molecular biology-2016 1 - university of...

Molecular Biology-2016 1

http://mysite.science.uottawa.ca/jbasso/molecular/home.htm


GENERAL DIRECTIVES

1. Attendance is mandatory. Please be on time.

2. Shoes and appropriate dress must be worn at all times.

3. Leave outerwear, backpacks, and any other extraneous materials in the lockers outside of the

lab. It is strongly recommended that you have a lock. We are not responsible for lost or stolen

items.

4. Wear a lab coat and gloves at all times while working in the lab.

5. Remove your gloves anytime you walk out of the lab.

6. Remove your gloves when using either our or your own computers.

7. Always dispose of used pipettes, tips, microcentrifuge tubes, and other materials in the

biohazard bags provided so that they can be disposed of properly. Do NOT throw trash in the

autoclave bag.

8. Never lick your fingers, or put your fingers in your mouth.

9. No eating or drinking in the lab.

10. No radios, MP3 players, or CD players in the lab.

11. No use of cell phones or texting in the lab.

12. Notify the T.A. or instructor of any accident, no matter how minor.

13. Notify the T.A. or instructor of any breakage or malfunction of the equipment supplied.

Material you MUST have to work in the molecular biology lab:

A lab coat

A thin tipped permanent, preferably black, marker for labelling.

A note book to record your results. Any type is acceptable. Do not waste your money.

A USB key to save your pictures

A calculator. The use of cell phone calculators is not allowed

Optional but strongly recommended:

Notify the instructor of any safety or medical concerns so that appropriate accommodations can be

taken. For example, allergies, diabetes, hypoglycemia, epilepsy, exposed wounds, color blindness,

etc..

Notify the instructor of any special needs you may require so that appropriate accommodations can

be taken. For example, if you write your exams with SASS.


Schedule

Exercise 1 Jan. 12-15 Concentrations and Dilutions

Restriction digests & agarose gel electrophoresis

Exercise 2 Jan. 19-22 Project I: Verifying the restriction map of a DNA insert

Project II: Site directed mutagenesis of GFP

Plasmid DNA isolation

PCR

Exercise 3 Jan. 26-29 Project I: Verifying the restriction map of a DNA insert


Electrophoresis of GFP PCR amplicons

Digestion of GFP PCR amplicons and pGFPuv

Ligation of GFP amplicons

Exercise 4 Feb. 2-5 Project I: Verifying the restriction map of a DNA insert (XhoI)


Transformation of ligation mixtures

Project III: Genomic fingerprinting

Isolation of human genomic DNA from cheek cells

PCR amplification of ApoC2 VNTR

PCR amplification of ApoB RFLP

Exercise 5 Feb. 9-12 Project II: Site directed mutagenesis of GFP

PCR screening of transformants

Analysis of colony PCR products

Patching

Project III: Genomic fingerprints

Project IV: Transcriptional control of GFP by the LacZ promoter

E.coli RNA isolation

STUDY BREAK Feb. 14-20

MIDTERM Feb. 23-26


Exercise 6 Mar. 1-4 Project IV: Transcriptional control of GFP by the LacZ promoter

RNA gel electrophoresis

Northern transfer

Exercise 7 Mar. 8-11 Project IV: Transcriptional control of GFP by the LacZ promoter

Northern hybridizations

Project V: RT-PCR of the yeast ribosomal protein URP1

Yeast RNA isolation

RT-PCR

Exercise 8 Mar. 15-18 Project II: Site directed mutagenesis of GFP

Evaluation of GFP activity


Immunodetection of northern blots


Analysis of RT-PCR reactions

PRACTICAL FINAL EXAM Mar. 29-Apr. 1

THEORETICAL FINAL EXAM


Grading scheme

Option I Option II

Quizzes 5% + *Bonus 2% 5% + *Bonus 2%

Assignments (X4) 20% 20%

Midterm 15% 25%

Practical 15% 15%

Final 45% 35%

Total 102% 102%

*You need to obtain 100% on at least 4 out of 9 quizzes to obtain the bonus

QUIZ

Each week, starting on week 2, a quiz will be available on Blackboard on the Saturday before the

following week’s lab between 9Am and 9Pm of a duration of 30 minutes. These quizzes will

contribute towards 5% of your final grade. Additionally, a 2% bonus will be added to the final grade

of students who obtained 100% on at least 4 of the 9 quizzes.

