After 24 h, the cells were trypsinized and plated

onto glass slides covered with 3% gelatin in PBS. After reaching 70%

confluence, the cells were cultured in differentiation medium for 3

and 5 days for immunostaining analysis. Transfection efficiency was

around 5%.

11

Cell culture immunofluorescence

After 3 and 5 days in differentiation medium, both the C2C12 and

primary myoblast cells were fixed with 4% PFA and treated with 0.1%

Igepal (Sigma-Aldrich) and 1% BSA (Sigma-Aldrich) at 37 °C for 30

min. Rabbit anti-GFP (Abcam) and mouse anti-Myosin Heavy Chain

MHC (Developmental Studies Hybridoma Bank), both diluted 1:500 in

1% BSA, were incubated overnight at 4 °C. Goat anti-rabbit coupled

to Alexa 488, and donkey anti-mouse 555 (Life Technologies), both

diluted 1:500 in PBS, were respectively used as secondary antibodies,

for 90 min at 4 °C. The nuclei were counterstained with DAPI.

Microscopy and analysis

Immunostaining images were captured using an Olympus Q Color 3

fluorescence microscope with an Olympus BX51 camera and Image

Pro Express Software (version 4.5) or using a Zeiss 510 Meta confocal

microscope. The immunohistochemistry results were photographed

using a BX-41 Olympus microscope with a Q-Color 3/Olympus capture

system. Adobe Photoshop CS6 software was used for image

assembly. Length and width were measured in all transfected

(GFP+/MHC+) cells from at least six wells for each treatment, using

ImageJ software. For cell measurement, immunostained sections were

scanned at an objective magnification of 20x and a projection

magnification of 2x. A stage micrometer was used for standardized

analysis. Digitized slides comprised TIFF images of 2018x1536 pixels.

The fusion index was calculated as the ratio of the number of nuclei

12

inside multinculeated myotubes (>3 nuclei) over the total nuclei

number 100, at day 5 of myogenic differentiation.

Statistical Analysis

RT-qPCR data were analyzed following the instructions of Willems et

al. (2008), with a 95% confidence interval.

RGMa in vitro phenotypes (morphometric traits of length and width,

and nuclei score) were analyzed using the F-test, which was verified

by SASLAB of SAS software and corrected when necessary.  ANOVA

was employed to detect the differences between two treatments, and

the means (± standard error) were compared by least squares (P <

0.05) using PROC GLM (SAS, 2007).  For the observed percentages,

we used the chi-square test implemented in the PROC FREQ (SAS,

2007), considering the expected frequencies as 50% for each

treatment.  Any deviation between the observed and expected

frequencies was significant at P < 0.05.  We plotted graphs to present

all of the results.

Results

Expression pattern of RGMs during skeletal muscle in vitro

differentiation

To investigate possible roles of RGMs in skeletal muscle cells, we

turned to the C2C12 cell lineage to detect RGMs expression levels

during 5 days under serum-deprived conditions to induce cell

13

differentiation. RGMa, RGMb, and RGMc transcripts were detected

during all stages of C2C12 differentiation (Fig. 1A-C). During all

differentiation stages (D1-D5), both RGMa and RGMc have presented

expression levels higher (P < 0.05) than that detected at the

corresponding D0 stage, in which cells were cultivated exclusively in

growth medium (Fig. 1A and C). RGMb expression levels did not differ

from those levels observed during the proliferative phase (Fig. 1B).

These findings suggested the presence of RGMa, RGMb and RGMc

transcripts during skeletal muscle cell differentiation.

RGMa, RGMb and RGMc immunolocalization in adult skeletal

muscle cells

Despite the detection of RGMs transcripts in skeletal muscle cells in

culture, no information regarding the localization of these proteins in

adult skeletal muscle tissues has been available thus far. To

determine the localization of RGMa, RGMb, and RGMc in skeletal

muscle cells, samples of quadriceps (mostly fast), soleus (slow) and

EDL (mixed) muscles were (transversally and longitudinally)

cryosectioned and subjected to immunofluorescence staining for

RGMa, RGMb and RGMc. As no difference in expression pattern was

observed in different muscle types, the best representative pictures

among the used muscles were presented.

