oulu 2013 d 1191 university of oulu p.o.b. 7500 fi-90014...
TRANSCRIPT
ABCDEFG
UNIVERS ITY OF OULU P.O.B . 7500 F I -90014 UNIVERS ITY OF OULU F INLAND
A C T A U N I V E R S I T A T I S O U L U E N S I S
S E R I E S E D I T O R S
SCIENTIAE RERUM NATURALIUM
HUMANIORA
TECHNICA
MEDICA
SCIENTIAE RERUM SOCIALIUM
SCRIPTA ACADEMICA
OECONOMICA
EDITOR IN CHIEF
PUBLICATIONS EDITOR
Senior Assistant Jorma Arhippainen
University Lecturer Santeri Palviainen
Professor Hannu Heusala
Professor Olli Vuolteenaho
University Lecturer Hannu Heikkinen
Director Sinikka Eskelinen
Professor Jari Juga
Professor Olli Vuolteenaho
Publications Editor Kirsti Nurkkala
ISBN 978-952-62-0043-9 (Paperback)ISBN 978-952-62-0044-6 (PDF)ISSN 0355-3221 (Print)ISSN 1796-2234 (Online)
U N I V E R S I TAT I S O U L U E N S I S
MEDICA
ACTAD
D 1191
ACTA
Jenni Nikkilä
OULU 2013
D 1191
Jenni Nikkilä
PALB2 AND RAP80 GENESIN HEREDITARY BREAST CANCER PREDISPOSITION
UNIVERSITY OF OULU GRADUATE SCHOOL;UNIVERSITY OF OULU,FACULTY OF MEDICINE,INSTITUTE OF CLINICAL MEDICINE, DEPARTMENT OF CLINICAL GENETICS;BIOCENTER OULU
A C T A U N I V E R S I T A T I S O U L U E N S I SD M e d i c a 1 1 9 1
JENNI NIKKILÄ
PALB2 AND RAP80 GENESIN HEREDITARY BREAST CANCER PREDISPOSITION
Academic dissertation to be presented with theassent of the Doctoral Training Committee of Healthand Biosciences of the University of Oulu for publicdefence in Auditorium 4 of Oulu University Hospital,on 8 February 2013, at 12 noon
UNIVERSITY OF OULU, OULU 2013
Copyright © 2013Acta Univ. Oul. D 1191, 2013
Supervised byProfessor Robert WinqvistDocent Helmut Pospiech
Reviewed byDoctor Päivi T. PeltomäkiProfessor Tapio Visakorpi
ISBN 978-952-62-0043-9 (Paperback)ISBN 978-952-62-0044-6 (PDF)
ISSN 0355-3221 (Printed)ISSN 1796-2234 (Online)
Cover DesignRaimo Ahonen
JUVENES PRINTTAMPERE 2013
Nikkilä, Jenni, PALB2 and RAP80 genes in hereditary breast cancer predisposition. University of Oulu Graduate School; University of Oulu, Faculty of Medicine, Institute ofClinical Medicine, Department of Clinical Genetics; Biocenter Oulu, P.O. Box 5000, FI-90014University of Oulu, FinlandActa Univ. Oul. D 1191, 2013Oulu, Finland
Abstract
Around 5–10% of all breast cancers stem from a strong hereditary predisposition to the disease.Mutations in currently known breast cancer predisposing genes, however, account for only25–30% of all hereditary breast cancer cases, BRCA1 and BRCA2 being the two major ones. SinceBRCA1 and BRCA2 participate in the DNA damage response, mutations in other genes, such asPALB2 and RAP80, which are involved in these pathways, may also predispose to breast tumours.Therefore, the aim of this study was to evaluate variations of the human PALB2 and RAP80 genesas novel potential candidates for breast cancer susceptibility and to further characterize the role ofPALB2-deficiency in cancer development.
A mutation, c.1592delT, was identified in PALB2 at an elevated frequency among breastcancer patients (0.9%) compared to controls (0.2%) (P = 0.003, OR 3.94, 95% CI 1.5–12.1).Among familial cases the frequency was even higher (2.7%). This mutation represents a genuineloss-of-function mutation since its protein product showed significantly decreased BRCA2-binding affinity and could neither support homologous recombination nor restore crosslink repairin PALB2-deficient cells.
Heterozygous PALB2 c.1592delT carriers displayed haploinsufficiency of PALB2 marked byaberrant DNA replication and DNA damage response that led to a significant increase in genomicinstability. As the tumours were negative for loss of heterozygosity at this chromosomal locus,these findings provide a mechanism for the early stages of breast cancer development in PALB2c.1592delT carriers.
Palb2 was also found to play a critical role in early mouse development. As in Brca1/2-deficient embryos, homozygous inactivation of Palb2 resulted in embryonic lethality due tomesoderm differentiation and cell proliferation defects. The phenotypic similarity of Palb2 andBrca1/2-deficient mice further supports the close functional relationship shown in vitro for theseproteins.
A novel mutation, delE81, was identified in RAP80 in one out of 112 breast cancer families,and in one patient diagnosed with bilateral breast cancer out of 503 unselected breast cancers. Theresultant delE81 protein displayed significantly reduced ubiquitin binding and double-strandbreak (DSB) localization. Furthermore, it impaired the recruitment of the whole BRCA1-Acomplex to the site of DSBs, thus compromising BRCA1-mediated DNA damage responsesignalling. Although the mutation is quite rare, the current results indicate that the RAP80 delE81defect is biologically relevant and is likely associated with a hereditary predisposition to breastcancer.
Keywords: DNA damage response, DNA repair, DNA replication, geneticpredisposition to breast cancer, haploinsufficiency, mouse embryonal developmentfailure, PALB2, RAP80
Nikkilä, Jenni, PALB2 ja RAP80 geenit ja perinnöllinen rintasyöpäalttius. Oulun yliopiston tutkijakoulu; Oulun yliopisto, Lääketieteellinen tiedekunta, Kliinisenlääketieteen laitos, Perinnöllisyyslääketiede; Biocenter Oulu, PL 5000, 90014 Oulun yliopistoActa Univ. Oul. D 1191, 2013Oulu
Tiivistelmä
Arviolta 5–10 % rintasyöpätapauksista aiheutuuu merkittävästä perinnöllisestä alttiudesta sairau-teen. Mutaatiot tähän mennessä tunnistetuissa rintasyövän alttiusgeeneissä, joista BRCA1 jaBRCA2 ovat tärkeimmät, selittävät kuitenkin vain 25–30 % kaikista perinnöllisistä rintasyöpäta-pauksista. Tämän tutkimuksen tarkoituksena on arvioida PALB2- ja RAP80-geenien mahdollisetvaikutukset rintasyöpäalttiuteen, sekä määrittää tarkemmin PALB2:n vaikutus syövän kehityk-seen.
PALB2:sta löydettiin mutaatio, c.1592delT, jota esiintyi merkittävästi enemmän rintasyöpä-potilailla (0,9 %) kuin kontrollihenkilöillä (0,2 %) [P = 0.003, OR 3.94, 95 % CI 1.5–12.1].Kaikista yleisimmin geenimuutos esiintyi perinnöllisten ritasyöpätapausten joukossa (2,7 %).Mutaatio aiheuttaa toiminnallisesti viallisen proteiinin, joka sitoutuu BRCA2:n kanssa normaaliaheikommin, eikä se pysty kunnolla toimimaan homologisessa rekombinaatiossa tai ristikkäidenDNA-virheiden korjauksessa.
Heterotsygoottisen PALB2 c.1592delT-mutaation aiheuttaa PALB2-geenin haploinsuffisienssijoka ilmentyy kantajien soluissa epänormaalina DNA:n kahdentumisena ja DNA-vauriovastee-na, jotka johtavat merkittävästi kohonneeseen genomin epävakaisuuteen. Jo kyseiset toiminnalli-set puutteet näyttävät tarjoavan pätevän selityksen PALB2 c.1592delT kantajien merkittävästisuurentuneelle rintasyöpäriskille ja lienee myös syy siihen, ettei potilaiden kasvaimissa havaittunormaalin vastinaleelin menetystä.
Palb2:lla on keskeinen rooli hiiren alkiokehityksessä. Kuten Brca1/2-puutteellisissa alkiois-sa, myös homotsygoottinen Palb2-inaktivaatio aiheuttaa alkioiden enneaikaisen kuoleman, jokaaiheutuu puutteista mesodermin erilaistumisessa ja hidastuneesta solujen kasvussa. Palb2- jaBrca1/2-puuttellisten hiirien samankaltaisuus vahvistaa ennestään näiden proteiinien toiminnal-lista yhteyttä, joka on osoitettu jo aikaisemmin laboratorio-oloissa.
RAP80-geenistä löydettiin uusi mutaatio, delE81, yhdestä 112 tutkitusta rintasyöpäperheestä.Kyseinen muutos nähtiin myös yhdessä molemminpuoliseen rintasyöpään sairastaneessa poti-laassa valikoimattomassa 503 tapauksen kattavasta aineistosta. Mutatoitunut proteiinituotevähensi huomattavasti DNA-vauriovastekompleksin kykyä sitoutua ubikitiiniin ja paikallistuaDNA-kaksoisjuostekatkoksille. Ennen kaikkea mutaatio heikensi BRCA1-A kompleksin kulje-tuksen DNA-vauriopaikalle, vaarantaen BRCA1-välitteisen DNA-vauriovasteen. Harvinaisuu-desta huolimatta nämä tutkimustulokset osoittavat RAP80 delE81 vaikutuksen olevan biologi-sesti merkittävä. Kyseinen synnynnäinen RAP80-geenimuutos altistaa mitä todennäköisimminkantajansa rintasyövälle.
Asiasanat: DNA-korjaus, DNA-replikaatio, DNA-vauriovaste, haploinsuffisienssi,PALB2, perinnöllinen rintasyöpäalttius, RAP80
7
Acknowledgements
This study was carried out at the Laboratory of Cancer Genetics, Department of
Clinical Genetics, Biocenter Oulu, University of Oulu and Oulu University
Hospital during January 2007 – November 2012. I want to express my sincere
gratitude to all those who participated in this project.
My supervisors, Prof. Robert Winqvist and Adj. Prof. Helmut Pospiech are
warmly acknowledged for their guidance and support throughout my studies.
Especially, Prof. Robert Winqvist is thanked for giving me the opportunity to join
his research group, for providing such excellent facilities to conduct my work and
for the chance to participate in the most fascinating field of research, cancer
research.
I am ever so grateful for all my present and former colleagues and some co-
authors for their supportive and the helpful atmosphere, their collaboration on
various research projects and excellent company: Maria Haanpää, MD, Mikko
Vuorela, M.Sc, Hellevi Peltoketo, PhD, Muthiah Bose, M.Sc, Hannele Erkko,
PhD, Katrin Rapakko, PhD, Sanna-Maria Karppinen, PhD, Szilvia Solyom, PhD
and last but definitely not least I want to thank Katri Pylkäs, PhD, for all the help
and advice that she has given me throughout my PhD studies. Furthermore Meeri
Otsukka and Helmi Konola are thanked for fantastic technical assistance.
Additionally, members of the Laboratory of Clinical Genetics and the Department
of Clinical Genetics are acknowledged for their valuable assistance and for
creating a friendly atmosphere at the Oulu University Hospital. My co-authors
and collaborators Professors Lauri A. Aaltonen, Roger Greenberg, Anne
Kallioniemi, Juha Kere, Veli-Matti Koska, David M. Livingston, Matti Poutanen,
Johanna Schkeutker and Ylermi Soini, Associate Professor Bing Xia, Docents
Vesa Kataja, Arto Mannermaa and Pentti Nieminen, Drs. Daphe W. Bell, Kerstin
Borgmann, Kara A. Coleman, Ronny I. Drapkin, Mervi Grip, Daniel A. Haber,
Arja Jukkola-Vuorinen, Quilan Li, Troy E. Messick, D Morrissey, Aki Mustonen,
Ann C. Parplys, Pia Rantakari, Alexander Miron, Kirsi Sainio, Qing Sheng and
Kirsi Syrjäkoski, Aljona Amelina, Heli Jokela, Heidi Lagerbohm, Henna Mattila,
Roxana Ola and Mervi Reiman deserve my sincere thanks for their valuable
contribution to the projects included in this thesis.
The official referees Dr. Päivi Peltomäki and Prof. Tapio Visakorpi are
thanked for reviewing this thesis and for their excellent suggestions to improve
this thesis. Dr Debbie Kaska and FM Marita Kuusikko are gratefully thanked for
reviewing the language for this thesis.
8
I wish to thank from the bottom of my heart my family and friends for their
endless support, without you I would not have been able to complete my PhD
studies and make my dream come true. My dearest mom and dad you have given
me the best possible foundation to start my career as a researcher and enabled my
PhD studies; you have helped me in so many ways whether supporting me in
every step of the way or patiently being my audience when I have rehearsed for
various presentations. I am so lucky that I have an amazing sister, Sanni, a brother,
Jani, and a “second brother” Andy who have been there for me when I needed you;
you have listened when I wanted to plan my projects and future career and more
importantly you have encouraged me to pursue the ultimate goal – a PhD degree.
I cannot thank my family enough, you all have stood by me no matter what! Last
but not least my dear friends, especially Salla, Outi and Kari, you have taken care
of me in so many ways during my PhD studies whether just getting my mind off
things or helping me with scientific matters. My life would be so boring without
you guys. Thank you for being there for me; you all mean the world to me.
Finally, my loving thanks to Stevie who has been the driving force to finalize my
PhD studies and helped me more than I could have asked for in scientific matters
and more importantly when arranging my future career as a postdoc – you have
made so many things possible and given me so much, I do not know how I can
ever thank you enough.
All the patients and their family members who have volunteered to participate
in this study are most sincerely thanked; without you these projects would not
have been possible.
This study has been financially supported by the University of Oulu, Oulu
University Hospital, the University of Oulu Graduate School, the Academy of
Finland, the University of Oulu Support Foundation, the Cancer Foundation of
Northern Finland, the Finnish Cancer Foundation, the Orion-Farmos Research
Foundation, the Ida Montini Foundation, the Finnish Breast Cancer Group and
Sigrid Juselius Foundation, which I most gratefully acknowledge.
Oulu, November 2012 Jenni Nikkilä
9
Abbreviations
ADD DNA adduct
AI allelic imbalance
APCF Aprataxin and PNK-like factor
ATM ataxia telangiectasia mutated gene/protein
ATR ataxia telangiectasia mutated and Rad3-related gene/protein
ATRIP ATR-interacting protein
BER base excision repair
BRCA1 breast cancer gene/protein 1
BRCA2/FANCD1 breast cancer gene 2/gene for Fanconi anemia subtype D1
BRIP1 BRCA1 interacting protein C-terminal helicase 1
ChAM chromatin-association motif
CHK1/CHEK1 checkpoint kinase gene/protein 1
CHK2/CHEK2 checkpoint kinase gene/protein 2
CHO Chinese hamster ovary cell
CSGE conformation sensitive gel electrophoresis
DDR DNA damage response
DNA-PK DNA-dependent protein kinase
DNA-PKcs DNA-dependent protein kinase catalytic subunit
DSB DNA double-strand break
DSE DNA double-stranded end
EBV Epstein-Barr virus
EdU ethinyl-deoxyuridine
ES embryonic stem cells
ET topoisomerase II inhibitor
FA Fanconi anemia
FAN1 FA associated nuclease 1
GWAS genome-wide association study
HE heterozygote phenotype
HO homozygote phenotype
HR homologous recombination
HU hydroxyurea
ICL interstrand crosslink
IR ionizing radiation
IRIF ionizing radiation-induced foci
LCL lymphoblastoid cell line
10
LOH loss of heterozygosity
miRNA microRNA
MLH1 gene for DNA mismatch repair protein mutL homologue 1
MMC mitomycin C
MMR mismatch repair
MRE11 gene for meiotic recombination 11 homologue
MSH2 gene for DNA mismatch repair protein mutS homologue 2
MSI microsatellite instability
NBS Nijmegen breakage syndrome
NBS1 Nijmegen breakage syndrome gene/protein
NER nucleotide excision repair
NF1 neurofibromatosis 1
NHEJ nonhomologous end-joining
p21 cyclin-dependent kinase inhibitor 1
p27 cyclin-dependent kinase inhibitor 1B
p53/TP53 tumour suppressor protein53
PALB2/FANCN partner and localizer of BRCA2/Fanconi anemia subtype N
gene/protein
PARP poly (ADP-ribose) polymerase
PCR polymerase chain reaction
PNKP polynucleotide kinase 3´-phosphatase
RAP80 receptor associated protein 80/protein
RFB replication fork barrier
ROS reactive oxygen species
RPA replication protein A
RT-PCR real-time PCR
SA splice acceptor
SNP single nucleotide polymorphism
SSB DNA single-strand break
ssDNA single-stranded DNA
TP53 gene for tumour suppressor protein 53
Ub ubiquitin
WT wild-type phenotype
11
List of original publications
This thesis is based on the following articles, which are referred to in the text by
their Roman numerals:
I Erkko H*, Xia B*, Nikkilä J, Schleutker J, Syrjäkoski K, Mannermaa A, Kallioniemi A, Pylkäs K, Karppinen S-M, Rapakko K, Miron A, Sheng Q, Li G, Mattila H, Bell DW, Haber DA, Grip M, Reiman M, Jukkola-Vuorinen A, Mustonen A, Kere J, Aaltonen LA, Kosma V-M, Kataja V, Soini Y, Drapkin RI, Livingston DM & Winqvist R (2007) A recurrent mutation in PALB2 in Finnish breast cancer families. Nature 446(7133): 316–319.
II Nikkilä J*, Parpys A*, Pylkäs K, Xia B, Borgmann K, Nieminen P, Pospiech H & Winqvist R (2012) Heterozygous mutations in PALB2 cause major DNA replication and damage response defects (Manuscript).
III Rantakari P*, Nikkilä J*, Jokela H, Ola R, Pylkäs K, Lagerbohm H, Sainio K, Poutanen M & Winqvist R (2010) Inactivation of Palb2 gene leads to mesoderm differentiation defect and early embryonic lethality in mice. Hum Mol Genet 19(15): 3021–3129.
IV Nikkilä J*, Coleman KA*, Morrissey D*, Pylkäs K, Erkko H, Messick TE, Karppinen S-M, Amelina A, Winqvist R & Greenberg RA (2009) Familial breast cancer screening reveals an alteration in the RAP80 UIM domain that impairs DNA damage response function. Oncogene 28(16): 1843–1852.
*Shared first authorship.
12
13
Contents
Abstract
Tiivistelmä
Acknowledgements 7 Abbreviations 9 List of original publications 11 Contents 13 1 Introduction 15 2 Review of the literature 17
2.1 Origin of cancer and characteristic features ............................................ 17 2.2 Breast cancer ........................................................................................... 20 2.3 Inherited predisposition to breast cancer ................................................. 24 2.4 High risk susceptibility genes ................................................................. 25
2.4.1 BRCA1 .......................................................................................... 26 2.4.2 BRCA2 .......................................................................................... 29 2.4.3 Other high penetrance genes ........................................................ 32
2.5 Moderate and low penetrance risk factors ............................................... 35 2.6 Search for novel disease predisposing gene variants .............................. 41 2.7 DNA damage response ............................................................................ 43
2.7.1 DNA double-strand break repair pathway .................................... 44 2.7.2 Replication stress response ........................................................... 48 2.7.3 DNA crosslink repair by the Fanconi anemia pathway ................ 52
2.8 Genes functioning in BRCA signalling complexes as candidates
for involvement in familial breast cancer susceptibility ......................... 56 2.8.1 PALB2 ........................................................................................... 56 2.8.2 RAP80 ........................................................................................... 59
3 Aims of the study 63 4 Materials and methods 65
4.1 Subjects ................................................................................................... 65 4.1.1 Studies I and IV ............................................................................ 65 4.1.2 Study II ......................................................................................... 66 4.1.3 Study III ........................................................................................ 67
4.2 Methods (I-IV) ........................................................................................ 69 4.3 Ethical issues (I-IV) ................................................................................ 69
5 Results 71
14
5.1 PALB2 c.1592delT mutation predisposes to familial breast cancer
(I) ............................................................................................................. 71 5.2 PALB2 c.1592delT mutation carriers display replication and
G2/M cell cycle checkpoint defects (II) .................................................. 73 5.3 Inactivation of Palb2 gene leads to early embryonic lethality (III) ........ 77 5.4 RAP80 c.241-243delGAA mutation impairs BRCA1- mediated
DNA damage response (IV) .................................................................... 80 6 Discussion 83
6.1 PALB2 is a well-established breast cancer susceptibility gene (I) ........... 83 6.2 On the mechanism of how PALB2 mutations cause predisposition
to breast cancer ........................................................................................ 89 6.3 Palb2 gene plays an important role in early mouse
embryogenesis (III) ................................................................................. 93 6.4 Germline mutations in RAP80 abrogate DNA double-strand
break repair function and may be involved in cancer
predisposition (IV) .................................................................................. 97 7 Concluding remarks 101 References 105 Original publications 141
15
1 Introduction
Cancer is a complex disease caused by a combination of genetic, epigenetic and
environmental factors, and arises from a clone of cells that expands in an
unregulated fashion because of somatically acquired genomic defects. Breast
cancer is the most common form of malignancy and the second leading cause of
cancer mortality among women (Downs-Holmes & Silverman 2011). Every year
~1.4 million women are diagnosed with breast cancer, which accounts for about
23% of all cancers, and around 500 000 breast cancer related deaths are reported
yearly worldwide (American Cancer Society 2011). In Finland, breast cancer
accounts for ~32% of all cancers and 16% of all cancer related deaths. In 2010
alone, around 4700 new breast cancer cases and 900 breast cancer related deaths
were reported (Finnish Cancer Registry 2010).
Approximately 5–10% of all breast cancers stem from a hereditary
predisposition to the disease (Claus et al. 1996, Narod & Foulkes 2004, Parkin
2004). The main indicators for a hereditary disease predisposition are: familial
clustering of breast cancers, early disease onset (under 50 years), and occurrence
of multiple primary tumours in the same individual (Barrett 2010). BRCA1 and
BRCA2 (FANCD1) are the two main breast cancer predisposing genes. They
confer a high disease susceptibility and together account for ~16% of all familial
breast cancers. These genes also predispose to ovarian cancer, and a substantial
percentage of families with breast and ovarian cancers harbour mutations in
BRCA1 and/or BRCA2 (Ford et al. 1998, Miki et al. 1994, Narod 2002, Wooster
et al. 1995). At present 9–14% of all remaining familial breast cancers, not due to
BRCA1/2, are likely to be explained by mutations in other known susceptibility
genes, including TP53, PTEN, STK11 (LKB1), CDH1, ATM, BRIP1
(BACH1/FANCJ), CHEK2, NBS1, RAD50 and various low risk factors.
Interestingly, some of these genes are also connected to certain rare inherited
cancer predisposing syndromes, like Fanconi anemia (FA; BRCA2, BRIP1), Li-
Fraumeni cancer syndrome (TP53), Cowden syndrome (PTEN), Peutz-Jegher
syndrome (STK11) and hereditary diffuse gastric cancer (CDH11). However,
mutations in currently known breast cancer predisposing genes only account for
about 25–30% of all familial breast cancers, leaving currently ~70% unexplained
(Ellsworth et al. 2010, Turnbull & Rahman 2008). Hence, it is crucial to search
for new susceptibility genes and other disease predisposing factors, in order to
provide better criteria for diagnosis, clinical counselling, and therapeutic
intervention. The importance of addressing the complexity of breast cancer and
16
the development of customized treatments are essential for success in the fight
against this common disease.
Genes responsible for childhood cancer syndromes also represent good
candidates for breast cancer predisposition as many of the known susceptibility
genes have been linked to cancer syndromes, especially childhood cancer (e.g.,
ATM in ataxia telangiectasia and BRCA2 and BRIP1 in FA) (Easton 1994,
Mathew 2006, Savitsky et al. 1995). However, most of the more recently
discovered breast cancer susceptibility genes are involved in the DNA damage
response (DDR), as are also BRCA1/2, and the protein products of these genes
usually interact with or otherwise contribute to the functions of BRCA1 and
BRCA2 in DDR. Therefore, novel breast cancer predisposition genes might be
revealed by further investigation of DNA repair pathways. Moreover, genes
whose protein products associate with BRCA1/2 have proved to be excellent
candidates for familial breast cancer susceptibility and several such genes have
already been identified (e.g. CHK2, BRIP1, ATM, ABRAXAS) (Meijers-Heijboer
et al. 2002, Pylkäs et al. 2007, Seal et al. 2006, Solyom et al. 2012). The use of
population isolates with founder mutations of higher prevalence than is typical of
outbred populations can also empower the search for new breast cancer
predisposing factors (Erkko et al. 2007). The Finns represent a particularly good
population for genetic studies as Finland was geographically isolated for centuries,
which has resulted in a genetically more homogenous population. Consequently,
many disease-causing alleles might be enriched among the Finns.
In the current study, we have evaluated the PALB2 and RAP80 genes as
potential candidates for breast cancer susceptibility. These genes were chosen
based on their interactions with BRCA1/2 and their crucial role in DDR. The
coding regions and exon-intron boundaries of PALB2 and RAP80 were screened
for mutations in Northern Finnish breast cancer families in order to define the
potential pathogenicity of the observed variants. Statistical, in silico and
functional analyses were used to assess the potential functional significance of the
mutations observed. In addition, the cancer-related PALB2 c.1592delT mutation
was further examined in order to resolve the functional mechanism by which the
mutation causes an elevated cancer risk for heterozygous carriers. Finally, the role
of PALB2-deficiency in early mouse embryogenesis was investigated.
17
2 Review of the literature
2.1 Origin of cancer and characteristic features
Cancer is mainly a disease of the genome arising from a clone of cells that
expands in an unregulated fashion due to somatically acquired mutations and
other dysregulatory defects of the genome. It is estimated that each cell
undergoes >20 000 DNA damaging events (Lange et al. 2011, Lindahl & Wood
1999) and >10,000 replication errors per cell per day (Loeb 2011). Therefore,
mutations occur throughout the genome, and include the genes responsible for
maintaining genomic stability. DNA damage that escapes correction by base
excision repair (BER) or nucleotide excision repair (NER) can generate
misincorporations during DNA replication. Misincorporations by mutant DNA
polymerases that escape mismatch repair (MMR) cause single-base substitutions.
Unrepaired DNA alterations and crosslinks that block DNA replication can cause
chromosomal rearrangements, amplifications and deletions (Lange et al. 2011,
Loeb 2011, Modrich & Lahue 1996, Preston 2005, Schmitt et al. 2010). Changes
in the copy number of DNA segments as well as various epigenetic lesions, for
example changes in gene promoter cytosine residue methylation status, can also
result in genomic instability. Hence, cancer-driving mutations have occurred
mainly in a set of key genes that control cell proliferation, differentiation as well
as tissue and organ development (Stratton 2011). A normal cell undergoes six
essential physiological changes, the hallmarks of cancer, to become a cancer cell:
1. sustaining proliferative signalling, 2. escaping growth suppressors, 3. resisting
cell death (apoptosis), 4. supporting replicative immortality, 5. inducing
angiogenesis, and 6. activating invasion and metastasis. In addition,
reprogramming of energy metabolism and evading immune destruction have been
suggested to represent two emerging hallmarks of cancer. A normal cell also
needs two enabling characteristics in order to develop into a cancer cell and to
promote tumour progression, and these are genomic instability and an
inflammatory state of premalignant and frankly malignant lesions (Hanahan &
Weinberg 2011). On the basis of age-incidence statistics it has been suggested that
– at least five mutations are required for a normal cell to cancer cell conversion.
However, higher estimates have also been proposed, and for some haematopoietic
neoplasms even fewer changes may be required. For instance, breast, colorectal
and prostate cancers seem to require at least 5–7 changes in essential genomic
18
components, and these estimates are also supported by experimental data (rev. in
Stratton et al. 2009, Stratton 2011).
Each somatic mutation in the cancer cell genome may be classified either as a
driver or as a passenger defect according to its consequences on cancer
development. Driver alterations are causally implicated in oncogenesis and confer
the cell with a growth advantage. The changes have been positively selected for in
the microenvironment of the tissue in which the malignancy arises. On the
contrary, passenger alterations have not been selected for, do not provide the cell
with any particular clonal growth advantage, and do not significantly contribute to
cancer development. Basically, passenger mutations are somatic mutations that
occur during normal cell division and have no major functional consequences.
Overall, driver mutations cluster in a subset of genes that are crucial for cancer
development, whereas passenger mutations are more or less randomly distributed
in the genome (Stratton et al. 2009). In a normal tissue, the frequency of
spontaneous random mutations is extremely low, less than 1 × 10−8 per base pair,
whereas in tumours from the same individual the average frequency is as high as
210 × 10−8 per base pair. It has been estimated that the mean mutation frequency
in tumours is elevated at least 200-fold relative to matching normal tissue, and by
the time a tumour is clinically detected it already contains ~109 cancer cells,
correlating to at least 1012 different mutations (Bielas et al. 2006).
No single genomic defect causes cancer. It is best to think of a
malfunctioning cancer gene as contributing to cancer, rather than causing it.
Cancer develops only when several genes are defective and the threshold for
normalcy is exceeded. Cancer genes can be divided into three categories:
oncogenes, tumour suppressor genes and genome stability maintenance genes.
Oncogenes are genes that contribute to oncogenesis when mutationally activated
or activated under conditions in which the wild-type gene is not. They act in a
dominant fashion, i.e. mutation of one copy of the gene suffices for activation.
Oncogenes typically play a role in cell survival, cell proliferation and growth-
related processes and therefore an activating somatic change in one allele of an
oncogene is usually sufficient to confer a selective growth advantage to the cell.
Tumour suppressor genes are genes that promote tumour growth when inactivated
and these genes play a role in regulating growth factors, cell proliferation, DNA
damage response, cell cycle arrest and apoptosis. Hence, tumour suppressors are
considered to be the “gatekeepers” of the genome. In contrast to oncogenes,
defective tumour suppressor genes act recessively, i.e. both copies need to be
mutated for a loss of function and they can be inactivated by a variety of
19
mechanisms. This “two-hit” model was initially proposed by Alfred Knudson
(1971) based on epidemiological studies of retinoblastoma. In the familial form of
this disease, the mutated allele is inherited from one of the parents and the second
one is somatically inactivated, leading to loss of heterozygosity (LOH) in the
tumour. A second alternative is thought to be a deletion of both alleles
(homozygous deletion). A third possibility is hypermethylation of the promoter
region of the gene, resulting in gene-silencing. However, mutations in tumour
suppressor genes are not always completely recessive, since haploinsufficiency
occurs when one allele is insufficient to sustain the full functionality produced
from two wild-type alleles. Haploinsufficiency can be either partial or complete
and can vary depending on tissue type, other epistatic interactions and
environmental factors. In addition, gene mutations can have qualitative
differences creating a gain of function or dominant-negative effect where the
remaining wild-type allele does not need to be inactivated, and that situation can
be difficult to distinguish from dosage-dependence. A gain-of-function mutation
changes the gene product such that it gains a new and abnormal function, and
dominant negative-mutations alter the gene product in such a way that it interferes
with the function of the wild-type protein, which inhibits its cellular effect
(Knudson 1971, Koorstra et al. 2008, Payne & Kemp 2005, Vogelstein & Kinzler
2004).
A third class of cancer genes consist of genomic stability maintenance genes,
also called caretakers, which include the MMR, NER and BER genes responsible
for repairing mistakes during normal replication or induced by mutagenesis
exposure. Other stability maintenance genes, like BRCA1, BLM and ATM, are
responsible for mitotic recombination and chromosomal segregation. Altogether,
normally functioning stability genes keep genetic alterations to a minimum. In
contrast, when inactivating mutations occur, cellular mutation rates become much
higher than normal. However, there is some overlap in the classification of
stability and tumour suppression genes and like most tumour suppressor genes,
both alleles of genome stability maintenance genes need to be inactivated in order
to cause physiological consequences (Friedberg 2003, Vogelstein & Kinzler 2004).
MicroRNAs (miRNA) are small, evolutionarily conserved, non-coding RNAs
18–25 nucleotides in length that have important functions in gene regulation
(Calin et al. 2002). They can function as malignancy drivers by acting either in a
tumour suppressor or an oncogenic fashion. miRNAs can act as oncogenes when
amplification or overexpression of miRNAs down-regulate a tumour suppressor
and give rise to cancer development by stimulating cell proliferation and growth
20
related processes. On the other hand, miRNAs may act as tumour suppressors by
negatively regulating protein-coding oncogenes, and thus the loss of these
miRNAs leads to upregulation of oncogenes. It is important to note that some
miRNAs can have dual roles in cancer formation, acting both as tumour
suppressors and oncogenes (rev. in Calin et al. 2002, Lujambio & Lowe 2012).
Mutations in these three classes of genes can occur in single somatic cells
resulting in sporadic cancer or in the germline leading to a hereditary cancer
syndrome. It is important to point out that a mutation can be any functionally
impairing change in the genome. In the germline most common alterations are
point mutations or small deletions / insertions, whereas all kinds of gene
alterations can be found in tumour cells (rev. in Vogelstein & Kinzler 2004).
Interestingly, nearly all inherited cancer syndromes arise from mutations in
tumour suppressor or genomic stability maintenance genes rather than in
oncogenes, and the first mutation is inherited in a Mendelian fashion and tends to
cause familial clustering of the disease (Fearon 1997).
2.2 Breast cancer
Breast cancer is the most common form of malignancy and the second leading
cause of cancer mortality among women. It is estimated that one in eight women
will develop breast cancer during her lifetime (Downs-Holmes & Silverman
2011). Worldwide, it is estimated that 1.4 million women are diagnosed with the
disease per year, which accounts for about 23% of all cancers. Breast cancer is
also the second leading cause of cancer deaths among women, since around 500
000 breast cancer related deaths are reported annually (American Cancer Society
2011). In Finland, breast cancer accounts for approximately 32% of all cancers
and 16% of all cancer related deaths, and in 2010 alone, around 4700 new breast
cancer cases and 900 breast cancer related deaths were reported (Finnish Cancer
Registry 2010).
The majority of breast cancer cases occur in women aged 50 years or older
(Barrett 2010). In population based studies, factors related to increased oestrogen
exposure throughout a woman´s lifetime, such as early menarche, late menopause,
use of oral contraceptives, and hormone replacement therapy, have all been
associated with a ~2-fold increase in breast cancer risk among premenopausal
women (Ellsworth et al. 2010). Other risk factors like age, family history, first
pregnancy at over 30 years of age or never being pregnant, and high breast
density are also important risk factors for breast cancer. Modifiable risk factors
21
such as nutrition, exercise, and alcohol/tobacco use also affect breast cancer risk.
For instance, in postmenopausal women, the breast cancer risk increases by 7.1%
for each 12 oz. of beer, 4 oz. of wine, or 1.5 oz. of liquor consumed per day and
women who currently smoke increases their risk by 16%, while those who
stopped smoking over 20 years ago still have a 9% increased risk when compared
to women who never smoked (Hamajima et al. 2002, Luo et al. 2011). In addition,
physical activity lowers the incidence of breast cancer and improves disease
prognosis when compared to inactive women. Moderate exercise five or more
times a week, 30 minutes at time, can reduce the risk of breast cancer by 30–40%
(rev. in Downs-Holmes & Silverman 2011).
Breast cancer can be classified into common (ductal or lobular), which tend
to have a similar prognosis, or less common forms such as mucinous, tubular, and
papillary (favourable prognosis) or inflammatory (poor prognosis) carcinomas. Of
all breast cancers ductal carcinomas accounts for approximately 75%, lobular
15% and the less common forms account for the remaining 10% (Li et al. 2003,
Li et al. 2005).
Breast cancer is biologically a very heterogeneous disease and, according to
microarray-based gene expression profiling studies, can be divided into five
distinct subtypes: luminal A, luminal B, HER2-overexpressing, basal-like / triple
negative and normal like. These subtypes have very different prognoses and
treatment options (Barrett 2010). Most breast cancers belong to the luminal A and
B subtypes and these tumours are oestrogen and progesterone receptor positive
and are associated with a more favourable prognosis, since they have low cellular
proliferation rates. Approximately 15–20% of breast cancers overexpress HER2,
which is an epidermal growth factor tyrosine kinase receptor that participates in
the control of epithelial cell growth and differentiation. These tumours exhibit
high histological grade and usually have a poor prognosis. Rigorous clinical
studies have shown that evaluating ER, PR and HER2 status provides additional
prognostic information beyond normal histological assessment alone. For instance,
basal-like / triple negative breast cancers, which are ER-, PR- and HER2-negative,
show more aggressive clinical behaviour and have relatively low long-term
survival rates, and triple negative disease is not eligible to hormonal treatments.
According to current estimates, triple negative / basal like breast cancers account
for 10–17% of all breast carcinomas (rev. in Downs-Holmes & Silverman 2011,
Ellsworth et al. 2010, Podo et al. 2010).
Interestingly, breast cancer occurs in males as well. Malignant tumours of the
male breast cancer type are rare, accounting for less than 1% of all cancers in men
22
worldwide (Otto 2011). In Finland, 22 cases were reported in 2010, representing
0.15% of all cancers in men (Finnish Cancer Registry 2010).
Heterogeneity in the clinical, pathological and molecular characteristics
makes breast cancer a challenging disease to manage. Hence, patients with similar
characteristics may have quite different clinical outcomes even though they
receive identical treatments (Gort et al. 2007). Therefore, the importance of
understanding the complexity of the disease and the development of novel,
customized treatments for breast cancer are critical for a successful fight against
this malignancy (Ellsworth et al. 2010).
Somatic changes in breast cancer
Somatic mutations occur in all cancer genomes and the number of somatic
mutations varies markedly between individual tumours. The whole-exome
sequencing studies have identified driver mutations in several new cancer genes
including AKT1, AKT2, ARID1B, FGFR1/ZNF703, CASP8, CBFB, CCND1,
CCND3, CDKN1B, GATA3, ERBB2, MAP3K1, MAP3K13, MAP2K4, MLL2,
MLL3, MYC, NCOR1, SMAD4, SMARCD1, TBX3, RUNX1, CBFB, AFF2,
PIK3CA, PIK3R1, PTPN22, PTPRD and SF3B1 (some of these genes are
described in more detail in Tables 1 & 2 and in Chapter 2.5). The driver mutations
found were mainly point mutations of which most were missense, silent and
nonsense mutations, but also read-through and splice-site mutations and
mutations in RNA genes were seen. In addition, dinucleotide mutations and
insertions/deletions were identified (Nik-Zainal et al. 2012a, Stephens et al. 2012,
The Cancer Genome Atlas Network 2012, Banerji et al. 2012).
Stephens et al. found somatic driver point mutations in at least 40 cancer
genes and 73 different combinations of mutated cancer genes among the 100
tumours studied, highlighting the substantial genetic diversity in breast cancer.
According to Stephens et al., the maximum number of mutated cancer genes in an
individual cancer was six and only 28 cases showed a single driver. Hence, the
number of drivers varied substantially and the presence of multiple drivers was
seen to be associated with subclonal evolution of cancer in some cases (Stephens
et al. 2012).
Somatic mutations in TP53, PIK3CA, GATA3, ERBB2, MYC,
FGFR1/ZNF703 and CCND1 have been reported to occur in more than 10% of all
breast cancers (Stephens et al. 2012, The Cancer Genome Atlas Network 2012).
However, many subtype-specific mutations and other genetic/epigenetic changes
23
have been identified in different breast cancer subtypes. For example, in the
luminal A subtype the most frequently mutated genes were PIK3CA (45%)
followed by MAP3K1, GATA3, TP53, CDH1 and MAP2K4. In luminal B cancers
TP53 and PIK3CA (29% each) were the most frequently mutated. Basal-like
cancers differed from the luminal subtypes in that TP53 mutations occurred in 80%
of the basal-like cancers while the majority of the genes mutated in luminal
subtypes were not altered in basal-like cancers. In the HER2 subtype TP53 (72%)
and PIK3CA (39%) were the most frequently mutated genes. These breast cancer
subtypes also differed by mutation types; TP53 mutations in basal-like tumours
were mostly nonsense and frame shifts, whereas in luminal A and B tumours
mostly missense mutations were seen (The Cancer Genome Atlas Network 2012).
The Cancer Genome Atlas Network reported that the overall mutation rate is
lowest in the luminal A subtype and highest in the basal-like and HER2 subtypes,
which further demonstrates the diversity in breast cancers. The luminal B subtype
also displayed a hypermethylated phenotype whereas the basal-like subtype
exhibited a hypomethylated phenotype. Jovanovic et al. have suggested that these
DNA methylation changes might be a useful marker for the early detection of
breast cancer and in the subtype classification as DNA is relatively stable
compared to other sources, like mRNA and proteins, and can be obtained rather
easily from patients (rev. in Jovanovic et al. 2010). Different breast cancer
subtypes also display diverse copy number changes and protein expression
patterns (The Cancer Genome Atlas Network 2012, Jovanovic et al. 2010).
The reported mutation rate for breast cancer is 1.66 per Mb (range 0.4–10.5),
which exceeds that of haematologic and prostate cancers but is lower than in lung
cancer and melanoma (Banerji et al. 2012). According to Nik-Zainal et al., the
final rate-limiting step in breast cancer development is the expansion of the
dominant subclone (present in every tumour and represents over 50% of tumour
cells) to a noticeable mass through the accumulation of many hundreds to
thousands of somatic mutations (Nik-Zainal et al. 2012b). Hence, it has been
predicted that some of these somatic mutations could represent potential new
therapeutic targets within each breast cancer subtype. For example, luminal and
HER2 subtypes have a high frequency of PIK3CA mutations, which suggests that
inhibitors of this activated kinase or its signalling pathway could be potential new
drug candidates (The Cancer Genome Atlas Network 2012).
Furthermore, a recurrent driver rearrangement producing an in-frame fusion
gene MAGI3-AKT3 in basal-like breast cancer was recently identified through
whole-genomic sequencing. This fusion leads to constitutive activation of AKT
24
kinase, which is abolished by treatment with an AKT-inhibitor and could
represent a new therapeutic candidate for basal-like breast cancers displaying this
rearrangement (Banerji et al. 2012).