ASSIGNMENTS

Assignments covering the procedures and the data you have obtained as well as associated

bioinformatics exercises. Assignments must be type written. All assignments may be submitted

individually or in groups of two (you and your teammate). A 10%/day penalty will be imposed on

late assignments. (Weekends will be considered as one day) Assignments are to be submitted on

Blackboard by 5Pm at the indicated due dates. ASSIGNMENTS MUST BE SUBMITTED IN PDF

FORMAT. NO OTHER FORMAT WILL BE ACCEPTED. Submission in a different format

will either result in a 1% penalty if the document could be accessed in Blackboard or a

notification in addition to a 1% penalty if the document could not be accessed.

ASSIGNMENT DUE DATES

ASSIGNMENT 1: WEEK OF JANUARY 26-29

ASSIGNMENT 2: WEEK OF FEBRUARY 9-12

ASSIGNMENT 3: WEEK OF MARCH 1-4

ASSIGNMENT 4: WEEK OF MARCH 22-25


Written Exams

All exams are open book. Access to the internet is allowed during both the final and midterm

examination.

The breakdown of the midterm exam (2.5 hours) will be as follows:

8 calculation problems (16 points)

1 calculation problem including a practical component. (4 points)

5 bioinfo exercises (5 points)

5 theoretical questions on bioinfo and molecular procedures (5 points)

2 out of 3 problems with an emphasis on data analysis and experimental design (10 points)

The final exam is cumulative and the breakdown (3 hours) will be as follows:

5 calculation problems (10 points)

10 bioinfo exercises (10 points)

5 theoretical questions on bioinfo and molecular procedures (5 points)

3 out of 4 problems with an emphasis on data analysis and experimental design (15 points)

Practical Exam

As with all exams, this exam is open book and will be given over a 2 hour period. Students will be

required to come to the lab, ON AN INDIVIDUAL BASIS, to carry out tasks which were routinely

performed during the semester. These may include, the preparation of PCR reactions, the preparation

of solutions, performing restriction digests, DNA isolations, migration of agarose gels, etc.. Grading

will be based on the results obtained and not on the approach used or their performance during the

course of the exam period.


Exercise 1

What we are doing today!

Concentrations and dilutions

Restriction digests & agarose gel electrophoresis


Introduction to concentrations One very important property of solutions that must be addressed is concentration. Concentration

generally refers to the amount of solute contained in a certain amount of solution. To deal with

concentration you must keep in mind the distinctions between solute, solvent and solution. Because

varying amounts of solute can be dissolved in a solution, concentration is a variable property and we

often need to have a numerical way of indicating how concentrated a solution happens to be. Over

the years a variety of ways have been developed for calculating and expressing the concentration of

solutions.

That can be done with percentages using measurements of weight (mass) or volume or both. It can

also be done using measurements that more closely relate to ways that chemicals react with one

another (moles).

In the pages that follow, several concentration types will be presented. They include volume

percent, weight percent, weight/volume percent, molarity (the workhorse of chemical

concentrations), and weight/volume.

You will get experience with more than one way of establishing the concentration of solutions. You

can prepare a solution from scratch and measure each of the components that go into the solution.

You can prepare a solution by diluting an existing solution. If an existing solution is colored, you can

determine its concentration by measuring the color intensity using colorimetry.