RGMa immunolocalization (C-terminal) on transversal skeletal muscle

cryosections revealed signals of this axon guidance molecule

detected as small dots both in the sarcolemma (Fig. 2A, arrows

14

heads) and all over the sarcoplasm (Fig. 2A, arrows). RGMb and

RGMc signals in transversal cryosections revealed the presence of

these proteins exclusively in the surrounding sarcolemma (Fig. 2C

and E). When longitudinal cryosections were used, RGMa

immunostaining in the sarcoplasm was surprisingly found in a striated

pattern (Fig. 2B) resembling sarcomeric protein staining, whereas

RGMb and RGMc were restricted to the sarcolemma (Fig. 2D and F).

As GPI-anchor proteins, RGMs were expected to be found exclusively

in membranes. Membrane-bound and soluble forms, but no

cytoplasmic forms, were previously described for RGMa in other cell

types (Tassew et al., 2012). To confirm our data, a second antibody

was used against the RGMa N-terminal domain. Transversal (Fig. 3B

and E) and longitudinal (Fig. 3A and D) sections presented similar

results for both antibodies. RGMa striated pattern in the sarcoplasm

was also confirmed by immunohistochemistry performed using both

C- and N-terminal RGMa antibodies (Fig. 4A and C).

Our data revealed all mammalian RGMs in the sarcolemma of skeletal

muscle cells and suggested an additional role for RGMa as a

sarcoplasmic striated protein.

RGMa fragments present in skeletal muscle cells

A Western blot was performed to confirm C- and N-terminal RGMa

antibodies specificities in skeletal muscle cells. A brain sample was

used as a control. In addition to confirming antibody specificities, our

results revealed the presence of two RGMa fragments, a 60 kDa

15

fragment and a 33 kDa fragment, in skeletal muscle tissues using a C-

terminal antibody (Fig. 5A). The N-terminal antibody allowed the

identification of the 60 kDa fragment only (Fig. 5B). These results

suggested the presence of two different RGMa fragments in skeletal

muscle cells.

Co-localization of RGMa with known skeletal muscle proteins

The unexpected striated aspect of RGMa in myofibers led us to

investigate whether this axon guidance protein co-localizes with

known skeletal muscle proteins. For this experiment, double labeling

was performed in longitudinal sections using RGMa, Desmin, and Titin

antibodies. Our results showed that RGMa co-localizes with Desmin

(Fig. 6A-D) and Titin (Fig. 6E-H) proteins, suggesting an association

between RGMa and the skeletal muscle sarcomeres, possibly with the

Z-disks.

RGMa in vitro phenotype

After 5 days in DM, primary muscle MHC-positive/RGMa-positive cells

presented an increase in cell width (p<0.05), compared to the control

(MHC-positive/pCAb-positive) cells (Fig. 7A). The same effect was

observed in RGMa-positive C2C12 cells (Fig.7A). No significant

difference was observed in cell length for both muscle cultures (data

not shown). RGMa knockdown resulted in the opposite effect: a

decrease in width of MHC-positive/RGMa-knockdown cells was

observed, compared to the controls (Fig. 7C). RGMa knockdown in

16

C2C12 cells resulted in the same phenotype (Fig. 7D). Western blot

analysis confirmed the efficiency of our transfections (Fig. 7E).

Additionally, it was also possible to note that MHC-positive/RGMa-

positive cells displayed a trend to increase the total number of nuclei

(44.4%), compared to the control (35.6%). Taken together, these

results suggested that RGMa could induce hypertrophy in skeletal

muscle cells, possibly through a mechanism dependent of nuclear

accretion.

RGMa and myotube formation

To evaluate the role of RGMa during skeletal muscle development, we

scored the number of nuclei (1n, 2-4n, and >5n) in

MHC-positive/RGMa-positive and MHC-positive/RGMa-knockdown cells

(primary muscle culture); and in RGMa-positive and RGMa-knockdown

C2C12 cells, after 3 and 5 days in DM.

MHC-positive/RGMa-positive cells did not display any significant

difference in the average number of nuclei per multi-nucleated

myotube, compared to the control (data not shown). Significant

difference was found when RGMa was knockdown:

MHC-positive/RGMa-knockdown cells were blocked from forming multi-

nucleated myotubes after 3 and 5 days in DM (Fig. 8A). It was not

possible to find MHC-positive/RGMa-knockdown multi-nucleated

myotubes (presenting 2 or more nuclei) (Fig. 8A). The same results

were obtained when C2C12 cells were used (data not shown).