2.3 Inherited predisposition to breast cancer
Approximately 5–10% of all breast cancers stem from a hereditary predisposition
to the disease (Claus et al. 1996, Narod & Foulkes 2004, Parkin 2004). Hereditary
breast cancer is classified by a clustering of breast cancers in a family that is
substantially higher than the observed incidence in the general population, early
disease onset, occurrence of bilateral breast cancer or multiple primary tumours in
the same individual or male breast cancer incidences in the family. Familial breast
cancer is usually seen in several generations and passes on through the same
bloodline, either maternal or paternal, which indicates that genetic factors must
strongly contribute to breast cancer predisposition (Thull & Vogel 2004). Twin
studies have confirmed that the predominant component of familial aggregation in
breast cancer indeed is due to genetic susceptibility as statistically significant
effects on hereditary factors were seen in 27% of the studied cases. Furthermore,
a monozygotic twin is at substantially higher risk of developing breast cancer by
the age of 75 years than a dizygotic twin of an affected individual (the risk was
18% for a monozygotic twin and 9% for a dizygotic twin) (Lichtenstein et al.
2000, Peto & Mack 2000). The Cancer Genome Atlas Network reported that
approximately ~10% of sporadic breast cancers have a strong hereditary
background, which supports the hypothesis that hereditary factors might actually
explain more than the given 5–10% or that there is at least some overlap between
the sporadic and inherited classification. According to the report, 47 out of 507
sporadic breast cancer patients studied carried deleterious germline variants in
some of the validated breast cancer genes (validated breast cancer genes are
presented in table 1) and therefore had a strong germline contribution to the
disease (The Cancer Genome Atlas Network 2012).
Predisposing factors can be divided into three distinct classes: rare high-
penetrance genes, rare intermediate/moderate-penetrance genes and common low-
penetrance genes, according to the level of breast cancer risk they confer and the
prevalence of disease-causing variants in the population. The level of penetrance
describes the likelihood that an individual who carries a mutation in a gene or a
particular genetic variant will develop breast cancer due to its presence. These
susceptibility genes have been identified by genome-wide linkage analysis and
25
positional cloning, mutation screening, next generation sequencing and genome-
wide association studies (GWAS) (rev. in Turnbull & Rahman 2008). The
grouping of breast cancer susceptibility genes is presented in table 1. However,
mutations in currently known breast cancer predisposing genes only account for
25–30% of familial breast cancers (Ellsworth et al. 2010, Turnbull & Rahman
2008). The fact that more than 70% of the genetic predisposition to breast cancer
is still unknown highlights the need for a search for new susceptibility genes and
other disease predisposing factors.
Table 1. Validated high-, moderate- and low-risk breast cancer susceptibility genes.
Classification Gene Relative risk
High penetrance BRCA1, BRCA2, TP53 >10
PTEN, STK11, CDH1 2–10
Moderate penetrance ATM, CHEK2, BRIP1, NF1, RAD50,
NBS1
2–3
PALB2 2–6 (19*)
Low penetrance FGFR2, TOX3/TNRC9,
MRPS30,FAM84B,
TNP1/IGFBP5/IGFBP2/TNS1, NOTCH2,
ESR1, CDKN2a
1.08–1.26
LSP1, MAP3K1, LSP1, NEK10 1.07–1.13
CASP8, COX11, RAD51L1 0.85–0.97
Breast cancer susceptibility genes are grouped according to Lalloo & Evans 2012, Shuen & Foulkes 2011,
Turnbull & Rahman 2008. *according to Southey et al. 2010.
The polygenic model suggests that the residual unexplained inherited breast
cancer risk might be caused by multiple genetic factors, which alone cause only a
small increase in cancer risk but together their effect could be sufficient for
tumourigenesis. These effects are also likely to be influenced by environmental
factors. The polygenic theory has been largely accepted as an alternative
explanation for the residual breast cancer predisposition and has been validated
by identification of a number of the incumbent polygenes (Antoniou & Easton
2003a, Antoniou & Easton 2006, Pharoah et al. 2002).
2.4 High risk susceptibility genes
Mutations in high penetrance genes are rare in the population but associate with a
very high breast cancer risk. These genes confer a 10- to 20-fold increased risk of
26
breast cancer (table 1) over that of non-mutation carriers and this increased risk is
equivalent to a 40–85% lifetime disease risk (Ahmed et al. 2009, Lalloo & Evans
2012). Overall, high-risk susceptibility genes explain ~22% of all inherited breast
cancers (Ellsworth et al. 2010). The two major breast cancer predisposing genes
are BRCA1 (chapter 2.4.1) and BRCA2 (chapter 2.4.2) (breast cancer 1 and 2), and
both were identified by genetic linkage mapping and positional cloning (Miki et
al. 1994, Wooster et al. 1995). Mutations in these genes exhibit a dominant
disease inheritance pattern and account for ~16% of all familial breast cancers.
These genes also predispose to ovarian cancer and a substantial percentage of
families with breast and ovarian cancers harbour mutations in BRCA1 and/or
BRCA2 (Ford et al. 1998, Narod 2002). In addition, other high penetrance genes
(chapter 2.4.3) have been identified as part of inherited cancer syndromes. These
include germline TP53 mutations found in Li-Fraumeni syndrome (Garber et al.
1991, Malkin 1994), PTEN germline mutations in Cowden syndrome (Nelen et al.
1996), STK11 mutations in Peutz-Jegher syndrome (Hemminki et al. 1998) and
CDH11 (E-Cadherin) mutations in hereditary diffuse gastric cancer (Guilford et al.
1998, Keller et al. 1999). However, the attributable risk of mutations in these
genes to familial breast cancer is low and less well defined than those of BRCA1
and BRCA2.
2.4.1 BRCA1
In 1990, the first breast cancer susceptibility gene was localized to chromosome
17q12-q21 (Hall et al. 1990). In 1994, positional cloning revealed the causative
gene, accordingly named BRCA1 (Miki et al. 1994), and later pathogenic
mutations in BRCA1 were found to account for about 7–10% of all familial breast
cancers (Peto et al. 1999).
BRCA1 comprises 24 exons encoding a protein of 1863 amino acids. Exon 11
is unusually large and, with the exception of the highly conserved domains
located at the terminal regions of the protein, sequence conservation is weak
(Boulton 2006). BRCA1 contains two important domains, a RING domain at the
N-terminus and two BRCT domains at the C-terminus and a coiled-coil domain
upstream of the two BRCT domains (Koonin et al. 1996). The structure of
BRCA1 as well as the binding sites of interacting proteins are shown in figure 1.
27
Fig. 1. Schematic structure and interacting proteins of BRCA1. BRCA1 contains a
RING domain, nuclear export signal (NES) and nuclear localization signals (NLSs) at
its N-terminus, clusters for serine and threonine sequences (SCD), coiled-coil domain
and two BRCT domains at the C-terminus. The transcription activation domains are
indicated as lines above the diagram. The interacting proteins are shown below the
region of BRCA1 required for their association. Modified from Karppinen 2009, Wang
2012.
The BRCA1 protein has important tasks in maintaining genomic stability since it
plays critical roles in many cellular processes including DNA damage response
(DDR), cell cycle checkpoint control, DNA replication, transcription, and
ubiquitylation and chromosome duplication. Therefore, the increase in risk of
breast and ovarian cancer caused by a mutation in BRCA1 has been attributed to
increased genomic instability (rev. in Wang 2012).
BRCA1 is a substrate of the central DNA damage response kinase ATM/ATR
that controls the DDR. It is required for homology directed repair and resolution
of stalled DNA replication forks through homologous recombination (HR) as well
as postreplicative repair in response to UV damage (Moynahan et al. 1999,
Nagaraju & Scully 2007, Powell & Kachnic 2003). BRCA1 forms three distinct
complexes through its C-terminal BRCT domains, namely the BRCA1-A/B/C
complexes, which all exhibit different functions in DDR. The BRCA1-A complex
28
contains RAP80, ABRAXAS, NBA1/MERIT40, BRE/BRCC45 and BRCC36
proteins, and this complex mediates DNA damage induced ubiquitin signalling
for recruitment of BRCA1 to DNA double-strand breaks (DSBs), where it can
further activate the DSB-repair and cell cycle checkpoints (described in more
detail in chapter 2.7.1 and 2.8.2). The BRCA1-B complex includes BRIP1 and
TOPBP1, and this complex is required for replication stress induced checkpoint
control and DNA interstrand crosslink repair (described in more detail in chapters
2.7.2–2.7.3). The BRCA1-C complex, consisting of CtIP and MRN, also has an
important role in DSB-repair and checkpoint activation since it is required for
DNA end resection (described in more detail in chapter 2.7.1–2.7.2) (rev. in Wang
2012).
Many clinically important mutations of BRCA1 frequently target the RING
and BRCT domains, with the majority being frameshift mutations resulting in
truncated protein products. Missense mutations account for approximately 2% of
pathogenic mutations but may be difficult to interpret or distinguish from
polymorphisms. Between 15–27% of the mutations may be due to large
rearrangements, including whole exon deletions and insertion/duplications
(Hogervorst et al. 2003, Wang 2012). Some common founder mutations are
relatively frequent in particular ethnic groups, such as c.68_69delAG and
c.5266dupC that occur in about 1.2% of Ashkenazi Jews, and BRCA1_4216-
2ntA→G that causes an aberrant splice-acceptor recognition site and appears to
be unique for the Finnish population. BRCA1_3745delT has been identified as a
founder mutation to both the Finnish and Swedish populations, possibly due to
the geographic isolation (Huusko et al. 1998, Vehmanen et al. 1997, Zelada-
Hedman et al. 1997). However, the majority of BRCA1 mutations are rare and
many of them have been reported only in single families (Hamel et al. 2011,
Lalloo & Evans 2012).
Pathogenic mutations in BRCA1 confer a lifetime risk of breast cancer
between 60–85%, with increased relative risk at younger ages since the relative
risk of breast cancer is markedly elevated in BRCA1 mutation carriers under age
40, and becomes less dramatic with advanced age. Pathogenic mutations also
confer an increased lifetime risk of ovarian cancer of 40–60%. In addition,
women with BRCA1 mutations also have a 64% increased risk for contralateral
(affecting the other breast) by the age of 70 years (rev. in Lalloo & Evans 2012,
Turnbull & Rahman 2008).
BRCA1 tumours are typically high grade, have an increased frequency of
pushing margins, high degree of nuclear pleomorphism and mitotic frequency,
29
suggesting a medullary carcinoma type. BRCA1 cancers also have a high
incidence of triple negative phenotype and a similar immunohistological profile to
that of sporadic basal carcinomas (Lakhani et al. 2005). The prognosis of BRCA1
associated breast cancers has been reported to be either better or worse than for
sporadic tumours, although the association with triple negative phenotype and
basal carcinomas would support the hypothesis of worse prognosis (Lalloo &
Evans 2012).
A number of studies have been performed to assess the risk of male breast
cancer and other cancers associated with mutations in BRCA1. At the moment, the
general consensus appears to be that the risk of breast cancer in male BRCA1
mutation carriers is higher than that in the general population as population-based
studies have estimated that the cumulative risk for male breast cancer is up to
1.2% by the age of 70 years in BRCA1 mutation carriers (Tai et al. 2007).
Population-based studies have also shown that women carrying BRCA1 mutations
are at a statistically significant increased risk of pancreatic, uterine and fallopian
cancers (rev. in Ahmed et al. 2009).
2.4.2 BRCA2
Initial evidence that BRCA1 was not the only breast cancer susceptibility gene
was provided by a study where only 45% of the breast cancer families were
linked to the BRCA1 locus (Easton et al. 1993). A genome-wide linkage search
was performed for breast cancer families that were not connected to BRCA1 and
this led to the localization of BRCA2 to chromosome 13q12-q13 in 1994, and the
BRCA2 gene was cloned the following year (Wooster et al. 1994, Wooster et al.
1995). Pathogenic mutations in BRCA2 account for approximately 10% of all
familial breast cancers (Anglian Breast Cancer Study Group 2000, Lalloo et al.
2003).
BRCA2 is a large gene with 27 exons encoding a 3418 amino acid protein,
with exon 11 being the largest. BRCA2 contains eight BRC repeats and one DNA-
binding domain that includes a helical motif, three oligonucleotide binding folds
and a tower domain at the C-terminus (rev. in Roy et al. 2011). The structure of
BRCA2 showing also the binding sites of its interacting proteins is presented in
figure 2.
30
Fig. 2. Schematic structure and interacting proteins of BRCA2. BRCA2 contains the
transcription activation domain at its N-terminus, eight BRC repeats, a DNA binding
domain, which includes a helical domain (H), three oligonucleotide binding (OB) folds
and a tower domain (T), and nuclear localization signals (NLSs) and a CDK2
phosphorylation site at S3291 at its C-terminus. The interacting proteins are shown
below and the region of BRCA2 required for their association is indicated by lines.
Modified from Karppinen 2009, Roy et al. 2011.
BRCA2 has very important functions in DDR since its protein product facilitates
HR and is involved in DNA DSB repair. One of these functions is the regulation
of RAD51 loading to DSBs. RAD51 is a crucial protein that covers appropriate
sites of single-stranded DNA, thus preventing it from binding to double-stranded
DNA and therefore activates strand invasion in HR. Hence, RAD51 loading to
DSBs is not only essential for HR but is also responsible for the tumour
suppressive function of this repair process (in more detail in chapter 2.7)
(Moynahan et al. 2001, Thorslund et al. 2010). Recent evidence has also implied
a second role for BRCA2 in protecting the replication fork, since BRCA2-
deficient hamster cells treated with a replication fork stalling and collapsing
reagent (hydroxyurea) were shown to have defects in maintaining the length of
the nascent DNA strand. This is possibly due to the function of BRCA2 in
protecting the nascent DNA strand from degradation at stalled replication forks
(Schlacher et al. 2011). In addition to these functions of BRCA2 in HR and
protecting replication forks, Menzel et al. (2011) showed that BRCA2 is also a
crucial protein for maintaining the G2/M checkpoint function upon DNA damage.
Using an siRNA-screen approach to uncover new G2/M checkpoint regulators,
they discovered that following ionizing radiation (IR) the G2/M checkpoint was
activated in BRCA2-depleted cells; however, these cells could overcome the
G2/M arrest already a few hours later when the checkpoint should still be active
and arrest the cells in G2 phase. This new checkpoint function might contribute to
31
the role of BRCA2 in tumour suppression and also influence the responses to
cancer therapy (Menzel et al. 2011). Hence, BRCA2 is a vital component in
maintaining genomic stability, and defects in its functions can cause genomic
instability, which is a crucial feature of carcinogenesis.
Mutations in BRCA2 confer a breast cancer lifetime risk between 40–85%
(Antoniou et al. 2003b, Lalloo et al. 2003, Peto et al. 1999). The range of risk is
wide since the method of ascertainment from high-risk families or population
studies clearly has an effect. For example, the common Ashkenazi Jewish
population mutation c.5946delT has a much lower penetrance in some studies
suggesting a lifetime risk of breast cancer of 30–40%. In addition, population-
based studies of unselected breast cancer cohorts have shown lower disease risk
for BRCA2 mutation carriers (Antoniou et al. 2010, Evans et al. 2008). Most
known pathogenic mutations (98%) are small deletions, insertions, single base
substitutions or splicing errors resulting in a truncated protein product. Some
BRCA2 mutations occur at a particularly increased frequency in distinct
populations: c.5946delT has found to be present in 1.52% of Ashkenazi Jews and
c.771_775delTCAAA is estimated to be present in 0.5% of the Icelandic
population, but is also a founder mutation in the Finnish population. In addition,
BRCA2_9346-2ntA→G seems to be a unique founder mutation only to the
Finnish population (Huusko et al. 1998, Johannesdottir et al. 1996, Thorlacius et
al. 1996, Vehmanen et al. 1997). BRCA2 mutation carriers who have had breast
cancer also have an increased risk of developing a second primary breast cancer
(Ford et al. 1998). Furthermore, male breast cancer is a major phenotypic feature
of families with a BRCA2 mutation. The relative risk of male breast cancer is
approximately 80- to 100-fold with around 10% of male breast cancers being due
to mutations in BRCA2. Male carriers also have an increased risk of prostate
cancer with lifetime risk of 14–20% (Evans et al. 2010, Thompson et al. 2001).
BRCA2 is also an ovarian cancer susceptibility gene and the risk associated
with pathogenic mutations is up to 30% (Evans et al. 2008). Interestingly,
individuals who carry a BRCA2 mutation located between nucleotides 3035 and
6629 appear to have a higher risk of ovarian cancer and a lower risk of breast
cancer compared with those who carry a mutation elsewhere in the gene. The
molecular basis for this is currently unknown (Gayther et al. 1997, Thompson et
al. 2001). There is also evidence of an increased risk of cancer of the gallbladder,
bile duct, stomach, and pancreas as well as malignant melanoma in BRCA2
mutation carriers (The Breast Cancer Linkage Consortium 1999).
32
Invasive ductal carcinoma is the most common histological type of breast
carcinomas in BRCA2 carriers. These tumours are more frequently ER+ than
those of the controls, although being typically of higher grade. Overall, BRCA2
tumours tend to have features similar to those of sporadic breast cancers, and no
specific subtypes are associated with germline BRCA2 mutations. The prognosis
of BRCA2 related breast cancer is very similar to that of breast cancer in general
(Breast Cancer Linkage Consortium 1997, Lakhani et al. 1998).
BRCA2 in Fanconi anemia
Cancers associated with BRCA2 heterozygosity occur in adulthood. However,
biallelic mutations in this gene lead to the Fanconi anemia (FA) D1
complementation group (FA-D1/FANCD1) (Howlett et al. 2002). To date 15 FA
genes have been identified, the biallelic disruption of which result in a disease.
Changes in these genes underlie over 95% of all known FA patients. Mutations in
FANCA, FANCC and FANCG are the most common ones and account for around
85% of all patients with FA. FANCD1, FANCD2, FANCE, FANCF and FANCL
account for approximately 10%, and FANCB, FANCI, FANCJ, FANCM, FANCN,
FANCP and FANCO are involved in less than 5% of the cases. FA is a rare
autosomal recessive disease characterized by multiple congenital abnormalities,
progressive bone marrow failure and pronounced cancer susceptibility (Su &
Huang 2011, Taniguchi & D'Andrea 2006). In addition, FA-D1 predisposes to
childhood solid tumours and haematological malignancies (Reid et al. 2005).
Interestingly, the affected FA-D1 individuals suffer from severe developmental
abnormalities and a striking propensity to develop rare cancers derived from
embryonal cell types. This is in stark contrast to individuals from the other FA
complementation groups. This indicates that the role of BRCA2 is more
fundamental to the functions of the FA pathway than are other FA proteins, or that
FA-D1 defines a distinct genetic, clinical and functional entity due to the vital role
of BRCA2 in DDR, which is not a feature shared with other FA-genes (the FA
pathway is described in more detail in chapter 2.7.3) (rev. in Patel 2007).
2.4.3 Other high penetrance genes
Four other high risk breast cancer genes have been validated to date, of which
TP53 confers the highest risk as mutations in this gene increase the breast cancer
risk by 18- to 60-fold by the age of 45 years when compared to the general
33
population. In addition, over 50% of TP53 mutation carriers develop cancer
before the age of 50 years (Garber et al. 1991). The other established high risk
factors are PTEN, STK11, and CDH1 and mutations in these genes confer a
lifetime risk of breast cancer of ~40–60% (Lalloo & Evans 2012).
TP53 was first identified in 1979 and is now well known to be frequently
mutated in human tumours. Inherited germline mutations are rare but are known
to result in Li-Fraumeni syndrome, which causes childhood tumours (soft tissue
sarcomas, osteosarcoma, leukaemia, brain tumours, gliomas and adrenocortical
carcinoma), but also early onset breast cancer. Over 70% of classical Li-Fraumeni
families display TP53 mutations, and on average 30% of the female mutation
carriers develop breast cancer by the age of 30 years (Malkin et al. 1990,
Srivastava et al. 1990). However, germline mutations in TP53 are considerably
rarer than are mutations in BRCA1 and BRCA2, and Li-Fraumeni syndrome
accounts for less than 0.1% of all breast cancers (Lalloo & Evans 2012). Wild-
type p53 protein has an important role in cells as it is a transcription factor
involved in the control of G1/S and G2/M phase transitions, in DNA repair, and in
induction of cellular senescence, cell death, autophagy, mitotic catastrophe as
well as angiogenesis. However, the principal function of p53 is to induce cell
death and, since tumour cell death after exposure to radiotherapy occurs by
apoptosis in a p53-dependent manner, inactivation of p53 can produce treatment
resistant tumours. Thus p53 status could be important in determining tumour
response to therapy. There is actually good in vitro evidence suggesting that Li-
Fraumeni patients have an abnormal response to low dose radiation with defective
apoptosis (Lalloo & Evans 2012, Lowe et al. 1994).
Mutations in PTEN, STK11 and CDH1 predispose to different kinds of cancer
syndromes. PTEN produces a protein product that functions as a tumour
suppressor through negative regulation of a cell-survival signalling pathway. In
addition, PTEN has been showed to function in maintaining chromosome
integrity (Shen et al. 2007). Mutations in PTEN cause a rare autosomal
dominantly inherited cancer syndrome, Cowden disease, which is a multiple
hamartoma syndrome (a new tissue growth resembling a tumour) that includes a
high risk of benign and malignant tumours of the breast, thyroid and endometrium
(Nelen et al. 1996, Nelen et al. 1997). PTEN mutation carriers have a 25–50%
lifetime risk for breast cancer (Longy & Lacombe 1996, Starink et al. 1986).
Germline mutations in STK11 and CDH1 also predispose to breast cancer; since
STK11 mutation carriers have a 30–50% risk for developing breast cancer and
mutations in CDH1 causes approximately a 50% risk for breast cancer (rev. in van
34
der Groep et al. 2011). The main function of STK11 is to inhibit cell proliferation
and to control cell polarity. Mutations in this gene cause an autosomal dominant
condition, Peutz-Jeghers syndrome, characterized by hamartomatous intestinal
polyps, mucocutaneous pigmentation and increased incidence of several
malignancies like breast cancer. CDH1 encodes E-cadherin that is a
transmembrane protein important in the maintenance of cell polarity. Mutations in
CDH1 cause hereditary diffuse gastric cancer, an autosomal dominant cancer
syndrome, which associates with elevated breast cancer risk. However, families
with CDH1 mutations with breast cancer but no gastric cancer have also been
reported (Hemminki et al. 1997, Hemminki et al. 1998, Jenne et al. 1998, Keller
et al. 1999, Masciari et al. 2007, Pharoah et al. 2001). All these syndromes
caused by mutations in PTEN, STK11 or CDH1 are very rare and therefore the
risk for familial breast cancer resulting from mutations in these genes is low.
There is no current evidence that mutations in these genes account for a
substantial proportion of hereditary or sporadic breast cancer in the absence of the
additional phenotypical features associated with the respective syndromes (rev. in
Turnbull & Rahman 2008).
RAD51C – a possible high penetrance gene
RAD51C is part of a complex composed of five RAD51 paralogues involved in
HR, where it is thought to play a central role in associating with other paralogues
in order to form two distinct subcomplexes at the sites of DNA damage. These
subcomplexes then mediate DNA damage repair via HR (Masson et al. 2001).
RAD51C has been recently established to be an FA and breast/ovarian cancer
predisposing factor. Biallelic RAD51C mutations have been identified in FA
patients (FANCO) and subsequently monoallelic alterations have been proposed
to cause a high risk for breast/ovarian cancer, comparable to that for mutations in
BRCA1 and BRCA2 (Meindl et al. 2010, Vaz et al. 2010). However, multiple
follow-up studies have not provided any evidence that RAD51C mutations
predispose specifically to breast cancer, as monoallelic RAD51C mutations have
mainly been identified in families displaying both breast and ovarian tumours.
Several studies have found pathogenic RAD51C mutations, most of them
resulting in truncated protein products. The frequency of RAD51C mutations in
breast and ovarian cancer families is between 1.3–4%. Mutations display high or
moderate penetrance (Akbari et al. 2010, Clague et al. 2011, Levy-Lahad 2010,
Meindl et al. 2010, Pang et al. 2011, Pelttari et al. 2011, Romero et al. 2011,
35
Silvestri et al. 2011, Thompson et al. 2012, Vuorela et al. 2011, Wong et al. 2011,
Zheng et al. 2010). Interestingly, approximately 1% of the unselected ovarian
cancers studied harbour germline RAD51C mutations. The relative risk of ovarian
cancer for RAD51C mutation carriers was estimated to be 5.88 which constitutes
a > 9% cumulative risk by the age 80 (Pelttari et al. 2011, Loveday et al. 2012).
2.5 Moderate and low penetrance risk factors
In contrast to the very low population frequency of pathological variants in high-
risk breast cancer susceptibility genes, variants in moderate risk and low risk
breast cancer genes are present at relatively low (moderate penetrance alleles) as
well as high frequencies (low penetrance alleles) in the general population (~1–
40%) (Stratton & Rahman 2008). Inheritance of moderate and low risk alleles
will not cause highly penetrant disease patterns among families and therefore
their inheritance is not easily recognized.
Moderate penetrance genes
Currently, it has been estimated that moderate risk variants account for about 5%
of excessive familial breast cancer risk and carriers of moderate penetrance
mutant alleles have ~6–10% risk of developing breast cancer by the age of 60,
compared to 3% in the general population (Hollestelle et al. 2010, Stratton &
Rahman 2008). To date, six moderate risk breast cancer genes have been
identified and mutations in all of them confer a 2–3 fold increased risk for breast
cancer, except PALB2, which mainly confers a 2–6 fold increased disease risk but
has also been reported to confer an increased risk as high as 19-fold (table 1).
CHEK2, ATM, BRIP1 and PALB2 are the genes studied most extensively as their
protein products are involved in DNA repair and also closely linked to BRCA1
and BRCA2 functions (Erkko et al. 2007, Meijers-Heijboer et al. 2002, Renwick
et al. 2006, Seal et al. 2006, Southey et al. 2010 ). The importance of PALB2 in
DDR and cancer predisposition will be discussed in more detail in chapters 2.7.1,
2.7.3, 2.8.1 and 6.1–6.3. CHEK2 is a cell cycle checkpoint kinase that modulates
the activities of p53 and BRCA1 by phosphorylation in DNA repair (described in
more detail in chapter 2.7.1) (Ahn et al. 2004). ATM is also a checkpoint kinase
that has key functions in DNA repair since upon DNA DSBs it initiates a signal
cascade that involves phosphorylation of multiple proteins like p53, BRCA1 and
CHK2 (for more detail see chapter 2.7.1) (Shiloh 2006). BRIP1 (also known as
36
BACH1) encodes a DEAH helicase that interacts with BRCA1 and has BRCA1-
dependent roles in DNA repair & cell cycle checkpoint control (Peng et al. 2006).
Most of the disease-causing mutations identified from these genes result in
premature protein truncation or nonsense-mediated RNA decay. A small portion is
likely to be due to rare missense variants disrupting critical functions. In each of
these genes there are multiple different pathogenic variants identified so far and
all of them are very rare in the general population. The CHEK2*1100delC variant
generates a truncated product and affects the kinase activity of the protein; it is
present in 1.1% of healthy individuals and in 5.5% of familial breast cancers, and
the relative risk has been estimated to be 2.2 for the mutation carriers (Meijers-
Heijboer et al. 2002). The carrier frequency varies in different populations: In the
Netherlands it reaches up to 0.8% and in Finland and Sweden up to 0.7% and
0.5%, respectively. However, in other European countries, North America and
Australia, it rarely exceeds 0.1 or 0.2% (Dufault et al. 2004, Nevanlinna & Bartek
2006). In addition, carriers of CHEK2*1100delC have an increased risk of
bilateral breast cancer. Families with homozygous CHEK2*1100delC mutations
have also been recently reported. Interestingly, women homozygous for this
mutation are estimated to have a six-fold risk for breast cancer and additionally
there appears to be an increased risk for other malignancies, such as colorectal
and prostate cancer (Adank et al. 2011a). However, this mutation does not
segregate completely with the breast cancer phenotype in families with a high
penetrance inheritance pattern so it seems that CHEK2*1100delC functions in a
polygenic cancer susceptibility setting (rev. in Hollestelle et al. 2010).
Biallelic mutations in ATM cause a rare syndrome, Ataxia-telangiectasia (A-
T), characterized by progressive cerebellar ataxia, immune deficiency and cancer
predisposition, including breast cancer (Easton 1994, Savitsky et al. 1995).
However, female carriers heterozygous for ATM mutations do not display the A-T
phenotype, but have an increased susceptibility to breast cancer with a relative
risk of 2.37 (Renwick et al. 2006, Thompson et al. 2005). Many breast cancer
predisposing ATM variants have been identified, including not only truncated
variants but also a variety of missense ones. The prevalence of these variants
varies greatly among populations from different geographical areas or ethnicity.
The penetrance of ATM is approximately 15% (rev. in Hollestelle et al. 2010,
Lalloo & Evans 2012).
Truncating mutations in BRIP1 are rarer than those in CHEK2 or ATM;
approximately half of the mutations reported in BRIP1 represent a nonsense
mutation, 2392C/T (R798X), and the remainder include disparate small insertions
37
and deletions. Segregation analysis found that the relative risk of breast cancer in
monoallelic mutation carriers is 2.0, although there are reports of higher risks in
some families especially for women younger than 50 years. As expected for a
moderate risk gene, cosegregation of the mutations with the breast cancer
phenotype is incomplete. In addition, BRIP1 mutations have been identified to
confer an increased risk for invasive ovarian cancer. Interestingly, BRIP1 has also
been identified as an FA gene, being responsible for FA complementation group J
(FANCJ) in biallelic mutation carriers. The phenotype in FAN-J is different from
that for biallelic mutations in BRCA2 (FANCD1) and results in a much lower rate
of childhood solid tumours (Levitus et al. 2005, Levran et al. 2005, Litman et al.
2005, Rafnar et al. 2011, Seal et al. 2006).
The MRN complex (MRE11, RAD50 and NBS1) plays a central role in
cellular responses that are activated upon DNA damage, described in more detail
in chapter 2.7.1. Homozygous or compound heterozygous germline mutations in
the Nijmegen Breakage Syndrome (NBS1) gene predispose to the chromosomal
instability associated Nijmegen Breakage Syndrome (NBS). NBS patients and
their relatives are known to be at increased risk for developing several types of
cancers, including breast cancer (Seemanova 1990, Seemanova et al. 2007, Varon
et al. 1998). NBS1 variants have been found to associate with an increased risk for
breast cancer, of which one (NBS1 657del5) is conclusively implicated in breast
cancer. NBS1 657del5 is the most prevalent pathogenic NBS1 mutation implicated
in 90% of NBS patients, and 50% of the heterozygous carriers develop breast
cancer. Heterozygous carriers of this mutation have approximately a 3-fold
increased breast cancer risk. This rare mutation, causing a truncated protein
product, has been studied in various populations but has so far only been shown
to be significantly associated with breast cancer in Polish, Byelorussian and
German populations (Bogdanova et al. 2008, di Masi & Antoccia 2008, Steffen et
al. 2006). RAD50, another member of the MRN complex, has been associated
with breast cancer. A truncating mutation in RAD50, 687delT, was identified to be
a founder mutation in Finland and confers a fourfold increased risk for breast
cancer. A few other mutations have also been identified in RAD50 that might
confer an increased disease risk, but these findings need to be confirmed by
further investigations (Heikkinen et al. 2003, Heikkinen et al. 2006). Another rare
truncating RAD50 mutation, Q350X, has been identified in one family from the
UK. However, the association between this mutation and breast cancer
predisposition remains unclear (Tommiska et al. 2006).
38
The breast cancer risk associated with neurofibromatosis, type 1 (NF1) may
also be moderately increased. NF1 is a common autosomal dominant disorder
with complete penetrance in the family caused by mutations in the NF1 gene.
NF1 is a tumour suppressor and its protein product, neurofibromin, functions
through downregulation of the RAS oncogene product. Patients with NF1 have a
greatly increased relative risk of developing gliomas, malignant peripheral nerve
sheath tumour, juvenile chronic myelomonocytic leukaemia, rhabdomyosarcoma
and phaeochromocytoma (Airewele et al. 2001, Sorensen et al. 1986, Zoller et al.
1997). According to one study, women with NF1 have a 4.9-fold excessive risk of
developing breast cancer by the age of 50 years when compared to the general
population. Overall, this study showed that the risk of developing breast cancer
before turning 50 is 8.4% for women with NF1 suggesting that there might be a
relationship between NF1 and breast cancer. However, further population-based
studies are needed to determine whether this relationship is a general feature of
NF1 or not (Sharif et al. 2007).
Low penetrance genes and factors
A number of common alleles have now been identified to associate with a slightly
increased risk of breast cancer and these may work in a polygenic multiplicative
model to account for the remainder of familial breast cancers. These so-called low
penetrance genes confer a relative risk < 1.5 for breast cancer, but their
heterozygote frequencies are high, ranging from 10% to 90% in the general
population (Pharoah et al. 2008, Turnbull & Rahman 2008). Validated low
penetrance genes are presented in table 1. Through large multistage GWAS
studies, around 20 SNPs have been validated at a significant level that reached the
genome-wide threshold (p < 5 × 10−7) (rev. in Trainer et al. 2011). Validated low-
risk susceptibility alleles are presented in table 2. To date, known low risk
variants account for ~10% of the breast cancer risk in the population although
potentially they may explain a greater component of the heritable risk in the
setting of a family history of the disease (Latif et al. 2010, Mavaddat et al. 2010b,
Turnbull et al. 2010). Unlike high penetrance mutations, none of the SNPs
described have been coding variants that would be expected to alter the amino
acid sequence directly or through regulation of splicing. Several of the SNPs
appear to be associated with an individual gene, many of which have known
functions consistent with a role of breast carcinogenesis such as growth regulation
(FGFR2, MAP3K1), DNA repair (RAD51L), apoptosis (CASP8), or hormone
39
signalling (ESR1). Half of the reported disease risk associated SNP loci map a
long way from any obvious candidate gene, and often in a region described as a
gene desert. However, further investigations of individual loci have provided
initial evidence that these variants may have an effect on long distance chromatin
interactions that in turn can influence the expression of genes over several
hundred kilo-bases from the variant site. This has been showed directly for the
8q24 gene desert and the corresponding expression of the MYC proto-oncogene,
and may well apply to other candidates such as the cell cycle regulator CCND1 in
the 11q13 region, or the fibroblast growth factor FGF10 in the 5p12 region. For
other variants, such as the SNP rs13387042 in the gene desert at 2q35, the
mechanism of action remains unknown, although the risk association has been
well validated (McClellan & King 2010, Pomerantz et al. 2009, Trainer et al.
2011).
40
Table 2. Validated low-penetrance breast cancer susceptibility alleles identified via
GWAS studies.
Variant Gene locus MAF Relative risk
rs2981582 FGFR2 0.40 1.26 (1.23–1.30)
rs3803662 TOX3 0.27 1.11 (1.08–1.14)
rs889312 MAP3K1 0.28 1.13 (1.10–1.16)
rs13281615 8q24/c-MYC/FAM84B 0.40 1.08 (1.05–1.11)
rs13387042 2q35/TNP1/IGFBP5/IGFBP2/TNS1 0.48 1.12 (1.09–1.15)
rs10941679 5p12/FGFR10/MRPS30 0.32 1.11 (1.03–1.20)
rs3817198 LSP1 0.26 1.07 (1.04–1.11)
rs2046210/rs3757318 ESR1 0.35 1.15 (1.08–1.22)
rs4973768 NEK10/SLC4A7 0.46 1.11 (1.08–1.13)
rs6504950 STXBP4/COX11 0.30 0.95 (0.92–0.97)
rs999737 RAD51L 0.25 0.94 (0.88–0.99)
rs11249433 1p11.2/NOTCH2/FCGR1B 0.41 1.16 (1.09–1.24)
rs1045485 CASP8 0.13 0.89 (0.85–0.94)
rs1011970 CDK2NA 0.16 1.09 (1.04–1.14)
rs2380205 ANKRD16 0.41 0.94 (0.91–0.98)
rs704010 ZMIZ1 0.37 1.07 (1.03–1.11)
rs614367 11q13 0.16 1.15 (1.10–1.20)
rs10509168 ZNF365 0.47 1.16 (NA)
rs12662670 ESR1 0.07 1.30 (NA)
rs8170 MERIT40 0.19 1.09 (NA)
rs865686 9q31.2 0.39 0.89 (NA)
MAF minimum allele frequency (frequency at which the less common allele occurs in a given population),
NA not available. Validated low-penetrance breast cancer susceptibility alleles are reviewed in Trainer et
al. 2011, Turnbull & Rahman 2008, Lalloo & Evans 2012, Mavaddat et al. 2010a, Ahmed et al. 2009.
So far, the largest contribution to breast cancer risk has been attributed to an SNP
allele at the FGFR2 locus. This variant is present in about 1% of all breast cancer
cases and is associated with a ~1.1% relative malignancy risk. Somatic FGFR2
mutations that result in overactivity of the protein have also been reported in
several other cancers (Easton et al. 2007). In contrast, a coding variant (D302H)
in the CASP8 gene has been shown to confer a protective effect against breast
cancer. This variant occurs in 13% of women of European background and is
associated with approximately a 12% reduction in breast cancer risk. The
functional implications of the D302H variant are unknown and it is possible that
other variants in linkage disequilibrium with this allele cause the observed
protective effect. However, the effect conferred by the D302H variant further
demonstrates the importance of inherited variation in the apoptosis pathway in
41
breast cancer predisposition (Cox et al. 2007, Mavaddat et al. 2010a).
Interestingly, some of the reported SNPs have also been identified to act as
modifiers of BRCA1 and BRCA2 since several common SNPs (TOX3, FGFR2,
MAP3K, LSP1, 2q35, SLC4A7, 1p11.2, 5p12 and 6q25.1) were found to confer
increased risks for breast cancer in BRCA2 mutation carriers. However, only the
SNPs at TOX3, 2q35 and 6q25.1 showed a further increased cancer risk for
BRCA1 mutation carriers (Antoniou et al. 2008, Antoniou et al. 2011). The
RAD51 polymorphism 135G>C, which affects splicing of this gene, has also been
identified to increase the risk of breast cancer for BRCA2 mutation carriers
(Antoniou et al. 2007).
In addition to low risk genes, certain copy number variants (CNVs) have an
impact on breast cancer risk similar to that of SNPs. The role of CNVs in
psychiatric disorders has already been established (International Schizophrenia
Consortium 2008, Walsh et al. 2008). Not long ago, a large case-control study
ruled out the association of common CNVs in breast cancer susceptibility
(Wellcome Trust Case Control Consortium et al. 2010). Nevertheless, a recent
study showed that a significant overrepresentation of genes involved in the
maintenance of genomic integrity were seen in familial and young breast cancer
cohorts and the number of rare CNVs in familial cases was almost two times, and
in young breast cancer cases 1.5 times higher than in the controls. The
overrepresented genes function mainly in DNA DSB repair signalling (BLM,
RECQL4 and DCLRE1C) and the TP53 network (CASP3 and ESR2) (Pylkäs et al.
2012). This finding was further supported by another study providing evidence
that rare CNVs indeed contribute significantly to familial and early-onset breast
cancer (Krepischi et al. 2012). Therefore, rare CNVs should be recognized as
optional predisposing factors for familial and early-onset breast cancer.
2.6 Search for novel disease predisposing gene variants
Despite the recent discoveries in the genetic predisposition to breast cancer, still
~70% of the inherited disease risk remains unexplained by known susceptibility
factors. It seems unlikely that additional high-risk genes similar to BRCA1 and
BRCA2 will be identified; however, it is possible that novel high risk genes exist
but that mutations in these factors will not be as common as those in BRCA1 and
BRCA2. Since most of the moderate risk genes discovered so far are involved in
DDR it is important to investigate DNA repair pathways further in order to reveal
possible novel breast cancer predisposition genes. In addition, genes coding for
42
protein products that interact with or otherwise contribute to the functions of
BRCA1 and BRCA2 are also excellent candidates for familial breast cancer since
many such susceptibility genes have already been identified (e.g. CHEK2, BRIP1
and PALB2) (Erkko et al. 2007, Meijers-Heijboer et al. 2002, Seal et al. 2006).
Many susceptibility genes have also been identified to cause cancer syndromes,
especially childhood cancer. For example, biallelic mutations in ATM are known
to cause A-T, and defects in BRCA2, BRIP1 and PALB2 predispose to FA, and
both of these syndromes predispose to childhood cancer (Easton 1994, Mathew
2006, Savitsky et al. 1995). Therefore, genes responsible for other childhood
cancer syndromes could also represent good candidates for breast cancer
susceptibility.
The first breast cancer susceptibility genes were found through genetic
linkage studies and positional cloning. Somewhat later moderate risk genes were
discovered through candidate screening approaches, and the most recently
identified common low risk loci were found through genome-wide association
SNP studies. Comprehensive international collaboration together with utilization
of new technology, such as whole genome and exome sequencing, SNP and CNV
arrays, have already revealed multiple novel common low risk genes and
probably will reveal many more in the near future. Nevertheless, the risk
conferred by these novel factors may be even lower than that conferred by those
already identified. Based on the widely accepted polygenic model of inherited
breast cancer predisposition, the identification of these common low risk alleles
will give more information on breast cancer susceptibility when coupled with
knowledge on how breast cancer susceptibility alleles interact to confer an
increased risk of breast cancer. Besides the understanding of breast cancer
susceptibility gene interactions, a greater knowledge of non-genetic factors that
modify the genetic risk will also allow more accurate estimates of the likelihood
for an individual to develop breast cancer (rev. in Ahmed et al. 2009).
Finding out more about the genetics of breast cancer and disease
susceptibility could lead to the availability of targeted therapies for malignancy
based on the individual patient´s genetic profile. As an example, PARP [poly
(ADP-ribose) polymerase] inhibitors were discovered to induce selective tumour
cytotoxicity, while sparing the normal cells in BRCA mutant tumours, and this
tumour cell specific effect raised the possibility that PARP inhibitors could
represent a novel means of therapy for BRCA mutation carriers (Farmer et al.
2005).
43
The use of population isolates with founder mutations of higher prevalence
than is typical of outbred populations can also empower the search for new breast
cancer predisposing factors (Erkko et al. 2007). The Finnish population represents
an especially good target for such studies since Finland has been geographically
isolated for centuries. Therefore, the Finns are genetically relatively homogenous
and thus some disease causing alleles might be enriched in this population.
2.7 DNA damage response
The maintenance of genomic stability is essential for cellular integrity, which is
constantly challenged by DNA lesions. Every day many thousands of DNA
lesions arise in each human cell of which the majority occur as by-products of
normal cell metabolism or DNA replication. Lesions are also induced by either
endogenous [e.g. reactive oxygen species (ROS) resulting from metabolic
processes] or exogenous (e.g. ionizing radiation, UV) agents (Ciccia & Elledge
2010, Jackson & Bartek 2009). DNA damage can have deleterious effects by
interfering with DNA replication and transcription, which may result in mutations
and chromosomal aberrations. Therefore cells have developed DDR as a defence
system against this threat – an elaborate signalling network activated by DNA
damage, which swiftly modulates many physiological processes, such as cell
cycle transmissions, DNA replication, DNA repair and apoptosis, to prevent
lesion transmission to daughter cells (Ciccia & Elledge 2010, Hoeijmakers 2001).