PERCENTAGE

The use of percentages is a common way of expressing the concentration of a solution. It is a

straightforward approach that refers to the amount of a component per 100. Percentages can be

calculated using volumes as well as weights, or even both together. One way of expressing

concentrations, with which you might be familiar, is by volume percent. Another is by weight

percent. Still another is a hybrid called weight/volume percent.

Volume percent is usually used when the solution is made by mixing two liquids.

For example, rubbing alcohol is generally 70% by

volume isopropyl alcohol. That means that 100

mL of solution contains 70 mL of isopropyl

alcohol. That also means that a litre (or 1000 mL)

of this solution has 700 mL of isopropyl alcohol

plus enough water to bring it up a total volume of

1 litre, or 1000 mL.

Volume percent = volume of solute

volume of solution x 100


Mass percent is a way of expressing the concentration of a solution as the mass of solute/mass of

solution.

To calculate the mass percent of a solution, you must divide the mass of the solute by the mass of the

solution (both the solute and the solvent together) and then multiply by 100 to change it into percent.

Mass/volume percent

Another variation on percentage concentration is mass/volume percent. This variation measures the

amount of solute in grams but measures the amount of solution in millilitres. An example would be a

5% (m/v) NaCl solution. It contains 5 g of NaCl for every 100 mL of solution.

Volume percent = mass of solute (in g)

volume of solution (in mL) x 100

This is the most common way that percentage solutions are expressed in this lab course.

Mass percent = mass of solute

mass of solution x 100

As an example, let's consider a 12% by

weight sodium chloride solution. Such a

solution would have 12 grams of sodium

chloride for every 100 grams of solution. To

make such a solution, you could weigh out 12

grams of sodium chloride, and then add 88

grams of water, so that the total mass for the

solution is 100 grams. Since mass is

conserved, the masses of the components of

the solution, the solute and the solvent, will

add up to the total mass of the solution.

12 % NaCl solution = 12 g NaCl

100 g solution

12 g NaCl

(12 g NaCl + 88 g water) = 12% NaCl solution


MOLARITY

Another way of expressing a concentration is

called molarity. Molarity is the number of moles

of solute dissolved in one litre of solution. The

units, therefore are moles per litre, specifically

it's moles of solute per litre of solution.

Molarity = moles of solute

litre of solution

Rather than writing out moles per litre, these units are abbreviated as M. So when you see M it

stands for molarity, and it means moles per litre (not just moles). You must be very careful to

distinguish between moles and molarity. "Moles" measures the amount or quantity of material you

have; "molarity" measures the concentration of that material. So when you're given a problem or

some information that says the concentration of the solution is 0.1 M that means that it has 0.1 moles

for every litre of solution; it does not mean that it is 0.1 moles.

WEIGHT/VOLUME

This means of expressing concentrations is very similar to that of percentages and is one of the most

popular ways used by molecular biologists. In contrast to percent, the concentration is expressed as a

mass per any volume the user wishes to use. Most commonly, these concentrations are expressed per

one measuring unit. For example, per 1 mL, 1 µL or 1L, etc. Essentially these expressions represent

the mass of solute present in a given amount of solution. For example a solution at a concentration of

1mg/mL contains 1 mg of solute in 1 mL of solution.

RATIOS

All the ways described above to express concentrations are done as a function of the total volume of

the solution which is the volume of the solvent and that of the solute. A common method used by

many molecular biologists and chemists is to express concentrations as ratios. In this case, the

relationship between the solvent and the solute is expressed independently of one another. For

example, we could say that the ratio between a solute and its solvent is 2:1. This indicates that for

two parts of the solute there is one part of solvent. Thus three parts total of solution.


Dilutions and the use of micropipettors

Dilutions: Being able to prepare dilutions is essential for the preparation of several reagents, reaction mixes,

and solutions used in a molecular biology lab. Basically, dilutions serve to reduce the initial

concentration of a compound in order to reach a new desired concentration. Solutions prepared by

the formulation of dilutions may be composed of one or more ingredients. The number of ingredients

within the solution does not in any way influence the formulation of dilutions. A brief overview of

the formulation of dilutions is presented below. Make sure that you fully understand their

preparation, since you will be called upon to prepare them throughout the semester as well as on the

final exam.