17

To identify a possible effect of RGMa in myoblasts fusion during cell

differentiation, the fusion index was assessed in MHC-positive/RGMa-

positive multi-nucleated myotubes, after 5 days in DM. An increase of

3-fold in the fusion index (p˂0.05) was observed in cells over-

expressing RGMa, compared to the control (Fig. 8B). This result

suggested that RGMa over-expressing muscle cells were more

efficient to fuse.

All together, these results suggest that RGMa is necessary for

myotube formation, as it interferes in myoblast fusion.

Discussion

RGMa is an axon guidance molecule first described as playing roles

during neurogenesis as repulsive cues to axonal outgrowth (Monnier

et al., 2002). Later, other members of this family were described

based on their sequence similarities: RGMb, RGMc, and RGMd. Neural

association was found to be restricted to RGMa and RGMb (Hata et al.,

2006; Liu et al., 2009). RGMc was described as the skeletal muscle

member of this family, playing roles in the regulation of hepcidin

expression (Babitt et al., 2006; Truksa et al., 2006; Babitt et al., 2006)

and of iron homeostasis (reviewed by Papanikolaou et al., 2003).

Recently, additional roles for RGMa and RGMb in other tissues,

including skeletal muscle, have been proposed (Kanomata et al.,

2009; Jorge et al., 2012). In chicken, RGMa transcripts were found in

domains of epithelial somites that generate skeletal muscle pioneer

and stem cells, and later RGMa transcripts were found at the

18

myotome in mature somites (Jorge et al., 2012). RGMb transcripts

were found in sites of differentiated muscle cells, and at later stages,

at craniofacial, limb and body muscles (Jorge et al., 2012). In the

present study, we provided new insights into the association of RGMs

and skeletal muscle cells.

RGMa, RGMb and RGMc are all induced during skeletal muscle

cell differentiation

RGMa and RGMc were up-regulated during the induction of C2C12 cell

differentiation, as detected by RT-qPCR. RGMa and RGMc were both

up-regulated as soon as GM was changed by DM (D1). Another

quantitative study performed on C2C12 cells revealed RGMa and

RGMb expression in both GM and DM, whereas RGMc was restricted

to myogenin-expressing cells (Kanomata et al., 2009). Despite the

detection of RGMs on C2C12 cells, no further in vitro investigation has

been performed thus far to understand the specific functions of RGMs

on these cells. Our findings suggested overlapping functions of RGMa

and RGMc during skeletal muscle cell differentiation.

RGMa, RGMb and RGMc are all found as skeletal muscle

proteins

Our analysis performed in adult skeletal muscle cells revealed that

RGMa, RGMb and RGMc are all found in the surrounding sarcolemma.

Additionally, RGMa was found in the sarcoplasm with a surprisingly

striated pattern that was confirmed by immunofluorescence and

immunohistochemistry assays. The striated pattern of RGMa

19

resembled those of known sarcomeric proteins, such as Titin and

Desmin. Our findings strongly suggested that (1) RGMs play roles as

skeletal muscle proteins, (2) RGMs might present overlapping or

regulatory roles on the sarcolemma, and (3) RGMa plays an additional

role inside the sarcoplasm of these cells most likely as a sarcomere-

associated protein.

A Western blot performed using RGMa C- and N-terminal antibodies

on samples of skeletal muscle tissue confirmed the antibody

specificities. In addition, this assay also corroborated our

immunolocalization data, confirming the presence of two RGMa

fragments of 60 and 33 kDa in this tissue. Multiple membrane-bound

and soluble RGMa forms were described in fibroblast-like cells

transfected with the full-length RGMa: four membrane-bound (a

cleaved and an uncleaved full length fragment, both of 60 kDa each;

a C-terminal fragment of 33 kDa; and a 37 kDa fragment); and three

soluble forms (two small N-terminal fragments of 30 kDa; and a

secreted 60 kDa form with no GPI-anchor) (Tassew et al., 2009;

Tassew et al., 2012). The current work revealed the presence of two

of these RGMa forms in skeletal muscle cells, possible the full-length

60 kDa and a fragment of 33 kDa, the product of an autocatalytic site

present at the C-terminal domain of this protein. This result

intriguingly suggested two different functions for this axon guidance

molecule in skeletal muscle cells. To our knowledge, this work is the

first to show a repulsive guidance molecule (RGMa) inside the

20

cytoplasm. The functions of RGMs on the sarcoplasm and

sarcolemma of skeletal muscle cells remain unknown.