DDR involves the recruitment and localization within distinct nuclear foci of
DNA damage sensors, mediators, transducers and effector proteins (Jackson &
Bartek 2009). To date, we know of several alternative DNA repair pathways that
may be recruited following certain types of DNA damage. DNA DSBs activate
HR and non-homologous end joining (NHEJ) pathways, while single-strand
breaks (SSBs) and lesions activate direct repair mechanisms through the action of
the NER, MMR or BER pathways. Some of these pathways are discussed in more
detail in chapter 2.7.1–2.7.3. Defects in DDR contribute to aging and various
disorders, including developmental defects, neurodegenerative diseases and
cancer (as discussed in previous chapters). This highlights the critical importance
of an efficient DDR for cell and organism viability (Hoeijmakers 2001, Jackson &
Bartek 2009).
44
2.7.1 DNA double-strand break repair pathway
DNA DSBs are the most deleterious form of DNA damage since they do not leave
an intact complementary strand to be used as a template for DNA synthesis. If left
unrepaired, they can ultimately lead to chromosome breaks and translocations that
are associated with different diseases, cancer in particular. DSBs are generated in
response to IR or radiometric drugs by free radical attack on deoxyribose and also
arise upon replication of DNA containing other DNA lesions like SSBs. In
addition, DSBs are deliberately generated in meiotic cells and in lymphocytes
during V(D)J recombination and class switch recombination (Jackson & Bartek
2009). In response to DSBs, repair pathways delay or stop the cell cycle at critical
points before or during DNA replication (G1/S and intra-S checkpoints) and
before cell division (G2/M checkpoint), thus preventing duplication and
segregation of damaged DNA. Proteins responsible for DSB repair can be
categorized as DNA damage sensors (MRN complex, Ku70/Ku80, RPA),
transducers (DNA-PK, ATM, ATR), mediators (MDC1, 53BP1, BRCA1, TopBP1)
and effectors (Chk2, Chk1) (Polo & Jackson 2011).
Two PIKKs (phosphatidylinositol-3kinase-like kinases), ATM and ATR, are
critical upstream regulators of checkpoint signalling. ATM is activated primarily
by DSBs, whereas stalled replication forks and DSBs activate ATR (the function
of ATR in replication stress is discussed in chapter 2.7.2). A third member of the
PIKK family, DNA-dependent protein kinase (DNA-PK), is also activated by
DSBs. In contrast to ATM and ATR, the role of DNA-PK is restricted to NHEJ
repair. Proteins responsible for recruiting these transducer kinases, PIKKs, to the
site of DNA damage are the sensors, MRN complex for ATM, Ku70/Ku80
heterodimer for DNA-PK, and ATR-interacting protein (ATRIP) and replication
protein A (RPA) for ATR. ATR is only recruited to the DSBs in the S or G2 phases
(Cimprich & Cortez 2008, Falck et al. 2005, Jazayeri et al. 2006). The MRN
complex and Ku70/Ku80 heterodimer are actually the first complexes to sense or
recognize DSBs and therefore initiate checkpoint signalling and repair pathways
by recruiting PIKKs. A prime PIKK target is the histone H2A variant H2AX
which is phosphorylated on Ser139, referred to as γH2AX; this is considered to be
a hallmark of the DSB response. γH2AX acts as a docking site for the recruitment
of the mediator protein MDC1 (for ATM) that in turn promotes phospho-
dependent recruitment of MRN-ATM as a positive feedback loop to amplify and
sustain DNA damage signalling (Mirzoeva & Petrini 2001, Stucki & Jackson
2004, Stucki et al. 2005). Further on, phosphorylated MDC1 allows the
45
recruitment of E3 ubiquitin ligases, such as RNF8 and RNF168, to DSB sites
where they polyubiquitylate γH2AX that is needed to get other mediators, such as
53BPI and BRCA1 for ATM, and TopBP1 and Claspin for ATR, to the damaged
sites. It is actually the BRCA1-A complex that is recruited to polyubiquitylated
γH2AX where it mediates the G2/M checkpoint. Another phosphorylation target
for ATM upon DSBs is the effector kinase Chk2 that initiates G1/S and G2/M
checkpoints by inactivating phosphatases of the Cdc25 family. In addition, ATR,
with the help of TopBP1 and Claspin, activates its downstream substrate, the
effector kinase Chk1, which phosphorylates partially the same targets as Chk2,
like Cdc25A, Cdc25C and p53, to induce transient cell cycle arrest in the intra-S
phase checkpoint and/or at the G2 while the DNA damage is repaired. In total,
Chk1 and Chk2 regulate fundamental cellular functions, such as DNA replication
and cell cycle progression, chromatin restructuring and apoptosis. These effector
kinases are actually responsible for spreading the DSB-signal throughout the
nucleus (rev. in Aressy & Ducommun 2008, Bartek & Lukas 2003, Busino et al.
2004). Generally it is thought that ATM activates Chk2, and ATR primarily
activates Chk1. However, this concept has been altered by reports of various
“crosstalk” among these kinases, especially when it was discovered that Chk1 is
activated both by ATR and ATM (rev. in Dai & Grant 2010).
HR and NHEJ repair mechanisms
Cells have two major pathways to repair DSBs, HR and NHEJ. These pathways
are complementary and operate optimally under different circumstances. HR
requires the presence of a homologous template, a sister chromatid, which allows
accurate repair of post-replicative DSBs in S and G2 phases (Moynahan & Jasin
2010, San Filippo et al. 2008). In contrast, NHEJ is active throughout the entire
cell cycle but is the preferred choice as a repair pathway during G0, G1 and early
S phase. While NHEJ is highly efficient, its imprecise nature makes it prone to
mutations (Lieber & Wilson 2010). Simplified models of the NHEJ and HR repair
mechanisms are presented in Figure 3.
Since it mediates the direct ligation of broken DNA ends and usually involves
minimal DNA end processing NHEJ is the most prevalent DSB repair pathway. In
NHEJ, broken DNA ends are first recognized, captured and brought together by
the Ku70/Ku80 heterodimer which recruits and activates the DNA-dependent
protein kinase (DNA-PK) holoenzyme (Gottlieb & Jackson 1993), composed of
the catalytic subunits of DNA-PK (DNA-PKcs) that juxtaposes these broken
46
DNA ends. Before being ligated by the XLF-XRCC4-LigaseIV complex, these
juxtaposed DNA ends are acted on by various factors, such as the nuclease
Artemis, polynucleotide kinase 3´-phosphatase (PNKP), Aprataxin and APLF
(Aprataxin and PNK-like factor). When NHEJ is hindered, alternative end-joining
pathways can take over. These pathways usually rely on terminal
microhomologies for the joining and involve certain factors that function in HR
and SSB repair, like the MRN complex (rev. in Polo & Jackson 2011).
A crucial regulatory step that determines the choice between HR and NHEJ
as a repair pathway is the process of DSB resection, which is required for HR but
not for NHEJ. The BRCA1-C complex facilitates the DSB resection to generate
ssDNA, since the CtIP in the complex promotes DNA end resection by interacting
and stimulating the nuclease activity of the MRN complex (Chen et al. 2008).
Resection comprises the 5´-to-3´nucleolytic processing of DNA ends by the MRN
complex with the help of CtIP, RECQ family helicases and the nucleases ExoI
and Dna2. The ssDNA overhangs formed are rapidly coated by the ssDNA-
binding complex RPA before being substituted by RAD51 with the help of other
RAD51 paralogs and other proteins, which also comprise the FA pathway, such as
FANCD1/BRCA2 and FANCN/PALB2. BRCA2 has a very important function in
HR repair since it promotes the assembly of RAD51 nucleofilaments that
mediates a homology search in the sister chromatid. This is then followed by
strand invasion into the homologous template. BRCA2 requires PALB2 to be
localized to the damaged sites, before it can stabilize the HR intermediates and
thereby promote HR. The role of PALB2 in HR will be discussed in more detail
in chapter 2.8.1. After strand invasion and the action of DNA polymerases and
DNA end ligation by Ligase I, DNA helicase and resolvase enzymes mediate the
cleavage and resolution of HR intermediates to yield intact and repaired DNA
strands (Bernstein & Rothstein 2009, Huertas 2010, Longhese et al. 2010,
Mimitou & Symington 2009, Polo & Jackson 2011, Rupnik et al. 2010, Xia et al.
2006, You & Bailis 2010, Zou & Elledge 2003).
47
Fig. 3. Simplified models of HR and NHEJ repair. Either a Ku70/Ku80 heterodimer or
the MRN complex recognizes the DSB and depending on pathway choice, HR or NHEJ
is activated. The NHEJ mechanism is presented in the diagram on the left and HR on
the right. In the NHEJ model DLIV means DNA ligase IV. In the HR model, after BRCA2
has mediated the RAD51 loading Rad51 forms a nucleoprotein filament that invades a
homologous sequence and activates strand exchange to generate a crossover
between the juxtaposed DNA. Modified by permission from Summers et al. 2011.
The repair pathway choice
It is clear that there are two protein complexes that recognize DSBs and each of
them activates a different repair mechanism. However, it is still not clear how the
cell decides which pathway to use and how HR and NHEJ proteins compete with
each other for the same DNA end. Several studies have shown that Ku70/Ku80
interferes with the repair of DSBs by HR. Conversely, it seems that the MRN
complex can actively release Ku70/Ku80 from DNA ends when HR is the
favourable repair mechanism (rev. in Langerak & Russell 2011). Moreover, the
efficiency of HR increases if Ku is absent, but not the other way around, which
suggests that cells are trying to join the DNA ends by NHEJ before initiating
resection. Therefore, it seems that cells favour NHEJ as the default mechanism to
repair DSBs if the DNA ends are compatible with joining. Only if this fails does
resection start to prepare substrates for HR (Allen et al. 2002, Frank-Vaillant &
Marcand 2002, Pierce et al. 2001).
48
Recent studies have indicated a pivotal role for BRCA1 in the competition
between HR and NHEJ. It is already established that the BRCA1-C complex has a
critical role in the initial resection of DSBs and the BRCA1-B complex functions
in HR as well. However, the specific mechanism for this remains unclear.
Furthermore, the BRCA1-A complex has also been indicated to function in HR,
apparently having a role in maintaining the balance of DNA repair pathways by
restricting excessive end resection (rev in. Coleman & Greenberg 2011, Wang
2012). The BRCA1-A complex has been shown to restrict end resection in the
S/G2 phase of the cell cycle and in this way limits HR and promotes NHEJ as a
repair mechanism. The loss of this complex results in elevated HR, and a decrease
in NHEJ, through an increase in end resection, which is mediated by an increase
in MRE11 and CtIP recruitment to DSBs during S and G2. Thus, it seems that the
BRCA1-A complex has also a role in protecting the break from aberrant nuclease
accessibility. Altogether, the BRCA1-A complex seems to be crucial in
maintaining the balance between HR and NHEJ and disruption of this balance can
lead to genomic instability, since chromosomal instability emerges when BRCA1
HR function is either uncontrolled or absent (Coleman & Greenberg 2011, Hu et
al. 2011). Furthermore, it is well known that recombination between homologous
sequences dispersed throughout the genome can lead to deleterious chromosome
rearrangements, which might promote cancer development. The fact that SSA and
HR are likely the main contributors to these events highlights the importance of
maintaining the balance between HR and NHEJ (Griffin & Thacker 2004,
Kolomietz et al. 2002, Radman et al. 1982, Reliene et al. 2007, Sung & Klein
2006, Thompson & Schild 2001).
2.7.2 Replication stress response
Cells are particularly vulnerable to DNA damage during replication since all
forms of DNA damage block replication and cause replication stress. Therefore,
the stability of DNA replication forks is crucial for genomic stability and cell
survival. When a DNA replication fork encounters obstacles on the DNA template
it may stall or collapse. These obstacles can be spontaneous DNA damage,
secondary structures arising from repeated A-T- or G-C-rich sequences or DNA
interstrand crosslinks (ICL; repair pathway and cellular response to ICLs is
discussed in chapter 2.7.3). If the replisome collides with the transcription
machinery or meets a replication fork barrier (RFB), this also causes replication
fork stalling (Deshpande & Newlon 1996, Little et al. 1993, Lobachev et al. 2007,
49
Woynarowski 2004). Replication forks rely on several signalling and repair
mechanisms to overcome the impediment; key proteins and pathways are
represented in figure 4. Uncoupling of the replicative helicase from the DNA
polymerase leads to accumulation of ssDNA, which is very rapidly bound by RPA,
RPA being a major signal for downstream events, including fork repair and
checkpoint activation. The replisome at stalled forks is stabilized by proteins that
also function in DDR, including RPA, ATR-ATRIP and ATM. These proteins
preserve the fork structure while the damage is repaired. PCNA also accumulates
rapidly to ssDNA/dsDNA transitions, providing an alternative pathway for
bypassing a lesion. Error-prone translesion synthesis polymerases may be
recruited to monoubiquitinated PCNA, which then allows lesion bypass in a
damage tolerance pathway. However, how PCNA accumulates at these sites and
whether this is regulated by the DDR is still not clear (Budzowska & Kanaar 2009,
Moldovan et al. 2007, Niimi et al. 2008, Petermann & Helleday 2010, Zou et al.
2006).
A stalled fork pauses in its movement to give time for the repair machinery to
remove the blockade. After the removal the fork is able to resume progression. If
a stalled fork is not restarted in a timely manner it may lead to the formation of
unusual DNA structures and collapse into a one-ended DSB (double-strand end -
DSE). When a fork encounters a single-strand break in a template strand, this
leads directly to a fork collapse and a DSE. As in the case of DSBs, ATM and
ATR are recruited to collapsed replication forks to activate checkpoint and repair
pathways via a signalling cascade that leads to the phosphorylation of γH2AX in
the DSE site (DSB repair has been discussed in more detail in chapter 2.7.1) (rev.
in Allen et al. 2011, Chanoux et al. 2009, Downey & Durocher 2006, Jones &
Petermann 2012, Ward & Chen 2001). Hence, both older and more recent
evidence indicate that broken forks stimulate replication initiation at adjacent,
dormant origins, possibly to complete replication of sequences that were not
replicated by the broken fork (Doksani et al. 2009, Taylor & Hozier 1976).
The replication stress (intra-S) checkpoint is executed through a stepwise
activation of damage sensors, transducers and effector proteins. First, the ssDNA
is rapidly coated by RPA at the stalled forks and the resulting RPA-ssDNA
complex recruits ATR through an ATRIP-RPA interaction. ATR activation
depends on RAD17-mediated loading of the RAD9-HUS1-RAD1 complex (9-1-1
complex) aided by a RAD9-RPA interaction. Next, RAD9 recruits TopBP1, which
is an essential ATR activator. Activated ATR phosphorylates RAD17, which then
recruits Claspin to be phosphorylated by ATR. Phosphorylated RAD17-Claspin
50
promotes both ATR phosphorylation/activation of Chk1. ATR also activates many
downstream targets, like H2AX and p53, via phosphorylation. These proteins are
involved in checkpoint signalling, DNA repair and apoptosis. However, the
phosphorylation of Chk1 on Ser345 and Ser317 is an extremely important task of
ATR (rev in. Allen et al. 2011, Ciccia & Elledge 2010, Jones & Petermann 2012).
In addition to ATR, other proteins, like Brit1/Mcph1 and FANCM/FAAP24 have
been reported to be essential for efficient Chk1 activation. Additionally, FANCJ
and Tim-Tipin seems to influence Chk1 activation via their roles in ssDNA
generation (Collis et al. 2008, Gong et al. 2010, Rai et al. 2006, Smith et al.
2009). Chk1 has a crucial role in intra-S phase checkpoint activation. Activated
Chk1 phosphorylates effector proteins, like cell cycle phosphatases CDC25A,
CDC25B and CDC25C, which prevent the activation of cyclin E/A-CDK2 and
cyclin B-CDK1. This slows down S phase progression and prevents mitotic entry,
providing time for the cell to restart or repair the stalled forks. Other Chk1
substrates are p53 and DNA repair proteins such as, RAD51, BRCA2 and FANCE.
Altogether Chk1 activation ultimately leads to the stabilization of stalled forks,
repair of collapsed forks and prevention of late origin firing which presumably
prevents further encounters of forks with DNA damage (Bahassi et al. 2008,
Ciccia & Elledge 2010, Kemp et al. 2010, Sanchez et al. 1997, Shieh et al. 2000,
Sorensen et al. 2003, Wang et al. 2007, Zhao et al. 2002).
ATR has always been considered to be the more important player in the
response to replication blocks than ATM. However, there is crosstalk between
ATR and ATM. ATM promotes processing of DSBs also during S phase, and ATM
can be phosphorylated and activated by ATR in response to replication stress.
Indeed, it has been shown that ATM signalling also slows replication in response
to DNA damage and this probably occurs by inhibition of origin firing. In
addition, ATM plays roles in the stabilization and repair of damaged replication
forks (Costanzo et al. 2000, Falck et al. 2001, Jazayeri et al. 2006, Jones &
Petermann 2012, Stiff et al. 2006).
Activated Chk1 has also been reported to be required for the HR mediated
restart of replication forks (Sorensen et al. 2005). Interestingly, HR plays a major
role in restarting stalled and collapsed forks, and this role is essential in higher
eukaryotes (Budzowska & Kanaar 2009, Sonoda et al. 1998). Most spontaneous
HR happens during DNA replication followed by DNA damage arising at
replication forks (Arnaudeau et al. 2001, Saleh-Gohari et al. 2005). HR catalyses
template switching of a blocked replication strand to the undamaged sister
chromatid where DNA synthesis and a second template switch bypass the
51
blocking lesion. If the lesion occurs in repeated sequences invasion can happen in
or out of register with the latter producing detectable genetic rearrangements. In
the same way, at collapsed forks, HR mediates strand invasion of the 3´end of a
DSE into a sister chromatid, a process termed break-induced replication (BIR)
(Llorente et al. 2008, Lundin et al. 2002, Saintigny et al. 2001). Recent studies
performed by Schlacher et al. on BRCA2 and by Hashimoto et al. on RAD51 and
MRE11 revealed that these key HR proteins perform crucial functions also at
replication forks. Both studies showed unexpected roles for BRCA2 and RAD51
in protecting nascent DNA from MRE11 mediated degradation. The protective
roles of BRCA2 and RAD51 are independent of HR and have been suggested to
relate to the licensing of cell cycle progression. According to this model, at stalled
replication forks Chk1-mediated inhibition of CDKs prevents BRCA2
phosphorylation. Once lesions are removed, the genome is fully duplicated and
stable, and RAD51 filaments are no longer needed, CDKs phosphorylate BRCA2
to promote RAD51 disassembly, which has been shown to promote entry into
mitosis (Ayoub et al. 2009, Hashimoto et al. 2010, Schlacher et al. 2011). This
replication-stress induced MRE11 recruitment seems to be dependent on PARP1
and PARP2 proteins functioning in DNA break protection. These enzymes are
suggested to detect disrupted replication forks and to attract MRE11 for resection
leading to ssDNA formation at stalled forks, which then allows RAD51 loading
and subsequent HR. However, the reason why MRE11 degrades a newly
synthesized strand is unknown, but the whole MRN complex is known to be
required for repair of DSBs spontaneously arising during replication. This is
consistent with the demonstration of the accumulation of DSBs during DNA
replication in the absence of MRE11. One explanation could be that BRCA2,
RAD51 and MRE11 may balance replicating forks by maintaining a fine
equilibrium between opposing activities. These could stabilize forks and promote
rapid repair. Interestingly, inhibition of PARP1 is a synthetic lethal with defects in
HR and is currently being tested as a monotherapy for heritable breast and
ovarian cancers deficient in BRCA1 or BRCA2, underlining the importance of HR
in the replication stress response (Bryant et al. 2009, Costanzo 2011, Farmer et al.
2005, Hashimoto et al. 2010, Schlacher et al. 2011).
Additionally, several reports have suggested that NHEJ factors are involved
in the replication stress response. The Ku70/Ku80 heterodimer, a core NHEJ
factor, likely plays an important role in DNA replication, since it associates with
mammalian origins of replication and replication-related proteins including DNA
polymerases, the origin recognition complex and PCNA. As a response to
52
replication stress, the Ku heterodimer associates with γH2AX foci in a DNA-
PKcs independent manner; however, the resolution of these foci depends on
DNA-PKcs, probably reflecting DSE and/or DSB repair. Considering the
significant cross-regulation of HR and NHEJ in DSB repair (discussed in more
detail in chapter 2.7.1) it is possible that HR and NHEJ proteins cooperate also in
fork restart (Allen et al. 2011, Arnaudeau et al. 2001).
Fig. 4. The replication stress response network. Black arrows/bars represent
activation or suppression pathways or interactions between different proteins, grey
arrows, which have been marked with stars, indicate known phosphorylation events
by ATM, ATR and DNA-PKcs and PIKKs stands for ATM/ATR/DNA-PKcs. Note that RPA
is phosphorylated by all three PIKKs. Modified by permission from the Oxford
University Press: [Journal of Molecular Cell Biology] Allen et al. 2011 (Copyright 2012).
2.7.3 DNA crosslink repair by the Fanconi anemia pathway
ICLs are toxic lesions that can arise during normal cellular metabolism or cancer
chemotherapy. ICL covalently tethers both DNA strands, which blocks DNA
strand separation and prevents DNA metabolism, like transcription and replication
(Su & Huang 2011). Cells have evolved a distinct pathway to deal with such
lesions, named the Fanconi anaemia pathway, since all the 15 FA proteins
cooperate in this pathway. A schematic model of the FA pathway is presented in
figure 5.
The FA pathway is not constitutively active in normal cells but is turned on
during S phase or following DNA damage. Repair is initiated when two
replication forks converge upon the site of the crosslink leading to replication fork
53
stalling. The ICL is recognized by the FANCM/FAAP24 complex, which then
recruits the FA core complex. MRN is also alerted to the lesion site in order to
activate ATR. ATR activates cell cycle checkpoints including Chk1 and also
initiates the repair process. ATR phosphorylates the FA core complex and
FANCD2 on the Thr691 and Ser717 sites. These phosphorylation events promote
monoubiquitylation and enhance cellular resistance to DNA crosslinking agents
(Friedel et al. 2009, Ho et al. 2006, Shuen & Foulkes 2011). Like FANCD2,
phosphorylation of FANCI is also required for the monoubiquitylation and
localization of the FANCD2-FANCI (ID) complex to the damage sites. It has been
suggested that the phosphorylation of FANCI may function as a molecular switch
to turn on the FA pathway, but this needs more clarification (Ishiai et al. 2008).
The FA core complex is composed of eight FA proteins (A, B, C, E, F, G, L
and M), which assemble into a nuclear complex. FANCL functions as an E3
ubiquitin ligase, monoubiquitylating its two substrates FANCD2 and FANCI.
Recently, a new subunit of the FA core complex, FAAP20, was identified.
FAAP20 interacts with FANCA, maintains the integrity of the FA core complex
and allows the monoubiquitination (Kim et al. 2012). In addition to the FA core
complex, MHF1 and MHF2 also serve as a multi-subunit ubiquitin E3 ligase for
the FANCD2-FANCD1 monoubiquitylation (Dorsman et al. 2007, Kennedy &
D'Andrea 2005, Montes de Oca et al. 2005, Smogorzewska et al. 2007, Wang
2007). The ubiquitylated ID complex assembles at the DNA damage sites to
stabilize the arrested fork and allows the recruitment of a number of proteins, like
FANCD1 (BRCA2), FANCN (PALB2), FACJ (BACH1/BRIP1), FANCO
(RAD51C), RAD51 and PCNA, to remove the ICL and to generate a DSB and/or
a DNA adduct (ADD), which are ultimately repaired by HR (DSB) and/or
translesion DNA synthesis (TLS)/NER (ADD) (Garcia-Higuera et al. 2000,
Hussain et al. 2004, Kumaraswamy & Shiekhattar 2007, Meindl et al. 2010, Vaz
et al. 2010, Wang et al. 2004, Xia et al. 2006). Especially BRCA1 plays an
important role in HR mediated ICL repair, since it promotes chromatin loading of
ubiquitylated FANCD2 at an early step and RAD51 loading at a later step
(Bunting et al. 2012).
The ID complex also recruits endonucleases such as FA associated nuclease 1
(FAN1) and the newly identified FANCP/SLX4 protein, which severs the
crosslink via dual incisions leading to the uncoupling of sister chromatids from
one another. SLX4-associated MUS81/EME1 and ERCC1/XPF nucleases also
promote crosslink unhooking (Ciccia et al. 2008, Crossan & Patel 2012, Kratz et
al. 2010, Liu et al. 2010, MacKay et al. 2010, Smogorzewska et al. 2010). The
54
unhooking process converts a stalled replication fork into a DSB and TLS allows
the bypass of the untied cross-linking oligonucleotides and the restoration of a
nascent strand. This step is performed by TLS polymerases like REV1, DNA
polymerase ζ and/or DNA polymerase η. The DSB is then repaired by HR (see
chapter 2.7.1 for the HR repair mechanism), while NER removes the remaining
adducts followed by replication fork restoration (rev in. de Groote et al. 2011,
Kim & D'Andrea 2012, Su & Huang 2011). Importantly, the FA core complex
seems to control the TLS step as well since it was shown that one FA core
complex subunit, FAAP20, regulates the localization of monoubiquitinated REV1
to the DNA lesion (Kim et al. 2012).
The deubiquitylation of FANCD2 by USP1 and UAF1 has also been shown
to be equally as important as its monoubiquitylation. While the exact mechanism
regulating this monodeubiquitylation is still unknown, several possibilities have
been proposed. For instance, deubiquitylation of FANCD2 may be required to
release it from DNA repair complex(es), thereby allowing the following repair
steps to take place in order to complete ICL repair. Another possibility is that
persistence of FANCD2 mono-ubiquitylation may be toxic to cells and hence it
gets deubiquitylated (Kim et al. 2009, Nijman et al. 2005, Oestergaard et al.
2007). Interestingly, also SUMOylation is involved in FA pathway coordination,
since recently SUMOylation was shown to target the USP1-UAF1 deubiquitinase
complex to its monoubiquitinated substrates (Yang et al. 2011). Hence, the FA
and TLS pathways are coordinated by concerted actions of ubiquitin and SUMO
signalling networks.
55
Fig. 5. A schematic model of the Fanconi anemia pathway for ICL repair. Modified by
permission from the Springer Science and Business media: [Journal of Mammary
Gland Biology and Neoplasia] Shuen & Foulkes 2011 (Copyright 2012).
56
2.8 Genes functioning in BRCA signalling complexes as candidates for involvement in familial breast cancer
susceptibility
2.8.1 PALB2
Partner and localizer of BRCA2 (PALB2) was identified via its interaction with
BRCA2, when the search for new proteins present in endogenous BRCA2-
containing complexes were performed. BRCA2 was immunoprecipitated from
HeLa cell extracts and the relatively small number of major components of the
precipitate were identified. All protein bands were subjected to mass
spectrometric analysis. As expected the most abundant protein with the highest
molecular weight was BRCA2 and the protein migrating just above the 39 kD gel
marker was RAD51. A third major band just above 97 kD was identified to be
PALB2 (Xia et al. 2006).
The putative open reading frame of PALB2 consists of 1186 residues
(~130kDa) and the PALB2 gene, which is located on chromosome 16p12, consists
of 13 exons (Xia et al. 2006). PALB2 contains a coiled coil domain, which
mediates PALB2 oligomerization and directly binds to BRCA1. Further analysis
of PALB2 revealed two DNA binding sites, P2T1 and P2T3, as well as a ChAM
(chromatin-association motif) binding motif at its N-terminus. A WD40 repeat at
its C-terminus binds directly to BRCA2 and RAD51 (Bleuyard et al. 2012,
Buisson et al. 2010, Dray et al. 2010, Sy et al. 2009b, Sy et al. 2009c, Xia et al.
2006, Zhang et al. 2009a, Zhang et al. 2009b). The schematic protein structure of
PALB2, known binding sites and interacting proteins are presented in figure 6.
Fig. 6. Schematic protein structure of PALB2. PALB2 contains a coiled-coil domain,
two DNA binding sites, P2T1 and P2T3, and ChAM binding motif at its N-terminus, and
WD40 repeats at its C-terminus. These binding sites/motifs and interacting proteins
are shown above/below the region of PALB2 required for their association (lines).
Modified by permission from American Society for Microbiology journals: [Molecular
and Cellular Biology] Ma et al. 2012 (Copyright 2012).
57
Around 50% of PALB2 and 50% of BRCA2 are associated with each other in the
cell with high affinity; however, the stoichiometry of PALB2-BRCA1 binding
seems to be much lower (Sy et al. 2009b, Xia et al. 2006, Zhang et al. 2009a).
Like BRCA2-deficient cells, PALB2 knockdown cells exhibited diminished HR
activity, MMC sensitivity and intra-S phase checkpoint defects showing that
PALB2 is extremely crucial for BRCA2 functions in HR mediated DSB repair. In
addition, the PALB2 binding site was mapped to the extreme N-terminus of
BRCA2, which is both necessary and sufficient for the binding (Xia et al. 2006).
PALB2 actually promotes the stable intranuclear localization/accumulation of
BRCA2, which facilitates BRCA2 functions in HR/DSB repair and the S phase
checkpoint. The PALB2-BRCA2 interaction stabilizes BRCA2, at least partly, by
preventing BRCA2 from being stranded in the nuclear soluble fraction where it is
intrinsically less stable, due to the effects of proteasome-mediated degradation
(Xia et al. 2006). BRCA2 localization to the damaged sites actually occurs via a
PALB2-BRCA1 interaction; therefore PALB2 physically links BRCA1 and
BRCA2 to form a “BRCA” complex. It was shown that BRCA1 is an upstream
regulator of PALB2 and BRCA2 in DDR since BRCA1 promotes the
concentration of PALB2-BRCA2 at the damage sites. Furthermore, these studies
demonstrated that the association between BRCA1 and PALB2 is important for
HR mediated DSB repair (Sy et al. 2009b, Zhang et al. 2009a, Zhang et al.
2009b). Altogether, PALB2 is essential for key nuclear caretaker functions of
BRCA2, since it ensures proper BRCA2 nuclear presence and as PALB2-deficient
cells phenocopy BRCA2-deficient cells. Interestingly, three discrete cancer-
associated BRCA2 mutations were found to disrupt the BRCA2-PALB2
association, causing deficiencies in BRCA2 localization to nuclear structures and
to function in HR mediated DSB repair (Xia et al. 2006). This implies that
PALB2 could contribute to genome stability much in the same way as BRCA2,
which has a vital tumour suppressor function.
Two separate studies have identified MRG15 as a component of certain
chromatin remodelling complexes that bind to PALB2 and suggested that this
interaction is actually required for recruiting the whole BRCA complex to the
damage sites. Hayakawa et al. showed that knockdown of MRG15 diminished the
BRCA complex recruitment and reduced chromatin loading of PALB2 and
BRCA2. However, this result was not supported by the other study, pointing to a
need for further studies in order to clarify whether or not MRG15 actually
facilitates HR via PALB2 (Hayakawa et al. 2010, Sy et al. 2009a).
58
PALB2 has a multifaceted role in DDR. It has been demonstrated that PALB2
directly binds D loops and dsDNA. More importantly, it interacts directly with
RAD51, which enhances the ability of the latter to form D-loops during strand
invasion in HR mediated DSB repair (Buisson et al. 2010, Dray et al. 2010). In
addition, one in vivo study demonstrated that PALB2 actually oligomerizes upon
DNA damage in order to facilitate its accumulation at DSB sites and to initiate
HR by recruiting the BRCA2-RAD51 repair machinery (Sy et al. 2009c).
Furthermore, the recently identified ChAM motif in the N-terminus of PALB2
mediates the nucleosome association of PALB2. This functional domain seems to
be important for its DSB localization, since its deletion from PALB2 does not
effect its ability to interact with other known binding partners, but causes reduced
association with chromatin in unperturbed and damaged cells. Thus, ChAM
deletion is sufficient to decrease PALB2 and RAD51 accumulation at DSB sites
(Bleuyard et al. 2012). Taken together, it seems that PALB2 needs MRG15, the
ChAM motif as well as oligomerization in order to localize to DSBs and to recruit
the BRCA2-RAD51 complex to damaged sites for the initiation of HR. However,
this issue needs further work to be fully understood.
Besides PALB2´s role in HR mediated DSB repair, recent reports have also
linked PALB2 to G2/M checkpoint maintenance and cellular redox homeostasis
regulation. Menzel et al. performed a siRNA screen to identify unknown G2
checkpoint regulators and demonstrated that both BRCA2 and PALB2 are the
main regulators for G2/M checkpoint maintenance following DNA damage
(discussed in more detail in chapters 5.2 and 6.2). Interestingly this new function
seems to be independent of HR (Menzel et al. 2011) as Ma et al. (2012) were able
to show that PALB2 can directly interact with KEAP1, an oxidative stress sensor
that binds and represses the master antioxidant transcription factor NRF2.
According to their study, PALB2 can effectively compete with NRF2 for KEAP1
binding, thereby promoting NRF2 accumulation, which lowers the amount of
cellular reactive oxygen species (Ma et al. 2012). It seems that PALB2 could be a
link between oxidative stress and the development of cancer and FA since it
seems to play a crucial part in pathways maintaining cellular redox homeostasis
and genomic instability.
PALB2 is a Fanconi anemia gene
Soon after PALB2 was discovered, biallelic pathogenic mutations were identified
in eight FA families, which identified PALB2 as a FA gene, named FANCN,
59
causing FA subtype N (FA-N). FA-N patients have a typical disease phenotype
with growth retardation and variable congenital malformations (the FA phenotype
was described in more detail in chapter 2.4.2). However, the FA-N subtype is
associated with an unusually severe predisposition to pediatric malignancies; all
eight patients developed cancer in early childhood, including five
medulloblastomas, three Wilms tumours, two acute myelogenous leukaemias, one
neuroblastoma and one Kaposi form haemangioendothelioma (Reid et al. 2007,
Xia et al. 2007). The subtype and ages of onset for FA-N are very similar to FA-
D1, which is also characterised by a high risk of embryonal tumours (Alter et al.
2007). Interestingly, the FA-N and FA-D1 phenotypes differ greatly from the
other FA subtypes, in which a progressive bone-marrow failure pre-dominates,
often in advance of blood malignancies. This might indicate that PALB2 and
BRCA2 are more fundamental for the FA pathway than the other FA proteins, or
alternatively, that FA-N and FA-D1 define a distinct genetic, clinical and
functional entity. This latter possibility is supported by the fact that both PALB2
and BRCA2 have vital roles in HR repair and dysfunction in either of these
proteins leads to a fundamental defect in DSB repair, a feature that is not
consistent with other FA subtypes. Only in strictly isogenic genetic systems, do
disruption of some FA genes (like FANCC and FANCD2) result in very mild HR
repair defects. Moreover, even a knockout of FANCJ or FANCM does not lead to
HR repair deficiencies (Bridge et al. 2005, Mosedale et al. 2005, Niedzwiedz et
al. 2004, Patel 2007, Pellegrini & Venkitaraman 2004, Xia et al. 2006, Yamamoto
et al. 2005). The similarities between FA-N and FA-D1 phenotypes highlight even
further the functional relationship and importance of the association of these
proteins to maintain genomic stability.
2.8.2 RAP80
Receptor-associated protein 80, RAP80, was identified as a novel nuclear protein
that is expressed in many human tissues, but is most abundant in the testis and
ovary. In situ hybridization of mouse testis showed that RAP80 is expressed at
especially high levels in germ cells. RAP80 encodes a 719 amino acid protein
(~80 kDa) containing two nuclear localization signals and two ubiquitin-
interacting motifs (UIMs) at its N-terminus, and two zinc finger motifs at its C-
terminus (Yan et al. 2007b, Yan et al. 2002). The schematic protein structure of
RAP80, known bind sites and interacting proteins are presented in figure 7.
60
Fig. 7. Schematic protein structure of RAP80. RAP80 contains two nuclear localization
signals (NLS), one SUMO interacting motif (SIM) and two ubiquitin-interacting motifs
(UIM) at its N-terminus, as well as an ABRAXAS interacting region (AIR) and two zinc
finger motifs (ZFD) at its C-terminus. The interacting proteins are shown below the
region of RAP80 required for their association (lines). Modified from Sato et al. 2009,
Yan et al. 2007, Yan et al. 2002.
RAP80 was shown to repress basal transcription and to interact with the retinoid-
related testis-associated receptor (RTR), and therefore it was suggested to
function as a (co)-repressor in RTR signalling (Yan et al. 2002). Later, another
study showed that RAP80 also interacts with the oestrogen receptor alpha (ERα)
in an agonist-dependent way and functions as a modulator in ERα-dependent
transcriptional activity, since RAP80 expression was shown to enhance ERα-
mediated transcriptional activation by causing an increase in ERα protein levels.
A decrease in ERα polyubiquitination caused an increase in ERα levels that was
dependent on RAP80 (Yan et al. 2007a).
RAP80 in DSB repair
RAP80 was identified to be a BRCA1 associated protein. It interacts with the
BRCA1-A complex, which is abundant in the cell during M phase, but not with
the BRCA1-B complex that primarily occurs during S phase (Sobhian et al. 2007)
(see chapter 2.4.1 for BRCA1 complex classifications). Upon DNA damage,
RAP80 forms DNA damage foci that co-localize with those of BRCA1. Like
BRCA1, RAP80 translocates to the damage foci after a delay of 90–120 min,
which suggests that RAP80 is not a DNA damage sensor but a downstream
mediator of the DDR cascade. Additionally, RAP80 foci formation depends on
the presence of MDC1 and γH2AX. Interestingly, knockdown of RAP80 impaired
the formation of BRCA1 and BRCC36 foci, but not those of BRIP1, which
suggests that RAP80 might function in targeting the BRCA1-BARD1-BRCC36
complex (BRCA1-A) to DSB sites (Kim et al. 2007, Sobhian et al. 2007, Wang et
al. 2007, Yan et al. 2007b). RAP80 has been shown to actually be responsible for
localizing this BRCA1 complex to DSBs via its UIM domains. The UIMs of
61
RAP80 were shown to bind polyubiquitin directly, especially K6- or K63-linked
ubiquitin chains. RAP80 has only a low affinity for K48-linked ubiquitin chains.
Moreover, these UIMs are required for the re-localization of RAP80 to DNA foci
after IR (IRIF), since mutant RAP80 lacking UIMs failed to localize to IRIFs.
Therefore, RAP80 targets the whole BRCA1-A complex to DSB sites through
recognition of K6- or K63 ubiquitin chains (Kim et al. 2007, Sobhian et al. 2007).
In fact, RAP80-BRCA1 interaction happens via ABRAXAS. ABRAXAS and
RAP80 were shown to bind directly via the N-terminal region of ABRAXAS and
the internal region of RAP80. ABRAXAS then links RAP80 to BRCA1 by
binding to the BRCT repeats of BRCA1 (Kim et al. 2007, Liu et al. 2007, Wang
et al. 2007). Overall, RAP80 is required for optimal HR repair of DSBs, since
RAP80 depleted cells showed impaired IR-induced Chk1 activation, which led to
defective G2/M checkpoint control. Thus RAP80 has a regulatory function in
DDR signalling by facilitating the recruitment of the BRCA1-A complex (see
chapter 2.4.1 for BRCA1 complex classifications) to the DSBs (Kim et al. 2007,
Sobhian et al. 2007, Wang et al. 2007, Yan et al. 2007b).
Recently RAP80 was also shown to possess a SIM (SUMO interacting motif)
domain that forms a tandem SIM-UIM-UIM motif at its N-terminus. The RAP80
SIM domain binds specifically to SUMO2/3 and both SIM and UIM domains
play important roles in recruiting RAP80 and the BRCA1-A complex to DSBs.
However, the actual target that the SIM domain of RAP80 binds to is still not
clear and needs further studies (Hu et al. 2012).
Interestingly, RAP80 is also phosphorylated on Ser205 by ATM in response
to IR treatment. This phosphorylation occurs within 5 min after the treatment,
which is much earlier than its accumulation at IRIF. Therefore RAP80 might have
a more general role in checkpoint control and repair of different forms of DNA.
However, whether this early phosphorylation has a specific regulatory function
has to be properly determined. RAP80 is also phosphorylated on the same site by
ATR and migrates to DNA damage foci in response to UV treatment, which
further supports the possibility that RAP80 plays a role in the response to
different types of DNA damage (Yan et al. 2008).
As discussed in chapter 2.7.1, the BRCA1-A complex plays a crucial role in
maintaining the balance between HR and NHEJ repair in response to DSBs.
Recently, RAP80 was shown to protect DSBs from excessive resection thus
suppressing HR and promoting NHEJ. Therefore, it may be actually RAP80 that
maintains the balance between these repair pathways. The binding of RAP80 to
ubiquitinated chromatin in response to IR driven DDR limits excessive end
62
resection, and thereby favours NHEJ as a repair choice. Conversely, loss of
RAP80 leads to an increase in HR and SSA and a corresponding decrease in
NHEJ (Coleman & Greenberg 2011, Hu et al. 2011).
In addition, RAP80 has been shown to be a negative regulator of p53 activity
and a direct transcription target of p53 following DNA damage. RAP80 is able to
form a complex with p53 and increase HDM2-dependent polyubiquitination of
p53, which leads to its destabilization. The resulting RAP80-p53-HDM2 loop is
vital in controlling the level of p53 and its transactivation activities. Therefore,
this loop might have an important role in genome stability and oncogenesis (Yan
et al. 2009). Based on the role that RAP80 has in DDR, it is possible that
mutations in RAP80 that compromise BRCA1 function could predispose to cancer,
particularly to breast and ovarian cancers.
63
3 Aims of the study
To date, approximately 70 % of the familial breast cancer cases cannot be
explained by any known predisposing factors. Therefore, it is predicted that a
majority of these cases could be caused by mutations in still unknown moderate-
and low-penetrance susceptibility genes, which together with the input of
environmental and epigenetic factors etc. predispose to breast cancer. It is also
suggested that there might still be additional high-penetrance susceptibility alleles
to be identified. Since the two major breast cancer susceptibility genes’ protein
products BRCA1 and BRCA2 function in maintaining genomic stability via the
DNA damage response, it is presumed that other genes involved in the same
pathways could be potential candidate genes for familial breast cancer
susceptibility. In this study PALB2 and RAP80 were evaluated as potential
candidate genes for hereditary predisposition to breast cancer, and particularly the
role of PALB2-deficiency in cancer development was analysed in more detail.