To comprehend how dilutions are prepared, you must grasp the following three concepts:

Concentration, dilution factor, and the dilution.

A concentration is defined as the quantity of a given element for a total volume of solution. Since a

quantity may be expressed in several different ways, concentrations are expressed as the unit of

measure of the quantity of the element/total final volume.

Ex. Grams/Litre

Molecules/Litre

Moles/Litre

Etc.

The dilution factor represents the multiple by which an initial concentration must be divided by in

order to obtain the desired final concentration. For example, if a solution contains 30g of caffeine per

litre of solution and you wish to reduce the caffeine concentration to 0.3 g/L, then you will have to

divide the initial concentration by 100, which represents the dilution factor. You can use the

following formula in order to determine a dilution factor.

Dilution Factor = Initial Concentration or What I have

Final Concentration What I want

The dilution represents the fraction of the component being investigated. For example, in the

previous problem a dilution of 1/100 was prepared. The dilution is expressed as a fraction of 1 over

the dilution factor. That is to say that the initial solution is represented as a fraction of the original

over the total. For example if you determined that a 1/100 dilution has to be prepared, this means that

one hundredth of the new solution must be represented by the original solution. Therefore for a total

volume of let’s say 2mL, 0.02mL must be represented by the original solution.


Preparing a solution that requires the dilution of more than one ingredient:

The basis for the formulation of a solution that requires the dilution of more than one ingredient is

the same as that of a solution with only one ingredient. The only difference is the volume of solvent

that must be added.

Let’s take as an example that we wish to prepare 10mL of a 0.1M solution from a stock solution of

2M.

To calculate the dilution factor: What I have = 2M = 20

What I want 0.1M

Thus the required dilution is 1/20, which means that one twentieth of the total must be represented by

the original solution.

Therefore to prepare 10mL we must add 0.5mL of the stock solution and make up the volume with

9.5mL of solvent.

If the solution to be prepared includes a second ingredient; let’s say that the final concentration of

this one must be 0.5M and that the stock solution is 3M.

Once again to calculate the dilution factor: What I have = 3M = 6

What I want 0.5M

Thus the required dilution is 1/6, which means that one sixth of the total volume must be represented

by the original solution.

Therefore, to prepare 10mL one must add 0.5mL of the first solution, 1.7mL of the second solution

and complete to the total volume with 7.8mL of solvent.

If the above explanations are not sufficient you can always consult the following web site:

http://www.wellesley.edu/Biology/Concepts/Html/dilutions.html

http://www.wellesley.edu/Biology/Concepts/Html/dilutions.html


Use of micropipettors

Micropipettes are indispensable tools in modern biology laboratories. How accurate are yours? How

precise are yours? What is the difference between accuracy and precision?

Accuracy refers to performance with respect to a standard value. Precision refers to the reliability or

repeatability of performance and doesn’t necessarily depend on a standard at all. These two features

are independent of each other. It is possible to have an instrument that is precisely inaccurate (or

accurately imprecise)!

Target analogy to illustrate accuracy and precision

Here, the bull’s-eye represents the "standard" against which accuracy is judged. To simultaneously

evaluate the accuracy and precision of your pipettes you must conduct multiple measurements and

compute the % Error of the Mean and Standard Deviation of the measurements for each pipette.

Directions for use of Gilson micropipettors

You have 3 sizes of micropipette. The P-1000, the P-200 and the P-20. The model numbers refer to

the maximum volume in microliters. Initially you will need to determine which pipette to use in a

given circumstance. For example, if you need to transfer 0.18 ml you would probably need to use the

P-200 because 0.18 ml = 180 µL and because the P-200 will measure this volume with greater

accuracy and precision than the P-1000 will.