RGMa in vitro phenotype

Our RGMa in vitro phenotypes, which were investigated using C2C12

and primary myoblast cells, revealed that RGMa over-expressing cells

formed larger myotubes, in comparison to the control. A trend to

increase the total number of nuclei in MHC-positive/RGMa-positive

cells was also observed, suggesting an association of RGMa with the

mechanism of nuclei accretion during skeletal muscle differentiation.

Additionally, RGMa over-expressing muscle cells showed a higher

efficiency in fusion, compared to the control. RGMa knockdown

revealed the opposite effect, resulting in the appearance of smaller

cells, with deficient ability to form multi-nucleated myotubes. These

results allowed us to assign a role for RGMa as a positive regulator of

skeletal muscle cell size and differentiation, possibilly through a

mechanism of induction of cell fusion.

Molecules involved in different mechanisms have already been

associated with myofiber cell size and differentiation; for example

IGF-1 signaling molecules (Coleman et al., 1995), the TGF-β super-

family members Myostatin and BMP (McPherron et al., 1997; Lee &

McPherron, 2001; Walsh et al., 2010), and Pax3 and Pax7, which are

known myogenic markers that induce cell size and morphology

phenotypes (Collins et al., 2009). Likewise, Neogenin, Netrin and

RGMc have also been associated with the system that regulates

21

skeletal muscle cell size and differentiation. Neogenin over-

expression in C2C12 cells resulted in the appearance of larger

myotubes and with more nuclei than did C2C12/puro cells (Kang et

al., 2004). In fact, C2C12/neogenin cultures displayed an increase in

the total number of nuclei present in MHC+ cells and in the average

number of nuclei/myotube (Kang et al., 2004). The same phenotype

was observed when cultures were treated with Netrin-2 (the chick

family member most closely related to mammalian Netrin-3) and

when RGMc was over-expressed. However, the effects of RGMc on

the cells were less pronounced than when Netrins were used (Kang et

al., 2004; Bae et al., 2009) and some studies even report that RGMc

over-expression in C2C12 cells has no effect on myotube formation

(Huang et al., 2005; Kuninger et al., 2006). Myoblasts derived from a

homozygous gene-trap mutation in the Neo1 locus developed smaller

myotubes with fewer nuclei than myoblasts from control animals, with

inefficient expression of muscle-specific proteins (Bae et al., 2009). A

similar phenotype was observed in GFP-sorted cells that received a

Neogenin RNAi vector because these cells produced smaller and

fewer myotubes than did sorted control transfectants (Kang et al.,

2004).

However, the molecular mechanisms that allow RGMa (and possibly

the other RGMs) to regulate skeletal muscle cell size and

differentiation remain unknown and must be further addressed. The

first suggestion would be through the Neogenin receptor, based on

similar findings. Neogenin binding to the axon guidance molecule

22

Netrin was found to induce E-proteins, myogenic bHLH factors, SRF

and NFATc3 to drive the transcription of muscle-specific genes to

regulate the actin cytoskeleton and the differentiation into

multinucleated myotubes (Cole et al., 2004; Krauss, 2005). Netrin-

3/Neogenin binds to the CDO co-receptor to activate NFATc3, which is

a candidate for the regulation of myoblast morphology, and the Focal

adhesion kinase (FAK) and the extracellular signal-regulated kinase

(ERK), which are both involved in the signaling that regulates

myotube formation (Yokoyama et al., 2007; Bae et al., 2009; Quach et

al., 2009).

RGMa was also reported as a BMP co-receptor (Samad et al., 2005;

Babitt et al., 2005; Babitt et al., 2006), and BMP signaling through

Smad1/5/8 was recently associated with skeletal muscle cell size

regulation (Sartori et al., 2013). The over-expression of ALK3 (BMP

receptor) enhanced Smad1/5/8 phosphorylation, resulting in

increased fiber size, leading to massive muscle hypertrophy (Sartori

et al., 2013). When Noggin (a BMP antagonist) was over-expressed, a

reduction of Smad1/5/8 phosphorylation was observed, which caused

muscle atrophy (Sartori et al., 2013). Curiously, the over-expression

of both RGMa and RGMc in C2C12 cells significantly enhanced BMP

activity compared with that observed for RGMa or RGMc individually

(Halbrooks et al., 2007). Conversely, the selective knockdown of

RGMa, RGMb, or RGMc resulted in a dramatic decrease in BMP

activity, which was more pronounced when RGMa and RGMc were

suppressed (Halbrooks et al., 2007). However, RGMa was seen to

23

have a less prominent function as a BMP co-receptor when compared

to other RGMs (Wu et al., 2012). Our results of muscle hypertrophy

are also similar to ALK3 phenotypes, and one hypothesis is that RGMa

may function as a BMP signaling enhancer. The involvement of RGMa

and BMP signaling in muscle size requires further attention.