These genes were chosen because of their significant impact on BRCA1 and
BRCA2 function during DDR. The specific aims of each sub-study were:
1. To identify potential cancer predisposing mutations in the PALB2 gene and to
evaluate their involvement in female and male breast, prostate and colorectal
cancer susceptibility.
2. To determine the functional mechanisms behind the Finnish PALB2
c.1592delT founder mutation and to explain why it causes an elevated cancer
risk for its heterozygous carriers.
3. To study the role of the PALB2 gene in mouse embryogenesis and to gain
more insight into its function and importance as a communicator between
BRCA1 and BRCA2.
4. To explore whether germline mutations in the RAP80 gene are associated
with an increased susceptibility to breast cancer.
64
65
4 Materials and methods
4.1 Subjects
4.1.1 Studies I and IV
Patients from 112–113 breast cancer families from northern Finland were
screened for germline mutations in the coding regions and exon-intron boundaries
of the PALB2 and RAP80 genes. The families originated from the geographic area
covered by the services of the Northern Ostrobothnia Health Care District. For
statistical analysis, one index patient from each family was selected according to
the youngest age of breast cancer onset. The studied families were categorized as
high- and moderate-risk families and the inclusion criteria and the number of
families are summarized in table 3.
Table 3. Inclusion criteria and a summary of the breast cancer families included in
studies I and IV.
Risk Study (no. of families) Inclusion criteria
High I (65) 1. Three or more cases of breast cancer and/or
ovarian cancer in first- or second-degree relatives.
2. Two cases of breast cancer in first- or second-
degree relatives, of which at least one with early
disease onset (≤ 35 years), bilateral disease or
multiple primary tumours.
IV (65)
Moderate I (48) Two cases of breast cancer in first- or second-
degree relatives. IV (47)
Total number of families I (113)
IV (112)
All the high-risk families have previously been screened and found negative for
germline mutations in BRCA1, BRCA2, CHEK2 and TP53 genes (Allinen et al.
2001, Huusko et al. 1998, Huusko et al. 1999, Rapakko et al. 2001). The families
have also been screened for mutation in RAD50, MRE11 and ATM genes in
previous studies (Heikkinen et al. 2003, Heikkinen et al. 2005).
In addition, an unselected cohort of breast cancer patients was analysed.
These breast cancer patients were not selected for or against family history of
cancer and were collected from three different university hospitals in Finland.
66
This cohort consisted of 503 (study IV) or 534 (study I) cases from Oulu, 888
cases from Tampere (study I) and 496 cases from Kuopio (study I). The blood
samples collected in Oulu were from breast cancer patients diagnosed either
between 1988–1994 or 2000–2004. The samples from Tampere were from breast
cancer patients diagnosed either between 1986–1994 or 1997–2000. The samples
from Kuopio were from breast cancer patients diagnosed during 1990–1995.
In study I prostate cancer, male breast cancer and colorectal cancer cohorts
were also analysed. The unselected Finnish prostate cancer cohort consisted of
475 patients diagnosed during 2000–2001. The familial prostate cancer cohort
(N = 164) was collected from all of Finland and the inclusion criteria were having
at least two affected family members (80 families had three or more affected
members). The colorectal cancer cohort (188 familial cases and 288 unselected
cases) was collected at Helsinki University Hospital during 1994–2002. Inclusion
criteria for the familial cases were malignancy in two or more first-degree
relatives. All of the familial cases had previously been studied for microsatellite
instability (MSI) and all positive individuals were screened for and had tested
negative for mutations in the MLH1 and MSH2 genes. The male breast cancer
cohort (N = 141) was collected from all available patients diagnosed in Finland
during 1967–1996.
The control cohort was from consecutive anonymous Finnish Red-Cross
blood donors originating from the same geographical region as the studied cases.
All control individuals were cancer-free at the time of donation of the blood
sample and there was no follow-up on donor health status. The age of the blood
donors was ≥ 40 years. Altogether 2501 (1765 females and 736 males) control
cases were analysed in study I, and the control cohort consisted of 325 female
control cases in study IV.
4.1.2 Study II
Altogether, eight female individuals carrying the PALB2 c.1592delT founder
mutation were analysed in this study. From these, six were breast cancer patients
and two were their healthy relatives representing two different families, which
were identified as PALB2 c.1592delT carriers in our previous study (Erkko et al.
2007). The samples of the breast cancer patients were collected at least three
years after the initial cancer diagnosis, with the exception of one patient who was
diagnosed in the same year that the sample was taken. Six healthy female
individuals were used as controls and from these, three were healthy family
67
members from two of our patients’ families and three were independent controls.
In addition, samples from six healthy female individuals were used as controls in
chromosomal analysis, originating from our previous study (Heikkinen et al.
2006). All controls originated from the same geographical region as the carriers,
were age-matched and cancer-free at the time of donation. There was no follow-
up on the health status of the controls.
4.1.3 Study III
A total of 451 C57BL/N6 mice, including wild-type mice and mice lacking the
Palb2 gene were used in this study. Chimaeric Palb2 knockout mice were
generated by inserting a gene trap clone CG0691 (Sanger Institute Gene Trap
Resource) into mouse blastocysts. Breeding of the chimaeric mice with
C57BL/N6 mice produced heterozygous (HE) Palb2(+/-) offspring carrying the
trapped allele. The insertion is located between exon 1 (E1) and exon 2 (E2) of
the mouse Palb2 gene. The gene trap contains a splice acceptor (SA) upstream of
the βGeo gene and trapping of the gene leads to the expression of a Palb2 Exon1-
β-Gal fusion protein. In order to locate the exact integration site of the gene trap
insertion, overlapping PCR amplicons compatible with a gene trap-specific 5´
reverse primer were designed to cover intron 1 of the Palb2 gene. The annealing
temperature was 60° for all primers. The sequences for the primers used are listed
in table 4. Direct sequencing revealed the exact integration site of the gene trap.
Table 4. Primers for gene trap localization.
Primer Sequence
Local_1 5´TGATGCTTTTGGTTTGTGGA´3
Local_2 5´CTTTTGGGGGATAGCAGTCA´3
Local_3 5´AGCCTCTGGAAAACCCACTT´3
Local_4 5´ACAGCCAGGGCTACAGAGAA´3
Local_5 5´AAGACCCACGTTGGAACAAG´3
Homozygous (HO), HE and wild-type (WT) mice were identified by genomic
PCR where the WT allele produces a 720 bp PCR fragment and the mutant allele
a 560 bp PCR fragment. The structure of the Palb2 gene trap construct and
identification of HO, HE and WT mice is presented in figure 8.
68
Fig. 8. A) Structure of the Palb2 gene trap construct. B) Identification of HO, HE and
WT mice.
All studies were carried out in a mixed genetic background (129/C57BL/N6, 1:1)
and the C57BL/N6 mice used as blastocyst donors were a gift from Charles River
laboratories (Wilmington, MA, USA). The mice were fed with a Soya-free diet
and were maintained in a specific pathogen-free state at the Central Animal
laboratory of the University of Turku.
Genotyping the chimeric mice
Genotyping was performed on DNA that was extracted from yolk sacs of E7.5-
E9.5 embryos or earmarks of 2-week-old mice. The methods for DNA extractions
are described in section 4.2. For genotyping, specific primers for the targeted
intronic sequence (WTs and WTa) and a primer from the gene trap (GTa) were
used to detect the WT and the mutant allele. Primer pair WTs/WTa amplified a
720 bp fragment in both heterozygote and WT DNA samples, whereas the primer
pair WTs/GTa amplified a 510 bp fragment in both Palb2(+/-) and Palb2(-/-) DNA.
The mutant allele was also identified by primers GTz and GTz2 that amplified a
680 bp internal segment of the Lac-Z reporter gene. Sequences for the primers
used are shown in table 5 and the genotypic distribution of the 451 chimaeric
mice is presented in table 9.
Table 5. Primer sequences for genotyping the chimeric mice.
Primer Sequence
WTs 5´CTTTTGGGGGATAGCAGTCA´3
WTa 5´TTGTTGCTGCTGAGTTCCTG´3
GTa 5´AGTATCGGCCTCAGGAAGATCG´3
GTz 5´TTATCGATGAGCGTGGTGGTTATGC´3
GTz2 5´GCGCGTACATCGGGCAAATAATATC´3
69
4.2 Methods (I-IV)
Detailed descriptions of the methods used in this thesis are presented in the
original publications, which are attached. Methods used in the original
publications are listed in table 6.
Table 6. Methods used in the original publications.
Method Original publication
Blastocyst, fibroblast cell and lymphoblastoid cell culturing I, II, III
Conformation sensitive gel electrophoresis and direct sequencing I, IV
Cytogenetic analysis II, IV
DNA extraction, total RNA extraction and cDNA synthesis I, II, III, IV
DNA fibre assay II
Etoposide and hydroxyurea treatments II
Flow cytometry analysis II
Homologous recombination DSB repair analysis I
Immunofluorescence and Immunohistochemistry I, IV
In situ hybridization III
Laser-capture microdissection and allelic imbalance analysis I, IV
Laser generated DNA DSBs IV
Mitomycin C sensitivity test I
Plasmid vectors I, IV
Real-time Quantitative RT-PCR III
Statistical and bioinformatics analyses I, II, III, IV
Western blot and protein binding analysis I, II, IV
4.3 Ethical issues (I-IV)
For studies I, II and IV, approval to investigate and collect biological specimens
and clinical information was obtained from the Ethical Board of the Northern
Ostrobothnia Health Care District (license no. 88/2999) and the Finnish Ministry
of Social Affairs (license no. 46/07/98), as well as from the Ethical Boards of the
University Hospital Health Care Districts. Family members were only contacted
with permission from the index patient and all patient and their family members
gave their informed consent. Results were for research purposes only and no
information on the outcome of ongoing studies was given to patients or their
family members. For study III, all experiments carried out with mice were
approved by the Finnish ethical committee for experimental animals (license no.
70
2008-00142) and complied with international guidelines on the care and use of
laboratory animals.
71
5 Results
5.1 PALB2 c.1592delT mutation predisposes to familial breast
cancer (I)
One hundred thirteen BRCA1/BRCA2 mutation-negative breast or breast-ovarian
cancer families from northern Finland were screened for mutations in the PALB2
gene and six exonic variants were found (Table 1 of study I). Four of these
changes were also seen at similar frequencies in controls, which suggest that they
are not cancer-associated. This was also supported by the results obtained from in
silico analyses done by PolyPhen, ESEfinder and NNSplice software. Whereas,
the c.1592delT alteration was discovered from three (2.7%) index cases but only
from six (0.2%) controls from the total of 2 501 analysed (P = 0.005; OR 11.3;
95% CI 1.8–57.8), which suggests that this alteration has a significant association
with cancer. The c.1592delT variant results in a frame-shift after Leu531, with a
new reading frame progressing for 28 codons before termination. In addition, one
alteration in exon 13, 3433G>C (G1145R), was detected from one index case but
none of the 971 controls studied. Three sequence alterations were also identified
in introns but none of them appeared to be cancer associated.
The potentially pathogenic variants c.1592delT and 3422G>C were analysed
functionally to determine whether their BRCA2-binding ability has changed, the
mutations cause HR-deficiency or affect the ability to restore crosslink repair in
PALB2-deficient cells. The c.1592delT mutation resulted in a truncated protein
product (PALB2-L531Fs) and had markedly decreased BRCA2-binding affinity
without affecting endogenous BRCA2 abundance upon transient overexpression.
PALB2-L531Fs also failed to support HR in PALB2 knockdown cells or to
restore crosslink repair after MMC-treatment in PALB2-depleted cells
underlining the functional importance of BRCA2-PALB2 complex formation and
indicating that c.1592delT is a genuine loss-of-function mutation. In contrast,
PALB2-G1145R appears to function normally since its ability to bind BRCA2
was not altered, it supported HR normally and could restore crosslink repair in
PALB2-deficient cells.
In addition, the PALB2 c.1592delT mutation was screened from Finnish
unselected breast cancers, unselected male breast cancers, colorectal cancers and
prostate cancers and these results are presented in Table 7. Information in table 7
is already published as a supplementary table 1 of study I.
72
Table 7. The PALB2 c.1592delT mutation occurrence in different cancers.
Cancer type Affected cases Controls Statistics
Unselected BC 0.9% (18/1918) 0.2% (6/2501) P = 0.003 (OR 3.94; CL 1.5–12.1; NA)
Unselected male BC - (0/141) - (0/475) NA
Familial prostate cancer 0.6% (1/164) - (0/475) NS (NA)
Unselected prostate cancer - (0/475) - (0/475) NA
Familial colorectal cancer - (0/188) 0.2% (6/2501) NS (NA)
Unselected colorectal cancer - (0/288) 0.2% (6/2501) NS (NA)
BC breast cancer, NA not available, NS not significant, OR odds ratio, CI confidence interval (study I,
supplementary table 1).
Possible co-segregation of known Finnish BRCA1/BRCA2 mutations was tested
for 16 cases from 22 unrelated cancer patients identified (21 breast cancer and
one prostate cancer) heterozygous for PALB2 c.1592delT, but none was detected.
The average age of disease onset for c.1592delT carriers was 52.9 years (variation
39–73 years), which is slightly younger than the average age of onset for the
unselected breast cancer group (57.8 years, variation 23–95 years) but older than
those with Finnish BRCA1 (46 years, variation 32–57 years) and BRCA2 (48
years, variation 45–67 years) mutations (Sarantaus et al. 2000). The mutation was
also observed in six controls (0.2%, 6/2501), which suggests that the penetrance
of c.1592delT is incomplete. Nevertheless, most c.1592delT mutation positive
control individuals were relative young (five females aged between 27–51 years
and one male aged 28 years) when compared with the above-noted average age of
disease onset for affected mutation carriers. Therefore, the actual penetrance
might be higher than currently observed (study I). For the 18 unselected breast
cancer cases carrying the c.1592delT mutation, available records were analysed
for evidence of a positive family history and at least half of these families were
found to have an apparently heritable disease history. Interestingly, all breast
cancer families studied also showed other forms of cancer, including colorectal,
stomach, endometrial and pancreatic cancers and leukaemia. Segregation analysis
of the c.1592delT allele with regard to cancer incidence was attempted in three of
the breast cancer families studied but was not sufficiently informative to draw
meaningful conclusions because of a lack of DNA samples from suitable family
members. For the remaining families, the analysis was restricted only to the
affected index individual who initially displayed the c.1592delT allele. In addition,
segregation analysis was performed on the family of the mutation-positive patient
with prostate cancer. Other than the individual who died early at 52 years of age,
all male carriers developed prostate cancer by the age of 76 years and this
73
indicates high penetrance for the c.1592delT mutation in the studied two
generations of this family.
LOH analysis was performed on six tumour sections of individuals
heterozygous for the PALB2 c.1592delT mutation, but no evidence of loss of
heterozygosity was observed. This result implies that these tumours were likely to
have been driven by haploinsufficiency, perhaps in combination with a dominant-
negative effect of the truncated protein product. Also, immunohistochemistry was
performed on sections from the same six tumours noted above and from one
further sample. As a result, all except one revealed strong expression of the
oestrogen receptor and five of seven showed expression of the progesterone
receptor indicating that PALB2 tumours share the above phenotypic properties
with those generated by BRCA2 mutations (Borg 2001, Hedenfalk et al. 2003).
5.2 PALB2 c.1592delT mutation carriers display replication and G2/M cell cycle checkpoint defects (II)
Lymphoblastoid cell lines from heterozygous carriers of the PALB2 c.1592delT
mutation and from their siblings and ancestry-match controls were established to
determine the functional impact of this Finnish founder mutation on DNA damage
checkpoint functions, DNA replication and genomic maintenance under normal
growth conditions and upon DNA damage. The cell lines studied are presented in
supplementary table 1 of study II. The average PALB2 protein levels were
determined by Western blot analysis of whole cell extracts derived from these
cells and found to be decreased to 54% in mutation carriers when compared to
controls (P = 0.00005, with a mean of 53.6%, SD = 10.0 for the carriers and
100%, SD = 17.9 for the controls, presented in figure 9 and partially in figure 1A
of study II).
74
Fig. 9. PALB2 expression levels under normal growth conditions for heterozygous
PALB2 c.1592delT mutation carriers and healthy controls (study II, figure 1a).
During initial cell cycle distribution and checkpoint analysis of a subset of six
carrier cell lines, carriers generally incorporated larger amounts of the nucleotide
analogue ethinyl-deoxyuridine (EdU) during pulse labelling and had a smaller
fraction of S phase cells under normal growth conditions (supplementary figure
S1 of study II). Hence, our carriers seem to replicate their DNA faster than our
controls. For this reason, the specific effects of the heterozygous PALB2
c.1592delT mutation on replication origin firing and elongation were studied.
Under normal growth conditions, the carriers were found to have a moderate
decrease in mean replication origin rates when compared to controls (figure 1B of
study II, mean 1.04 kb/min for carriers and 1.11 kb/min for controls). However,
regularly incidences of closely spaced origins were seen in mutation carriers that
were largely absent in controls (figure 1C of study II). In fact, the mean inter-
origin distance is strongly reduced in carriers (42 kb compared to 62 kb in
controls, P = 0.0056, SD = 10.8 for the carriers and SD = 10.8 for the controls),
and also the mean frequency of origin firing (the fraction of origin events among
all fork structure in the fiber spreads) is nearly doubled (21.9 %, SD = 4.4 %
compared to 11.8 %, SD = 4.1 % in controls, P = 0.0009, Figure 1D of study II).
Since the ATR/Chk1 pathway has such a prominent role in the regulation of origin
firing, the expression of key factors involved in DDR and the FA pathways were
studied. ATM, Chk1, Chk1 phosphorylated at Ser345, the FANCD2 and RAD51
protein levels were expressed at the same level in both of our cohorts, whereas,
mean ATR levels were increased almost 3-fold in our carriers when compared to
controls (274%, SD = 114, compared to 100%, SD = 30, P = 0.0036, figures 2A-
B of study II).
75
The S phase DDR was studied further by triggering DNA replication stress
with hydroxyurea (HU)-induced deoxynucleotide depletion treatment. In the
presence of 2 mM HU, cells from both cohorts showed a clear intra-S phase
checkpoint response (figure 2C and supplementary figure S2 of study II),
however, controls uniformly showed a rapid response already 30 minutes after
HU and some (albeit not all) carriers displayed a delay in the Chk1
phosphorylation. Hence, carriers reached on average only 52% (SD = 9.6) of the
maximum Chk1 phosphorylation at this time point compared to 66% (SD = 15.0)
in the controls, P = 0.0838, figure 2D of study II). When studying the recovery
from HU block for a carrier having a delay in Chk1 phosphorylation compared
with a control, the carrier showed a reduction in 1st order origins indicative of a
decrease or delay in fork restart and/or dormant origin firing, as well as a decrease
in origin firing after release from HU (supplementary figures S3A-C of study II).
In order to assess the DNA damage checkpoint response, cells were treated
with 0.5 µM of the topoisomerase II inhibitor (Etoposide, ET) to generate DSBs
and cell cycle distribution was determined to analyse DNA content, DNA
incorporation and phosphorylation of histone H3(Ser10) (supplementary figure S4
and supplementary table 2 of study II). G2/M cell cycle checkpoint activation was
already apparent six hours after ET treatment, and both G1/S and G2/M
checkpoints were enforced 24 hours after ET treatment, this was seen from the
decrease of the S/G1 and M/G2 ratios. After 24 hours of ET-treatment,
approximately 50% (4/8) of the carriers showed a G2/M leakage since they
displayed larger M/G2-phase ratios when compared to controls (supplementary
figure S4B and supplementary table 2 of study II). When studying the checkpoint
function further by analysing the Chk2 phosphorylation on Thr68 after ET
treatment, at least 63% (5/8) of the carriers were seen to have aberrant Chk2
phosphorylation when compared to controls (supplementary figure 5A of study II).
Already 30 min after the ET treatment carriers displayed a rapid and excessive
Chk2 phosphorylation (median 1701.3 for carriers and 114.5 for controls, see
ranges from figure 3B of study II of the average control levels, P = 0.0281). On
the other hand, the phosphorylation had been lost already five hours after the
treatment, when controls were maximally phosphorylated (median 55.0 for
carriers and 108.3 for controls, see ranges from figure 3D of study II, P = 0.0222,
figures 3A-D of study II). These results were further supported by fiber assay
analysis of origin firing, since carriers showed a strong reduction within 30 min of
ET treatment and an increase in origin firing immediately after removal of ET
(supplementary figure S5 of study II).
76
To investigate whether a heterozygous PALB2 c.1592delT mutation also
caused genomic instability in its carriers in primary, untransformed cells,
cytogenetic analysis of peripheral blood T-lymphocytes from six carriers and nine
mutation negative age-matched healthy controls was performed. The carriers
showed a significant increase in the total number of spontaneous chromosomal
rearrangements (P = 0.018); both simple and complex chromosomal
rearrangements were seen more frequently in carriers than in controls (P = 0.0036
for both simple and complex). Telomeric associations were also seen, but only
among mutation carriers. The results from cytogenetic analyses are presented in
table 8 and figure 10, and data are also presented in table 1 of study II. All
observed chromosomal aberrations were considered random, since no preference
for a site-specific break or evidence for clonality was observed.
Table 8. Heterozygous PALB2 c.1592delT mutation carriers have a significant increase
in chromosomal aberrations when compared to healthy controls.
Aberration type Mean number of chromosomal aberrations
observed per 100 metaphases
P-value
Carriers Controls
Telomeric associations 0.65 (SE = 0.41) - 0.328
Chromatid/chromosome breaks,
deletions
1.65 (SE = 1.07) 1.67 (SE = 0.49) 0.689
Simple chromosomal rearrangementsa 5.92 (SE = 2.19) 0.67 (SE = 0.33) 0.036
Complex chromosomal rearrangementsb 2.92 (SE = 1.76) - 0.036
Total rearrangementsc 8.83 (SE = 3.75) 0.67 (SE = 0.33) 0.018 a Inversions, ring chromosomes, translocations (≤3 break rearrangements) b Translocations, ≥4 break rearrangements and marker chromosomes c Simple + complex rearrangements
P-values were calculated by Mann Whitney U-test due to small sample size
SE, standard error
(study II, table 1)
77
Fig. 10. Examples of observed chromosomal aberrations. Figures A and B each
represent one heterozygous PALB2 c.1592 delT mutation carrier and show the type of
aberrations listed in table 8 (study II, figure 4).
5.3 Inactivation of Palb2 gene leads to early embryonic lethality (III)
A Palb2 knockout mouse model was established to produce mice deficient in
Palb2 expression. The absence of Palb2 expression in the Palb2(-/-) (HO) mice
was confirmed by quantitative RT-PCR, as shown in figure 11. X-gal staining
indicated that Palb2 is broadly expressed in the mouse embryo, and high levels of
expression were seen as early as at E7.5 in the primitive streak. At E8.5 Palb2
expression was detected in the open neural folds both at the anterior and posterior
regions of the body, and the expression was ubiquitous (Figure 1 of study III).
Mice heterozygous (HE) for the Palb2 gene trap insertion were viable,
phenotypically like WT mice and lacked any macroscopic tumours by the age of
two years. No viable HO mice were identified indicating that in mice HO
inactivation of Palb2 results in embryonic lethality. At E7.5, HO embryos were
seen at the expected Mendelian frequency. However, resorptions and empty
conceptues were observed from this stage onwards. No live HO embryos were
seen beyond E9.5. The HO embryos expected by Hardy-Weinberg genotype
distribution, analysed at birth, deviated significantly from the normal distribution
(P = 0.006 for E9.5 and 11.5 embryos and P = 9.41 e-14 postnatal mice, table 9).
78
Table 9. Genotype distribution of the WT, HE and HO mice for the Palb2 gene trap.
Embryonic day No. of mice Genotype Absorbed Deviation from HWE
+/+ (WT) +/- (HE) -/- (HO)
E7.5 20 5 (26%) 11 (54%) 4 (20%) - 1.00
E8.5 35 10 (29%) 18 (51%) 4 (12%) 3 (8%) 0.35
E9.5 157 49 (31%) 72 (46%) 8 (5%) 28 (18%) 0.006
E11.5 39 10 (26%) 21 (54%) - 8 (20%) 0.006
Postnatal, 1 day 200 62 (31%) 138 (69%) - - 9.41 × 10−14
The embryos were collected on given embryonic days of pregnancy from Palb2 HE intercrosses and were
genotyped from the yolk sac of E7.5-E11.5 or earmarks of postnatal mice. Resorptions were not subjected
to genotyping analysis and hence not accounted for in the HWE analysis. HWE Hardy-Weinberg
equilibrium given as P-value (study III, table 1).
The morphology of the HO embryos differs from the HE and WT embryos
already at E6.5 and the histological analysis revealed that the HO embryos were
markedly smaller in size than their WT littermates. By E7.5 the difference in size
between WT and HO embryos was even more obvious (Figure 3 of study III). The
whole mount analysis revealed that only a poorly defined boundary between the
embryonic and extra embryonic regions was observed in HO embryos, in contrast
to the proper ectoplacental cone, primitive streak and head fold seen in the WT
embryos (Figure 4 of study III). From the histological analysis, it could be clearly
seen that the embryonic ectoderm of the HO embryos appeared with an increased
mass of cells, the embryonic cavities were not properly formed and the amnion
was missing. This was in contrast to WT embryos, which had a well-defined
anterior-posterior axis with a proper formation of the epiblast and the typical
structures for the mesodermal layer, ectoplacental cone, chorion, amnion and the
embryos had initiated gastrulation (Figure 3 of study III). At E8.5 the difference
in size between HO and WT embryos was further increased.HO embryos had
developed a head fold and a neural groove, and mesoderm formation and
patterning was initiated, as indicated by Lim1 expression, primitive streak-derived
tissue and extra embryonic tissue for head formation. But the mesoderm failed to
differentiate properly as the somite structures never formed. The expression of
sonic hedgehog revealed a notochord with diffuse and discontinuous morphology
and according to Brachyury expression, the HO embryos lacked proper tail-bud
structures and the notochord did not progress caudally. The HO embryos’
development seems to stop at E9.5 as no progression was seen after E8.5 and they
did not show proper organogenesis (Figures 4–5 of study III).
79
The pre-implantation stage of development was also analysed and it seems
that lack of functional Palb2 does not affect this since the appearance of HO
blastocysts was normal. Nevertheless, 85% of these HO blastocysts presented
with impaired outgrowth of the inner cell mass in vitro, while only 25% of the
inner cell mass of the WT and HE blastocysts failed to grow (Figure 6 of study
III). These results are consistent with the growth retardation seen in the HO
embryos in vivo.
The expression of Brca1, Brca2, Rad51, p53, p27 and p21 was determined by
quantitative RT-PCR and no difference was seen in Brca1, Brca2, Rad51, p53, or
p27 expression levels between the HO and WT embryos. Interestingly, HO
embryos had a 6-fold increase in p21 expression (P = 0.002) when compared to
WT embryos, presented in figure 11, and this p21 overexpression associates with
the growth deficiency since overexpression of p21 has been shown to inhibit
proliferation of mammalian cells (Xiong et al. 1993).
Fig. 11. Expression of p21, p53, p27 and Palb2 in HO and WT embryos at E8.5. The
expression levels were analysed by quantitative RT-PCR and the data were normalised
to the expression of the mouse Ppia gene. n = 2–3 pools, each consisting of 4–6
embryos. NS not significant, ND not determined (study III, figure 2).
80
5.4 RAP80 c.241-243delGAA mutation impairs BRCA1- mediated DNA damage response (IV)
Screening of 112 BRCA1/BRCA2 mutation-negative breast cancer families from
Northern Finland for RAP80 mutations revealed 10 germline variations (Table 1
of study IV). Of the detected alterations two were in intron regions and eight were
in exon regions, of which one exonic variation was novel and seven had been
reported earlier (Akbari et al. 2009, Osorio et al. 2009, Novak et al. 2009). All
detected alterations were checked for potential splicing defects by NNsplice
software, but nothing abnormal was detected. ESEfinder 2.0 software was also
used to identify exonic alterations that fall within predicted exonic splicing
enhancer sequences and could therefore affect exonic splicing enhancer functions,
and the results from this in silico analysis are summarized in table 1 of study IV.
All except the novel variant were detected in similar frequencies both in
affected index cases and controls, which suggests that these mutations are not
cancer related. The novel alteration, c.241-243delGAA, was identified from one
patient (0.9%) who had been diagnosed with breast cancer at the age of 60 and
from one control individual (0.3%) (P = 0.45; OR 2.92; 95% CI 0.18–47.1).
Interestingly, the patient´s maternal aunt had also been diagnosed with breast
cancer at an unknown age, information regarding other family members and their
health status, however, was incomplete.
c.241-243delGAA leads to an in-frame deletion of one of the three
consecutive glutamic acid residues (delE81), a stretch of glutamic acid residues
that is evolutionarily conserved between all the vertebrate species tested (Figure
1b in study IV) and locates to a functionally important UIM1 domain of RAP80.
Since the RAP80 UIM1 domain is required for RAP80-BRCA1 complex
migration to ubiquitin (Ub) polymers at DSBs (Kim et al. 2007a, Sobhian et al.
2007, Yan et al. 2007b), the delE81 variation was functionally analysed to
determine whether its ubiquitin recognition at DSBs is deficient. RAP80 delE81
showed a greatly reduced, albeit detectable, K63-Ub binding and weaker, but still
present, DSB localization. These results suggest that the delE81 variant has
impaired, but not completely absent, DSB recognition function. However, RAP80
delE81 showed normal association with BRCA1 and other members of this
complex, ABRA1 and BRCC36, but the intensity of the BRCA1 and ABRA1 at
IRIFs were significantly reduced in RAP80 delE81-expressing cells. Hence, it
seems that RAP80 delE81 could function as a dominant-negative allele by
associating with known binding partners, yet largely failing to recognize DNA
81
DSBs and to localize RAP80-ABRA1-BRCA1 complex to the damage sites. In
addition, cells expressing the delE81 mutation exhibited a significant increase in
chromosomal aberrations, presented in figure 12, of which a majority were sister
chromatid breaks. These cytogenetic abnormalities are characteristic of cells with
DSB repair deficiencies (Patel et al. 1998, Xu et al. 1999, Celeste et al. 2002, Lou
et al. 2006).
Fig. 12. Cells expressing RAP80 delE81 show an increase in chromosomal aberrations.
A) Metaphase spreads were prepared from asynchronously growing cells and
cytogenetic abnormalities per metaphase scored for each cohort in a blinded manner.
B) Quantification of detected cytogenetic abnormalities. Error bars represent s.e.m.
(study IV, figure 4).
The mutational status of RAP80 delE81 was also assessed from 503 unselected
breast cancer cases, which revealed one carrier (0.2%) who was diagnosed with
bilateral breast cancer at a relatively young age (39 and 41 years). The family
history of cancer for this patient is unknown. LOH analysis was performed on
available tumour specimens to test whether loss of the WT allele occurred in the
two mutation-positive patients. No evidence of loss of the normal RAP80 allele
was seen in either case.
82
83
6 Discussion
6.1 PALB2 is a well-established breast cancer susceptibility gene (I)
PALB2 has emerged as a third major breast cancer susceptibility factor as
mutations in this gene have been detected worldwide in most familial breast
cancer cohorts tested. The percentage of PALB2 mutations is low; so far
deleterious mutations have been detected in various populations ranging from
1–2% of women with hereditary breast and ovarian cancer, which have been
found negative for BRCA1/2 mutations. However, one study from the USA found
that PALB2 mutations were detected as high as 3–4% (Bogdanova et al. 2011,
Cao et al. 2009, Casadei et al. 2011, Dansonka-Mieszkowska et al. 2010, Erkko
et al. 2007, Foulkes et al. 2007, Garcia et al. 2009, Hellebrand et al. 2011, Papi et
al. 2010, Rahman et al. 2007, Sluiter et al. 2009, Tischkowitz et al. 2007,
Tischkowitz & Xia 2010). Generally, it is considered that mutations in PALB2
increase the breast cancer risk 2- to 6-fold, however, a 19-fold increased breast
cancer risk has been reported for one alteration (W1038X) seen both in the UK
and Australia (Casadei et al. 2011, Erkko et al. 2008, Hellebrand et al. 2011,
Hollestelle et al. 2010, Rahman et al. 2007, Southey et al. 2010, Tischkowitz et al.
2012).
Most pathogenic PALB2 mutations identified to date are truncating frameshift
or nonsense mutations and are found from different parts of the gene with no hot-
spot areas. Even mutations affecting the C-terminus can be deleterious, for
example Y1183X in exon 13 abolishes the propeller structure of the C-terminus of
PALB2 and destabilizes the whole protein (Oliver et al. 2009, Reid et al. 2007).
The pathogenic PALB2 mutations, reported to date, are presented in table 10.
84
Table 10. Reported pathogenic truncating mutations in PALB2.
Mutation Country/Ethnicity Cancer type Study
L531fs Finland Breast, prostate (Erkko et al. 2007)
G796X, A995fs,
W1038X, N1039fs,
Y1183X
UK,
W1038X also in Australia
Breast,
Y1183 also in FA
(Rahman et al. 2007, Reid et
al. 2007, Southey et al.
2010)
C77fs Canada (Ashkenazi Jews,
French Canadian, other)
Breast (Tischkowitz et al. 2007)
Q775X Canada (French Canadian) Breast
(young onset)
(Foulkes et al. 2007)
Q251X, Q350fs China Breast
(young onset)
(Cao et al. 2009)
K353fsX7 Spain Breast (Garcia et al. 2009)
V233fs South Africa (whites) Breast
(young onset)
(Sluiter et al. 2009)
R170fs The Netherlands Breast
(male BC as index)
(Adank et al. 2011b)
L451X Italy Breast (Balia et al. 2010)
Y1183X USA Male BC (Ding et al. 2011)
R753X Italy Breast (Papi et al. 2010)
R170fs, E545X Germany Bilateral BC (Bogdanova et al. 2011)
R414X, Q921X Russia Bilateral BC (Bogdanova et al. 2011)
Q60RfsX7 Germany Breast, ovarian,
colon
(Hellebrand et al. 2011)
S168X,
R414X,D715EfsX2,
R753X,Q988X
Germany Breast (Hellebrand et al. 2011)
Q66X, W1038X Australia Breast (Wong et al. 2011)
S58fs, N1039fs,
R1086X
USA Pancreatic (Jones et al. 2009)
Deletion of exons 12
and 13
Canada Pancreatic (Tischkowitz et al. 2009)
R414, R170fs,
N1039fs
Europe Pancreatic (Slater et al. 2010)
R170fs Poland Ovarian (Dansonka-Mieszkowska et
al. 2010)
Y551X USA FA (Xia et al. 2007)
BC, breast cancer; FA, Fanconi anemia
In a similar manner, results of study I show that the PALB2 c.1592delT founder
mutation leads to a premature stop codon and results in a functionally defective
protein product. Based on this study, it is clear that the PALB2 c.1592delT
85
mutation contributes significantly to both familial and unselected patient breast
cancer risk in Finland. The cumulative risk for this mutation was estimated to be
40% (95% CI 17–77) by the age of 70 years, which is comparable to the disease
risk calculated for mutations in BRCA2 (Erkko et al. 2008). Interestingly, the
PALB2 c.1592delT mutation was observed in 1% of unselected breast cancers,
which is quite a high occurrence when considering that the 19 most common
founder mutations in BRCA1/2 combined to account for 1.8% of unselected cases
in Finland (Syrjakoski et al. 2000). Cosegregation of PALB2 c.1592delT and
BRCA1/2 mutations was not detected in any of the 16 individuals tested for
PALB2 c.1592delT and BRCA1/2 mutations. However, most tested individuals
were only screened for the common Finnish BRCA1/2 founder mutations so we
cannot rule out the possibility of cosegregation with less common defects. In
addition, the age of cancer onset for PALB2 c.1592delT carriers seems to be
slightly lower than for breast cancer patients without this mutation and slightly
higher than for BRCA1/2 mutation carriers in Finland. However, these findings
were not statistically significant.
So far, all reported pathogenic PALB2 mutations cause truncations of the
protein. Missense variants could also predispose to cancer if the mutation
localizes to a functionally important domain of PALB2. For example, an alanine
change at position 1025 of PALB2 abolished PALB2 binding to BRCA2 and
therefore this kind of mutation could cause cancer (Oliver et al. 2009). In study I,
one rare missense variant, G1145R, in one of the WD40 domains of PALB2 was
observed. The WD40 domains of PALB2 bind directly to BRCA2 and RAD51.
This mutation was identified in a single breast cancer family but in none of the
971 controls. The family exhibits a markedly increased cancer predisposition,
especially for breast cancer. Unfortunately, the lack of suitable DNA samples
prevented completion of a proper segregation analysis in study I. In functional
studies, however, G1145R behaved like the WT PALB2 as neither BRCA2
binding nor HR capacity was affected. In addition, the bioinformatics and
functional analyses conducted in study I suggested that the G1145R variant does
not associate with cancer predisposition.
Large rearrangements in PALB2 have been observed only in one FA-N
individual with several family members who had cancer (Xia et al. 2007) and in
one breast cancer family (Blanco et al. 2012). Blanco et al. identified a large
deletion spanning from exon 7 to 11 of PALB2 in one breast cancer family and
this deletion segregated with breast cancer in this family, suggesting that large
genomic rearrangements in PALB2 may contribute to familial breast cancer.
86
However, two other studies did not detect rearrangements in PALB2 (Ameziane et
al. 2009, Pylkäs et al. 2008). Hence, further research on the role of genomic
rearrangements in PALB2 and the risk that they may cause in terms of cancer
development are still needed.
PALB2 c.1592delT tumour characteristics
Several studies have shown that PALB2 mutated tumours resemble those mutated
in BRCA1 or BRCA2, since tumours in patients carrying PALB2 mutations are
mainly found to be ER+, PR+ or triple negative for ER, PR and HER2. However,
PALB2 tumors are also found to be ER+ and PR+, ER+, PR+ and HER2-, HER+
or triple negative (Blanco et al. 2012, Bogdanova et al. 2011, Borg 2001, Cao et
al. 2009, Foulkes et al. 2007, Garcia et al. 2009, Hedenfalk et al. 2003, Patel
2007, Pylkäs et al. 2008, Reid et al. 2007, Sorlie et al. 2003, Tischkowitz et al.
2007, Wong et al. 2011, Xia et al. 2007). In study I, all except one of the seven
tumours analysed (86%) were observed to have strong ER expression, and five of
seven (71%) showed expression of the PR, indicating that these tumours closely
resemble BRCA2 mutation derived tumours (Borg 2001, Hedenfalk et al. 2003).
However, since only a limited number of tumours were analysed in study I, more
extensive studies are needed to determine whether these expression patterns can
be used to distinguish PALB2 mutated tumours from sporadic ones. The vast
majority of PALB2 tumours seem to be infiltrating ductal carcinomas, whereas
some have been described to be infiltrating lobular carcinomas and tumours with
medullary features, in addition to premalignant ductal carcinoma and lobular
carcinoma in situ (Cao et al. 2009, Foulkes et al. 2007, Garcia & Benitez 2008,
Tischkowitz et al. 2007). In a similar manner, most tumours analysed in study I
were also infiltrating ductal carcinomas and appeared to be of relatively high
grade (mostly grade III). Indeed, more research is needed before more accurate
predictions of the tumour subtypes associated with PALB2 mutations can be made.
In study I, LOH was not observed in the breast tumours analysed. To date,
only two studies (Casadei et al. 2011, Garcia et al. 2009) have shown PALB2
tumours to exhibit loss of the WT allele and therefore the current opinion is that
haploinsufficiency and/or a dominant-negative effect of the truncated protein
product causes tumourigenesis in PALB2 mutation carriers. Another dysfunction
of PALB2 detected in sporadic breast and ovarian cancers was its expressional
silencing by promoter hypermethylation (Potapova et al. 2008). The regular allele
of PALB2 may be eliminated by promoter hypermethylation and also it is possible
87
that truncated PALB2 mutants complex with the WT protein and disturb its proper
function. Potapova et al. (2008) found PALB2 hypermethylation in 8% (10/130)
of the studied breast and ovarian tumours and none of the normal tissues.
Interestingly, the frequency of BRCA1 hypermethylation in familial and sporadic
breast and ovarian cancers is similar to that of PALB2 (Esteller et al. 2000,
Esteller et al. 2001). Given the small sample size studied by Potapova et al. (2008)
further studies with larger cohorts of inherited breast and ovarian tumours are
needed. Other molecular changes may also cooperate with PALB2 deficiency in
cancer development and this is an extremely important aspect that warrants
further investigation.
Furthermore, it would be of great importance to find the second hit that is
needed to overcome the cellular threshold for tumour development in PALB2
mutation carriers in order to develop personalized therapeutic approaches.
Especially, since it seems that new effective targeted therapeutic options, like
synthetic lethality with novel PARP inhibitors, may not be suitable for those
PALB2 mutation carriers whose tumours are negative for LOH. PARP inhibitors
seem to kill tumour cells (not normal cells) only when both BRCA2 alleles are
missing or dysfunctional (Bryant et al. 2005, Farmer et al. 2005). This may
explain why the cells of heterozygous PALB2 c.1592delT mutation carriers, which
express on average 54% of the normal amount of PALB2 were not sensitive to
PARP inhibitors (unpublished data). Another explanation could be that LCLs are
not cancer cells. However, the effect of PARP inhibitors on cells lacking PALB2
expression completely is still not known and should therefore be addressed. If
synthetic lethality occurs in PALB2-/- cells, this could be a potential therapeutic
option for cancer patients whose tumours are showing LOH for PALB2. This
underlines the importance of analysing more PALB2 tumours so that all applicable
patients for this treatment option can be detected.
Suggestions for genetic counselling for CHEK2 c.1100delC in a clinical
setting, with targeted surveillance and medical follow up for mutation carriers,
have already been made (Narod 2010). Since, the prevalence of inherited PALB2
mutations in non-BRCA1/2 familial breast cancer patients is approximately the
same as the occurrence of inherited mutations in CHEK2 in a similar cohort
(Walsh et al. 2006), it would be worthwhile to assess the possibility of genetic
counselling for PALB2 as well, since the breast cancer risk associated with protein
truncating mutations in PALB2 appears to be greater than the risk associated with
CHEK2 c.1100delC. Especially, the PALB2 c.1592delT mutation should be
considered for inclusion in genetic counselling in a clinical setting with targeted
88
surveillance as this mutation occurs in 1% of Finnish breast cancers and overall
increases the cancer risk 4–6 times for the carrier (Erkko et al. 2008). Therefore,
the mutational status for PALB2 c.1592delT should be assessed when a breast
cancer inheritanse pattern is suspected in the family, and especially all family
members of the PALB2 c.1592delT mutation carrier should be tested for this
mutation as it substantially increases the cancer risk. PALB2 c.1592delT mutation
carrier screening would enable early detection of breast cancer and allow
mutation carriers to participate in breast cancer follow-up. The early detection of
breast cancer development in turn would offer a better prognosis for the patient
since treatments could be started as soon as possible.