Rules:

Always use a disposable tip. The P-20 and P-200 use the smaller tips and the P-1000 uses the

bigger ones.

Never draw any fluid into the white barrel of the pipette itself.

Never lay a pipette down while there is fluid in the tip. The fluid may accidentally find its

way into the barrel.

Never turn the adjustment scale below or above the full range settings.

To maximize precision, Always use the smallest volume pipette for a given total volume.

1. Set the desired volume:

Turn the volume up just a bit past the desired setting, then back down.

2. Attach a tip:

Press it on firmly, with a slight twisting motion. The tip must make an air-tight seal

with the pipette barrel.

Accurate & Precise Precise & Inaccurate Imprecise & Inaccurate


3. Depress the plunger to first stop.

4. Insert the tip in the liquid you want to transfer. Not far, just a bit below the surface.

5. Slowly release plunger.

6. As you withdraw the tip, touch it to the side wall of the tube to remove excess fluid from the

exterior.

7. To dispense, depress plunger slowly to the first stop; then depress all the way.

Never dispense a small volume into thin air. Always dispense into a liquid or onto the

wall of a tube so that adhesion will draw the expelled liquid off the tip.

8. With the plunger still fully depressed, remove tip from the liquid.

REMEMBER THAT YOUR MICROPIPETTORS ARE EXPENSIVE PIECES OF

EQUIPMENT!

Dilutions exercise with micropipettors (TO BE PERFORMED BY EACH STUDENT)

These exercises are included so that each individual will be familiar with the basics of solution

preparation, micropipetting, and the use of tips. (ALWAYS LABEL YOUR TUBES!! ).

Materials: Solution I (1% Compound “A” (m/v); M.W. 800g/mole)

Solution II (1.2M Compound “B” M.W. 60g/mole; Density of compound “B”: 1.6g/mL)

Method:

1. Prepare 1mL of each of the following solutions from the above stock solutions.

a. A 1.5mM solution of compound “A”.

b. A 0.36% (m/v) solution of compound “B”.

c. A 6% (v/v) solution of solution I.

d. A solution containing 0.5mg of compound “A” and 0.1% (v/v) of compound “B”.

e. A solution representing the following ratio: solution I: solution II : water : 2:1:2

2. Transfer 100 µL from each of the solutions to the appropriate wells of a 96 well plate as shown

below:

96 well microtiter plate layout (One plate/table)

Soln. a Soln. b Soln. c Soln. d Soln. e Person 1 Group 1

Soln. a Soln. b Soln. c Soln. d Soln. e Person 2








More dilutions: Determining the concentration of DNA (Groups of 2) As with most compounds, the concentration of nucleic acids can be determined

spectrophotometrically. To do so, the absorbance of the compound is determined at the wavelength

for maximal absorption. In the case of nucleic acids, this is in the UV range at a wavelength of

260nm. In the following exercise you will prepare samples at different known concentrations of

DNA and then use the absorbance values obtained to generate a standard curve representing

absorbance Vs DNA concentration (NOT AMOUNT). The standard curve generated will then allow

you to determine the concentration of an unknown DNA sample as well as determining the

relationship between DNA concentration and absorbance at a wavelength of 260nm. Specifically you

want to determine what concentration of DNA (in µg/mL or ng/µL) is equal to an absorbance of 1.0.

Materials

Salmon sperm DNA (200µL at 0.5mg/mL)

Salmon sperm DNA (200µL of unknown concentration)

Method:

1. Prepare 500µL in water of each of the following DNA standard solutions from the DNA sample

of known concentration: 0.0, 0.05, 0.025, 0.01, 0.005 and 0.0025mg/mL.

2. Prepare 500µL samples in water representing 1/4 and 1/10 dilutions of the unknown DNA

sample.

3. Transfer 200µL of each of the standard DNA solutions to a microtiter plate as indicated in the

plan below.

4. Transfer 200µL of each of the unknown DNA solutions to a microtiter plate as indicated in the

plan below.