Taken together, these data provide insights regarding RGMa as a

key player in regulating skeletal muscle size and differentiation,

highlighting its possible association with the dynamic and intricate

cytoskeleton of skeletal muscle cells.

Acknowledgments

The present study was supported by CNPq and UFMG/PRPq. Aline F

Martins was funded by Capes. Luiz L Coutinho and Millor F Rosário

received scholarships from CNPq. S Dietrich received an AFM

research grant.

REFERENCES

Alvares, L.E., Schubert, F.R., Thorpe, C., Mootoosamy, R.C., Cheng, L.,

Parkyn, G., Lumsden, A., Dietrich, S (2003) Intrinsic Hox-dependent

cues determine the fate of skeletal muscle precursors. Developmental

Cell 5(3), 379-90.

24

Babitt, J.L., Zhang, Y., Samad, T.A., Xia, Y., Tang, J., Campagna, J.A.,

Schneyer, A.L., Woolf, C.J., Lin, H.Y (2005) Repulsive guidance

molecule (RGMa), a DRAGON homologue, is a bone morphogenetic

protein co-receptor. The Journal of Biological Chemistry 280, 29820-

29827.

Babitt, J.L., Huang, F.W., Wrighting, D.M., Xia, Y., Sidis, Y., Samad,

T.A., Campagna, J. A., Chung, R. T., Schneyer, A. L., Woolf, C. J.,

Andrews, N. C., Lin, H. Y (2006) Bone morphogenetic protein signaling

by hemojuvelin regulates hepcidin expression. Nature Genetics 38, 5,

531-539.

Bae, G.U., Yang, Y.J., Jiang, G., Hong, M., Lee, H.J., Tessier-Lavigne, M.,

Kang, J.S., Krauss, R.S (2009) Neogenin regulates skeletal myofiber

size and focal adhesion kinase and extracellular signal-regulated

kinase activities in vivo and in vitro. Molecular Biology of the Cell 20,

4920-4931.

Brugeaud, A., Tong, M., Luo, L., Edge, A.S (2013) Inhibition of

repulsive guidance molecule, RGMa, increases afferent synapse

formation with auditory hair cells. Developmental Neurobiology.

Cole, F., Zhang, W., Geyra, A., Kang, J.S., Krauss, R.S. (2004). Positive

regulation of myogenic bHLH factors and skeletal muscle

development by the cell surface receptor CDO. Developmental Cell 7,

843-854.

25

Coleman, M.E., DeMayo, F., Yin, K.C., Lee, H.M., Geske, R.,

Montgomery, C., Schwartz, R.J (1995). Myogenic vector expression of

insulin-like growth factor I stimulates muscle cell differentiation and

myofiber hypertrophy in transgenic mice. The Journal of Biological

Chemistry 270, 12109-12116.

Collins, C.A., Gnocchi, V.F., White, R.B., Boldrin, L., Perez-Ruiz, A.,

Relaix, F., Morgan, J.E., Zammit, P.S (2009) Integrated functions of

Pax3 and Pax7 in the regulation of proliferation, cell size and

myogenic differentiation. PloS One 4, e4475.

Halbrooks, P.J., Ding, R., Wozney, J.M., Bain, G (2007) Role of RGM

coreceptors in bone morphogenetic protein signaling. Journal of

Molecular Signaling 2, 4.

Hata, K., Fujitani, M., Yasuda, Y., Doya, H., Saito, T., Yamagishi, S.,

Mueller, B.K., Yamashita, T (2006). RGMa inhibition promotes axonal

growth and recovery after spinal cord injury. The Journal of Cell

Biology 173, 47-58.

Huang, F.W., Pinkus, J.L., Pinkus, G. S., Fleming, M.D., Andrews, EN.C

(2005). A mouse model of juvenile hemochromatosis. The Journal of

Clinical Investigation, 115, 8, 2187-2191.

Jorge, E.C., Ahmed, M.U., Bothe, I., Coutinho, L.L., Dietrich, S (2012)

RGMa and RGMb expression pattern during chicken development

suggest unexpected roles for these repulsive guidance molecules in

26

notochord formation, somitogenesis, and myogenesis. Developmental

Dynamics 241, 1886-1900.