PALB2 c.1592delT mutation occurrence in other cancer types
In study I, the PALB2 c.1592delT mutation was also screened in 141 Finnish male
breast cancers, 639 prostate and 476 colon cancers. No carriers were identified
among male breast cancer or colon cancer patients. Hence, it seems that the
PALB2 c.1592delT mutation does not contribute significantly to male breast
cancer or colon cancer in Finland. This notion is further supported by the fact that
no male breast cancers were identified in any of the PALB2 c.1592delT carrier
families in study I. Interestingly, according to Rahman et al., the prevalence of a
truncating pathogenic mutation in PALB2 is higher in families with both male and
female breast cancers (6.7%) than in families with only female breast cancer (1%)
(Rahman et al. 2007). Supporting this observation, also Garcia et al. and Ding et
al. identified truncating PALB2 mutations in families with both female and male
breast cancer (Ding et al. 2011, Garcia et al. 2009). Together these studies suggest
that PALB2 might be important in male breast cancer. The association between
male breast cancer and PALB2 needs further study, since all the reported
observations were derived from analysis of just one family in each study and the
difference was not statistically significant. However, colorectal cancer patients
were observed in some of the PALB2 c.1592delT carrier families but the lack of
DNA samples from these family members prevented further analysis. Obviously,
other PALB2 mutations in Finnish male breast cancer and colon cancer cannot be
ruled out and they may affect the predisposition for these cancer types.
The PALB2 c.1592delT was also identified from one Finnish prostate cancer
family, where it had a high disease penetrance since all male carriers, except one
who died early at 52 years of age, from the two generations that were studied
developed prostate cancer by the age of 76 years. Supporting the present
89
observation, Pakkanen et al. found two additional sporadic prostate cancer
patients carrying the PALB2 c.1592delT mutation suggesting that this mutation
may have a minor contribution to prostate cancer risk in Finland (Pakkanen et al.
2009). Subsequently, Tischkowitz et al. studied 95 familial prostate cancers for
PALB2 mutations and found only two novel alterations that were considered to be
non-pathogenic (Tischkowitz et al. 2008). Together with study I, these results
suggest that PALB2 mutations are unlikely to be common in familial prostate
cancer.
Three distinct studies have found a connection with familial pancreatic cancer
and PALB2 mutations (Hofstatter et al. 2011, Jones et al. 2009, Slater et al. 2010).
Hofstatter et al. and Slater et al. detected PALB2 mutations in 3–4% of familial
pancreatic cancers but not necessarily enriched in breast-pancreas families as one
would have expected (Hofstatter et al. 2011, Slater et al. 2010). One pancreatic
cancer patient was observed in a PALB2 c.1592delT carrier family of study I.
However, the lack of a DNA specimen from this pancreatic cancer patient
prevented determination of the PALB2 mutational status. Hence, it might be
worthwhile to consider whether PALB2 mutations should be included in genetic
counselling in a clinical setting, with targeted surveillance and medical follow up
at least in the populations where a connection with familial pancreatic cancer and
PALB2 mutations has been identified.
Interestingly, families carrying the PALB2 c.1592delT mutation also
displayed increased prevalence for stomach and ovarian cancers as shown in
pedigrees in study I. Dansoka-Mieszkowska et al. also found one truncating
PALB2 (R170fs) mutation in two Polish ovarian cancer patients. Together with the
observations in study I, these results suggest that PALB2 may be defective or
insufficient in some rare ovarian cancers. However, a possible contribution to
ovarian cancer development needs further elucidation (Dansonka-Mieszkowska et
al. 2010). Thus, it will be beneficial to assess the role of PALB2 mutations in
other cancer types especially since PALB2 is also identified to be a FA gene
(discussed in more detail in chapter 2.8.1).
6.2 On the mechanism of how PALB2 mutations cause predisposition to breast cancer
The mechanisms behind cancer predisposing mutations are not well characterized
at a cellular level. The fact that deficiencies in DDR genes lead to genomic
instability and ultimately to tumour development is a well-reported characteristic
90
for hereditary cancers (rev. in Negrini et al. 2010). But what are the molecular
mechanisms behind these mutations in DDR genes that actually cause a normal
cell to accumulate all the mutations necessary for its transition to a cancer cell?
Given the fact that in inherited cancers, germline mutations are present in every
cell of the patient´s body, it is extremely important to characterize the deficiencies
these mutations cause at the cellular level. Especially since they could represent
new targets for therapeutic approaches in cancer treatments.
In study II, lymphoblastoid cell lines from breast cancer patients carrying the
heterozygous PALB2 c.1592delT mutation and expressing only 54% of the normal
PALB2 expression were found to be defective in normal replication and DDR
checkpoint functions when compared to healthy controls, which suggests a
mechanism for early cancer development for these mutation carriers. Already
under normal growth conditions the carriers exhibited a minor, although not
statistically significant, decrease in replication elongation rate. However, they
show a significant decrease in inter-origin distance as well as a significant
increase in replication origin firing that indicate these mutation carriers exhibit
excessive origin firing. This phenotype resembles observations in CHO (Chinese
hamster ovary) cells deficient for BRCA2, XRCC2 or RAD51 functions, where
the loss of HR severely reduced the replication fork rate compensated by an
increased origin firing (Daboussi et al. 2008). Interestingly, after inducing more
replication stress (2 mM HU) in the cells, the PALB2 c.1592delT carrier cells
displayed a slight delay in their intra-S phase checkpoint activation as the Chk1
phosphorylation on Ser345 was somewhat delayed after the HU treatment when
compared to controls. Moreover, when the recovery from the HU block was
examined in one slowly responding carrier and one control cell line, the carrier
displayed a reduction in 1st order origins indicating a decrease or delay in fork
restart and/or dormant origin firing as well as a decrease in origin firing after
release from HU. This further suggests that the unperturbed PALB2 c.1592delT
carrier cells are truly having high levels of replication stress, which lead to
excessive amounts of origin firing. Therefore, it seems that these carriers exhaust
part of their capacity to recover from replication stress during normal growth and
cannot cope with the extra replication stress at the same levels as the healthy
controls. Since PALB2 has such a prominent role in regulating RAD51 activity, it
is possible that the PALB2 c.1592delT carriers have a reduced ability to utilize a
RAD51-dependent restart of stalled replication forks and therefore have to rely
more on the activation of dormant origins (Petermann et al. 2010). A recent study
by Schlacher et al. showed that BRCA2 has a role in protecting newly replicated
91
strands at stalled forks from degradation and that this function is distinct from its
HR function, yet was critical in maintaining genomic stability when replication
stress was induced by HU. They proposed that BRCA2-deficient cells are
particularly vulnerable to oncogene activation for the generation of chromosome
aberrations leading to tumourigenesis, as replication stress occurs with oncogene
activation (Schlacher et al. 2011). Hence, it could be possible that newly
synthesized DNA is degraded at some of the replication forks in PALB2
c.1592delT carrier cells and this is compensated by firing new origins.
Considering that DNA replication forks were moving slightly slower in these
carrier cells, there appears to be at least some degree of stalling at replication
forks during normal growth. Therefore, the observed replication defect could
partly explain why these mutation carriers are at higher risk for developing cancer.
The ATR pathway regulates replication timing, normal S phase progression
and restricts the overall levels of origin firing during normal S phase, hence
inhibition of this pathway increases origin firing (Maya-Mendoza et al. 2007,
Petermann & Caldecott 2006, Petermann et al. 2010, Shechter et al. 2004,
Syljuasen et al. 2005). Oncogenic stress has been shown to cause increased
reliance on ATR function. It possibly generates circumstances that increase the
frequency of replication uncoupling, which in turn leads to an increased need for
ATR, as ATR is known to stabilize uncoupled replication forks. The direct cause
of such replication fork uncoupling events under oncogenic stress also includes
premature origin firing, as well as altered origin density and placement (Gilad et
al. 2010, Paulsen & Cimprich 2007, Schoppy et al. 2012). In study II, the
unperturbed PALB2 c.1592delT carrier cells were shown to exhibit an at least 3-
fold increase in ATR expression, when compared to controls. Given that carriers
are experiencing excessive amounts of origin firing during normal growth it is
possible that the cells limit this by overexpressing ATR. Thus, ATR
overexpression might be a compensating mechanism for carrier cells, especially
when taking into account that ATR is crucial when a cell is going through
oncogene-induced replication stress.
In study II, PALB2 c.1592delT mutation carriers were also shown to have a
maintenance defect in their G2/M checkpoint upon DNA damage, since a
considerable proportion of the carrier cells entered into mitosis prematurely when
compared to healthy controls. Further supporting this finding, the carriers were
found to have an aberrant Chk2 phosphorylation on Thr68, which is the
prominent phosphorylation site of Chk2 phosphorylated by ATM in response to
DSBs (Reinhardt & Yaffe 2009). Following DNA damage after 0.5 µM ET
92
treatment, the carriers showed a significant over-response in Chk2
phosphorylation already after 30 min. Therefore, their G2/M checkpoint must be
functional. However, after five hours in the presence of low doses of ET, carriers
had already a significantly lower level of Chk2 phosphorylation when compared
to healthy controls, demonstrating that carriers are not able to sustain the G2/M
checkpoint. This appears to be the actual reason why carrier cells are able to enter
into mitosis prematurely. A similar phenomenon was also seen when studying
origin firing in the presence of ET; PALB2 c.1592delT carriers showed a strong
reduction within the first 30 min of ET treatment and in contrast, a clear increase
in origin firing after the removal of ET consistent with the described checkpoint
maintenance defect in PALB2 c.1592delT carriers. In line with this finding,
Menzel et al. demonstrated that the BRCA pathway is involved in maintaining the
G2/M checkpoint function upon DNA damage, PALB2 and BRCA2 being the
main regulators of G2/M checkpoint maintenance following DNA damage. They
showed that both BRCA2 and PALB2 depleted cells recover from G2 arrest too
early and enter into mitosis prematurely (Menzel et al. 2011).
Genomic instability is a general characteristic of cancer, especially in
hereditary cancers, and has been linked to mutations in DDR genes (Negrini et al.
2010). Currently favoured models for early stages of cancer progression suggest
that activated oncogenes induce genomic instability due to stalling and collapse of
DNA replication forks and subsequent formation of DNA damage (Halazonetis et
al. 2008). Indeed breast cancer patients carrying the heterozygous PALB2
c.1592delT mutation were shown to have a significant increase in chromosomal
instability as both simple and complex rearrangements were found more
frequently from these patients’ primary lymphocytes than in healthy controls, as
presented in study II. Hence, these data provide strong evidence that mechanisms
of genome destabilisation similar to those revealed in the heterozygous
lymphoblastoid cell lines are also operational in primary tissues of the carriers.
Based on the present study, it seems that the Finnish founder mutation, PALB2
c.1592delT, causes a haploinsufficiency phenotype in the cells characterized by
an excessive amount of origin firing under normal growth conditions and a G2/M
checkpoint maintenance problem upon DNA damage. These defects together then
cause elevated chromosomal instability in the mutation carriers. These
observations provide a mechanism for the early stages of breast cancer
development in PALB2 c.1592delT carriers, and this could also be a model for
other cancers, especially those that are linked to deficiencies in DDR like BRCA1
and BRCA2. Furthermore, Bartek et al. introduced a “conditional
93
haploinsufficiency” model to explain how inherited heterozygous defects in DDR,
like the PALB2 c.1592delT, may predispose to cancer. According to this concept,
the reduced dose of a DDR factor in an affected carrier may be sufficient in
normal tissue but not enough for the appropriate response for the increased DNA
damage load in a pre-malignant lesion (Bartek et al. 2007), further supporting the
mechanism presented here. In addition to this, other tumour suppressor genes
have also been found to exhibit haploinsufficiency where a mutation of a single
allele that causes a deficient protein product and leaves only one copy of the
functional gene is not sufficient for the proper function of the gene. Tumour
suppressor genes displaying haploinsufficiency have been identified in many
human cancers such as p53, PTEN, NF1, p27, SMAD4 and LKB1 (rev. in Berger
& Pandolfi 2011). Recently Konishi et al. showed that an inactivating mutation of
a single BRCA1 allele leads to haploinsufficiency in human breast epithelial cells,
which resulted in genomic instability and further supports the results presented in
study II (Konishi et al. 2011). BRCA2 may also exhibit haploinsufficiency and/or
dosage effects as primary breast and ovarian cells from patients with
heterozygous germline mutations of BRCA2 have altered mRNA profiles
compared to BRCA wild-type individuals. This suggests that single mutations in
this gene can confer phenotypic differences that could impact on breast/or ovarian
tumourigenesis. This has also been observed in heterozygous BRCA1 mutation
carriers (Bellacosa et al. 2010).
Under circumstances in which ATR is overexpressed in PALB2 c.1592delT
carrier cells as a compensating mechanism, it would be of great interest to study
whether ATR-inhibitors could cause synthetic lethality of the tumour cells of
PALB2 c.1592delT carriers as this might be a new approach to targeted therapy of
these cancers. In addition, if the mechanism behind the cancers of BRCA1 and
BRCA2 mutation carriers is the same as proposed here, then even a larger number
of patients would benefit from the same targeted therapeutic approaches, which
underlines the need to determine whether this mechanism actually could be a
model for other cancers as well.
6.3 Palb2 gene plays an important role in early mouse embryogenesis (III)
After the identification of BRCA1 and BRCA2 as breast cancer predisposing genes
researchers set out to develop mouse models for the associated disease, aiming to
solve in more detail the function of these genes in both development and
94
tumourigenesis. Several groups have generated a range of conventional Brca1/2
knockout mice with mutations in different portions of the genes. Unexpectedly,
none of these models showed a strong tumour predisposing phenotype in
heterozygous settings. However, in homozygous settings these models displayed
severe, embryonic lethal phenotypes (rev. in Evers & Jonkers 2006).
Conventional mouse models, where most of Brca1/Brca2 is deleted, are presented
in table 11.
Table 11. Conventional Brca1 and Brca2 knockout mouse models.
Model Mutant transcript Lethality Study
Brca1ex2 ex1 E7.5 (Ludwig et al. 1997)
Brca15-6 ex1-3* E7.5 (Hakem et al. 1996)
Brca111- ex1-10 + 12-24 (Brca1-∆11) E7.5-9.5 (Shen et al. 1998)
Brca1∆223-763 ex1-10 + 12-24 (Brca1-∆11) E10-13.5 (Gowen et al. 1996)
Brca1ko ex1-5´part of ex11* E7.5-8.5 (Liu et al. 1996)
Brca1Tr ex1-5´part of ex11* Partly viable (Ludwig et al. 2001)
Brca11700T ex1-5´part of ex20* E10.5 (Hohenstein et al. 2001)
Brca2- ex1´5part of ex10 E8.5-10.5 (Bennett et al. 2000, Suzuki et al. 1997)
Brca2Brdm1 ex1-10 E7.5 (Sharan et al. 1997)
Brca2ex11 ex1-5´part of ex11 E8.5 (Ludwig et al. 1997)
Brca2tm1Cam ex1-5´part of ex11 10% viable (Friedman et al. 1998)
Brca2tm1Mhun ex1-5´part of ex11 E8.5-9.5 (Yan et al. 2004)
Brca2Tr2014 ex1-5´part of ex11 ~20% viable (Connor et al. 1997)
Brca2Lex2 ex1-5´part of ex 26 E8.5 (Donoho et al. 2003, Morimatsu et al. 1998) *Transcript contains a premature stop codon resulting from a frame shift.
As seen from table 11, various Brca1/2 mouse models display large phenotypic
variation. However, all embryonic lethal models display similar developmental
defects, such as ICM growth defects in blastocyst cultures, mesoderm formation
and/or differentiation and growth and/or cell proliferation defects, which have
been considered to be the reason why these models are lethal at such an early
stage of development in homozygous settings. Some models are additionally
characterized by hypersensitivity to γ-irradiation, chromosomal abnormalities and
neural tube abnormalities (Bennett et al. 2000, Connor et al. 1997, Donoho et al.
2003, Friedman et al. 1998, Gowen et al. 1996, Hakem et al. 1996, Hohenstein et
al. 2001, Liu et al. 1996, Ludwig et al. 1997, Ludwig et al. 2001, Morimatsu et al.
1998, Sharan et al. 1997, Shen et al. 1998, Suzuki et al. 1997, Yan et al. 2004).
Similar to Brca1/2 knockout mouse models, homozygous inactivation of Palb2
results in an embryonic lethal phenotype where embryos die at or before E9.5 as
95
shown in study III. The Palb2 deficient embryos were found to be abnormal as
early as E6.5, and by E7.5 all embryos were developmentally retarded. Palb2
deficient embryos were much smaller in size already at E6.5 and the size
difference between WT and HO embryos increased over time. They initiate
gastrulation at E7.5, but the proper formation of embryonic cavities is disrupted
and the amnion is missing as is reported for Brca1/2 deficient embryos (Hakem et
al. 1996, Suzuki et al. 1997). Like embryos lacking Brca1/2, HO Palb2 embryos
showed a severe cell proliferation defect as they were not able to grow in vitro,
their blastocysts’ ICM failed to grow in blastocyst cultures and they had a
significant overexpression of p21, which has been shown to inhibit proliferation
in mammalian cells (Xiong et al. 1993). Furthermore, homozygous inactivation of
Palb2 leads to a mesoderm differentiation defect as their notchordal mesoderm
remained diffuse and displayed an interrupted pattern. Their paraxial mesoderm
also remained undifferentiated, which was indicated by the lack of somite
formation. What is more, no epithelialization of the paraxial mesoderm was seen
nor was heart formation observed, which speaks further for a failure in mesoderm
organogenesis in the Palb2 HO embryos. This has previously been described for
Brca1/2 deficient embryos (Hakem et al. 1996, Suzuki et al. 1997). Therefore, it
seems that the Palb2 deficiency results in embryonic lethality, like Brca1/2,
because of a cell proliferation defect after gastrulation and a defect in the
differentiation of mesoderm-derived structures, which is essential for further
embryonic development.
Like heterozygous Brca1/2 knockout mice, heterozygous Palb2 knockout
mice were viable, fertile, and did not develop tumours in any of the organs
analysed (mammary, kidney, heart, adrenals, lungs, liver, intestinal, spleen, brain,
ovary, testis, epididymis and prostate) as shown in study III, and these mice were
followed up until the age of two years (unpublished data). Recently, Bouwman et
al. reported a similar Palb2 knockout mouse model with the same kind of results
as presented in study III. Additionally, they tried to induce tumourigenesis in
heterozygous Palb2 knockout mice in a p53-deficient background but found no
evidence for Palb2 haploinsufficiency in suppressing tumourigenesis as only
haemangiosarcomas and thymic lymphomas were observed in heterozygous
Palb2 mice in a p53-deficient background. In addition, these Palb2 heterozygous
lymphomas were euploid and did not contain more translocations or copy number
changes than the WT tumours. However, they were able to show that the p53
knockout delays the embryonic lethal phenotype for Palb2 homozygous embryos
since the Palb2 deficient embryos in a p53-deficient background died a few days
96
later than Palb2 deficient embryos in a WT background as they were able to form
mesoderm-derived structures, like heart muscle (Bouwman et al. 2011) Again,
similar results for Brca1/2 deficient embryos in a p53-deficient background have
been reported (Hakem et al. 1997, Ludwig et al. 1997). In human BRCA1/2-
associated breast tumours TP53 is more frequently mutated than in sporadic cases,
which suggests selective pressure for loss of p53 in the absence of BRCA1/2
(Greenblatt et al. 2001, Holstege et al. 2009). According to Bouwman et al., the
ablation of p53 alleviates the embryonic phenotype of Palb2 knockout mice,
suggesting a similar requirement for TP53 mutation in BRCA1/2- and PALB2-
associated tumours.
The main difference between the phenotypes of conventional Brca1/2
knockout mouse models is that some gave rise to viable homozygous Brca1/2
knockout mice, which were found to be tumour-prone. Nevertheless, these
models were biased towards lymphoid and sarcomatoid tumours as mammary
tumours were present only in a minority of the mice. This has been seen
especially when the Brca1Tr/Tr mice were crossed onto a p53 background
(Cressman et al. 1999, Ludwig et al. 2001). In addition, few studies have shown
survival for conventional Brca2 knockout mice and interestingly all these viable
animals had increased tumourigenesis towards thymic lymphomas (Connor et al.
1997, Friedman et al. 1998). Given that most conventional Brca1/2 knockout
mice are embryonic lethal and heterozygous mice are not tumour prone,
conditional models with mammary gland-specific deletion of Brca1/2 have been
created with or without co-deletion of p53. Few conditional knockout models for
BRCA1-related breast cancer have been reported to resemble closely the
pathology of the human disease (rev. in Michalak & Jonkers 2011). For some
reason, creating conditional knockout models for BRCA2-related breast cancer
has turned out to be difficult. A few studies have been reported where conditional
Brca2 knockout mice succumb to non-metastatic mammary carcinomas or
adenosquamous carcinomas after continuous mating. The latency period was also
relatively long (~1.4–1.6 years) in these models. This latency was significantly
reduced in a p53 heterozygous background, which also caused a dramatic shift in
the tumour spectrum as combined tissue-specific inactivation of both Brca2 and
p53 resulted in highly efficient mammary tumour formation (rev. in Evers &
Jonkers 2006). Regardless, conditional Brca1/2 knockout mouse models have
proved to be an extremely important tool to study BRCA-associated breast
cancers and to test novel therapeutics and tumour prevention strategies. Therefore,
it would be of great importance to create PALB2 tissue-specific knockout mouse
97
models to generate PALB2-related tumourigenesis, which would provide more
information on how PALB2-deficiency induces cancer development.
According to study III and Bouwman et al., Palb2 has an extremely important
role in early mouse embryogenesis and is essential for cell proliferation and
mesoderm differentiation (Bouwman et al. 2011). As shown in study III, defective
Palb2 function during early embryonic development results in insufficient cell
proliferation, which might originate from the accumulation of DNA damage, and
failure of mesoderm differentiation. Together these defects eventually lead to the
death of homozygous Palb2 knockout embryos. Given that no study so far has
been able to show that PALB2 is a haploinsufficient tumour suppressor, it would
be of great importance to generate conditional Palb2 knockout mouse models
and/or human-in-mouse models for Palb2 deficiency to gain more insight into the
role of PALB2 mutations in FA and PALB2-associated breast cancer. Furthermore,
results from such studies might have important consequences for tumour
treatment strategies in PALB2 mutation carriers if they could confirm that PALB2
truly is a haploinsufficient tumour suppressor also in mice. Additional studies
regarding whether a second hit is needed in PALB2 mutation carriers for a cancer
to occur, in agreement with Knudson´s two-hit theory, would be valuable
information for developing targeted therapeutic approaches to patients carrying
mutations in PALB2.
6.4 Germline mutations in RAP80 abrogate DNA double-strand break repair function and may be involved in cancer predisposition (IV)
Subsets of breast cancers are associated with germline mutations in BRCA1 and
BRCA2 genes. However, a majority are sporadic malignancies and do not have
mutations in these genes. Therefore, it has been hypothesized that mutations in
other functional partners in the BRCA pathway could account for a subset of
breast cancers lacking BRCA1/2 mutations. Indeed, this hypothesis has been
partially proved by identifying cancer-associated mutations in BRCA1/2 partners,
such as BRIP1, PALB2, RAD51 and ABRAXAS (Cantor et al. 2001, Erkko et al.
2007, Kato et al. 2000, Solyom et al. 2012, Wong et al. 2011). However, it
remains unclear whether mutations in additional partners, other than ABRAXAS,
of the BRCA1-A complex are associated with tumourigenesis, since no cancer-
associated mutations have been found for MERIT40 (Solyom et al. 2010),
BRCC45, or BRCC36 genes to date. A few investigations on the occurrence of
98
RAP80 mutations in breast cancer families have been conducted where no cancer-
associated mutations were found (Akbari et al. 2009, Novak et al. 2009, Osorio et
al. 2009). In contrast, a loss of function mutation in RAP80, RAP80 delE81, was
identified from two breast cancer patients in study IV. Interestingly, one
heterozygous delE81 carrier, diagnosed with breast cancer at age 60 years, had a
moderate familial background for breast cancer but unfortunately the segregation
of the RAP80 delE81 mutation with regard to the cancer incidence was not
possible to analyse due to a lack of DNA samples from relatives. The other
RAP80 delE81 carrier had been diagnosed with bilateral breast cancer at
relatively young ages (39 and 41 years) but unfortunately the family history of
cancer for this patient remained unknown. In addition, a RAP80 delE81 mutation
was identified in one 49-year old control individual. However, it is possible that
this individual was too young to express the disease phenotype when donating the
DNA specimen. Indeed, the majority of germline BRCA1/2 mutation carriers
display cancer phenotypes only after the age of 50 (King et al. 2003).
The identified variant, RAP80 delE81, localized to a functionally important
UIM1 domain of RAP80, which has already proved to be crucial for localizing
the whole BRCA1-A complex to the DSBs (discussed in more detail in chapter
2.8.2). More importantly, this variant has a reduced capacity to bind K63-linked
ubiquitin and to localize to IRIF & laser-induced DSBs, suggesting that the
diminished ubiquitin binding leads to a decrease in RAP80 delE81 retention at
sites of damage, as shown in study IV. This variant also seems to act as a
dominant-negative allele since it does not interfere with RAP80´s ability to
interact with its known binding partners but fails to recruit the whole BRCA1-A
complex to the sites of DNA damage. This may partially explain why LOH was
not seen in the mutation carrier’s breast tumours, as shown in study IV.
Furthermore, if RAP80 delE81 indeed acts as a dominant-negative allele, then
cells expressing this variant may have deficiencies in DDR, owing to impaired
recruitment of BRCA1, and should display chromosomal abnormalities, since this
has been shown for BRCA1/2 deficient cells (Patel et al. 1998, Xu et al. 1999).
Accordingly, cells expressing the RAP80 delE81 variant exhibited a significant
increase in sister chromatid breaks, indicating that DSBs are not repaired with the
same fidelity as in the WT expressing cells, as shown in study IV. These results
strongly support the importance of DSB-linked ubiquitin recognition by the
RAP80-BRCA1 complex for the maintenance of genome integrity and hence, the
RAP80 delE81 allele may represent a new alternative mechanism of disrupting
BRCA1 DSB repair function in tumourigenesis. Interestingly Strauss et al.
99
showed recently that MDC1 interacts with RAP80 via its UIMs and that this
association is involved in the recruitment of the whole complex to the DSBs.
They proposed a model where upon DNA damage a fraction of MDC1, which is
not bound to RAP80, is recruited to DSBs where it binds to γH2AX as discussed
in chapter 2.7.1, and another fraction of MDC1 is bound to RAP80´s UIMs
promoting the recruitment of this complex to the sites of damaged DNA.
Supporting the results presented in study IV, Strauss et al. showed that the RAP80
delE81 mutation also impairs the RAP80-MDC1 interaction further
demonstrating the importance of these UIM-domains to the function of RAP80 in
DDR (Strauss et al. 2011). To establish the importance of RAP80 in maintaining
genomic stability even further, Wu et al. and Yin et al. generated Rap80 knockout
mouse models. Wu et al. found that Rap80-deficient mice were prone to B-cell
lymphomagenesis, hypersensitive to IR and had impaired BRCA1-A complex
foci formation upon DNA damage (Wu et al. 2012). Yin et al. showed that
Rap80-deficient mice were more susceptible to spontaneous lymphoma
development and the development of DMBA-induced mammary gland tumours,
and that the loss of Rap80 accelerated tumour formation in both p53-/- and p53+/-
mice. Yin et al. also showed that mouse embryonic fibroblasts and thymocytes
derived from Rap80-deficient mice were more sensitive to IR than WT mice (Yin
et al. 2012), results similar to those of Wu et al. Therefore, both of these studies
support the findings presented in study IV.
As shown in study IV, the prevalence of the RAP80 delE81 mutation in the
breast cancer cohort was not statistically significant. However, this is likely
because of a combination of extremely low allele frequency and an incomplete
disease penetrance. The mutation carriers were found to originate from the same
limited geographical region of northern Finland and if the affected site represents
a mutational hotspot, it would be expected to occur in other geographical settings
as well. Hence, studies in additional populations are needed to understand the
prevalence of this allele in other locations. Further insight into the occurrence of
the RAP80 delE81 mutation in breast cancer is needed in order to establish
whether carriers of this mutation would benefit from genetic counselling in
clinical settings. In total, the present study underscores the importance of both
ubiquitin signalling and recognition in DDR and maintenance of genomic stability,
and further supports the hypothesis that BRCA1/2 interacting partners represent
potential cancer predisposing factors and their role in tumourigenesis should be
studied in more detail.
100
Taken together, RAP80 has been shown to play a crucial roles in DDR and in
the maintenance of genome integrity, and mutations in RAP80 may be associated
with cancer predisposition, as shown in study IV. Interestingly, a truncating
mutation of RAP80, RAP80 c.1107G>A, was recently identified in one ovarian
cancer cell line (TOV-21G). The ovarian cancer cell line was found to be a
RAP80-null cell line, due to the monoallelic mutation of RAP80 and promoter
hypermethylation, which silences the expression of both alleles. The cell line also
displayed similar deficiencies in BRCA1-A foci formation upon DNA damage as
demonstrated in study IV, which suggests that RAP80 mutations may also be
involved in ovarian cancer predisposition (Bian et al. 2012). Although the
functional consequences of the currently identified RAP80 mutations need to be
further characterized, the present study and Bian et al. have provided data
supporting RAP80 as a genuine breast and ovarian tumour suppressor. In this
regard, it would be extremely interesting to study the impact of the RAP80 delE81
mutation in ovarian cancer, especially in the Northern Finnish ovarian cancer
cohort since this mutation seems to have a hotspot in this geographical setting. If
RAP80 delE81 can be connected to ovarian cancer predisposition then screening
for this mutation could be considered as RAP80 delE81 carriers would benefit
greatly from targeted follow-up on cancer development enabling early detection
of cancer and better disease prognosis.
In addition, a few studies have shown that RAP80 expression increases
significantly during pancreatic cancer development and that RAP80 is a predictor
of survival in non-squamous cell lung cancer patients treated with chemotherapy.
Furthermore, Li et al. showed that inhibition of RAP80 expression can increase
the sensitivity of pancreatic cancer cells to chemotherapy and stimulate apoptosis,
making RAP80 a potential target for future pancreatic cancer therapy (Li et al.
2012, Rosell et al. 2009, Wang et al. 2011). Taken together, it is extremely
important to study the role of RAP80, as well as other BRCA1/2-interacting
partners, their mutations in various settings, such as different cancers and
populations, to gain more insight into the role of RAP80 and other BRCA1/2-
associating partners in tumourigenesis and possibly identify new targets for
therapeutic approaches.
101
7 Concluding remarks
Currently, only ~30% of hereditary breast cancers can be explained by mutations
in known breast cancer susceptibility genes and the mechanisms behind these
mutations, at the cellular level, are largely unknown. Therefore, new familial
breast cancer predisposing factors need to be identified in order to recognize
patients at higher risk for developing a breast malignancy, giving them the
opportunity for effective disease monitoring and an early detection of cancer.
Equally important is discovering why certain cancer predisposing mutations lead
to cancer development in the heterozygous state. Resolving these issues will
ultimately lead to a better understanding of cancer development and disease
progression, and will enable the development of targeted therapeutic approaches
and also further improve the effectiveness of the already existing regimens for
treating cancer. Thus, the purpose of this thesis was to identify novel breast
cancer predisposing genes and to characterize one of them (PALB2) in more detail.
The chosen candidate genes were PALB2 and RAP80, which were selected based
on their biological functions in DDR. Furthermore, the products encoded by these
genes have crucial roles in recruiting protein products of known susceptibility
genes, BRCA1 and BRCA2, to the sites of DNA damage. Based on the results of
each study, the major observations and conclusion are as follows:
1. The PALB2 c.1592delT founder mutation was identified to be associated with
a four-fold increased breast cancer risk. This mutation was also seen in 1% of
unselected breast cancer patients, therefore being a significant contributor to
breast cancer predisposition even outside the high-risk breast cancer families.
2. The PALB2 c.1592delT mutation resulted in a truncated protein product that
showed significantly decreased BRCA2-binding affinity and could not
support intact BRCA2 function in homologous recombination in PALB2
knockdown cells. It was also unable to restore crosslink repair in PALB2-
deficient cells. Hence, c.1592delT is a genuine loss-of-function mutation.
3. No loss of heterozygosity was observed in the breast tumours of the six
patients analysed, suggesting that PALB2 might not act as a classical tumour
suppressor gene and the effect of c.1592delT might be mediated through
PALB2 haploinsufficiency combined with a dominant-negative effect of the
truncated protein product.
102
4. Heterozygous PALB2 c.1592delT mutation carrier lymphoblastoid cells were
found to express only 54% of the normal amount of PALB2 protein under
normal growth conditions.
5. At the cellular level, the heterozygous PALB2 c.1592delT mutation causes a
haploinsufficiency phenotype characterized by excessive replication origin
firing under normal growth conditions. As a consequence, DNA is
synthesized slightly faster, which might generate more DNA damage during
cell cycling than is normally produced.
6. As a compensating mechanism, ATR expression was significantly increased
by a factor of at least three in PALB2 c.1592delT carrier cells when compared
to healthy controls, which further demonstrates that the heterozygous carriers
experience replication stress under normal growth conditions.
7. After induction of more replication stress, PALB2 c.1592delT carrier cells
displayed a slight delay in their intra-S phase checkpoint activation and
replication fork restart and/or dormant origin firing, which demonstrates that
these carrier cells exhaust part of their capacity to recover from replication
stress already during normal growth.
8. Upon DNA damage, the heterozygous PALB2 c.1592delT mutation carriers
display a maintenance problem in their G2/M checkpoint, which enables
some of the cells with unrepaired DNA damage to escape into mitosis
prematurely. This might lead to the accumulation of unrepaired DNA damage
in the daughter cells and may predispose to cancer.
9. Together these defects in DNA replication origin firing and G2/M checkpoint
maintenance cause a significant increase in genomic instability in the PALB2
c.1592delT mutation carrier´s primary lymphocytes which are manifested by
spontaneous chromosomal rearrangements, providing strong evidence that the
mechanism of genome instability in primary tissues is the same. These results
provide a mechanism for the early stages of breast cancer development in
PALB2 c.1592delT mutation carriers that may be a model for other cancer
predisposing mutations as well, but this needs further investigation.
10. As the tumours were negative for LOH, it seems that the haploinsufficiency
for PALB2 results in a gradual loss of genomic integrity via combined
replication and G2/M checkpoint maintenance defects.
11. Palb2 was found to play a critical role in early embryonal development in
mice, similar to Brca1 and Brca2.
103
12. Homozygous inactivation of Palb2 was embryonal lethal and these embryos
died at or before E9.5 due to defects in mesoderm differentiation and cell
proliferation, as has been reported for Brca1/2-deficient embryos.
13. The similarity in phenotypes between Palb2, Brca1 and Brca2-deficient mice
further supports the functional relationship shown in vitro for these proteins.
Hence, this in vivo data suggests that a key function for PALB2 is to interact
with and to establish appropriate communication between BRCA1/2 and to
licence the successful performance mediated by BRCA1/2 in DDR.
14. Heterozygous inactivation of Palb2 did not have any effect on mouse
development since these mice, like WT, were viable, fertile and did not
develop tumours in any of the organs analysed.
15. A RAP80 delE81 mutation was identified from two breast cancer patients,
one of which had a moderate familial background of cancer and the other had
been diagnosed with bilateral breast cancer at ages 39 and 41.
16. The resultant delE81 protein displayed significantly reduced ubiquitin
binding and DSB localization. Furthermore, it impaired the whole BRCA1-A
complex DSB recruitment, thus compromising BRCA1-mediated DDR
signalling.
17. Expression of the delE81 allele was associated with a significant increase in
cytogenetically detectable chromosomal aberrations, mainly chromatid
breaks.
18. No loss of heterozygosity was observed in the breast tumours of the two
patients analysed, which suggests that the effect of delE81 might be mediated
by a dominant-negative effect of the RAP80 delE81 protein product.
19. Although the RAP80 delE81 mutation is quite rare, the results from study IV
indicate that the RAP80 delE81 defect is biologically relevant and might be
associated with hereditary predisposition to breast cancer.
104
105
References
Adank MA, Jonker MA, Kluijt I, van Mil SE, Oldenburg RA, Mooi WJ, Hogervorst FB, van den Ouweland AM, Gille JJ, Schmidt MK, van der Vaart AW, Meijers-Heijboer H & Waisfisz Q (2011a) CHEK2*1100delC homozygosity is associated with a high breast cancer risk in women. J Med Genet 48(12): 860–863.
Adank MA, van Mil SE, Gille JJ, Waisfisz Q & Meijers-Heijboer H (2011b) PALB2 analysis in BRCA2-like families. Breast Cancer Res Treat 127(2): 357–362.
Ahmed M, Lalloo F & Evans DG (2009) Update on genetic predisposition to breast cancer. Expert Rev Anticancer Ther 9(8): 1103–1113.
Ahn J, Urist M & Prives C (2004) The Chk2 protein kinase. DNA Repair (Amst) 3(8–9): 1039–1047.
Airewele GE, Sigurdson AJ, Wiley KJ, Frieden BE, Caldarera LW, Riccardi VM, Lewis RA, Chintagumpala MM, Ater JL, Plon SE & Bondy ML (2001) Neoplasms in neurofibromatosis 1 are related to gender but not to family history of cancer. Genet Epidemiol 20(1): 75–86.
Akbari MR, Ghadirian P, Robidoux A, Foumani M, Sun Y, Royer R, Zandvakili I, Lynch H & Narod SA (2009) Germline RAP80 mutations and susceptibility to breast cancer. Breast Cancer Res Treat 113(2): 377–381.
Akbari MR, Tonin P, Foulkes WD, Ghadirian P, Tischkowitz M & Narod SA (2010) RAD51C germline mutations in breast and ovarian cancer patients. Breast Cancer Res 12(4): 404.
Allen C, Ashley AK, Hromas R & Nickoloff JA (2011) More forks on the road to replication stress recovery. J Mol Cell Biol 3(1): 4–12.
Allen C, Kurimasa A, Brenneman MA, Chen DJ & Nickoloff JA (2002) DNA-dependent protein kinase suppresses double-strand break-induced and spontaneous homologous recombination. Proc Natl Acad Sci USA 99(6): 3758–3763.
Allinen M, Huusko P, Mantyniemi S, Launonen V & Winqvist R (2001) Mutation analysis of the CHK2 gene in families with hereditary breast cancer. Br J Cancer 85(2): 209–212.
Alter BP, Rosenberg PS & Brody LC (2007) Clinical and molecular features associated with biallelic mutations in FANCD1/BRCA2. J Med Genet 44(1): 1–9.
American Cancer Society (ed) (2011) Global Cancer Facts & Figures 2nd Edition. Atlanta: American Cancer Society. .
Ameziane N, van den Ouweland AM, Adank MA, Vijzelaar RN, Errami A, Dorsman JC, Joenje H, Meijers-Heijboer H & Waisfisz Q (2009) Lack of large genomic deletions in BRIP1, PALB2, and FANCD2 genes in BRCA1/2 negative familial breast cancer. Breast Cancer Res Treat 118(3): 651–653.
Anglian Breast Cancer Study Group (2000) Prevalence and penetrance of BRCA1 and BRCA2 mutations in a population-based series of breast cancer cases. Br J Cancer 83(10): 1301–1308.
Antoniou AC & Easton DF (2003a) Polygenic inheritance of breast cancer: Implications for design of association studies. Genet Epidemiol 25(3): 190–202.
106
Antoniou A, Pharoah PD, Narod S, Risch HA, Eyfjord JE, Hopper JL, Loman N, Olsson H, Johannsson O, Borg A, Pasini B, Radice P, Manoukian S, Eccles DM, Tang N, Olah E, Anton-Culver H, Warner E, Lubinski J, Gronwald J, Gorski B, Tulinius H, Thorlacius S, Eerola H, Nevanlinna H, Syrjakoski K, Kallioniemi OP, Thompson D, Evans C, Peto J, lalloo F, Evans DG & Easton DF (2003b) Average risks ob breast and ovarian cancer associated with BRCA1 or BRCA2 mutations detected in case Series unselected for family history: a combination of analysis of 22 studies. Am. J. Hum. genet. 72(5): 1117–1130.
Antoniou AC, Beesley J, McGuffog L, Sinilnikova OM, Healey S, Neuhausen SL, Ding YC, Rebbeck TR, Weitzel JN, Lynch HT, Isaacs C, Ganz PA, Tomlinson G, Olopade OI, Couch FJ, Wang X, Lindor NM, Pankratz VS, Radice P, Manoukian S, Peissel B, Zaffaroni D, Barile M, Viel A, Allavena A, Dall'Olio V, Peterlongo P, Szabo CI, Zikan M, Claes K, Poppe B, Foretova L, Mai PL, Greene MH, Rennert G, Lejbkowicz F, Glendon G, Ozcelik H, Andrulis IL, Ontario Cancer Genetics Network, Thomassen M, Gerdes AM, Sunde L, Cruger D, Birk Jensen U, Caligo M, Friedman E, Kaufman B, Laitman Y, Milgrom R, Dubrovsky M, Cohen S, Borg A, Jernstrom H. Lindblom A, Rantala J, Stenmark-Askmalm M, Melin B, SWE-BRCA, Nathanson K, Domchek S, Jakubowska A, Lubinski J, Huzarski T, Osorio A, Lasa A, Duran M, Tejada MI, Godino J, Benitez J, Hamann U, Kriege M, Hoogerbrugge N, van der Luijt RB, van Asperen CJ, Devilee P, Meijers-Heijboer EJ, Blok MJ, Aalfs CM, Hogervorst F, Rookus M, HEBON, Cook M, Oliver C, Frost D, Conroy D, Evans DG, Lalloo F, Pichert G, Davidson R, Cole T, Cook J, Paterson J, Hodgson S, Morrison PJ, Porteous ME, Walker L, Kennedy MJ, Dorkins H, Peock S, EMBRACE, Godwin AK, Stoppa-Lyonnet D, de Pauw A, Mazoyer S, Bonadona V, Lasset C, Dreyfus H, Leroux D, Hardouin A, Berthet P, Faivre L, GEMO, Loustalot C, Noguchi T, Sobol H, Rouleau E, Nogues C, Frenay M, Venat-Bouvet L, GEMO, Hopper JL, Daly MB, Terry MB, John EM, Buys SS, Yassin Y, Miron A, Goldgar D, Breast Cancer Family Registry, Singer CF, Dressler AC, Gschwantler-Kaulich D, Pfeiler G, Hansen TV, Jonson L, Agnarsson BA, Kirchhoff T, Offit K, Devlin V, Dutra-Clarke A, Piedmonte M, Rodriguez GC, Wakeley K, Boggess JF, Basil J, Schwartz PE, Blank SV, Toland AE, Montagna M, Casella C, Imyanitov E, Tihomirova L, Blanco I, Lazaro C, Ramus SJ, Sucheston L, Karlan BY, Gross J, Schmutzler R, Wappenschmidt B, Engel C, Meindl A, Lochmann M, Arnold N, Heidemann S, Varon-Mateeva R, Niederacher D, Sutter C, Deissler H, Gadzicki D, Preisler-Adams S, Kast K, Schonbuchner I, Caldes T, de la Hoya M, Aittomaki K, Nevanlinna H, Simard J, Spurdle AB, Holland H, Chen X, kConFab, Platte R, Chenevix-Trench G, Easton DF & CIMBA (2010) Common breast cancer susceptibility alleles and the risk of breast cancer for BRCA1 and BRCA2 mutation carriers: implications for risk prediction. Cancer Res. 70(23): 9742–9754.