5. Measure absorbance at 260nm.

DNA assay plate layout

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 1

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 2

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 3

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 4

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 5

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 6

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 7

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 8


Restriction digests & agarose gel electrophoresis (Groups of 2) The use of restriction endonucleases to cleave DNA at specific sites was a key breakthrough in

opening up the field of molecular biology in the mid-1970's. There are now several hundred different

restriction enzymes that are commercially available, and you can find detailed information about

some (including the ones that you will be using in this course) in catalogues from commercial

suppliers. Their specificity makes them very useful for several tasks including but not limited to the

mapping of DNA, cloning and subcloning of DNA, etc. The goal of this exercise is to introduce

you to restriction enzyme mapping and analysis. At the end of this exercise you should be able

to answer the following questions:

Which enzymes cut within the plasmid insert?

Which enzymes do not cut within the plasmid insert?

What is the size of the plasmid insert?

What are the possible positions of the different restriction sites?

The DNA fragment was inserted in which restriction site within the MCS?

For more information on restriction enzymes and their use consult the following web site.

http://askabiologist.asu.edu/expstuff/mamajis/restriction/restriction.html

Agarose gel electrophoresis

Agarose gel electrophoresis is the most commonly used technique to answer these questions. This

technique involves the separation of DNA molecules based on their size and conformation through

an agarose gel using an electric current. The electrophoretic migration of a DNA fragment through

agarose is inversely proportional to the logarithm of its molecular weight (for certain size classes

under defined conditions). [Tip! When you are estimating the sizes of restriction fragments, be sure

to keep in mind the accuracy that is warranted - i.e. the number of significant digits.] The

concentration of agarose used depends on the sizes of the DNAs being studied; for separating linear

DNAs in the 0.5 kb to 10 kb range, a 1% agarose gel is commonly used. After electrophoresis the

gels will be viewed under ultraviolet light and a digital picture will be taken. The intensity of

fluorescence is proportional to the amount (and length) of linear DNA and this method can be used

for a rough estimate of the quantity of DNA in the samples.

Agarose gel electrophoresis is performed at voltage levels that are potentially hazardous. The gel

boxes have a safety interlock feature and the leads must be removed before opening the lid.

ALWAYS TURN THE POWER SUPPLY OFF BEFORE DISCONNECTING THE LEADS.

Ethidium bromide, which is used in staining agarose gels to visualize DNA under ultraviolet light, is

a potential carcinogen; so always wear gloves when handling anything containing it. The UV light

source is also extremely hazardous to skin and particularly your eyes, so be sure to use proper

protection (gloves, lab coat, face mask) when viewing your agarose gels.

http://askabiologist.asu.edu/expstuff/mamajis/restriction/restriction.html


Each gel apparatus has two gel casting plates and three combs (8-wells, 10 wells, and 14-wells

holding about 14L, 12L, and 6L respectively). Remember that the 8 and 10-wells gels require

about twice as much DNA as the 14-wells one because of the difference in well size. Also if you

wish to visualize fairly small fragments (<500bp) which are less intensely stained you may consider

using more DNA and perhaps a higher percentage of agarose (e.g. 1.5% instead of the more standard

1%) for a better resolution.

Method:

A. Preparation of an agarose gel (8 well comb)

Materials:

Agarose

10X TBE

1. Prepare 200mL TBE buffer at a final concentration of 1X in your graduated cylinder. Mix well.

2. Mix the appropriate amount of agarose to obtain a final concentration of 1.0% m/v) in 25 mL of

1X TBE.

3. To dissolve the agarose, microwave (25-45 sec.). Loosely cover the mouth of the flask with

plastic to prevent evaporation. Once the agarose is totally dissolved, allow the flask to cool to 50-

60 oC (5 minutes or so).

4. Add 50 L of a stock solution of ethidium bromide at 1mg/mL (CAUTION! CARCINOGEN!)

and mix well.