Kang, J.S., Yi, M.J., Zhang, W., Feinleib, J.L., Cole, F., Krauss, R.S (2004)

Netrins and neogenin promote myotube formation. The Journal of Cell

Biology 167, 493-504.

Kanomata, K., Kokabu, S., Nojima, J., Fukuda, T., Katagiri, T (2009)

DRAGON, a GPI-anchored membrane protein, inhibits BMP signaling in

C2C12 myoblasts. Genes to Cells 14, 695-702.

Kitayama, M., Ueno, M., Itakura, T., Yamashita, T (2011) Activated

microglia inhibit axonal growth through RGMa. PloS One 6, e25234.

Kong, Y., Rogers, M.R., Qin, X (2013) Effective neuroprotection by

ischemic postconditioning is associated with a decreased expression

of RGMa and inflammation mediators in ischemic rats. Neurochemical

Research 38, 815-825.

Krauss, R.S., Cole, F., Gaio, U., Takaesu, G., Zhang, W., Kang, J.S

(2005) Close encounters: regulation of vertebrate skeletal

myogenesis by cell-cell contact. Journal of Cell Science 118, 2355-

2362.

Kuninger, D., Kuns-Hashimoto, R., Kuzmickas, R., Rotwein, P (2006).

Complex biosynthesis of the muscle-enriched iron regulator RGMc.

Journal of Cell Science 119, 3273-3283.

27

Lee, S.J., McPherron, A.C (2001) Regulation of myostatin activity and

muscle growth. Proceedings of the National Academy of Sciences of

the United States of America 98, 9306-9311.

Liu, X., Hashimoto, M., Horii, H., Yamaguchi, A., Naito, K., Yamashita,

T. (2009). Repulsive guidance molecule b inhibits neurite growth and

is increased after spinal cord injury. Biochemical and Biophysical

Research Communications, 382(4), 795-800.

Matsunaga, E., Tauszig-Delamasure, S., Monnier, P.P., Mueller, B.K.,

Strittmatter, S.M., Mehlen, P., Chedotal, A (2004). RGM and its

receptor neogenin regulate neuronal survival. Nature Cell Biology 6,

749-755.

Matsunaga, E., Nakamura, H., Chedotal, A (2006) Repulsive guidance

molecule plays multiple roles in neuronal differentiation and axon

guidance. The Journal of Neuroscience 26, 6082-6088.

McPherron, A.C., Lee, S.J (1997) Double muscling in cattle due to

mutations in the myostatin gene. Proceedings of the National

Academy of Sciences of the United States of America 94, 12457-

12461.

Monnier, P.P., Sierra, A., Macchi, P., Deitinghoff, L., Andersen, J.S.,

Mann, M., Flad, M., Hornberger, M.R., Stahl, B., Bonhoeffer, F.,

Mueller, B.K (2002) RGM is a repulsive guidance molecule for retinal

axons. Nature 419, 392-395.

28

Mueller, B.K., Yamashita, T., Schaffar, G., Mueller, R (2006) The role of

repulsive guidance molecules in the embryonic and adult vertebrate

central nervous system. Philosophical transactions of the Royal

Society of London 361, 1513-1529.

Niederkofler, V., Salie, R., Sigrist, M., Arber, S. (2004). Repulsive

guidance molecule (RGM) gene function is required for neural tube

closure but not retinal topography in the mouse visual system. The

Journal of Neuroscience 24, 808-818.

Papanikolaou, G., Samuels, M.E., Ludwig, E.H., MacDonald, M.L.,

Franchini, P.L., Dube, M.P., Andres, L., MacFarlane, J., Sakellaropoulos,

N., Politou, M., Nemeth, E., Thompson, J., Risler, J.K., Zaborowska, C.,

Babakaiff, R., Radomski, C.C., Pape, T.D., Davidas, O., Christakis, J.,

Brissot, P., Lockitch, G., Ganz, T., Hayden, M.R., Goldberg, Y.P. 2004.

Mutations in HFE2 cause iron overload in chromosome 1q-linked

juvenile hemochromatosis. Nature Genetics 36, 77-82.

Pietrangelo, A (2007) Hemochromatosis: an endocrine liver disease.

Hepatology 46, 1291-1301.

Quach, N.L., Biressi, S., Reichardt, L.F., Keller, C., Rando, T.A (2009)

Focal adhesion kinase signaling regulates the expression of caveolin 3

and beta1 integrin, genes essential for normal myoblast fusion.