Antoniou AC & Easton DF (2006) Models of genetic susceptibility to breast cancer. Oncogene 25(43): 5898–5905.
Antoniou AC, Kartsonaki C, Sinilnikova OM, Soucy P, McGuffog L, Healey S, Lee A, Peterlongo P, Manoukian S, Peissel B, Zaffaroni D, Cattaneo E, Barile M, Pensotti V, Pasini B, Dolcetti R, Giannini G, Putignano AL, Varesco L, Radice P, Mai PL,
107
Greene MH, Andrulis IL, Glendon G, Ozcelik H, Thomassen M, Gerdes AM, Kruse TA, Birk Jensen U, Cruger DG, Caligo MA, Laitman Y, Milgrom R, Kaufman B, Paluch-Shimon S, Friedman E, Loman N, Harbst K, Lindblom A, Arver B, Ehrencrona H, Melin B, SWE-BRCA, Nathanson KL, Domchek SM, Rebbeck T, Jakubowska A, Lubinski J, Gronwald J, Huzarski T, Byrski T, Cybulski C, Gorski B, Osorio A, Ramon y Cajal T, Fostira F, Andres R, Benitez J, Hamann U, Hogervorst FB, Rookus MA, Hooning MJ, Nelen MR, van der Luijt RB, van Os TA, van Asperen CJ, Devilee P, Meijers-Heijboer HE, Gomez Garcia EB, HEBON, Peock S, Cook M, Frost D, Platte R, Leyland J, Evans DG, Lalloo F, Eeles R, Izatt L, Adlard J, Davidson R, Eccles D, Ong KR, Cook J, Douglas F, Paterson J, Kennedy MJ, Miedzybrodzka Z, EMBRACE, Godwin A, Stoppa-Lyonnet D, Buecher B, Belotti M, Tirapo C, Mazoyer S, Barjhoux L, Lasset C, Leroux D, Faivre L, Bronner M, Prieur F, Nogues C, Rouleau E, Pujol P, Coupier I, Frenay M, CEMO Study Collaborators, Hopper JL, Daly MB, Terry MB, John EM, Buys SS, Yassin Y, Miron A, Goldgar D, Breast Cancer Family Registry, Singer CF, Tea MK, Pfeiler G, Dressler AC, Hansen T, Jonson L, Ejlertsen B, Barkardottir RB, Kirchhoff T, Offit K, Piedmonte M, Rodriguez G, Small L, Boggess J, Blank S, Basil J, Azodi M, Toland AE, Montagna M, Tognazzo S, Agata S, Imyanitov E, Janavicius R, Lazaro C, Blanco I, Pharoah PD, Sucheston L, Karlan BY, Walsh CS, Olah E, Bozsik A, Teo SH, Seldon JL, Beattie MS, van Rensburg EJ, Sluiter MD, Diez O, Schmutzler RK, Wappenschmidt B, Engel C, Meindl A, Ruehl I, Varon-Mateeva R, Kast K, Deissler H, Niederacher D, Arnold N, Gadzicki D, Schonbuchner I, Caldes T, de la Hoya M, Nevanlinna H, Aittomaki K, Dumont M, Chiquette J, Tischkowitz M, Chen X, Beesley J, Spurdle AB, kConFab investigators, Neuhausen SL, Chun Ding Y, Fredericksen Z, Wang X, Pankratz VS, Couch F, Simard J, Easton DF, Chenevix-Trench G & CIMBA (2011) Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers. Hum Mol Genet 20(16): 3304–3321.
Antoniou AC, Sinilnikova OM, Simard J, Leone M, Dumont M, Neuhausen SL, Struewing JP, Stoppa-Lyonnet D, Barjhoux L, Hughes DJ, Coupier I, Belotti M, Lasset C, Bonadona V, Bignon YJ, Genetic Modifiers of Cancer Risk in BRCA1/2 Mutation Carriers Study (GEMO), Rebbeck TR, Wagner T, Lynch HT, Domchek SM, Nathanson KL, Garber JE, Weitzel J, Narod SA, Tomlinson G, Olopade OI, Godwin A, Isaacs C, Jakubowska A, Lubinski J, Gronwald J, Gorski B, Byrski T, Huzarski T, Peock S, Cook M, Baynes C, Murray A, Rogers M, Daly PA, Dorkins H, Epidemiological Study of BRCA1 and BRCA2 Mutation Carriers (EMBRACE), Schmutzler RK, Versmold B, Engel C, Meindl A, Arnold N, Niederacher D, Deissler H, German Consortium for Hereditary Breast and Ovarian Cancer (GCHBOC), Spurdle AB, Chen X, Waddell N, Cloonan N, Kathleen Cuningham Consortium for Research into Familial Breast Cancer (kConFab), Kirchhoff T, Offit K, Friedman E, Kaufmann B, Laitman Y, Galore G, Rennert G, Lejbkowicz F, Raskin L, Andrulis IL, Ilyushik E, Ozcelik H, Devilee P, Vreeswijk MP, Greene MH, Prindiville SA, Osorio A, Benitez J, Zikan M, Szabo CI, Kilpivaara O, Nevanlinna H, Hamann U, Durocher F, Arason A, Couch FJ, Easton DF, Chenevix-Trench G & Consortium of
108
Investigators of Modifiers of BRCA1/2 (CIMBA) (2007) RAD51 135G-->C modifies breast cancer risk among BRCA2 mutation carriers: results from a combined analysis of 19 studies. Am J Hum Genet 81(6): 1186–1200.
Antoniou AC, Spurdle AB, Sinilnikova OM, Healey S, Pooley KA, Schmutzler RK, Versmold B, Engel C, Meindl A, Arnold N, Hofmann W, Sutter C, Niederacher D, Deissler H, Caldes T, Kampjarvi K, Nevanlinna H, Simard J, Beesley J, Chen X, Kathleen Cuningham Consortium for Research into Familial Breast Cancer, Neuhausen SL, Rebbeck TR, Wagner T, Lynch HT, Isaacs C, Weitzel J, Ganz PA, Daly MB, Tomlinson G, Olopade OI, Blum JL, Couch FJ, Peterlongo P, Manoukian S, Barile M, Radice P, Szabo CI, Pereira LH, Greene MH, Rennert G, Lejbkowicz F, Barnett-Griness O, Andrulis IL, Ozcelik H, OCGN, Gerdes AM, Caligo MA, Laitman Y, Kaufman B, Milgrom R, Friedman E, Swedish BRCA1 and BRCA2 study collaborators, Domchek SM, Nathanson KL, Osorio A, Llort G, Milne RL, Benitez J, Hamann U, Hogervorst FB, Manders P, Ligtenberg MJ, van den Ouweland AM, DNA-HEBON collaborators, Peock S, Cook M, Platte R, Evans DG, Eeles R, Pichert G, Chu C, Eccles D, Davidson R, Douglas F, EMBRACE, Godwin AK, Barjhoux L, Mazoyer S, Sobol H, Bourdon V, Eisinger F, Chompret A, Capoulade C, Bressac-de Paillerets B, Lenoir GM, Gauthier-Villars M, Houdayer C, Stoppa-Lyonnet D, GEMO, Chenevix-Trench G, Easton DF & CIMBA (2008) Common breast cancer-predisposition alleles are associated with breast cancer risk in BRCA1 and BRCA2 mutation carriers. Am J Hum Genet 82(4): 937–948.
Aressy B & Ducommun B (2008) Cell cycle control by the CDC25 phosphatases. Anticancer Agents Med Chem 8(8): 818–824.
Arnaudeau C, Lundin C & Helleday T (2001) DNA double-strand breaks associated with replication forks are predominantly repaired by homologous recombination involving an exchange mechanism in mammalian cells. J Mol Biol 307(5): 1235–1245.
Ayoub N, Rajendra E, Su X, Jeyasekharan AD, Mahen R & Venkitaraman AR (2009) The carboxyl terminus of Brca2 links the disassembly of Rad51 complexes to mitotic entry. Curr Biol 19(13): 1075–1085.
Bahassi EM, Ovesen JL, Riesenberg AL, Bernstein WZ, Hasty PE & Stambrook PJ (2008) The checkpoint kinases Chk1 and Chk2 regulate the functional associations between hBRCA2 and Rad51 in response to DNA damage. Oncogene 27(28): 3977–3985.
Balia C, Sensi E, Lombardi G, Roncella M, Bevilacqua G & Caligo MA (2010) PALB2: a novel inactivating mutation in a Italian breast cancer family. Fam Cancer 9(4): 531–536.
Banerji S, Cibulskis K, Rangel-Escareno C, Brown KK, Carter SL, Frederick AM, Lawrence MS, Sivachenko AY, Sougnez C, Zou L, Cortes ML, Fernandez-Lopez JC, Peng S, Ardlie KG, Auclair D, Bautista-Piña V, Duke F, Francis J, Jung J, Maffuz-Aziz A, Onofrio RC, Parkin M, Pho NH, Quintanar-Jurado V, Ramos AH, Rebollar-Vega R, Rodriguez-Cuevas S, Romero-Cordoba SL, Schumacher SE, Stransky N, Thompson KM, Uribe-Figueroa L, Baselga J, Beroukhim R, Polyak K, Sgroi DC, Richardson AL, Jimenez-Sanchez G, Lander ES, Gabriel SB, Garraway LA, Golub TR, Melendez-Zajgla J, Toker A, Getz G, Hidalgo-Miranda A & Meyerson M (2012)
109
Sequence analysis of mutations and translocations across breast cancer subtypes. Nature. 486(7403):405–409.
Barrett SV (2010) Breast cancer. J R Coll Physicians Edinb 40(4): 335–8; quiz 339. Bartek J, Bartkova J & Lukas J (2007) DNA damage signalling guards against activated
oncogenes and tumour progression. Oncogene 26(56): 7773–7779. Bartek J & Lukas J (2003) Chk1 and Chk2 kinases in checkpoint control and cancer.
Cancer Cell 3(5): 421–429. Bellacosa A, Godwin AK, Peri S, Devarajan K, Caretti E, Vanderveer L, Bove B, Slater C,
Zhou Y, Daly M, Howard S, Campbell K, Nicolas E, Yeung AT, Clapper ML, Crowell JA, Lynch HT, Ross E, Kopelovich L & Knudson AG (2010) Altered Gene Expression in Morphologically Normal Epithelial Cells from Heterozygous Carriers of BRCA1 or BRCA2 Mutations. Cancer Prev Res (Phila). 3(1): 48–61.
Bennett LM, McAllister KA, Blackshear PE, Malphurs J, Goulding G, Collins NK, Ward T, Bunch DO, Eddy EM, Davis BJ & Wiseman RW (2000) BRCA2-null embryonic survival is prolonged on the BALB/c genetic background. Mol Carcinog 28(3): 174–183.
Berger AH & Pandolfi PP (2011) Haplo-insufficiency: a driving force in cancer. J Pathol 223: 137–146.
Bernstein KA & Rothstein R (2009) At loose ends: resecting a double-strand break. Cell 137(5): 807–810.
Bian C, Wu R, Cho K & Yu X (2012) Loss of BRCA1-A Complex Function in RAP80 Null Tumor Cells. PLoS One 7(7): e40406.
Bielas JH, Loeb KR, Rubin BP, True LD & Loeb LA (2006) Human cancers express a mutator phenotype. Proc Natl Acad Sci USA 103(48): 18238–18242.
Blanco A, de la Hoya M, Balmana J, Ramon y Cajal T, Teule A, Miramar MD, Esteban E, Infante M, Benitez J, Torres A, Tejada MI, Brunet J, Grana B, Balbin M, Perez-Segura P, Osorio A, Velasco EA, Chirivella I, Calvo MT, Feliubadalo L, Lasa A, Diez O, Carracedo A, Caldes T & Vega A (2012) Detection of a large rearrangement in PALB2 in Spanish breast cancer families with male breast cancer. Breast Cancer Res Treat 132(1): 307–315.
Bleuyard JY, Buisson R, Masson JY & Esashi F (2012) ChAM, a novel motif that mediates PALB2 intrinsic chromatin binding and facilitates DNA repair. EMBO Rep 13(2): 135–141.
Bogdanova N, Feshchenko S, Schurmann P, Waltes R, Wieland B, Hillemanns P, Rogov YI, Dammann O, Bremer M, Karstens JH, Sohn C, Varon R & Dork T (2008) Nijmegen Breakage Syndrome mutations and risk of breast cancer. Int J Cancer 122(4): 802–806.
Bogdanova N, Sokolenko AP, Iyevleva AG, Abysheva SN, Blaut M, Bremer M, Christiansen H, Rave-Frank M, Dork T & Imyanitov EN (2011) PALB2 mutations in German and Russian patients with bilateral breast cancer. Breast Cancer Res Treat 126(2): 545–550.
Borg A (2001) Molecular and pathological characterization of inherited breast cancer. Semin Cancer Biol 11(5): 375–385.
110
Boulton SJ (2006) Cellular functions of the BRCA tumour-suppressor proteins. Biochem Soc Trans 34(Pt 5): 633–645.
Bouwman P, Drost R, Klijn C, Pieterse M, van der Gulden H, Song JY, Szuhai K & Jonkers J (2011) Loss of p53 partially rescues embryonic development of Palb2 knockout mice but does not foster haploinsufficiency of Palb2 in tumour suppression. J Pathol 224(1): 10–21.
Breast Cancer Linkage Consortium (1997) Pathology of familial breast cancer: differences between breast cancers in carriers of BRCA1 or BRCA2 mutations and sporadic cases. Lancet 349(9064): 1505–1510.
Bridge WL, Vandenberg CJ, Franklin RJ & Hiom K (2005) The BRIP1 helicase functions independently of BRCA1 in the Fanconi anemia pathway for DNA crosslink repair. Nat Genet 37(9): 953–957.
Bryant HE, Petermann E, Schultz N, Jemth AS, Loseva O, Issaeva N, Johansson F, Fernandez S, McGlynn P & Helleday T (2009) PARP is activated at stalled forks to mediate Mre11-dependent replication restart and recombination. EMBO J 28(17): 2601–2615.
Bryant HE, Schultz N, Thomas HD, Parker KM, Flower D, Lopez E, Kyle S, Meuth M, Curtin NJ & Helleday T (2005) Specific killing of BRCA2-deficient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature 434(7035): 913–917.
Budzowska M & Kanaar R (2009) Mechanisms of dealing with DNA damage-induced replication problems. Cell Biochem Biophys 53(1): 17–31.
Buisson R, Dion-Cote AM, Coulombe Y, Launay H, Cai H, Stasiak AZ, Stasiak A, Xia B & Masson JY (2010) Cooperation of breast cancer proteins PALB2 and piccolo BRCA2 in stimulating homologous recombination. Nat Struct Mol Biol 17(10): 1247–1254.
Bunting SF, Callen E, Kozak ML, Kim JM, Wong N, Lopez-Contreras AJ, Ludwig T, Baer R, Faryabi RB, Malhowski A, Chen HT, Fernandez-Capetillo O, D'Andrea A & Nussenzweig A (2012) BRCA1 functions independently of homologous recombination in DNA interstrand crosslink repair. Mol Cell 46(2): 125–135.
Busino L, Chiesa M, Draetta GF & Donzelli M (2004) Cdc25A phosphatase: combinatorial phosphorylation, ubiquitylation and proteolysis. Oncogene 23(11): 2050–2056.
Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F & Croce CM (2002) Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci USA 99(24): 15524–15529.
Cantor SB, Bell DW, Ganesan S, Kass EM, Drapkin R, Grossman S, Wahrer DC, Sgroi DC, Lane WS, Haber DA & Livingston DM (2001) BACH1, a novel helicase-like protein, interacts directly with BRCA1 and contributes to its DNA repair function. Cell 105(1): 149–160.
Cao AY, Huang J, Hu Z, Li WF, Ma ZL, Tang LL, Zhang B, Su FX, Zhou J, Di GH, Shen KW, Wu J, Lu JS, Luo JM, Yuan WT, Shen ZZ, Huang W & Shao ZM (2009) The prevalence of PALB2 germline mutations in BRCA1/BRCA2 negative Chinese
111
women with early onset breast cancer or affected relatives. Breast Cancer Res Treat 114(3): 457–462.
Casadei S, Norquist BM, Walsh T, Stray S, Mandell JB, Lee MK, Stamatoyannopoulos JA & King MC (2011) Contribution of inherited mutations in the BRCA2-interacting protein PALB2 to familial breast cancer. Cancer Res 71(6): 2222–2229.
Celeste A, Petersen S, Romanienko PJ, Fernandez-Capetillo O, Chen HT, Sedelnikova OA, Reina-San-Martin B, Coppola V, Meffre E, Difilippantonio MJ, Redon C, Pilch DR, Olaru A, Eckhaus M, Camerini-Otero RD, Tessarollo L, Livak F, Manova K, Bonner WM, Nussenzweig MC & Nussenzweig A (2002) Genomic instability in mice lacking histone H2AX. Science. 296(5569): 922–927.
Chanoux RA, Yin B, Urtishak KA, Asare A, Bassing CH & Brown EJ (2009) ATR and H2AX cooperate in maintaining genome stability under replication stress. J Biol Chem 284(9): 5994–6003.
Chen L, Nievera CJ, Lee AY & Wu X (2008) Cell cycle-dependent complex formation of BRCA1.CtIP.MRN is important for DNA double-strand break repair. J Biol Chem 283(12): 7713–7720.
Ciccia A & Elledge SJ (2010) The DNA damage response: making it safe to play with knives. Mol Cell 40(2): 179–204.
Ciccia A, McDonald N & West SC (2008) Structural and functional relationships of the XPF/MUS81 family of proteins. Annu Rev Biochem 77: 259–287.
Cimprich KA & Cortez D (2008) ATR: an essential regulator of genome integrity. Nat Rev Mol Cell Biol 9(8): 616–627.
Clague J, Wilhoite G, Adamson A, Bailis A, Weitzel JN & Neuhausen SL (2011) RAD51C germline mutations in breast and ovarian cancer cases from high-risk families. PLoS One 6(9): e25632.
Claus EB, Schildkraut JM, Thompson WD & Risch NJ (1996) The genetic attributable risk of breast and ovarian cancer. Cancer 77(11): 2318–2324.
Coleman KA & Greenberg RA (2011) The BRCA1-RAP80 complex regulates DNA repair mechanism utilization by restricting end resection. J Biol Chem 286(15): 13669–13680.
Collis SJ, Ciccia A, Deans AJ, Horejsi Z, Martin JS, Maslen SL, Skehel JM, Elledge SJ, West SC & Boulton SJ (2008) FANCM and FAAP24 function in ATR-mediated checkpoint signaling independently of the Fanconi anemia core complex. Mol Cell 32(3): 313–324.
Connor F, Bertwistle D, Mee PJ, Ross GM, Swift S, Grigorieva E, Tybulewicz VL & Ashworth A (1997) Tumorigenesis and a DNA repair defect in mice with a truncating Brca2 mutation. Nat Genet 17(4): 423–430.
Costanzo V (2011) Brca2, Rad51 and Mre11: performing balancing acts on replication forks. DNA Repair (Amst) 10(10): 1060–1065.
Costanzo V, Robertson K, Ying CY, Kim E, Avvedimento E, Gottesman M, Grieco D & Gautier J (2000) Reconstitution of an ATM-dependent checkpoint that inhibits chromosomal DNA replication following DNA damage. Mol Cell 6(3): 649–659.
112
Cox A, Dunning AM, Garcia-Closas M, Balasubramanian S, Reed MW, Pooley KA, Scollen S, Baynes C, Ponder BA, Chanock S, Lissowska J, Brinton L, Peplonska B, Southey MC, Hopper JL, McCredie MR, Giles GG, Fletcher O, Johnson N, dos Santos Silva I, Gibson L, Bojesen SE, Nordestgaard BG, Axelsson CK, Torres D, Hamann U, Justenhoven C, Brauch H, Chang-Claude J, Kropp S, Risch A, Wang-Gohrke S, Schurmann P, Bogdanova N, Dork T, Fagerholm R, Aaltonen K, Blomqvist C, Nevanlinna H, Seal S, Renwick A, Stratton MR, Rahman N, Sangrajrang S, Hughes D, Odefrey F, Brennan P, Spurdle AB, Chenevix-Trench G, Kathleen Cunningham Foundation Consortium for Research into Familial Breast Cancer, Beesley J, Mannermaa A, Hartikainen J, Kataja V, Kosma VM, Couch FJ, Olson JE, Goode EL, Broeks A, Schmidt MK, Hogervorst FB, Van't Veer LJ, Kang D, Yoo KY, Noh DY, Ahn SH, Wedren S, Hall P, Low YL, Liu J, Milne RL, Ribas G, Gonzalez-Neira A, Benitez J, Sigurdson AJ, Stredrick DL, Alexander BH, Struewing JP, Pharoah PD, Easton DF & Breast Cancer Association Consortium (2007) A common coding variant in CASP8 is associated with breast cancer risk. Nat Genet 39(3): 352–358.
Cressman VL, Backlund DC, Avrutskaya AV, Leadon SA, Godfrey V & Koller BH (1999) Growth retardation, DNA repair defects, and lack of spermatogenesis in BRCA1-deficient mice. Mol Cell Biol 19(10): 7061–7075.
Crossan GP & Patel KJ (2012) The Fanconi anaemia pathway orchestrates incisions at sites of crosslinked DNA. J Pathol 226(2): 326–337.
Daboussi F, Courbet S, Benhamou S, Kannouche P, Zdzienicka MZ, Debatisse M & Lopez BS (2008) A homologous recombination defect affects replication-fork progression in mammalian cells. J Cell Sci 121(Pt 2): 162–166.
Dai Y & Grant S (2010) New insights into checkpoint kinase 1 in the DNA damage response signaling network. Clin Cancer Res 16(2): 376–383.
Dansonka-Mieszkowska A, Kluska A, Moes J, Dabrowska M, Nowakowska D, Niwinska A, Derlatka P, Cendrowski K & Kupryjanczyk J (2010) A novel germline PALB2 deletion in Polish breast and ovarian cancer patients. BMC Med Genet 11: 20.
de Groote FH, Jansen JG, Masuda Y, Shah DM, Kamiya K, de Wind N & Siegal G (2011) The Rev1 translesion synthesis polymerase has multiple distinct DNA binding modes. DNA Repair (Amst) 10(9): 915–925.
Deshpande AM & Newlon CS (1996) DNA replication fork pause sites dependent on transcription. Science 272(5264): 1030–1033.
di Masi A & Antoccia A (2008) NBS1 Heterozygosity and Cancer Risk. Curr Genomics 9(4): 275–281.
Ding YC, Steele L, Kuan CJ, Greilac S & Neuhausen SL (2011) Mutations in BRCA2 and PALB2 in male breast cancer cases from the United States. Breast Cancer Res Treat 126(3): 771–778.
Doksani Y, Bermejo R, Fiorani S, Haber JE & Foiani M (2009) Replicon dynamics, dormant origin firing, and terminal fork integrity after double-strand break formation. Cell 137(2): 247–258.
113
Donoho G, Brenneman MA, Cui TX, Donoviel D, Vogel H, Goodwin EH, Chen DJ & Hasty P (2003) Deletion of Brca2 exon 27 causes hypersensitivity to DNA crosslinks, chromosomal instability, and reduced life span in mice. Genes Chromosomes Cancer 36(4): 317–331.
Dorsman JC, Levitus M, Rockx D, Rooimans MA, Oostra AB, Haitjema A, Bakker ST, Steltenpool J, Schuler D, Mohan S, Schindler D, Arwert F, Pals G, Mathew CG, Waisfisz Q, de Winter JP & Joenje H (2007) Identification of the Fanconi anemia complementation group I gene, FANCI. Cell Oncol 29(3): 211–218.
Downey M & Durocher D (2006) gammaH2AX as a checkpoint maintenance signal. Cell Cycle 5(13): 1376–1381.
Downs-Holmes C & Silverman P (2011) Breast cancer: overview & updates. Nurse Pract 36(12): 20–6; quiz 7.
Dray E, Etchin J, Wiese C, Saro D, Williams GJ, Hammel M, Yu X, Galkin VE, Liu D, Tsai MS, Sy SM, Schild D, Egelman E, Chen J & Sung P (2010) Enhancement of RAD51 recombinase activity by the tumor suppressor PALB2. Nat Struct Mol Biol 17(10): 1255–1259.
Dufault MR, Betz B, Wappenschmidt B, Hofmann W, Bandick K, Golla A, Pietschmann A, Nestle-Kramling C, Rhiem K, Huttner C, von Lindern C, Dall P, Kiechle M, Untch M, Jonat W, Meindl A, Scherneck S, Niederacher D, Schmutzler RK & Arnold N (2004) Limited relevance of the CHEK2 gene in hereditary breast cancer. Int J Cancer 110(3): 320–325.
Easton DF (1994) Cancer risks in A-T heterozygotes. Int J Radiat Biol 66(6 Suppl): S177–82.
Easton DF, Bishop DT, Ford D & Crockford GP (1993) Genetic linkage analysis in familial breast and ovarian cancer: results from 214 families. The Breast Cancer Linkage Consortium. Am J Hum Genet 52(4): 678–701.
Easton DF, Pooley KA, Dunning AM, Pharoah PD, Thompson D, Ballinger DG, Struewing JP, Morrison J, Field H, Luben R, Wareham N, Ahmed S, Healey CS, Bowman R, SEARCH collaborators, Meyer KB, Haiman CA, Kolonel LK, Henderson BE, Le Marchand L, Brennan P, Sangrajrang S, Gaborieau V, Odefrey F, Shen CY, Wu PE, Wang HC, Eccles D, Evans DG, Peto J, Fletcher O, Johnson N, Seal S, Stratton MR, Rahman N, Chenevix-Trench G, Bojesen SE, Nordestgaard BG, Axelsson CK, Garcia-Closas M, Brinton L, Chanock S, Lissowska J, Peplonska B, Nevanlinna H, Fagerholm R, Eerola H, Kang D, Yoo KY, Noh DY, Ahn SH, Hunter DJ, Hankinson SE, Cox DG, Hall P, Wedren S, Liu J, Low YL, Bogdanova N, Schurmann P, Dork T, Tollenaar RA, Jacobi CE, Devilee P, Klijn JG, Sigurdson AJ, Doody MM, Alexander BH, Zhang J, Cox A, Brock IW, MacPherson G, Reed MW, Couch FJ, Goode EL, Olson JE, Meijers-Heijboer H, van den Ouweland A, Uitterlinden A, Rivadeneira F, Milne RL, Ribas G, Gonzalez-Neira A, Benitez J, Hopper JL, McCredie M, Southey M, Giles GG, Schroen C, Justenhoven C, Brauch H, Hamann U, Ko YD, Spurdle AB, Beesley J, Chen X, kConFab, AOCS Management Group, Mannermaa A, Kosma VM, Kataja V, Hartikainen J, Day NE, Cox DR &
114
Ponder BA (2007) Genome-wide association study identifies novel breast cancer susceptibility loci. Nature 447(7148): 1087–1093.
Ellsworth RE, Decewicz DJ, Shriver CD & Ellsworth DL (2010) Breast cancer in the personal genomics era. Curr Genomics 11(3): 146–161.
Erkko H, Dowty JG, Nikkilä J, Syrjakoski K, Mannermaa A, Pylkäs K, Southey MC, Holli K, Kallioniemi A, Jukkola-Vuorinen A, Kataja V, Kosma VM, Xia B, Livingston DM, Winqvist R & Hopper JL (2008) Penetrance analysis of the PALB2 c.1592delT founder mutation. Clin Cancer Res 14(14): 4667–4671.
Erkko H, Xia B, Nikkilä J, Schleutker J, Syrjakoski K, Mannermaa A, Kallioniemi A, Pylkäs K, Karppinen SM, Rapakko K, Miron A, Sheng Q, Li G, Mattila H, Bell DW, Haber DA, Grip M, Reiman M, Jukkola-Vuorinen A, Mustonen A, Kere J, Aaltonen LA, Kosma VM, Kataja V, Soini Y, Drapkin RI, Livingston DM & Winqvist R (2007) A recurrent mutation in PALB2 in Finnish cancer families. Nature 446(7133): 316–319.
Esteller M, Fraga MF, Guo M, Garcia-Foncillas J, Hedenfalk I, Godwin AK, Trojan J, Vaurs-Barriere C, Bignon YJ, Ramus S, Benitez J, Caldes T, Akiyama Y, Yuasa Y, Launonen V, Canal MJ, Rodriguez R, Capella G, Peinado MA, Borg A, Aaltonen LA, Ponder BA, Baylin SB & Herman JG (2001) DNA methylation patterns in hereditary human cancers mimic sporadic tumorigenesis. Hum Mol Genet 10(26): 3001–3007.
Esteller M, Silva JM, Dominguez G, Bonilla F, Matias-Guiu X, Lerma E, Bussaglia E, Prat J, Harkes IC, Repasky EA, Gabrielson E, Schutte M, Baylin SB & Herman JG (2000) Promoter hypermethylation and BRCA1 inactivation in sporadic breast and ovarian tumors. J Natl Cancer Inst 92(7): 564–569.
Evans DG, Shenton A, Woodward E, Lalloo F, Howell A & Maher ER (2008) Penetrance estimates for BRCA1 and BRCA2 based on genetic testing in a Clinical Cancer Genetics service setting: risks of breast/ovarian cancer quoted should reflect the cancer burden in the family. BMC Cancer 8: 155.
Evans DG, Susnerwala I, Dawson J, Woodward E, Maher ER & Lalloo F (2010) Risk of breast cancer in male BRCA2 carriers. J.Med.Genet. 47(10): 710- 711.
Evers B & Jonkers J (2006) Mouse models of BRCA1 and BRCA2 deficiency: past lessons, current understanding and future prospects. Oncogene 25(43): 5885–5897.
Falck J, Coates J & Jackson SP (2005) Conserved modes of recruitment of ATM, ATR and DNA-PKcs to sites of DNA damage. Nature 434(7033): 605–611.
Falck J, Mailand N, Syljuasen RG, Bartek J & Lukas J (2001) The ATM-Chk2-Cdc25A checkpoint pathway guards against radioresistant DNA synthesis. Nature 410(6830): 842–847.
Farmer H, McCabe N, Lord CJ, Tutt AN, Johnson DA, Richardson TB, Santarosa M, Dillon KJ, Hickson I, Knights C, Martin NM, Jackson SP, Smith GC & Ashworth A (2005) Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434(7035): 917–921.
Fearon ER (1997) Human cancer syndromes: clues to the origin and nature of cancer. Science 278(5340): 1043–1050.
115
Finnish Cancer Registry (2010) Cancer statistics for Finland. Finnish Cancer Society Publication at http://www.cancer.fi/syoparekisteri/?x52393114=71954169.
Ford D, Easton DF, Stratton M, Narod S, Goldgar D, Devilee P, Bishop DT, Weber B, Lenoir G, Chang-Claude J, Sobol H, Teare MD, Struewing J, Arason A, Scherneck S, Peto J, Rebbeck TR, Tonin P, Neuhausen S, Barkardottir R, Eyfjord J, Lynch H, Ponder BA, Gayther SA & Zelada-Hedman M (1998) Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. The Breast Cancer Linkage Consortium. Am J Hum Genet 62(3): 676–689.
Foulkes WD, Ghadirian P, Akbari MR, Hamel N, Giroux S, Sabbaghian N, Darnel A, Royer R, Poll A, Fafard E, Robidoux A, Martin G, Bismar TA, Tischkowitz M, Rousseau F & Narod SA (2007) Identification of a novel truncating PALB2 mutation and analysis of its contribution to early-onset breast cancer in French-Canadian women. Breast Cancer Res 9(6): R83.
Frank-Vaillant M & Marcand S (2002) Transient stability of DNA ends allows nonhomologous end joining to precede homologous recombination. Mol Cell 10(5): 1189–1199.
Friedberg EC (2003) DNA damage and repair. Nature 421(6921): 436–440. Friedel AM, Pike BL & Gasser SM (2009) ATR/Mec1: coordinating fork stability and
repair. Curr Opin Cell Biol 21(2): 237–244. Friedman LS, Thistlethwaite FC, Patel KJ, Yu VP, Lee H, Venkitaraman AR, Abel KJ,
Carlton MB, Hunter SM, Colledge WH, Evans MJ & Ponder BA (1998) Thymic lymphomas in mice with a truncating mutation in Brca2. Cancer Res 58(7): 1338–1343.
Garber JE, Goldstein AM, Kantor AF, Dreyfus MG, Fraumeni JF,Jr & Li FP (1991) Follow-up study of twenty-four families with Li-Fraumeni syndrome. Cancer Res 51(22): 6094–6097.
Garcia MJ & Benitez J (2008) The Fanconi anaemia/BRCA pathway and cancer susceptibility. Searching for new therapeutic targets. Clin Transl Oncol 10(2): 78–84.
Garcia MJ, Fernandez V, Osorio A, Barroso A, Llort G, Lazaro C, Blanco I, Caldes T, de la Hoya M, Ramon Y Cajal T, Alonso C, Tejada MI, San Roman C, Robles-Diaz L, Urioste M & Benitez J (2009) Analysis of FANCB and FANCN/PALB2 fanconi anemia genes in BRCA1/2-negative Spanish breast cancer families. Breast Cancer Res Treat 113(3): 545–551.
Garcia-Higuera I, Kuang Y, Denham J & D'Andrea AD (2000) The fanconi anemia proteins FANCA and FANCG stabilize each other and promote the nuclear accumulation of the Fanconi anemia complex. Blood 96(9): 3224–3230.
Gayther SA, Mangion J, Russell P, Seal S, Barfoot R, Ponder BA, Stratton MR & Easton D (1997) Variation of risks of breast and ovarian cancer associated with different germline mutations of the BRCA2 gene. Nat Genet 15(1): 103–105.
Gilad O, Nabet BY, Ragland RL, Schoppy DW, Smith KD, Durham AC & Brown EJ (2010) Combining ATR suppression with oncogenic Ras synergistically increases genomic instability, causing synthetic lethality or tumorigenesis in a dosage-dependent manner. Cancer Res 70(23): 9693–9702.
116
Gong Z, Kim JE, Leung CC, Glover JN & Chen J (2010) BACH1/FANCJ acts with TopBP1 and participates early in DNA replication checkpoint control. Mol Cell 37(3): 438–446.
Gort M, Broekhuis M, Otter R & Klazinga NS (2007) Improvement of best practice in early breast cancer: actionable surgeon and hospital factors. Breast Cancer Res Treat 102(2): 219–226.
Gottlieb TM & Jackson SP (1993) The DNA-dependent protein kinase: requirement for DNA ends and association with Ku antigen. Cell 72(1): 131–142.
Gowen LC, Johnson BL, Latour AM, Sulik KK & Koller BH (1996) Brca1 deficiency results in early embryonic lethality characterized by neuroepithelial abnormalities. Nat Genet 12(2): 191–194.
Greenblatt MS, Chappuis PO, Bond JP, Hamel N & Foulkes WD (2001) TP53 mutations in breast cancer associated with BRCA1 or BRCA2 germ-line mutations: distinctive spectrum and structural distribution. Cancer Res 61(10): 4092–4097.
Griffin CS & Thacker J (2004) The role of homologous recombination repair in the formation of chromosome aberrations. Cytogenet Genome Res 104(1–4): 21–27.
Guilford P, Hopkins J, Harraway J, McLeod M, McLeod N, Harawira P, Taite H, Scoular R, Miller A & Reeve AE (1998) E-cadherin germline mutations in familial gastric cancer. Nature 392(6674): 402–405.
Hakem R, de la Pompa JL, Elia A, Potter J & Mak TW (1997) Partial rescue of Brca1 (5–6) early embryonic lethality by p53 or p21 null mutation. Nat Genet 16(3): 298–302.
Hakem R, de la Pompa JL, Sirard C, Mo R, Woo M, Hakem A, Wakeham A, Potter J, Reitmair A, Billia F, Firpo E, Hui CC, Roberts J, Rossant J & Mak TW (1996) The tumor suppressor gene Brca1 is required for embryonic cellular proliferation in the mouse. Cell 85(7): 1009–1023.
Halazonetis TD, Gorgoulis VG & Bartek J (2008) An oncogene-induced DNA damage model for cancer development. Science 319(5868): 1352–1355.
Hall JM, Lee MK, Newman B, Morrow JE, Anderson LA, Huey B & King MC (1990) Linkage of early-onset familial breast cancer to chromosome 17q21. Science 250(4988): 1684–1689.
Hamajima N, Hirose K, Tajima K, Rohan T, Calle EE, Heath CW,Jr, Coates RJ, Liff JM, Talamini R, Chantarakul N, Koetsawang S, Rachawat D, Morabia A, Schuman L, Stewart W, Szklo M, Bain C, Schofield F, Siskind V, Band P, Coldman AJ, Gallagher RP, Hislop TG, Yang P, Kolonel LM, Nomura AM, Hu J, Johnson KC, Mao Y, De Sanjose S, Lee N, Marchbanks P, Ory HW, Peterson HB, Wilson HG, Wingo PA, Ebeling K, Kunde D, Nishan P, Hopper JL, Colditz G, Gajalanski V, Martin N, Pardthaisong T, Silpisornkosol S, Theetranont C, Boosiri B, Chutivongse S, Jimakorn P, Virutamasen P, Wongsrichanalai C, Ewertz M, Adami HO, Bergkvist L, Magnusson C, Persson I, Chang-Claude J, Paul C, Skegg DC, Spears GF, Boyle P, Evstifeeva T, Daling JR, Hutchinson WB, Malone K, Noonan EA, Stanford JL, Thomas DB, Weiss NS, White E, Andrieu N, Bremond A, Clavel F, Gairard B, Lansac J, Piana L, Renaud R, Izquierdo A, Viladiu P, Cuevas HR, Ontiveros P, Palet A, Salazar SB, Aristizabel N, Cuadros A, Tryggvadottir L, Tulinius H, Bachelot A, Le
117
MG, Peto J, Franceschi S, Lubin F, Modan B, Ron E, Wax Y, Friedman GD, Hiatt RA, Levi F, Bishop T, Kosmelj K, Primic-Zakelj M, Ravnihar B, Stare J, Beeson WL, Fraser G, Bullbrook RD, Cuzick J, Duffy SW, Fentiman IS, Hayward JL, Wang DY, McMichael AJ, McPherson K, Hanson RL, Leske MC, Mahoney MC, Nasca PC, Varma AO, Weinstein AL, Moller TR, Olsson H, Ranstam J, Goldbohm RA, van den Brandt PA, Apelo RA, Baens J, de la Cruz JR, Javier B, Lacaya LB, Ngelangel CA, La Vecchia C, Negri E, Marubini E, Ferraroni M, Gerber M, Richardson S, Segala C, Gatei D, Kenya P, Kungu A, Mati JG, Brinton LA, Hoover R, Schairer C, Spirtas R, Lee HP, Rookus MA, van Leeuwen FE, Schoenberg JA, McCredie M, Gammon MD, Clarke EA, Jones L, Neil A, Vessey M, Yeates D, Appleby P, Banks E, Beral V, Bull D, Crossley B, Goodill A, Green J, Hermon C, Key T, Langston N, Lewis C, Reeves G, Collins R, Doll R, Peto R, Mabuchi K, Preston D, Hannaford P, Kay C, Rosero-Bixby L, Gao YT, Jin F, Yuan JM, Wei HY, Yun T, Zhiheng C, Berry G, Cooper Booth J, Jelihovsky T, MacLennan R, Shearman R, Wang QS, Baines CJ, Miller AB, Wall C, Lund E, Stalsberg H, Shu XO, Zheng W, Katsouyanni K, Trichopoulou A, Trichopoulos D, Dabancens A, Martinez L, Molina R, Salas O, Alexander FE, Anderson K, Folsom AR, Hulka BS, Bernstein L, Enger S, Haile RW, Paganini-Hill A, Pike MC, Ross RK, Ursin G, Yu MC, Longnecker MP, Newcomb P, Bergkvist L, Kalache A, Farley TM, Holck S, Meirik O & Collaborative Group on Hormonal Factors in Breast Cancer (2002) Alcohol, tobacco and breast cancer--collaborative reanalysis of individual data from 53 epidemiological studies, including 58,515 women with breast cancer and 95,067 women without the disease. Br J Cancer 87(11): 1234–1245.
Hamel N, Feng BJ, Foretova L, Stoppa-Lyonnet D, Narod SA, Imyanitov E, Sinilnikova O, Tihomirova L, Lubinski J, Gronwald J, Gorski B, Hansen TO, Nielsen FC, Thomassen M, Yannoukakos D, Konstantopoulou I, Zajac V, Ciernikova S, Couch FJ, Greenwood CM, Goldgar DE & Foulkes WD (2011) On the origin and diffusion of BRCA1 c.5266dupC (5382insC) in European populations. Eur J Hum Genet 19(3): 300–306.
Hanahan D & Weinberg RA (2011) Hallmarks of cancer: the next generation. Cell 144(5): 646–674.
Hashimoto Y, Ray Chaudhuri A, Lopes M & Costanzo V (2010) Rad51 protects nascent DNA from Mre11-dependent degradation and promotes continuous DNA synthesis. Nat Struct Mol Biol 17(11): 1305–1311.
Hayakawa T, Zhang F, Hayakawa N, Ohtani Y, Shinmyozu K, Nakayama J & Andreassen PR (2010) MRG15 binds directly to PALB2 and stimulates homology-directed repair of chromosomal breaks. J Cell Sci 123(Pt 7): 1124–1130.