5. Pour into the gel tray. After pouring the gel, place the 8 well comb (Well capacity approx. 14 L)

and remove any air bubbles (e.g. with a small tip). Allow to solidify at least 15-20 minutes.

6. Once the gel has solidified, remove the dams. Pour a sufficient amount of 1X TBE to cover the

gel by approx. 0.5cm.

7. Carefully remove the comb.


B. Checking the good operation of your gel

8. Attach electrodes so that the cathode (negative electrode) is at the "origin" end of the gel and the

samples will run through the gel towards the anode (positive electrode). (CAUTION! HIGH

VOLTAGE!)

9. Set the power supply at 100V. Turn on the power supply. Verify that the current is in the 40-55

mA range. If it is not there is a problem.

Possible problems:

The buffer is at the wrong concentration

The buffer in the gel is at the wrong concentration

You forgot to put buffer in the gel

C. Analysis of restriction digests

10. Load the following DNA samples. The unknown is a recombinant with pUC9 as the vector:

a. 1Kbp molecular weight markers (5 µL)

b. Recombinant pUC9 plasmid DNA, 5 µL

c. Recombinant pUC9 plasmid cut with BamHI, 5 µL

d. Recombinant pUC9 plasmid cut with EcoRI, 5 µL

e. Recombinant pUC9 plasmid cut with HindIII, 5 µL

f. Recombinant pUC9 plasmid cut with EcoRI + HindIII, 5 µL

g. Recombinant pUC9 plasmid cut with PstI, 5 µL

h. Plasmid pUC9 cut with BamHI, 5 µL

11. Carry out the electrophoresis at 100V for approx. 45 minutes and ask a teaching assistant to take

a picture.


DNA Size Markers


Exercise 2


Project I: Verifying the restriction map of a DNA insert


Plasmid DNA isolation

PCR


Restriction enzymes and agarose gel electrophoresis Following most restriction digest reactions it is necessary to answer the following questions:

Was the DNA digested?

Was the digest complete or partial?

Is there partially digested DNA?

Is there partially undigested DNA?

Have the DNA samples completely digested? If there is only partial cleavage of the DNA (for

example - low enzyme activity due to inappropriate reaction conditions or impurities in the DNA that

inhibit the enzyme), the slower migrating species (representing uncleaved fragments containing a site

for the enzyme used) are usually present in sub-stoichiometric amounts. In other words, because the

UV fluorescence intensity is proportional to the amount of ethidium bromide bound (and therefore

the amount/length of DNA), these species are not as intense as they would be if present in equimolar

amounts to the completely digested fragments.

Are the calculated sizes of restriction fragments internally consistent? If you are running different

digests of cloned DNA, it is important to check that the calculated sizes of the fragments add up to

approximately the same value in each of the different lanes (that is, the size of the intact DNA

molecule). Because there are inaccuracies in estimating sizes from the standard markers (and those in

the non-linear part of the curve have greater error), there usually is only approximate agreement

(perhaps 200-300 bp differences for a 5 Kbp recombinant plasmid). If there are greater discrepancies,

consider the following: Might there be co-migrating species? (Clues from relative fluorescence

intensity) Are partial digestion products being included in the calculation? Might there be multiple

low MW fragments (of correspondingly lower intensity that you cannot easily see)? Could you be

using the size of fragments which are the result of a partial digest in your calculation? Are linear size

markers being used to size linear (as opposed to non-linear) DNA molecules? Remember that linear,

relaxed circular and supercoiled double-stranded DNA molecules have different migration properties

under our conditions of agarose gel electrophoresis. Because the size markers that we are using are

linear ones, can they be used to estimate the size of an uncut recombinant plasmid?