Molecular Biology of the Cell 20, 3422-3435.

29

Rodriguez, A., Pan, P., Parkkila, S (2007). Expression studies of

neogenin and its ligand hemojuvelin in mouse tissues. The Journal of

Histochemistry and Cytochemistry 55, 85-96.

Samad, T.A., Srinivasan, A., Karchewski, L.A., Jeong, S.J., Campagna,

J.A., Ji, R.R., Fabrizio, D.A., Zhang, Y., Lin, H.Y., Bell, E., Woolf, C.J.

(2004). DRAGON: a member of the repulsive guidance molecule-

related family of neuronal- and muscle-expressed membrane proteins

is regulated by DRG11 and has neuronal adhesive properties. The

Journal of Neuroscience 24, 2027-2036.

Sartori, R., Schirwis, E., Blaauw, B., Bortolanza, S., Zhao, J., Enzo, E.,

Stantzou, A., Mouisel, E., Toniolo, L., Ferry, A., Stricker, S., Goldberg,

A.L., Dupont, S., Piccolo, S., Amthor, H., Sandri, M (2013) BMP

signaling controls muscle mass. Nature Genetics 45, 1309-1318.

Schmidtmer, J., Engelkamp, D (2004) Isolation and expression pattern

of three mouse homologues of chick RGM. Gene Expression Patterns

4, 105-110.

Tassew, N.G., Charish, J., Chestopalova, L., Monnier, P.P (2009)

Sustained In Vivo Inhibition of Protein Domains Using Single-Chain Fv

Recombinant Antibodies and Its Application to Dissect RGMa Activity

on Axonal Outgrowth. The Journal of Neuroscience, 29, 4, 1126–1131.

Tassew, N.G., Charish, J., Seidah, N.G., Monnier, P.P (2012) SKI-1 and

Furin generate multiple RGMa fragments that regulate axonal growth.

Developmental Cell 22, 391-402.

30

Truksa, J., Peng, H., Lee, P., Beutler, E. (2006). Bone morphogenetic

proteins 2, 4, and 9 stimulate murine hepcidin 1 expression

independently of Hfe, transferrin receptor 2 (Tfr2), and IL-6.

Proceedings of the National Academy of Sciences, 103, 27, 10289 –

10293.

Yokoyama, T., Takano, K., Yoshida, A., Katada, F., Sun, P., Takenawa,

T., Andoh, T., Endo, T (2007) DA-Raf1, a competent intrinsic

dominant-negative antagonist of the Ras-ERK pathway, is required for

myogenic differentiation. The Journal of Cell Biology 177, 781-793.

Walsh, D.W., Godson, C., Brazil, D.P., Martin, F (2010) Extracellular

BMP-antagonist regulation in development and disease: tied up in

knots. Trends Cell Biology 20, 244–256.

Willems, E., Leyns, L., Vandesompele, J (2008) Standardization of real-

time PCR gene expression data from independent biological

replicates. Analytical Biochemistry, 379(1), 127-29.

Wu, Q., Sun, C.C., Lin, H.Y., Babitt, J.L (2012). Repulsive Guidance

Molecule (RGM) Family Proteins Exhibit Differential Binding Kinetics

for Bone Morphogenetic Proteins (BMPs). Plos One, 7, 9, e46307.

Figure Legends

31

Fig. 1. RT-qPCR data. RGMa, RGMb, and RGMc were quantified

during 5 days of C2C12 differentiation (X-axis). Relative

quantification was determined following the instructions of Willems et

al. (2008). The relative expression levels of (A) RGMa, (B) RGMb, and

(C) RGMc during cellular differentiation.

Fig. 2. RGMs are found at the sarcolemma of adult mouse

skeletal muscle cells, whereas RGMa is also found in the

sarcoplasm, with a striated labeling pattern. Six micrometer

sections of adult mouse quadriceps and soleus muscles were stained

with RGMa (red), RGMb and RGMc (both in green) antibodies.

Transversal (A, C, and E) and longitudinal (B, D, and F) section views

were taken using a fluorescence microscope. (A) RGMa is found at

the sarcoplasm (arrows) and in some particular spots of the

sarcolemma (arrowheads). (B) RGMa label (red) revealing its striated

expression pattern in the fiber. RGMb (C, D) and RGMc (E, F) are

found at the sarcolemma in transversal and longitudinal views. (G)

RGMa negative control. (H) RGMb and RGMc negative control. Bar,

20 µm.