Hedenfalk I, Ringner M, Ben-Dor A, Yakhini Z, Chen Y, Chebil G, Ach R, Loman N, Olsson H, Meltzer P, Borg A & Trent J (2003) Molecular classification of familial non-BRCA1/BRCA2 breast cancer. Proc Natl Acad Sci USA 100(5): 2532–2537.
Heikkinen K, Karppinen SM, Soini Y, Makinen M & Winqvist R (2003) Mutation screening of Mre11 complex genes: indication of RAD50 involvement in breast and ovarian cancer susceptibility. J Med Genet 40(12): e131.
118
Heikkinen K, Rapakko K, Karppinen SM, Erkko H, Knuutila S, Lundan T, Mannermaa A, Borresen-Dale AL, Borg A, Barkardottir RB, Petrini J & Winqvist R (2006) RAD50 and NBS1 are breast cancer susceptibility genes associated with genomic instability. Carcinogenesis 27(8): 1593–1599.
Heikkinen K, Rapakko K, Karppinen SM, Erkko H, Nieminen P & Winqvist R (2005) Association of common ATM polymorphism with bilateral breast cancer. Int J Cancer 116(1): 69–72.
Hellebrand H, Sutter C, Honisch E, Gross E, Wappenschmidt B, Schem C, Deissler H, Ditsch N, Gress V, Kiechle M, Bartram CR, Schmutzler RK, Niederacher D, Arnold N & Meindl A (2011) Germline mutations in the PALB2 gene are population specific and occur with low frequencies in familial breast cancer. Hum Mutat 32(6): E2176–88.
Hemminki A, Markie D, Tomlinson I, Avizienyte E, Roth S, Loukola A, Bignell G, Warren W, Aminoff M, Hoglund P, Jarvinen H, Kristo P, Pelin K, Ridanpaa M, Salovaara R, Toro T, Bodmer W, Olschwang S, Olsen AS, Stratton MR, de la Chapelle A & Aaltonen LA (1998) A serine/threonine kinase gene defective in Peutz-Jeghers syndrome. Nature 391(6663): 184–187.
Hemminki A, Tomlinson I, Markie D, Jarvinen H, Sistonen P, Bjorkqvist AM, Knuutila S, Salovaara R, Bodmer W, Shibata D, de la Chapelle A & Aaltonen LA (1997) Localization of a susceptibility locus for Peutz-Jeghers syndrome to 19p using comparative genomic hybridization and targeted linkage analysis. Nat Genet 15(1): 87–90.
Ho GP, Margossian S, Taniguchi T & D'Andrea AD (2006) Phosphorylation of FANCD2 on two novel sites is required for mitomycin C resistance. Mol Cell Biol 26(18): 7005–7015.
Hoeijmakers JH (2001) Genome maintenance mechanisms for preventing cancer. Nature 411(6835): 366–374.
Hofstatter EW, Domchek SM, Miron A, Garber J, Wang M, Componeschi K, Boghossian L, Miron PL, Nathanson KL & Tung N (2011) PALB2 mutations in familial breast and pancreatic cancer. Fam Cancer 10(2): 225–231.
Hogervorst FB, Nederlof PM, Gille JJ, McElgunn CJ, Grippeling M, Pruntel R, Regnerus R, van Welsem T, van Spaendonk R, Menko FH, Kluijt I, Dommering C, Verhoef S, Schouten JP, van't Veer LJ & Pals G (2003) Large genomic deletions and duplications in the BRCA1 gene identified by a novel quantitative method. Cancer Res 63(7): 1449–1453.
Hohenstein P, Kielman MF, Breukel C, Bennett LM, Wiseman R, Krimpenfort P, Cornelisse C, van Ommen GJ, Devilee P & Fodde R (2001) A targeted mouse Brca1 mutation removing the last BRCT repeat results in apoptosis and embryonic lethality at the headfold stage. Oncogene 20(20): 2544–2550.
Hollestelle A, Wasielewski M, Martens J & Schutte M (2010) Discovering moderate-risk breast cancer susceptibility genes. Curr Opin Genet Dev 20(3): 268–276.
Holstege H, Joosse SA, van Oostrom CT, Nederlof PM, de Vries A & Jonkers J (2009) High incidence of protein-truncating TP53 mutations in BRCA1-related breast cancer. Cancer Res 69(8): 3625–3633.
119
Howlett NG, Taniguchi T, Olson S, Cox B, Waisfisz Q, De Die-Smulders C, Persky N, Grompe M, Joenje H, Pals G, Ikeda H, Fox EA & D'Andrea AD (2002) Biallelic inactivation of BRCA2 in Fanconi anemia. Science 297(5581): 606–609.
Hu X, Paul A & Wang B (2012) Rap80 Protein Recruitment to DNA Double-strand Breaks Requires Binding to Both Small Ubiquitin-like Modifier (SUMO) and Ubiquitin Conjugates. J Biol Chem 287(30): 25510–25519.
Hu Y, Scully R, Sobhian B, Xie A, Shestakova E & Livingston DM (2011) RAP80-directed tuning of BRCA1 homologous recombination function at ionizing radiation-induced nuclear foci. Genes Dev 25(7): 685–700.
Huertas P (2010) DNA resection in eukaryotes: deciding how to fix the break. Nat Struct Mol Biol 17(1): 11–16.
Hussain S, Wilson JB, Medhurst AL, Hejna J, Witt E, Ananth S, Davies A, Masson JY, Moses R, West SC, de Winter JP, Ashworth A, Jones NJ & Mathew CG (2004) Direct interaction of FANCD2 with BRCA2 in DNA damage response pathways. Hum Mol Genet 13(12): 1241–1248.
Huusko P, Castren K, Launonen V, Soini Y, Paakkonen K, Leisti J, Vahakangas K & Winqvist R (1999) Germ-line TP53 mutations in Finnish cancer families exhibiting features of the Li-Fraumeni syndrome and negative for BRCA1 and BRCA2. Cancer Genet Cytogenet 112(1): 9–14.
Huusko P, Paakkonen K, Launonen V, Poyhonen M, Blanco G, Kauppila A, Puistola U, Kiviniemi H, Kujala M, Leisti J & Winqvist R (1998) Evidence of founder mutations in Finnish BRCA1 and BRCA2 families. Am J Hum Genet 62(6): 1544–1548.
International Schizophrenia Consortium (2008) Rare chromosomal deletions and duplications increase risk of schizophrenia. Nature 455(7210): 237–241.
Ishiai M, Kitao H, Smogorzewska A, Tomida J, Kinomura A, Uchida E, Saberi A, Kinoshita E, Kinoshita-Kikuta E, Koike T, Tashiro S, Elledge SJ & Takata M (2008) FANCI phosphorylation functions as a molecular switch to turn on the Fanconi anemia pathway. Nat Struct Mol Biol 15(11): 1138–1146.
Jackson SP & Bartek J (2009) The DNA-damage response in human biology and disease. Nature 461(7267): 1071–1078.
Jazayeri A, Falck J, Lukas C, Bartek J, Smith GC, Lukas J & Jackson SP (2006) ATM- and cell cycle-dependent regulation of ATR in response to DNA double-strand breaks. Nat Cell Biol 8(1): 37–45.
Jenne DE, Reimann H, Nezu J, Friedel W, Loff S, Jeschke R, Muller O, Back W & Zimmer M (1998) Peutz-Jeghers syndrome is caused by mutations in a novel serine threonine kinase. Nat Genet 18(1): 38–43.
Johannesdottir G, Gudmundsson J, Bergthorsson JT, Arason A, Agnarsson BA, Eiriksdottir G, Johannsson OT, Borg A, Ingvarsson S, Easton DF, Egilsson V & Barkardottir RB (1996) High prevalence of the 999del5 mutation in icelandic breast and ovarian cancer patients. Cancer Res. 56(16): 3663–3665.
Jones RM & Petermann E (2012) Replication fork dynamics and the DNA damage response. Biochem J 443(1): 13–26.
120
Jones S, Hruban RH, Kamiyama M, Borges M, Zhang X, Parsons DW, Lin JC, Palmisano E, Brune K, Jaffee EM, Iacobuzio-Donahue CA, Maitra A, Parmigiani G, Kern SE, Velculescu VE, Kinzler KW, Vogelstein B, Eshleman JR, Goggins M & Klein AP (2009) Exomic sequencing identifies PALB2 as a pancreatic cancer susceptibility gene. Science 324(5924): 217.
Jovanovic J, Rønneberg JA, Tost J & Kristensen V (2010) The epigenetics of breast cancer. Mol Oncol. 4(3):242–254.
Karppinen S (2009) The role of BACH1, BARD1 and TOPBP1 genes in familial breast cancer. Oulu, University of Oulu.
Kato M, Yano K, Matsuo F, Saito H, Katagiri T, Kurumizaka H, Yoshimoto M, Kasumi F, Akiyama F, Sakamoto G, Nagawa H, Nakamura Y & Miki Y (2000) Identification of Rad51 alteration in patients with bilateral breast cancer. J Hum Genet 45(3): 133–137.
Keller G, Vogelsang H, Becker I, Hutter J, Ott K, Candidus S, Grundei T, Becker KF, Mueller J, Siewert JR & Hofler H (1999) Diffuse type gastric and lobular breast carcinoma in a familial gastric cancer patient with an E-cadherin germline mutation. Am J Pathol 155(2): 337–342.
Kemp MG, Akan Z, Yilmaz S, Grillo M, Smith-Roe SL, Kang TH, Cordeiro-Stone M, Kaufmann WK, Abraham RT, Sancar A & Unsal-Kacmaz K (2010) Tipin-replication protein A interaction mediates Chk1 phosphorylation by ATR in response to genotoxic stress. J Biol Chem 285(22): 16562–16571.
Kennedy RD & D'Andrea AD (2005) The Fanconi Anemia/BRCA pathway: new faces in the crowd. Genes Dev 19(24): 2925–2940.
Kim H, Chen J & Yu X (2007a) Ubiquitin-binding protein RAP80 mediates BRCA1-dependent DNA damage response. Science 316(5828): 1202–1205.
Kim H & D'Andrea AD (2012) Regulation of DNA cross-link repair by the Fanconi anemia/BRCA pathway. Genes Dev 26(13): 1393–1408.
Kim H, Huang J & Chen J (2007b) CCDC98 is a BRCA1-BRCT domain-binding protein involved in the DNA damage response. Nat Struct Mol Biol 14(8): 710–715.
Kim H, Yang K, Dejsuphong D & D'Andrea AD (2012) Regulation of Rev1 by the Fanconi anemia core complex. Nat Struct Mol Biol 19(2): 164–170.
Kim JM, Parmar K, Huang M, Weinstock DM, Ruit CA, Kutok JL & D'Andrea AD (2009) Inactivation of murine Usp1 results in genomic instability and a Fanconi anemia phenotype. Dev Cell 16(2): 314–320.
King MC, Marks JH, Mandell JB & New York Breast Cancer Study Group (2003) Breast and ovarian cancer risks due to inherited mutations in BRCA1 and BRCA2. Science 302(5645): 643–646.
Knudson AG Jr (1971) Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci USA 68(4): 820–823.
Kolomietz E, Meyn MS, Pandita A & Squire JA (2002) The role of Alu repeat clusters as mediators of recurrent chromosomal aberrations in tumors. Genes Chromosomes Cancer 35(2): 97–112.
Konishi H, Mohseni M, Tamaki A, Garay JP, Croessmann S, Karnan S, Ota A, Wong HY, Konishi Y, Karakas B, Tahir K, Abukhdeir AM, Gustin JP, Cidado J, Wang GM,
121
Cosgrove D, Cochran R, Jelovac D, Higgins MJ, Arena S, Hawkins L, Lauring J, Gross AL, Heaphy CM, Hosokawa Y, Gabrielson E, Meeker AK, Visvanathan K, Argani P, Bachman KE & Park BH (2011) Mutation of a single allele of the cancer susceptibility gene BRCA1 leads to genomic instability in human breast epithelial cells. Proc Natl Acad Sci USA. 108(43): 17773–17778.
Koonin EV, Altschul SF & Bork P (1996) BRCA1 protein products ... Functional motifs.. Nat Genet 13(3): 266–268.
Koorstra JB, Hustinx SR, Offerhaus GJ & Maitra A (2008) Pancreatic carcinogenesis. Pancreatology 8(2): 110–125.
Kratz K, Schopf B, Kaden S, Sendoel A, Eberhard R, Lademann C, Cannavo E, Sartori AA, Hengartner MO & Jiricny J (2010) Deficiency of FANCD2-associated nuclease KIAA1018/FAN1 sensitizes cells to interstrand crosslinking agents. Cell 142(1): 77–88.
Krepischi AC, Achatz MI, Santos EM, Costa SS, Lisboa BC, Brentani H, Santos TM, Goncalves A, Nobrega AF, Pearson PL, Vianna-Morgante AM, Carraro DM, Brentani RR & Rosenberg C (2012) Germline DNA copy number variation in familial and early-onset breast cancer. Breast Cancer Res 14(1): R24.
Kumaraswamy E & Shiekhattar R (2007) Activation of BRCA1/BRCA2-associated helicase BACH1 is required for timely progression through S phase. Mol Cell Biol 27(19): 6733–6741.
Lakhani SR, Jacquemier J, Sloane JP, Gusterson BA, Anderson TJ, van de Vijver MJ, Farid LM, Venter D, Antoniou A, Storfer-Isser A, Smyth E, Steel CM, Haites N, Scott RJ, Goldgar D, Neuhausen S, Daly PA, Ormiston W, McManus R, Scherneck S, Ponder BA, Ford D, Peto J, Stoppa-Lyonnet D, Bignon YJ, Struewing JP, Spurr NK, Bishop DT, Klijn JG, Devilee P, Cornelisse CJ, Lasset C, Lenoir G, Barkardottir RB, Egilsson V, Hamann U, Chang-Claude J, Sobol H, Weber B, Stratton MR & Easton DF (1998) Multifactorial analysis of differences between sporadic breast cancers and cancers involving BRCA1 and BRCA2 mutations. J Natl Cancer Inst 90(15): 1138–1145.
Lakhani SR, Reis-Filho JS, Fulford L, Penault-Llorca F, van der Vijver M, Parry S, Bishop T, Benitez J, Rivas C, Bignon YJ, Chang-Claude J, Hamann U, Cornelisse CJ, Devilee P, Beckmann MW, Nestle-Kramling C, Daly PA, Haites N, Varley J, Lalloo F, Evans G, Maugard C, Meijers-Heijboer H, Klijn JG, Olah E, Gusterson BA, Pilotti S, Radice P, Scherneck S, Sobol H, Jacquemier J, Wagner T, Peto J, Stratton MR, McGuffog L, Easton DF & Breast Cancer Linkage Consortium (2005) Prediction of BRCA1 status in patients with breast cancer using estrogen receptor and basal phenotype. Clin Cancer Res 11(14): 5175–5180.
Lalloo F & Evans D (2012) Familial breast cancer. Clin Genet . Lalloo F, Varley J, Ellis D, Moran A, O'Dair L, Pharoah P, Evans DG & Early Onset
Breast Cancer Study Group (2003) Prediction of pathogenic mutations in patients with early-onset breast cancer by family history. Lancet 361(9363): 1101–1102.
Lange SS, Takata K & Wood RD (2011) DNA polymerases and cancer. Nat Rev Cancer 11(2): 96–110.
122
Langerak P & Russell P (2011) Regulatory networks integrating cell cycle control with DNA damage checkpoints and double-strand break repair. Philos Trans R Soc Lond B Biol Sci 366(1584): 3562–3571.
Latif A, Hadfield KD, Roberts SA, Shenton A, Lalloo F, Black GC, Howell A, Evans DG & Newman WG (2010) Breast cancer susceptibility variants alter risks in familial disease. J Med Genet 47(2): 126–131.
Levitus M, Waisfisz Q, Godthelp BC, de Vries Y, Hussain S, Wiegant WW, Elghalbzouri-Maghrani E, Steltenpool J, Rooimans MA, Pals G, Arwert F, Mathew CG, Zdzienicka MZ, Hiom K, De Winter JP & Joenje H (2005) The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J. Nat Genet 37(9): 934–935.
Levran O, Attwooll C, Henry RT, Milton KL, Neveling K, Rio P, Batish SD, Kalb R, Velleuer E, Barral S, Ott J, Petrini J, Schindler D, Hanenberg H & Auerbach AD (2005) The BRCA1-interacting helicase BRIP1 is deficient in Fanconi anemia. Nat Genet 37(9): 931–933.
Levy-Lahad E (2010) Fanconi anemia and breast cancer susceptibility meet again. Nat Genet 42(5): 368–369.
Li CI, Anderson BO, Daling JR & Moe RE (2003) Trends in incidence rates of invasive lobular and ductal breast carcinoma. JAMA 289(11): 1421–1424.
Li CI, Uribe DJ & Daling JR (2005) Clinical characteristics of different histologic types of breast cancer. Br J Cancer 93(9): 1046–1052.
Li Y, Gu WJ & Liu HL (2012) Induction of Pancreatic Cancer Cell Apoptosis and Enhancement of Gemcitabine Sensitivity by RAP80 siRNA. Dig Dis Sci 57(8): 2072–2078.
Lichtenstein P, Holm NV, Verkasalo PK, Iliadou A, Kaprio J, Koskenvuo M, Pukkala E, Skytthe A & Hemminki K (2000) Environmental and heritable factors in the causation of cancer--analyses of cohorts of twins from Sweden, Denmark, and Finland. N Engl J Med 343(2): 78–85.
Lieber MR & Wilson TE (2010) SnapShot: Nonhomologous DNA end joining (NHEJ). Cell 142(3): 496–496.e1.
Lindahl T & Wood RD (1999) Quality control by DNA repair. Science 286(5446): 1897–1905.
Litman R, Peng M, Jin Z, Zhang F, Zhang J, Powell S, Andreassen PR & Cantor SB (2005) BACH1 is critical for homologous recombination and appears to be the Fanconi anemia gene product FANCJ. Cancer Cell 8(3): 255–265.
Little RD, Platt TH & Schildkraut CL (1993) Initiation and termination of DNA replication in human rRNA genes. Mol Cell Biol 13(10): 6600–6613.
Liu CY, Flesken-Nikitin A, Li S, Zeng Y & Lee WH (1996) Inactivation of the mouse Brca1 gene leads to failure in the morphogenesis of the egg cylinder in early postimplantation development. Genes Dev 10(14): 1835–1843.
Liu T, Ghosal G, Yuan J, Chen J & Huang J (2010) FAN1 acts with FANCI-FANCD2 to promote DNA interstrand cross-link repair. Science 329(5992): 693–696.
Liu Z, Wu J & Yu X (2007) CCDC98 targets BRCA1 to DNA damage sites. Nat Struct Mol Biol 14(8): 716–720.
123
Llorente B, Smith CE & Symington LS (2008) Break-induced replication: what is it and what is it for? Cell Cycle 7(7): 859–864.
Lobachev KS, Rattray A & Narayanan V (2007) Hairpin- and cruciform-mediated chromosome breakage: causes and consequences in eukaryotic cells. Front Biosci 12: 4208–4220.
Loeb LA (2011) Human cancers express mutator phenotypes: origin, consequences and targeting. Nat Rev Cancer 11(6): 450–457.
Longhese MP, Bonetti D, Manfrini N & Clerici M (2010) Mechanisms and regulation of DNA end resection. EMBO J 29(17): 2864–2874.
Longy M & Lacombe D (1996) Cowden disease. Report of a family and review. Ann Genet 39: 35–42.
Lou Z, Minter-Dykhouse K, Franco S, Gostissa M, Rivera MA, Celeste A, Manis JP, van Deursen J, Nussenzweig A, Paull TT, Alt FW & Chen J (2006) MDC1 maintains genomic stability by participating in the amplification of ATM-dependent DNA damage signals. Mol.Cell 21(2): 187–200.
Loveday C, Turnbull C, Ruark E, Xicola RM, Ramsay E, Hughes D, Warren-Perry M, Snape K, Breast Cancer Susceptibility Collaboration (UK), Eccles D, Evans DG, Gore M, Renwick A, Seal S, Antoniou AC & Rahman N (2012) Germline RAD51C mutations confer susceptibility to ovarian cancer. Nat Genet 44(5): 475–476.
Lowe SW, Bodis S, McClatchey A, Remington L, Ruley HE, Fisher DE, Housman DE & Jacks T (1994) P53 Status and the Efficacy of Cancer Therapy in Vivo. Science 266(5186): 807–810.
Ludwig T, Chapman DL, Papaioannou VE & Efstratiadis A (1997) Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes Dev 11(10): 1226–1241.
Ludwig T, Fisher P, Ganesan S & Efstratiadis A (2001) Tumorigenesis in mice carrying a truncating Brca1 mutation. Genes Dev 15(10): 1188–1193.
Lujambio A & Lowe SW (2012) The microcosmos of cancer. Nature 482(7385): 347–355. Lundin C, Erixon K, Arnaudeau C, Schultz N, Jenssen D, Meuth M & Helleday T (2002)
Different roles for nonhomologous end joining and homologous recombination following replication arrest in mammalian cells. Mol Cell Biol 22(16): 5869–5878.
Luo J, Margolis KL, Wactawski-Wende J, Horn K, Messina C, Stefanick ML, Tindle HA, Tong E & Rohan TE (2011) Association of active and passive smoking with risk of breast cancer among postmenopausal women: a prospective cohort study. BMJ 342: d1016.
Ma J, Cai H, Wu T, Sobhian B, Huo Y, Alcivar A, Mehta M, Cheung KL, Ganesan S, Kong AN, Zhang DD & Xia B (2012) PALB2 interacts with KEAP1 to promote NRF2 nuclear accumulation and function. Mol Cell Biol 32(8): 1506–1517.
MacKay C, Declais AC, Lundin C, Agostinho A, Deans AJ, MacArtney TJ, Hofmann K, Gartner A, West SC, Helleday T, Lilley DM & Rouse J (2010) Identification of KIAA1018/FAN1, a DNA repair nuclease recruited to DNA damage by monoubiquitinated FANCD2. Cell 142(1): 65–76.
124
Malkin D (1994) Germline p53 mutations and heritable cancer. Annu Rev Genet 28: 443–465.
Malkin D, Li FP, Strong LC, Fraumeni JF,Jr, Nelson CE, Kim DH, Kassel J, Gryka MA, Bischoff FZ & Tainsky MA (1990) Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 250(4985): 1233–1238.
Masciari S, Larsson N, Senz J, Boyd N, Kaurah P, Kandel MJ, Harris LN, Pinheiro HC, Troussard A, Miron P, Tung N, Oliveira C, Collins L, Schnitt S, Garber JE & Huntsman D (2007) Germline E-cadherin mutations in familial lobular breast cancer. J Med Genet 44(11): 726–731.
Masson JY, Tarsounas MC, Stasiak AZ, Stasiak A, Shah R, McIlwraith MJ, Benson FE & West SC (2001) Identification and purification of two distinct complexes containing the five RAD51 paralogs. Genes Dev. 15: 3296–3307.
Mathew CG (2006) Fanconi anaemia genes and susceptibility to cancer. Oncogene 25(43): 5875–5884.
Mavaddat N, Antoniou AC, Easton DF & Garcia-Closas M (2010a) Genetic susceptibility to breast cancer. Mol Oncol 4(3): 174–191.
Mavaddat N, Pharoah PD, Blows F, Driver KE, Provenzano E, Thompson D, Macinnis RJ, Shah M, SEARCH Team, Easton DF & Antoniou AC (2010b) Familial relative risks for breast cancer by pathological subtype: a population-based cohort study. Breast Cancer Res 12(1): R10.
Maya-Mendoza A, Petermann E, Gillespie DA, Caldecott KW & Jackson DA (2007) Chk1 regulates the density of active replication origins during the vertebrate S phase. EMBO J 26(11): 2719–2731.
McClellan J & King MC (2010) Genetic heterogeneity in human disease. Cell 141(2): 210–217.
Meijers-Heijboer H, van den Ouweland A, Klijn J, Wasielewski M, de Snoo A, Oldenburg R, Hollestelle A, Houben M, Crepin E, van Veghel-Plandsoen M, Elstrodt F, van Duijn C, Bartels C, Meijers C, Schutte M, McGuffog L, Thompson D, Easton D, Sodha N, Seal S, Barfoot R, Mangion J, Chang-Claude J, Eccles D, Eeles R, Evans DG, Houlston R, Murday V, Narod S, Peretz T, Peto J, Phelan C, Zhang HX, Szabo C, Devilee P, Goldgar D, Futreal PA, Nathanson KL, Weber B, Rahman N, Stratton MR & CHEK2-Breast Cancer Consortium (2002) Low-penetrance susceptibility to breast cancer due to CHEK2(*)1100delC in noncarriers of BRCA1 or BRCA2 mutations. Nat Genet 31(1): 55–59.
Meindl A, Hellebrand H, Wiek C, Erven V, Wappenschmidt B, Niederacher D, Freund M, Lichtner P, Hartmann L, Schaal H, Ramser J, Honisch E, Kubisch C, Wichmann H, Kast K, Deissler H, Engel C, Müller-Myhsok B, Neveling K, Kiechle M, Mathew C, Schindler D, Schmutzler R & Hanenberg H (2010) Germline mutations in breast and ovarian cancer pedigrees establish RAD51C as a human cancer susceptibility gene. Nat Genet 42(5): 410–414.
Menzel T, Nahse-Kumpf V, Kousholt AN, Klein DK, Lund-Andersen C, Lees M, Johansen JV, Syljuasen RG & Sorensen CS (2011) A genetic screen identifies
125
BRCA2 and PALB2 as key regulators of G2 checkpoint maintenance. EMBO Rep 12(7): 705–712.
Michalak EM & Jonkers J (2011) Studying therapy response and resistance in mouse models for BRCA1-deficient breast cancer. J Mammary Gland Biol Neoplasia 16(1): 41–50.
Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, Liu Q, Cochran C, Bennett LM & Ding W (1994) A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 266(5182): 66–71.
Mimitou EP & Symington LS (2009) Nucleases and helicases take center stage in homologous recombination. Trends Biochem Sci 34(5): 264–272.
Mirzoeva OK & Petrini JH (2001) DNA damage-dependent nuclear dynamics of the Mre11 complex. Mol Cell Biol 21(1): 281–288.
Modrich P & Lahue R (1996) Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu Rev Biochem 65: 101–133.
Moldovan GL, Pfander B & Jentsch S (2007) PCNA, the maestro of the replication fork. Cell 129(4): 665–679.
Montes de Oca R, Andreassen PR, Margossian SP, Gregory RC, Taniguchi T, Wang X, Houghtaling S, Grompe M & D'Andrea AD (2005) Regulated interaction of the Fanconi anemia protein, FANCD2, with chromatin. Blood 105(3): 1003–1009.
Morimatsu M, Donoho G & Hasty P (1998) Cells deleted for Brca2 COOH terminus exhibit hypersensitivity to gamma-radiation and premature senescence. Cancer Res 58(15): 3441–3447.
Mosedale G, Niedzwiedz W, Alpi A, Perrina F, Pereira-Leal JB, Johnson M, Langevin F, Pace P & Patel KJ (2005) The vertebrate Hef ortholog is a component of the Fanconi anemia tumor-suppressor pathway. Nat Struct Mol Biol 12(9): 763–771.
Moynahan ME, Chiu JW, Koller BH & Jasin M (1999) Brca1 controls homology-directed DNA repair. Mol Cell 4(4): 511–518.
Moynahan ME & Jasin M (2010) Mitotic homologous recombination maintains genomic stability and suppresses tumorigenesis. Nat Rev Mol Cell Biol 11(3): 196–207.
Moynahan ME, Pierce AJ & Jasin M (2001) BRCA2 is required for homology-directed repair of chromosomal breaks. Mol Cell 7(2): 263–272.
Nagaraju G & Scully R (2007) Minding the gap: the underground functions of BRCA1 and BRCA2 at stalled replication forks. DNA Repair (Amst) 6(7): 1018–1031.
Narod SA (2002) Modifiers of risk of hereditary breast and ovarian cancer. Nat Rev Cancer 2(2): 113–123.
Narod SA (2010) Testing for CHEK2 in the cancer genetics clinic: ready for prime time? Clin Genet 78(1): 1–7.
Narod SA & Foulkes WD (2004) BRCA1 and BRCA2: 1994 and beyond. Nat Rev Cancer 4(9): 665–676.
Negrini S, Gorgoulis VG & Halazonetis TD (2010) Genomic instability--an evolving hallmark of cancer. Nat Rev Mol Cell Biol 11(3): 220–228.
Nelen MR, Padberg GW, Peeters EA, Lin AY, van den Helm B, Frants RR, Coulon V, Goldstein AM, van Reen MM, Easton DF, Eeles RA, Hodgsen S, Mulvihill JJ,
126
Murday VA, Tucker MA, Mariman EC, Starink TM, Ponder BA, Ropers HH, Kremer H, Longy M & Eng C (1996) Localization of the gene for Cowden disease to chromosome 10q22-23. Nat Genet 13(1): 114–116.
Nelen MR, van Staveren WC, Peeters EA, Hassel MB, Gorlin RJ, Hamm H, Lindboe CF, Fryns JP, Sijmons RH, Woods DG, Mariman EC, Padberg GW & Kremer H (1997) Germline mutations in the PTEN/MMAC1 gene in patients with Cowden disease. Hum Mol Genet 6(8): 1383–1387.
Nevanlinna H & Bartek J (2006) The CHEK2 gene and inherited breast cancer susceptibility. Oncogene 25(43): 5912–5919.
Niedzwiedz W, Mosedale G, Johnson M, Ong CY, Pace P & Patel KJ (2004) The Fanconi anaemia gene FANCC promotes homologous recombination and error-prone DNA repair. Mol Cell 15(4): 607–620.
Nik-Zainal S, Alexandrov LB, Wedge DC, Van Loo P, Greenman CD, Raine K, Jones D, Hinton J, Marshall J, Stebbings LA, Menzies A, Martin S, Leung K, Chen L, Leroy C, Ramakrishna M, Rance R, Lau KW, Mudie LJ, Varela I, McBride DJ, Bignell GR, Cooke SL, Shlien A, Gamble J, Whitmore I, Maddison M, Tarpey PS, Davies HR, Papaemmanuil E, Stephens PJ, McLaren S, Butler AP, Teague JW, Jönsson G, Garber JE, Silver D, Miron P, Fatima A, Boyault S, Langerød A, Tutt A, Martens JWM, Aparicio S, Borg Å, Salomon AV, Thomas G, Børresen-Dale A-L, Richardson AL, Neuberger MS, Futrea PA, Campbell PJ, Stratton MR & the Breast Cancer Working Group of the International Cancer Genome Consortium (2012a) Mutational Processes Molding the Genomes of 21 Breast Cancers. Cell 149(5): 979–993.
Nik-Zainal S, Van Loo P, Wedge DC, Alexandrov LB, Greenman CD, Wai Lau K, Raine K, Jones D, Marshall J, Ramakrishna M, Shlien A, Cooke SL, Hinton J, Menzies A, Stebbings LA, Leroy C, Jia M, Rance R, Mudie LJ, Gamble SJ, Stephens PJ, McLaren S, Tarpey PS, Papaemmanuil E, Davies HR, Varela I, McBride DJ, Bignell GR, Leung K, Butler AP, Teague JW, Martin S, Jönsson G, Mariani O, Boyault S, Miron P, Fatima A, Langerød A, Aparicio S, Tutt A, Sieuwerts AM, Borg Å, Thomas G, Salomon AV, Richardson AL, Børresen-Dale A-L, Futrea PA, Stratton MR & Campbell PJ (2012b) The Life History of 21 Breast Cancers. Cell 149(5): 994–1007.
Niimi A, Brown S, Sabbioneda S, Kannouche PL, Scott A, Yasui A, Green CM & Lehmann AR (2008) Regulation of proliferating cell nuclear antigen ubiquitination in mammalian cells. Proc Natl Acad Sci USA 105(42): 16125–16130.
Nijman SM, Huang TT, Dirac AM, Brummelkamp TR, Kerkhoven RM, D'Andrea AD & Bernards R (2005) The deubiquitinating enzyme USP1 regulates the Fanconi anemia pathway. Mol Cell 17(3): 331–339.
Novak DJ, Sabbaghian N, Maillet P, Chappuis PO, Foulkes WD & Tischkowitz M (2009) Analysis of the genes coding for the BRCA1-interacting proteins, RAP80 and Abraxas (CCDC98), in high-risk, non-BRCA1/2, multiethnic breast cancer cases. Breast Cancer Res Treat 117(2): 453–459.
Oestergaard VH, Langevin F, Kuiken HJ, Pace P, Niedzwiedz W, Simpson LJ, Ohzeki M, Takata M, Sale JE & Patel KJ (2007) Deubiquitination of FANCD2 is required for DNA crosslink repair. Mol Cell 28(5): 798–809.
127
Oliver AW, Swift S, Lord CJ, Ashworth A & Pearl LH (2009) Structural basis for recruitment of BRCA2 by PALB2. EMBO Rep 10(9): 990–996.
Osorio A, Barroso A, Garcia MJ, Martinez-Delgado B, Urioste M & Benitez J (2009) Evaluation of the BRCA1 interacting genes RAP80 and CCDC98 in familial breast cancer susceptibility. Breast Cancer Res Treat 113(2): 371–376.
Otto F (2011) Male breast cancer--neglected tumour. Eur J Cancer 47 Suppl 3: S340–1. Pakkanen S, Wahlfors T, Siltanen S, Patrikainen M, Matikainen MP, Tammela TL &
Schleutker J (2009) PALB2 variants in hereditary and unselected Finnish prostate cancer cases. J Negat Results Biomed 8: 12.
Pang Z, Yao L, Zhang J, Ouyang T, Li J, Wang T, Fan Z, Fan T, Lin B & Xie Y (2011) RAD51C germline mutations in Chinese women with familial breast cancer. Breast Cancer Res Treat 129: 1019–1020.
Papi L, Putignano AL, Congregati C, Piaceri I, Zanna I, Sera F, Morrone D, Genuardi M & Palli D (2010) A PALB2 germline mutation associated with hereditary breast cancer in Italy. Fam Cancer 9(2): 181–185.
Parkin DM (2004) International variation. Oncogene 23(38): 6329–6340. Patel KJ (2007) Fanconi anemia and breast cancer susceptibility. Nat Genet 39(2): 142–
143. Patel KJ, Yu VP, Lee H, Corcoran A, Thistlethwaite FC, Evans MJ, Colledge WH,
Friedman LS, Ponder BA & Venkitaraman AR (1998) Involvement of Brca2 in DNA repair. Mol Cell 1(3): 347–357.
Paulsen RD & Cimprich KA (2007) The ATR pathway: fine-tuning the fork. DNA Repair (Amst) 6(7): 953–966.
Payne SR & Kemp CJ (2005) Tumor suppressor genetics. Carcinogenesis 26(12): 2031–2045.
Pellegrini L & Venkitaraman A (2004) Emerging functions of BRCA2 in DNA recombination. Trends Biochem Sci 29(6): 310–316.
Pelttari L, Heikkinen T, Thompson D, Kallioniemi A, Schleutker J, Holli K, Blomqvist C, Aittomäki K, Bützow R & Nevanlinna H (2011) RAD51C is a susceptibility gene for ovarian cancer. Hum Mol Genet 20: 3278–3288.
Peng M, Litman R, Jin Z, Fong G & Cantor SB (2006) BACH1 is a DNA repair protein supporting BRCA1 damage response. Oncogene 25(15): 2245–2253.
Petermann E & Caldecott KW (2006) Evidence that the ATR/Chk1 pathway maintains normal replication fork progression during unperturbed S phase. Cell Cycle 5(19): 2203–2209.
Petermann E & Helleday T (2010) Pathways of mammalian replication fork restart. Nat Rev Mol Cell Biol 11(10): 683–687.
Petermann E, Woodcock M & Helleday T (2010) Chk1 promotes replication fork progression by controlling replication initiation. Proc Natl Acad Sci USA 107(37): 16090–16095.
Peto J, Collins N, Barfoot R, Seal S, Warren W, Rahman N, Easton DF, Evans C, Deacon J & Stratton MR (1999) Prevalence of BRCA1 and BRCA2 gene mutations in patients with early-onset breast cancer. J Natl Cancer Inst 91(11): 943–949.
128
Peto J & Mack TM (2000) High constant incidence in twins and other relatives of women with breast cancer. Nat Genet 26(4): 411–414.
Pharoah PD, Antoniou A, Bobrow M, Zimmern RL, Easton DF & Ponder BA (2002) Polygenic susceptibility to breast cancer and implications for prevention. Nat Genet 31(1): 33–36.
Pharoah PD, Antoniou AC, Easton DF & Ponder BA (2008) Polygenes, risk prediction, and targeted prevention of breast cancer. N Engl J Med 358(26): 2796–2803.
Pharoah PD, Guilford P, Caldas C & International Gastric Cancer Linkage Consortium (2001) Incidence of gastric cancer and breast cancer in CDH1 (E-cadherin) mutation carriers from hereditary diffuse gastric cancer families. Gastroenterology 121(6): 1348–1353.
Pierce AJ, Hu P, Han M, Ellis N & Jasin M (2001) Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev 15(24): 3237–3242.
Podo F, Buydens LM, Degani H, Hilhorst R, Klipp E, Gribbestad IS, Van Huffel S, van Laarhoven HW, Luts J, Monleon D, Postma GJ, Schneiderhan-Marra N, Santoro F, Wouters H, Russnes HG, Sorlie T, Tagliabue E, Borresen-Dale AL & FEMME Consortium (2010) Triple-negative breast cancer: present challenges and new perspectives. Mol Oncol 4(3): 209–229.
Polo SE & Jackson SP (2011) Dynamics of DNA damage response proteins at DNA breaks: a focus on protein modifications. Genes Dev 25(5): 409–433.
Pomerantz MM, Ahmadiyeh N, Jia L, Herman P, Verzi MP, Doddapaneni H, Beckwith CA, Chan JA, Hills A, Davis M, Yao K, Kehoe SM, Lenz HJ, Haiman CA, Yan C, Henderson BE, Frenkel B, Barretina J, Bass A, Tabernero J, Baselga J, Regan MM, Manak JR, Shivdasani R, Coetzee GA & Freedman ML (2009) The 8q24 cancer risk variant rs6983267 shows long-range interaction with MYC in colorectal cancer. Nat Genet 41(8): 882–884.
Potapova A, Hoffman AM, Godwin AK, Al-Saleem T & Cairns P (2008) Promoter hypermethylation of the PALB2 susceptibility gene in inherited and sporadic breast and ovarian cancer. Cancer Res 68(4): 998–1002.
Powell SN & Kachnic LA (2003) Roles of BRCA1 and BRCA2 in homologous recombination, DNA replication fidelity and the cellular response to ionizing radiation. Oncogene 22(37): 5784–5791.
Preston RJ (2005) Mechanistic data and cancer risk assessment: the need for quantitative molecular endpoints. Environ Mol Mutagen 45(2–3): 214–221.
Pylkäs K, Erkko H, Nikkilä J, Solyom S & Winqvist R (2008) Analysis of large deletions in BRCA1, BRCA2 and PALB2 genes in Finnish breast and ovarian cancer families. BMC Cancer 8: 146.
Pylkäs K, Tommiska J, Syrjakoski K, Kere J, Gatei M, Waddell N, Allinen M, Karppinen SM, Rapakko K, Kaariainen H, Aittomaki K, Blomqvist C, Mustonen A, Holli K, Khanna KK, Kallioniemi OP, Nevanlinna H & Winqvist R (2007) Evaluation of the role of Finnish ataxia-telangiectasia mutations in hereditary predisposition to breast cancer. Carcinogenesis 28(5): 1040–1045.
129
Pylkäs K, Vuorela M, Otsukka M, Kallioniemi A, Jukkola-Vuorinen A & Winqvist R (2012) Rare Copy Number Variants Observed in Hereditary Breast Cancer Cases Disrupt Genes in Estrogen Signaling and TP53 Tumor Suppression Network. PLoS Genet 8(6): e1002734.
Radman M, Jeggo P & Wagner R (1982) Chromosomal rearrangement and carcinogenesis. Mutat Res 98(3): 249–264.
Rafnar T, Gudbjartsson DF, Sulem P, Jonasdottir A, Sigurdsson A, Jonasdottir A, Besenbacher S, Lundin P, Stacey SN, Gudmundsson J, Magnusson OT, le Roux L, Orlygsdottir G, Helgadottir HT, Johannsdottir H, Gylfason A, Tryggvadottir L, Jonasson JG, de Juan A, Ortega E, Ramon-Cajal JM, Garcia-Prats MD, Mayordomo C, Panadero A, Rivera F, Aben KK, van Altena AM, Massuger LF, Aavikko M, Kujala PM, Staff S, Aaltonen LA, Olafsdottir K, Bjornsson J, Kong A, Salvarsdottir A, Saemundsson H, Olafsson K, Benediktsdottir KR, Gulcher J, Masson G, Kiemeney LA, Mayordomo JI, Thorsteinsdottir U & Stefansson K (2011) Mutations in BRIP1 confer high risk of ovarian cancer. Nat Genet 43(11): 1104–1107.
Rahman N, Seal S, Thompson D, Kelly P, Renwick A, Elliott A, Reid S, Spanova K, Barfoot R, Chagtai T, Jayatilake H, McGuffog L, Hanks S, Evans DG, Eccles D, Breast Cancer Susceptibility Collaboration (UK), Easton DF & Stratton MR (2007) PALB2, which encodes a BRCA2-interacting protein, is a breast cancer susceptibility gene. Nat Genet 39(2): 165–167.
Rai R, Dai H, Multani AS, Li K, Chin K, Gray J, Lahad JP, Liang J, Mills GB, Meric-Bernstam F & Lin SY (2006) BRIT1 regulates early DNA damage response, chromosomal integrity, and cancer. Cancer Cell 10(2): 145–157.
Rapakko K, Allinen M, Syrjakoski K, Vahteristo P, Huusko P, Vahakangas K, Eerola H, Kainu T, Kallioniemi OP, Nevanlinna H & Winqvist R (2001) Germline TP53 alterations in Finnish breast cancer families are rare and occur at conserved mutation-prone sites. Br J Cancer 84(1): 116–119.
Reid S, Renwick A, Seal S, Baskcomb L, Barfoot R, Jayatilake H, Pritchard-Jones K, Stratton MR, Ridolfi-Luthy A, Rahman N, Breast Cancer Susceptibility Collaboration (UK) & Familial Wilms Tumour Collaboration (2005) Biallelic BRCA2 mutations are associated with multiple malignancies in childhood including familial Wilms tumour. J Med Genet 42(2): 147–151.