Fig. 3. C-RGMa and N-RGMa confocal images. Sections (6 µm) of

adult mouse EDL and quadriceps muscles were stained for C-RGMa

(red) and N-RGMa (green). Longitudinal (A and D) and transversal (B

and E) section views were taken using a confocal microscope. (A)

Longitudinal section showing the striated labeling pattern of C-RGMa.

32

(B) Transversal section showing C-RGMa at the sarcoplasm and in

some particular spots of the sarcolemma. (C) C-RGMa negative

control, EDL muscle. (D) Longitudinal section showing the striated

labeling pattern of N-RGMa. (E) Transversal section showing N-RGMa

at the sarcoplasm and in some particular spots of the sarcolemma.

(F) N-RGMa negative control in quadriceps muscle. Bar, 20 µm.

Fig. 4. RGMa is found at the sarcoplasm of adult mouse

skeletal muscle cells with a striated labeling pattern in

immunohistochemistry sections. Six micrometer sections of adult

mouse quadriceps muscle were stained for C-RGMa and N-RGMa.

Longitudinal section views were taken using an optical microscope.

(A) C-RGMa labeling. (B) C-RGMa negative control. (C) N-RGMa

labeling. (D) N-RGMa negative control. Bar, 20 µm.

Fig. 5. Western blot of adult mouse skeletal muscle cells. (A)

Western blot analysis of C-RGMa in adult mouse skeletal muscle and

brain. Brain tissue was used as a positive control. Two bands are

visible for C-RGMa (33 and 60 kDa) in both tissue samples. (B)

Western blot analysis of N-RGMa in adult mouse skeletal muscle and

brain. A single 60 kDa band is visible in both tissue samples for N-

RGMa.

Fig. 6. Colocalization of RGMa with Desmin and Titin in adult

mouse skeletal muscle. Six micrometer transverse sections of EDL

muscle were stained for C-RGMa (red), Desmin (green) and Titin

(green). Images were taken using a fluorescence microscope. (A) C-

33

RGMa staining. (B) Desmin staining. (C) Overlay of the

immunostaining images displayed in A and B was performed using

Adobe Photoshop CS6 software. Co-localization spots of RGMa and

Desmin are shown in detail (visualized as yellow dots). (D) Overlay of

immunostaining negative controls for C-RGMa and Desmin. (E) C-

RGMa staining. (F) Titin staining. (G) Overlay of immunostaining

images displayed in E and F. Co-localization spots of RGMa and

Desmin are shown in detail (visualized as yellow dots). (H) Overlay of

immunostaining negative controls for C-RGMa and Titin. Bar, 20 µm.

Fig. 7. RGMa over-expression promotes the hypertrophy of

skeletal muscle cells, whereas RGMa knockdown promotes

atrophy. Primary and C2C12 cells were transfected with an

expression vector harboring RGMa cDNA (RGMa+pCAb), with the

expression vector alone (pCAb) and with an interference RNA for

RGMa. Cells were stained for MHC (red) and GFP (green). Overlay of

images are shown. (A) Width of MHC+ cells carrying the GFP+(RGMa+)

over-expression vector and the control (GFP+). (B) MHC+ cells are

shown in yellow at 5 days of differentiation (DM) for both

RGMa+pCAb+GFP and pCAb+GFP. (C) Width of MHC+ cells carrying

the RGMa interference construct [GFP+(RGMa-)] and the control vector

(GFP+). (D) MHC+ are shown in yellow at 5 days of differentiation

(DM) for both siRGMa+pcDNA3+GFP and pcDNA3+GFP. (E) Western

blots of the indicated cells were probed with the antibodies RGMa and

β-actin, as a control, to prove the efficacy of the treatments. Width of

34

each cell was measured using ImageJ software. Cell width was

expressed in µm. Bar, 20 µm.

Fig. 8. RGMa knockdown blocks myotube formation. Primary

and C2C12 cells were transfected with RGMa+pCAb and

siRGMa+pcDNA3 and their respective vectors alone. Nuclei were

counted after 3 and 5 days of differentiation. Quantification of

myotube formation was assessed as the average number of

nuclei/myotube in MHC+/GFP+ cells. (A) RGMa knockdown and

pcDNA3 control transfectant after 3 days in DM. (B) Fusion index for

MHC+/GFP+(RGMa+) and control after 5 days of differentiation

(significant values are shown, p<0.05).

35