Reid S, Schindler D, Hanenberg H, Barker K, Hanks S, Kalb R, Neveling K, Kelly P, Seal S, Freund M, Wurm M, Batish SD, Lach FP, Yetgin S, Neitzel H, Ariffin H, Tischkowitz M, Mathew CG, Auerbach AD & Rahman N (2007) Biallelic mutations in PALB2 cause Fanconi anemia subtype FA-N and predispose to childhood cancer. Nat Genet 39(2): 162–164.
Reinhardt HC & Yaffe MB (2009) Kinases that control the cell cycle in response to DNA damage: Chk1, Chk2, and MK2. Curr Opin Cell Biol 21(2): 245–255.
Reliene R, Bishop AJ & Schiestl RH (2007) Involvement of homologous recombination in carcinogenesis. Adv Genet 58: 67–87.
Renwick A, Thompson D, Seal S, Kelly P, Chagtai T, Ahmed M, North B, Jayatilake H, Barfoot R, Spanova K, McGuffog L, Evans DG, Eccles D, Breast Cancer
130
Susceptibility Collaboration (UK), Easton DF, Stratton MR & Rahman N (2006) ATM mutations that cause ataxia-telangiectasia are breast cancer susceptibility alleles. Nat Genet 38(8): 873–875.
Romero A, Perez-Segura P, Tosar A, Garcia-Saenz JA, Diaz-Rubio E, Caldes T & de la Hoya M (2011) A HRM-based screening method detects RAD51C germ-line deleterious mutations in Spanish breast and ovarian cancer families. Breast Cancer Res Treat 129(3): 939–946.
Rosell R, Perez-Roca L, Sanchez JJ, Cobo M, Moran T, Chaib I, Provencio M, Domine M, Sala MA, Jimenez U, Diz P, Barneto I, Macias JA, de Las Penas R, Catot S, Isla D, Sanchez JM, Ibeas R, Lopez-Vivanco G, Oramas J, Mendez P, Reguart N, Blanco R & Taron M (2009) Customized treatment in non-small-cell lung cancer based on EGFR mutations and BRCA1 mRNA expression. PLoS One 4(5): e5133.
Roy R, Chun J & Powell SN (2011) BRCA1 and BRCA2: different roles in a common pathway of genome protection. Nat Rev Cancer 12(1): 68–78.
Rupnik A, Lowndes NF & Grenon M (2010) MRN and the race to the break. Chromosoma 119(2): 115–135.
Saintigny Y, Delacote F, Vares G, Petitot F, Lambert S, Averbeck D & Lopez BS (2001) Characterization of homologous recombination induced by replication inhibition in mammalian cells. EMBO J 20(14): 3861–3870.
Saleh-Gohari N, Bryant HE, Schultz N, Parker KM, Cassel TN & Helleday T (2005) Spontaneous homologous recombination is induced by collapsed replication forks that are caused by endogenous DNA single-strand breaks. Mol Cell Biol 25(16): 7158–7169.
San Filippo J, Sung P & Klein H (2008) Mechanism of eukaryotic homologous recombination. Annu Rev Biochem 77: 229–257.
Sanchez Y, Wong C, Thoma RS, Richman R, Wu Z, Piwnica-Worms H & Elledge SJ (1997) Conservation of the Chk1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science 277(5331): 1497–1501.
Sarantaus L, Huusko P, Eerola H, Launonen V, Vehmanen P, Rapakko K, Gillanders E, Syrjakoski K, Kainu T, Vahteristo P, Krahe R, Paakkonen K, Hartikainen J, Blomqvist C, Lopponen T, Holli K, Ryynanen M, Butzow R, Borg A, Wasteson Arver B, Holmberg E, Mannermaa A, Kere J, Kallioniemi OP, Winqvist R & Nevanlinna H (2000) Multiple founder effects and geographical clustering of BRCA1 and BRCA2 families in Finland. Eur J Hum Genet 8(10): 757–763.
Sato Y, Yoshikawa A, Mimura H, Yamashita M, Yamagata A & Fukai S (2009) Structural basis for specific recognition of Lys 63-linked polyubiquitin chains by tandem UIMs of RAP80. EMBO J. 28(16): 2461–2468.
Savitsky K, Bar-Shira A, Gilad S, Rotman G, Ziv Y, Vanagaite L, Tagle DA, Smith S, Uziel T, Sfez S, Ashkenazi M, Pecker I, Frydman M, Harnik R, Patanjali SR, Simmons A, Clines GA, Sartiel A, Gatti RA, Chessa L, Sanal O, Lavin MF, Jaspers NG, Taylor AM, Arlett CF, Miki T, Weissman SM, Lovett M, Collins FS & Shiloh Y (1995) A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science 268(5218): 1749–1753.
131
Schlacher K, Christ N, Siaud N, Egashira A, Wu H & Jasin M (2011) Double-strand break repair-independent role for BRCA2 in blocking stalled replication fork degradation by MRE11. Cell 145(4): 529–542.
Schmitt MW, Venkatesan RN, Pillaire MJ, Hoffmann JS, Sidorova JM & Loeb LA (2010) Active site mutations in mammalian DNA polymerase delta alter accuracy and replication fork progression. J Biol Chem 285(42): 32264–32272.
Schoppy DW, Ragland RL, Gilad O, Shastri N, Peters AA, Murga M, Fernandez-Capetillo O, Diehl JA & Brown EJ (2012) Oncogenic stress sensitizes murine cancers to hypomorphic suppression of ATR. J Clin Invest 122(1): 241–252.
Seal S, Thompson D, Renwick A, Elliott A, Kelly P, Barfoot R, Chagtai T, Jayatilake H, Ahmed M, Spanova K, North B, McGuffog L, Evans DG, Eccles D, Breast Cancer Susceptibility Collaboration (UK), Easton DF, Stratton MR & Rahman N (2006) Truncating mutations in the Fanconi anemia J gene BRIP1 are low-penetrance breast cancer susceptibility alleles. Nat Genet 38(11): 1239–1241.
Seemanova E (1990) An increased risk for malignant neoplasms in heterozygotes for a syndrome of microcephaly, normal intelligence, growth retardation, remarkable facies, immunodeficiency and chromosomal instability. Mutat Res 238(3): 321–324.
Seemanova E, Jarolim P, Seeman P, Varon R, Digweed M, Swift M & Sperling K (2007) Cancer risk of heterozygotes with the NBN founder mutation. J Natl Cancer Inst 99(24): 1875–1880.
Sharan SK, Morimatsu M, Albrecht U, Lim DS, Regel E, Dinh C, Sands A, Eichele G, Hasty P & Bradley A (1997) Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. Nature 386(6627): 804–810.
Sharif S, Moran A, Huson SM, Iddenden R, Shenton A, Howard E & Evans DG (2007) Women with neurofibromatosis 1 are at a moderately increased risk of developing breast cancer and should be considered for early screening. J Med Genet 44(8): 481–484.
Shechter D, Costanzo V & Gautier J (2004) ATR and ATM regulate the timing of DNA replication origin firing. Nat Cell Biol 6(7): 648–655.
Shen W, Balajee A, Wang J, Wu H, Eng C, Pandolfi P & Yin Y (2007) Essential role for nuclear PTEN in maintaining chromosomal integrity. Cell 128: 157–170.
Shen SX, Weaver Z, Xu X, Li C, Weinstein M, Chen L, Guan XY, Ried T & Deng CX (1998) A targeted disruption of the murine Brca1 gene causes gamma-irradiation hypersensitivity and genetic instability. Oncogene 17(24): 3115–3124.
Shieh SY, Ahn J, Tamai K, Taya Y & Prives C (2000) The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites. Genes Dev 14(3): 289–300.
Shiloh Y (2006) The ATM-mediated DNA-damage response: taking shape. Trends Biochem Sci 31(7): 402–410.
Shuen AY & Foulkes WD (2011) Inherited mutations in breast cancer genes--risk and response. J Mammary Gland Biol Neoplasia 16(1): 3–15.
Silvestri V, Rizzolo P, Falchetti M, Zanna I, Masala G, Palli D & Ottini L (2011) Mutation screening of RAD51C in male breast cancer patients. Breast Cancer Res 13(1): 404.
132
Slater EP, Langer P, Niemczyk E, Strauch K, Butler J, Habbe N, Neoptolemos JP, Greenhalf W & Bartsch DK (2010) PALB2 mutations in European familial pancreatic cancer families. Clin Genet 78(5): 490–494.
Sluiter M, Mew S & van Rensburg EJ (2009) PALB2 sequence variants in young South African breast cancer patients. Fam Cancer .
Smith KD, Fu MA & Brown EJ (2009) Tim-Tipin dysfunction creates an indispensible reliance on the ATR-Chk1 pathway for continued DNA synthesis. J Cell Biol 187(1): 15–23.
Smogorzewska A, Desetty R, Saito TT, Schlabach M, Lach FP, Sowa ME, Clark AB, Kunkel TA, Harper JW, Colaiacovo MP & Elledge SJ (2010) A genetic screen identifies FAN1, a Fanconi anemia-associated nuclease necessary for DNA interstrand crosslink repair. Mol Cell 39(1): 36–47.
Smogorzewska A, Matsuoka S, Vinciguerra P, McDonald ER,3rd, Hurov KE, Luo J, Ballif BA, Gygi SP, Hofmann K, D'Andrea AD & Elledge SJ (2007) Identification of the FANCI protein, a monoubiquitinated FANCD2 paralog required for DNA repair. Cell 129(2): 289–301.
Sobhian B, Shao G, Lilli DR, Culhane AC, Moreau LA, Xia B, Livingston DM & Greenberg RA (2007) RAP80 targets BRCA1 to specific ubiquitin structures at DNA damage sites. Science 316(5828): 1198–1202.
Solyom S, Aressy B, Pylkäs K, Patterson-Fortin J, Hartikainen JM, Kallioniemi A, Kauppila S, Nikkilä J, Kosma VM, Mannermaa A, Greenberg RA & Winqvist R (2012) Breast cancer-associated Abraxas mutation disrupts nuclear localization and DNA damage response functions. Sci Transl Med 4(122): 122ra23.
Solyom S, Patterson-Fortin J, Pylkäs K, Greenberg RA & Winqvist R (2010) Mutation screening of the MERIT40 gene encoding a novel BRCA1 and RAP80 interacting protein in breast cancer families. Breast Cancer Res Treat 120(1): 165–168.
Sonoda E, Sasaki MS, Buerstedde JM, Bezzubova O, Shinohara A, Ogawa H, Takata M, Yamaguchi-Iwai Y & Takeda S (1998) Rad51-deficient vertebrate cells accumulate chromosomal breaks prior to cell death. EMBO J 17(2): 598–608.
Sorensen CS, Hansen LT, Dziegielewski J, Syljuasen RG, Lundin C, Bartek J & Helleday T (2005) The cell-cycle checkpoint kinase Chk1 is required for mammalian homologous recombination repair. Nat Cell Biol 7(2): 195–201.
Sorensen CS, Syljuasen RG, Falck J, Schroeder T, Ronnstrand L, Khanna KK, Zhou BB, Bartek J & Lukas J (2003) Chk1 regulates the S phase checkpoint by coupling the physiological turnover and ionizing radiation-induced accelerated proteolysis of Cdc25A. Cancer Cell 3(3): 247–258.
Sorensen SA, Mulvihill JJ & Nielsen A (1986) Long-term follow-up of von Recklinghausen neurofibromatosis. Survival and malignant neoplasms. N Engl J Med 314(16): 1010–1015.
Sorlie T, Tibshirani R, Parker J, Hastie T, Marron JS, Nobel A, Deng S, Johnsen H, Pesich R, Geisler S, Demeter J, Perou CM, Lonning PE, Brown PO, Borresen-Dale AL & Botstein D (2003) Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc Natl Acad Sci USA 100(14): 8418–8423.
133
Southey MC, Teo ZL, Dowty JG, Odefrey FA, Park DJ, Tischkowitz M, Sabbaghian N, Apicella C, Byrnes GB, Winship I, Baglietto L, Giles GG, Goldgar DE, Foulkes WD, Hopper JL & kConFab for the Beast Cancer Family Registry (2010) A PALB2 mutation associated with high risk of breast cancer. Breast Cancer Res 12(6): R109.
Srivastava S, Zou ZQ, Pirollo K, Blattner W & Chang EH (1990) Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature 348(6303): 747–749.
Starink T, van der Veen J, Arwert F, de Waal L, de Lange G, Gille J & Erikson A (1986) The Cowden syndrome: a clinical and genetic study in 21 patients. Clin Genet 29: 222–233.
Steffen J, Nowakowska D, Niwinska A, Czapczak D, Kluska A, Piatkowska M, Wisniewska A & Paszko Z (2006) Germline mutations 657del5 of the NBS1 gene contribute significantly to the incidence of breast cancer in Central Poland. Int J Cancer 119(2): 472–475.
Stephens P, Tarpey PS, Davies H, Van Loo P, Greenman C, Wedge DC, Nik-Zainal S, Martin S, Varela I, Bignell GR, Yates LR, Papaemmanuil E, Beare D, Butler A, Cheverton A, Gamble J, Hinton J, Jia M, Jayakumar A, Jones D, Latimer C, Lau KW, McLaren S, McBride DJ, Menzies A, Mudie L, Raine K, Rad R, Chapman MS, Teague J, Easton D, Langerød A; Oslo Breast Cancer Consortium (OSBREAC), Lee MT, Shen CY, Tee BT, Huimin BW, Broeks A, Vargas AC, Turashvili G, Martens J, Fatima A, Miron P, Chin SF, Thomas G, Boyault S, Mariani O, Lakhani SR, van de Vijver M, van 't Veer L, Foekens J, Desmedt C, Sotiriou C, Tutt A, Caldas C, Reis-Filho JS, Aparicio SA, Salomon AV, Børresen-Dale AL, Richardson AL, Campbell PJ, Futreal PA & Stratton MR (2012) The landscape of cancer genes and mutational processes in breast cancer. Nature 486(7403):400–404.
Stiff T, Walker SA, Cerosaletti K, Goodarzi AA, Petermann E, Concannon P, O'Driscoll M & Jeggo PA (2006) ATR-dependent phosphorylation and activation of ATM in response to UV treatment or replication fork stalling. EMBO J 25(24): 5775–5782.
Stratton M & Rahman N (2008) The emerging landscape of breast cancer susceptibility. Nat Genet 40(1): 17–22.
Stratton MR (2011) Exploring the genomes of cancer cells: progress and promise. Science 331(6024): 1553–1558.
Stratton MR, Campbell PJ & Futreal PA (2009) The cancer genome. Nature 458(7239): 719–724.
Strauss C, Halevy T, Macarov M, Argaman L & Goldberg M (2011) MDC1 is ubiquitylated on its tandem BRCT domain and directly binds RAP80 in a UBC13-dependent manner. DNA Repair (Amst) 10(8): 806–814.
Stucki M, Clapperton JA, Mohammad D, Yaffe MB, Smerdon SJ & Jackson SP (2005) MDC1 directly binds phosphorylated histone H2AX to regulate cellular responses to DNA double-strand breaks. Cell 123(7): 1213–1226.
Stucki M & Jackson SP (2004) MDC1/NFBD1: a key regulator of the DNA damage response in higher eukaryotes. DNA Repair (Amst) 3(8–9): 953–957.
134
Su X & Huang J (2011) The Fanconi anemia pathway and DNA interstrand cross-link repair. Protein Cell 2(9): 704–711.
Summers KC, Shen F, Sierra Potchanant EA, Phipps EA, Hickey RJ & Malkas LH (2011) Phosphorylation: the molecular switch of double-strand break repair. Int J Proteomics 2011: 373816.
Sung P & Klein H (2006) Mechanism of homologous recombination: mediators and helicases take on regulatory functions. Nat Rev Mol Cell Biol 7(10): 739–750.
Suzuki A, de la Pompa JL, Hakem R, Elia A, Yoshida R, Mo R, Nishina H, Chuang T, Wakeham A, Itie A, Koo W, Billia P, Ho A, Fukumoto M, Hui CC & Mak TW (1997) Brca2 is required for embryonic cellular proliferation in the mouse. Genes Dev 11(10): 1242–1252.
Sy SM, Huen MS & Chen J (2009a) MRG15 is a novel PALB2-interacting factor involved in homologous recombination. J Biol Chem 284(32): 21127–21131.
Sy SM, Huen MS & Chen J (2009b) PALB2 is an integral component of the BRCA complex required for homologous recombination repair. Proc Natl Acad Sci USA 106(17): 7155–7160.
Sy SM, Huen MS, Zhu Y & Chen J (2009c) PALB2 regulates recombinational repair through chromatin association and oligomerization. J Biol Chem 284(27): 18302–18310.
Syljuasen RG, Sorensen CS, Hansen LT, Fugger K, Lundin C, Johansson F, Helleday T, Sehested M, Lukas J & Bartek J (2005) Inhibition of human Chk1 causes increased initiation of DNA replication, phosphorylation of ATR targets, and DNA breakage. Mol Cell Biol 25(9): 3553–3562.
Syrjakoski K, Vahteristo P, Eerola H, Tamminen A, Kivinummi K, Sarantaus L, Holli K, Blomqvist C, Kallioniemi OP, Kainu T & Nevanlinna H (2000) Population-based study of BRCA1 and BRCA2 mutations in 1035 unselected Finnish breast cancer patients. J Natl Cancer Inst 92(18): 1529–1531.
Tai YC, Domchek S, Parmigiani G & Chen S (2007) Breast cancer risk among male BRCA1 and BRCA2 mutation carriers. J Natl Cancer Inst 99(23): 1811–1814.
Taniguchi T & D'Andrea AD (2006) Molecular pathogenesis of Fanconi anemia: recent progress. Blood 107(11): 4223–4233.
Taylor JH & Hozier JC (1976) Evidence for a four micron replication unit in CHO cells. Chromosoma 57(4): 341–350.
The Breast Cancer Linkage Consortium (1999) Cancer risks in BRCA2 mutation carriers. J Natl Cancer Inst 91(15): 1310–1316.
The Cancer Genome Atlas Network (2012) Comprehensive molecular portraits of human breast tumours. Nature 490(7418): 61–70.
Thompson D, Duedal S, Kirner J, McGuffog L, Last J, Reiman A, Byrd P, Taylor M & Easton DF (2005) Cancer risks and mortality in heterozygous ATM mutation carriers. J Natl Cancer Inst 97(11): 813–822.
Thompson D, Easton D & Breast Cancer Linkage Consortium (2001) Variation in cancer risks, by mutation position, in BRCA2 mutation carriers. Am J Hum Genet 68(2): 410–419.
135
Thompson ER, Boyle SE, Johnson J, Ryland GL, Sawyer S, Choong DY, kConFab, Chenevix-Trench G, Trainer AH, Lindeman GJ, Mitchell G, James PA & Campbell IG (2012) Analysis of RAD51C germline mutations in high-risk breast and ovarian cancer families and ovarian cancer patients. Hum Mutat 33(1): 95–99.
Thompson LH & Schild D (2001) Homologous recombinational repair of DNA ensures mammalian chromosome stability. Mutat Res 477(1–2): 131–153.
Thorlacius S, Olafsdottir G, Tryggvadottir L, Neuhausen S, Jonasson JG, Tavtigian SV, Tulinius H, Ogmundsdottir HM & Eyfjord JE (1996) A single BRCA2 mutation in male and female breast cancer families from Iceland with varied cancer phenotypes. Nat.Genet. 13(1): 117–119.
Thorslund T, McIlwraith MJ, Compton SA, Lekomtsev S, Petronczki M, Griffith JD & West SC (2010) The breast cancer tumor suppressor BRCA2 promotes the specific targeting of RAD51 to single-stranded DNA. Nat Struct Mol Biol 17(10): 1263–1265.
Thull DL & Vogel VG (2004) Recognition and management of hereditary breast cancer syndromes. Oncologist 9(1): 13–24.
Tischkowitz M, Capanu M, Sabbaghian N, Li L, Liang X, Vallee MP, Tavtigian SV, Concannon P, Foulkes WD, Bernstein L, WECARE Study Collaborative Group, Bernstein JL & Begg CB (2012) Rare germline mutations in PALB2 and breast cancer risk: a population-based study. Hum Mutat 33(4): 674–680.
Tischkowitz M, Sabbaghian N, Ray AM, Lange EM, Foulkes WD & Cooney KA (2008) Analysis of the gene coding for the BRCA2-interacting protein PALB2 in hereditary prostate cancer. Prostate 68(6): 675–678.
Tischkowitz M & Xia B (2010) PALB2/FANCN: recombining cancer and Fanconi anemia. Cancer Res 70(19): 7353–7359.
Tischkowitz M, Xia B, Sabbaghian N, Reis-Filho JS, Hamel N, Li G, van Beers EH, Li L, Khalil T, Quenneville LA, Omeroglu A, Poll A, Lepage P, Wong N, Nederlof PM, Ashworth A, Tonin PN, Narod SA, Livingston DM & Foulkes WD (2007) Analysis of PALB2/FANCN-associated breast cancer families. Proc Natl Acad Sci USA 104(16): 6788–6793.
Tischkowitz MD, Sabbaghian N, Hamel N, Borgida A, Rosner C, Taherian N, Srivastava A, Holter S, Rothenmund H, Ghadirian P, Foulkes WD & Gallinger S (2009) Analysis of the gene coding for the BRCA2-interacting protein PALB2 in familial and sporadic pancreatic cancer. Gastroenterology 137(3): 1183–1186.
Tommiska J, Seal S, Renwick A, Barfoot R, Baskcomb L, Jayatilake H, Bartkova J, Tallila J, Kaare M, Tamminen A, Heikkila P, Evans DG, Eccles D, Aittomaki K, Blomqvist C, Bartek J, Stratton MR, Nevanlinna H & Rahman N (2006) Evaluation of RAD50 in familial breast cancer predisposition. Int J Cancer 118(11): 2911–2916.
Trainer AH, Thompson E & James PA (2011) BRCA and beyond: a genome-first approach to familial breast cancer risk assessment. Discov Med 12(66): 433–443.
Turnbull C, Ahmed S, Morrison J, Pernet D, Renwick A, Maranian M, Seal S, Ghoussaini M, Hines S, Healey CS, Hughes D, Warren-Perry M, Tapper W, Eccles D, Evans DG, Breast Cancer Susceptibility Collaboration (UK), Hooning M, Schutte M, van den Ouweland A, Houlston R, Ross G, Langford C, Pharoah PD, Stratton MR, Dunning
136
AM, Rahman N & Easton DF (2010) Genome-wide association study identifies five new breast cancer susceptibility loci. Nat Genet 42(6): 504–507.
Turnbull C & Rahman N (2008) Genetic predisposition to breast cancer: past, present, and future. Annu Rev Genomics Hum Genet 9: 321–345.
van der Groep P, van der Wall E & van Diest PJ (2011) Pathology of hereditary breast cancer. Cell Oncol (Dordr) 34(2): 71–88.
Varon R, Vissinga C, Platzer M, Cerosaletti KM, Chrzanowska KH, Saar K, Beckmann G, Seemanova E, Cooper PR, Nowak NJ, Stumm M, Weemaes CM, Gatti RA, Wilson RK, Digweed M, Rosenthal A, Sperling K, Concannon P & Reis A (1998) Nibrin, a novel DNA double-strand break repair protein, is mutated in Nijmegen breakage syndrome. Cell 93(3): 467–476.
Vaz F, Hanenberg H, Schuster B, Barker K, Wiek C, Erven V, Neveling K, Endt D, Kesterton I, Autore F, Fraternali F, Freund M, Hartmann L, Grimwade D, Roberts R, Schaal H, Mohammed S, Rahman N, Schindler D & Mathew C (2010) Mutation of the RAD51C gene in a Fanconi anemia-like disorder. Nat Genet 42(5): 406–409.
Vehmanen P, Friedman LS, Eerola H, McClure M, Ward B, Sarantaus L, Kainu T, Syrjakoski K, Pyrhonen S, Kallioniemi OP, Muhonen T, Luce M, Frank TS & Nevanlinna H (1997) Low proportion of BRCA1 and BRCA2 mutations in Finnish breast cancer families: evidence for additional susceptibility genes. Hum Mol Genet 6(13): 2309–2315.
Vogelstein B & Kinzler KW (2004) Cancer genes and the pathways they control. Nat Med 10(8): 789–799.
Vuorela M, Pylkäs K, Hartikainen JM, Sundfeldt K, Lindblom A, von Wachenfeldt Wappling A, Haanpaa M, Puistola U, Rosengren A, Anttila M, Kosma VM, Mannermaa A & Winqvist R (2011) Further evidence for the contribution of the RAD51C gene in hereditary breast and ovarian cancer susceptibility. Breast Cancer Res Treat 130(3): 1003–1010.
Walsh T, Casadei S, Coats KH, Swisher E, Stray SM, Higgins J, Roach KC, Mandell J, Lee MK, Ciernikova S, Foretova L, Soucek P & King MC (2006) Spectrum of mutations in BRCA1, BRCA2, CHEK2, and TP53 in families at high risk of breast cancer. JAMA 295(12): 1379–1388.
Walsh T, McClellan JM, McCarthy SE, Addington AM, Pierce SB, Cooper GM, Nord AS, Kusenda M, Malhotra D, Bhandari A, Stray SM, Rippey CF, Roccanova P, Makarov V, Lakshmi B, Findling RL, Sikich L, Stromberg T, Merriman B, Gogtay N, Butler P, Eckstrand K, Noory L, Gochman P, Long R, Chen Z, Davis S, Baker C, Eichler EE, Meltzer PS, Nelson SF, Singleton AB, Lee MK, Rapoport JL, King MC & Sebat J (2008) Rare structural variants disrupt multiple genes in neurodevelopmental pathways in schizophrenia. Science 320(5875): 539–543.
Wang B (2012) BRCA1 tumor suppressor network: focusing on its tail. Cell Biosci 2(1): 6. Wang B, Matsuoka S, Ballif BA, Zhang D, Smogorzewska A, Gygi SP & Elledge SJ (2007)
Abraxas and RAP80 form a BRCA1 protein complex required for the DNA damage response. Science 316(5828): 1194–1198.
137
Wang L, Liu HL, Li Y & Yuan P (2011) Proteomic analysis of pancreatic intraepithelial neoplasia and pancreatic carcinoma in rat models. World J Gastroenterol 17(11): 1434–1441.
Wang W (2007) Emergence of a DNA-damage response network consisting of Fanconi anaemia and BRCA proteins. Nat Rev Genet 8(10): 735–748.
Wang X, Andreassen PR & D'Andrea AD (2004) Functional interaction of monoubiquitinated FANCD2 and BRCA2/FANCD1 in chromatin. Mol Cell Biol 24(13): 5850–5862.
Wang X, Kennedy RD, Ray K, Stuckert P, Ellenberger T & D'Andrea AD (2007) Chk1-mediated phosphorylation of FANCE is required for the Fanconi anemia/BRCA pathway. Mol Cell Biol 27(8): 3098–3108.
Ward IM & Chen J (2001) Histone H2AX is phosphorylated in an ATR-dependent manner in response to replicational stress. J Biol Chem 276(51): 47759–47762.
Wellcome Trust Case Control Consortium, Craddock N, Hurles ME, Cardin N, Pearson RD, Plagnol V, Robson S, Vukcevic D, Barnes C, Conrad DF, Giannoulatou E, Holmes C, Marchini JL, Stirrups K, Tobin MD, Wain LV, Yau C, Aerts J, Ahmad T, Andrews TD, Arbury H, Attwood A, Auton A, Ball SG, Balmforth AJ, Barrett JC, Barroso I, Barton A, Bennett AJ, Bhaskar S, Blaszczyk K, Bowes J, Brand OJ, Braund PS, Bredin F, Breen G, Brown MJ, Bruce IN, Bull J, Burren OS, Burton J, Byrnes J, Caesar S, Clee CM, Coffey AJ, Connell JM, Cooper JD, Dominiczak AF, Downes K, Drummond HE, Dudakia D, Dunham A, Ebbs B, Eccles D, Edkins S, Edwards C, Elliot A, Emery P, Evans DM, Evans G, Eyre S, Farmer A, Ferrier IN, Feuk L, Fitzgerald T, Flynn E, Forbes A, Forty L, Franklyn JA, Freathy RM, Gibbs P, Gilbert P, Gokumen O, Gordon-Smith K, Gray E, Green E, Groves CJ, Grozeva D, Gwilliam R, Hall A, Hammond N, Hardy M, Harrison P, Hassanali N, Hebaishi H, Hines S, Hinks A, Hitman GA, Hocking L, Howard E, Howard P, Howson JM, Hughes D, Hunt S, Isaacs JD, Jain M, Jewell DP, Johnson T, Jolley JD, Jones IR, Jones LA, Kirov G, Langford CF, Lango-Allen H, Lathrop GM, Lee J, Lee KL, Lees C, Lewis K, Lindgren CM, Maisuria-Armer M, Maller J, Mansfield J, Martin P, Massey DC, McArdle WL, McGuffin P, McLay KE, Mentzer A, Mimmack ML, Morgan AE, Morris AP, Mowat C, Myers S, Newman W, Nimmo ER, O'Donovan MC, Onipinla A, Onyiah I, Ovington NR, Owen MJ, Palin K, Parnell K, Pernet D, Perry JR, Phillips A, Pinto D, Prescott NJ, Prokopenko I, Quail MA, Rafelt S, Rayner NW, Redon R, Reid DM, Renwick, Ring SM, Robertson N, Russell E, St Clair D, Sambrook JG, Sanderson JD, Schuilenburg H, Scott CE, Scott R, Seal S, Shaw-Hawkins S, Shields BM, Simmonds MJ, Smyth DJ, Somaskantharajah E, Spanova K, Steer S, Stephens J, Stevens HE, Stone MA, Su Z, Symmons DP, Thompson JR, Thomson W, Travers ME, Turnbull C, Valsesia A, Walker M, Walker NM, Wallace C, Warren-Perry M, Watkins NA, Webster J, Weedon MN, Wilson AG, Woodburn M, Wordsworth BP, Young AH, Zeggini E, Carter NP, Frayling TM, Lee C, McVean G, Munroe PB, Palotie A, Sawcer SJ, Scherer SW, Strachan DP, Tyler-Smith C, Brown MA, Burton PR, Caulfield MJ, Compston A, Farrall M, Gough SC, Hall AS, Hattersley AT, Hill AV, Mathew CG, Pembrey M, Satsangi J, Stratton MR, Worthington J, Deloukas P,
138
Duncanson A, Kwiatkowski DP, McCarthy MI, Ouwehand W, Parkes M, Rahman N, Todd JA, Samani NJ & Donnelly P (2010) Genome-wide association study of CNVs in 16,000 cases of eight common diseases and 3,000 shared controls. Nature 464(7289): 713–720.
Wong MW, Nordfors C, Mossman D, Pecenpetelovska G, Avery-Kiejda KA, Talseth-Palmer B, Bowden NA & Scott RJ (2011) BRIP1, PALB2, and RAD51C mutation analysis reveals their relative importance as genetic susceptibility factors for breast cancer. Breast Cancer Res Treat 127(3): 853–859.
Wooster R, Bignell G, Lancaster J, Swift S, Seal S, Mangion J, Collins N, Gregory S, Gumbs C & Micklem G (1995) Identification of the breast cancer susceptibility gene BRCA2. Nature 378(6559): 789–792.
Wooster R, Neuhausen SL, Mangion J, Quirk Y, Ford D, Collins N, Nguyen K, Seal S, Tran T & Averill D (1994) Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12–13. Science 265(5181): 2088–2090.
Woynarowski JM (2004) AT islands – their nature and potential for anticancer strategies. Curr Cancer Drug Targets 4(2): 219–234.
Wu J, Liu C, Chen J & Yu X (2012) RAP80 Protein Is Important for Genomic Stability and Is Required for Stabilizing BRCA1-A Complex at DNA Damage Sites in Vivo. J Biol Chem 287(27): 22919–22926.
Xia B, Dorsman JC, Ameziane N, de Vries Y, Rooimans MA, Sheng Q, Pals G, Errami A, Gluckman E, Llera J, Wang W, Livingston DM, Joenje H & de Winter JP (2007) Fanconi anemia is associated with a defect in the BRCA2 partner PALB2. Nat Genet 39(2): 159–161.
Xia B, Sheng Q, Nakanishi K, Ohashi A, Wu J, Christ N, Liu X, Jasin M, Couch FJ & Livingston DM (2006) Control of BRCA2 cellular and clinical functions by a nuclear partner, PALB2. Mol Cell 22(6): 719–729.
Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R & Beach D (1993) P21 is a Universal Inhibitor of Cyclin Kinases. Nature 366(6456): 701–704.
Xu X, Weaver Z, Linke SP, Li C, Gotay J, Wang XW, Harris CC, Ried T & Deng CX (1999) Centrosome amplification and a defective G2-M cell cycle checkpoint induce genetic instability in BRCA1 exon 11 isoform-deficient cells. Mol Cell 3(3): 389–395.
Yamamoto K, Hirano S, Ishiai M, Morishima K, Kitao H, Namikoshi K, Kimura M, Matsushita N, Arakawa H, Buerstedde JM, Komatsu K, Thompson LH & Takata M (2005) Fanconi anemia protein FANCD2 promotes immunoglobulin gene conversion and DNA repair through a mechanism related to homologous recombination. Mol Cell Biol 25(1): 34–43.
Yan DH, Wen Y, Su LK, Xia W, Wang SC, Zhang S, Gan L, Lee DF, Spohn B, Frey JA, Hortobagyi GN & Hung MC (2004) A delayed chemically induced tumorigenesis in Brca2 mutant mice. Oncogene 23(10): 1896–1901.
Yan J, Kim YS, Yang XP, Albers M, Koegl M & Jetten AM (2007a) Ubiquitin-interaction motifs of RAP80 are critical in its regulation of estrogen receptor alpha. Nucleic Acids Res 35(5): 1673–1686.
139
Yan J, Kim YS, Yang XP, Li LP, Liao G, Xia F & Jetten AM (2007b) The Ubiquitin-Interacting Motif Containing Protein RAP80 Interacts with BRCA1 and Functions in DNA Damage Repair Response. Cancer Res 67(14): 6647–6656.
Yan J, Menendez D, Yang XP, Resnick MA & Jetten AM (2009) A regulatory loop composed of RAP80-HDM2-p53 provides RAP80-enhanced p53 degradation by HDM2 in response to DNA damage. J Biol Chem 284(29): 19280–19289.
Yan J, Yang XP, Kim YS & Jetten AM (2008) RAP80 responds to DNA damage induced by both ionizing radiation and UV irradiation and is phosphorylated at Ser 205. Cancer Res 68(11): 4269–4276.
Yan Z, Kim YS & Jetten AM (2002) RAP80, a novel nuclear protein that interacts with the retinoid-related testis-associated receptor. J Biol Chem 277(35): 32379–32388.
Yang K, Moldovan GL, Vinciguerra P, Murai J, Takeda S & D'Andrea AD (2011) Regulation of the Fanconi anemia pathway by a SUMO-like delivery network. Genes Dev 25(17): 1847–1858.
Yin Z, Menendez D, Resnick MA, French JE, Janardhan KS & Jetten AM (2012) RAP80 is critical in maintaining genomic stability and suppressing tumor development. Cancer Res. DOI: 10.1158/0008-5472.CAN-12-1484.
You Z & Bailis JM (2010) DNA damage and decisions: CtIP coordinates DNA repair and cell cycle checkpoints. Trends Cell Biol 20(7): 402–409.
Zelada-Hedman M, Wasteson Arver B, Claro A, Chen J, Werelius B, Kok H, Sandelin K, Hakansson S, Andersen TI, Borg A, Borresen Dale AL & Lindblom A (1997) A screening for BRCA1 mutations in breast and breast-ovarian cancer families from the Stockholm region. Cancer Res 57(12): 2474–2477.
Zhang F, Fan Q, Ren K & Andreassen PR (2009a) PALB2 functionally connects the breast cancer susceptibility proteins BRCA1 and BRCA2. Mol Cancer Res 7(7): 1110–1118.
Zhang F, Ma J, Wu J, Ye L, Cai H, Xia B & Yu X (2009b) PALB2 links BRCA1 and BRCA2 in the DNA-damage response. Curr Biol 19(6): 524–529.
Zhao H, Watkins JL & Piwnica-Worms H (2002) Disruption of the checkpoint kinase 1/cell division cycle 25A pathway abrogates ionizing radiation-induced S and G2 checkpoints. Proc Natl Acad Sci USA 99(23): 14795–14800.
Zheng Y, Zhang J, Hope K, Niu Q, Huo D & Olopade OI (2010) Screening RAD51C nucleotide alterations in patients with a family history of breast and ovarian cancer. Breast Cancer Res Treat 124(3): 857–861.
Zoller ME, Rembeck B, Oden A, Samuelsson M & Angervall L (1997) Malignant and benign tumors in patients with neurofibromatosis type 1 in a defined Swedish population. Cancer 79(11): 2125–2131.
Zou L & Elledge SJ (2003) Sensing DNA damage through ATRIP recognition of RPA-ssDNA complexes. Science 300(5625): 1542–1548.
Zou Y, Liu Y, Wu X & Shell SM (2006) Functions of human replication protein A (RPA): from DNA replication to DNA damage and stress responses. J Cell Physiol 208(2): 267–273.
140
141
Original publications
I Erkko H, Xia B, Nikkilä J, Schleutker J, Syrjäkoski K, Mannermaa A, Kallioniemi A, Pylkäs K, Karppinen S-M, Rapakko K, Miron A, Sheng Q, Li G, Mattila H, Bell DW, Haber DA, Grip M, Reiman M, Jukkola-Vuorinen A, Mustonen A, Kere J, Aaltonen LA, Kosma V-M, Kataja V, Soini Y, Drapkin RI, Livingston DM & Winqvist R (2007) A recurrent mutation in PALB2 in Finnish breast cancer families. Nature 446(7133): 316–319.
II Nikkilä J, Parpys A, Pylkäs K, Xia B, Borgmann K, Nieminen P, Pospiech H & Winqvist R (2012) Heterozygous mutations in PALB2 cause major DNA replication and damage response defects (Manuscript).
III Rantakari P, Nikkilä J, Jokela H, Ola R, Pylkäs K, Lagerbohm H,Sainio K, Poutanen M & Winqvist R (2010) Inactivation of Palb2 gene leads to mesoderm differentiation defect and early embryonic lethality in mice. Hum Mol Genet 19(15): 3021–3129.
IV Nikkilä J, Coleman KA, Morrissey D, Pylkäs K, Erkko H, Messick TE, Karppinen S-M, Amelina A, Winqvist R & Greenberg RA (2009) Familial breast cancer screening reveals an alteration in the RAP80 UIM domain that impairs DNA damage response function. Oncogene 28(16): 1843–1852.
Reprinted with the permission from Nature Publishing Group (I, IV) and Oxford
University Press (III).
Original publications are not included in the electronic version of the dissertations.
142
A C T A U N I V E R S I T A T I S O U L U E N S I S
Book orders:Granum: Virtual book storehttp://granum.uta.fi/granum/
S E R I E S D M E D I C A
1176. Puljula, Jussi (2012) Alcohol-related traumatic brain injuries before and after thereduction of alcohol prices : Observations from Oulu Province and NorthernOstrobothnia
1177. Kenttä, Tuomas (2012) Dynamics of cardiac repolarization during exercise : Rate-dependence and prognostic significance
1178. Vasunta, Riitta-Liisa (2012) Ambulatory blood pressure : association withmetabolic risk indicators, renal function and carotid artery atherosclerosis
1179. Haapsamo, Helena (2012) A Follow-up study of children's communicativedevelopment : Associations to social-emotional and behavioural problems andcompetences and experienced maternal stress
1180. Norppa, Anna (2012) Association between periodontal and systemicinflammation : A study of pro- and anti-inflammatory mediators
1181. Karjalainen, Teemu (2012) Nitinol shape memory alloy in flexor tendon repair
1182. Saukkonen, Tuula (2012) Prediabetes and associated cardiovascular risk factors :A prospective cohort study among middle-aged and elderly Finns
1183. Hagman, Juha (2012) Resource utilization in the treatment of open angleglaucoma in Finland: an 11-year retrospective analysis
1184. Eskola, Pasi (2012) The search for susceptibility genes in lumbar discdegeneration : Focus on young individuals
1185. Kaivorinne, Anna-Lotta (2012) Frontotemporal lobar degeneration in Finland :Molecular genetics and clinical aspects
1186. Härkönen, Pirjo (2012) Elämäntyytyväisyys ja terveys : Voimavarasuuntautunutikääntyvien henkilöiden seurantatutkimus
1187. Laukkanen, Päivi (2012) Occurrence of high risk human papillomaviruses andcervical cancer among fertile-aged women in Finland
1188. Junttila, Eija (2012) Cardiovascular abnormalities after non-traumatic intracranialhemorrhage
1189. Hookana, Eeva (2012) Characteristics of victims of non-ischemic sudden cardiacdeath
1190. Murugan, Subramanian (2012) Control of nephrogenesis by Wnt4 signaling :Mechanisms of gene regulation and targeting of specific lineage cells by tissueengineering tools
ABCDEFG
UNIVERS ITY OF OULU P.O.B . 7500 F I -90014 UNIVERS ITY OF OULU F INLAND
A C T A U N I V E R S I T A T I S O U L U E N S I S
S E R I E S E D I T O R S
SCIENTIAE RERUM NATURALIUM
HUMANIORA
TECHNICA
MEDICA
SCIENTIAE RERUM SOCIALIUM
SCRIPTA ACADEMICA
OECONOMICA
EDITOR IN CHIEF
PUBLICATIONS EDITOR
Senior Assistant Jorma Arhippainen
University Lecturer Santeri Palviainen
Professor Hannu Heusala
Professor Olli Vuolteenaho
University Lecturer Hannu Heikkinen
Director Sinikka Eskelinen
Professor Jari Juga
Professor Olli Vuolteenaho
Publications Editor Kirsti Nurkkala
ISBN 978-952-62-0043-9 (Paperback)ISBN 978-952-62-0044-6 (PDF)ISSN 0355-3221 (Print)ISSN 1796-2234 (Online)
U N I V E R S I TAT I S O U L U E N S I S
MEDICA
ACTAD
D 1191
ACTA
Jenni Nikkilä
OULU 2013
D 1191
Jenni Nikkilä
PALB2 AND RAP80 GENESIN HEREDITARY BREAST CANCER PREDISPOSITION
UNIVERSITY OF OULU GRADUATE SCHOOL;UNIVERSITY OF OULU,FACULTY OF MEDICINE,INSTITUTE OF CLINICAL MEDICINE, DEPARTMENT OF CLINICAL GENETICS;BIOCENTER OULU