Project I: Verifying the restriction map of a DNA insert (Groups of 2) The goal of this project is to give you an understanding of the technique of restriction mapping. In

the next few weeks you will be asked to use both experimental and bioinformatics approaches to

characterize a cloned DNA fragment. Each group of two will be working with a plasmid that

contains an insert representing one of the genes listed under the heading "sequences" > Unknown

"genes" on this course's web site. Amongst a group of four (per end of table) each group of two will

have the same unknown but in different orientations. These inserts were all obtained from a genomic

library created in the cloning vector pUC19. Briefly, genomic DNA was isolated from an organism,

digested, and the resulting fragments were then ligated into the vector pUC19 which was linearized

with an appropriate restriction enzyme whose site is within the multiple cloning site. (See figure on

next page).

The goals of this project are:

Using an experimental approach to: o Determine the insertion site

o Verify the size of the insert

o Verify the orientation of the insert

o Determine the restriction map

Tips for working with restriction enzymes

Always keep the enzyme stocks on ice when they're out of the -20oC freezer, and plan your setup for

that time to be as short as possible.

The enzyme is always the last component added to a reaction mixture, and it is added directly into

the solution in the bottom of the tube rather than as a drop on the side of the tube.

Make sure the solution is well mixed (e.g. "flicking" the tube with your finger) and if any drops are

along the side of the tube, spin them down using the microcentrifuge. Alternatively, the sample can

be mixed by vortexing (unless you are using high molecular weight genomic DNA in which case

there is the danger of shearing it).

Never touch the end of the plastic pipette tips with your fingers or anything except the solution that

you are transferring.

Always use a clean tip for each operation and dispose of the used tips at once.

In compliance with the BIOHAZARD GUIDELINES, all disposable items (micropipette tips,

microcentrifuge tubes, etc.) used when working with recombinant DNAs and bacterial host cells

must be placed in special waste containers (that is, the disposal boxes at your work stations which

you will then transfer to orange bags) to be autoclaved before disposal.


The following enzymes do not cut pUC19 : AdeI, AloI, ApaI, AscI, BaeI, BbvCI, BclI, BcuI, BglII, BoxI, BpiI, BplI, Bpu10I,

Bpu1102I, BsaAI, BsaBI, BseRI, BsgI, BshTI, BsmFI, Bsp68I, Bsp119I, Bsp120I,

Bsp1407I, BspTI, Bst1107I, BstXI, Bsu15I, BtrI, Cfr42I, CpoI, DsaI, Eco32I,

Eco47III, Eco52I, Eco72I, Eco81I, Eco91I, Eco105I, Eco130I, Eco147I, FseI, Kpn2I,

KspAI, MlsI, MluI, Mph1103I, MssI, MunI, Mva1269I, NcoI, NheI, NotI, PacI, PauI,

PdiI, Pfl23II, PsiI, Psp5II, PsyI, SacII, SanDI, SexAI, SfiI, SgfI, SgrAI, SmiI,

SrfI, SstII, Van91I, XagI, XcmI, XhoI, XmaJI.

The pUC vectors are small, high copy number, plasmids that have a multiple cloning site (MCS), the

pMB1 origin of replication responsible for the replication of the plasmid (source – plasmid pBR322),

and the bla gene, coding for beta-lactamase, which confers resistance to ampicillin (source – plasmid

pBR322). Note that all the restriction sites within the multiple cloning site occur only once.

Amorce univ. reverse

PvuII

PvuII

Univ. forward primer

Univ. reverse primer


Tips for restriction enzyme cleavage of plasmid DNA

Amount of DNA to use:

The ease of detection of your restriction fragments (by UV fluorescence after ethidium bromide

staining where fluorescence intensity is proportional to the mass of DNA in a fragment) will depend

on the amount of DNA used (and also parameters such as gel well width, sharpness of bands, etc).

Typically, 200-600ng plasmid DNA/lane is used for digests with a single enzyme. For digests that

result in many fragments you may need to restrict 400-1,000ng so that the smallest fragment can be

visualized after staining (WHY??)

After taking DNA samples from the freezer, be sure to completely thaw them before pipetting (to

obtain the correct amount of DNA in a given volume).

Your digestions will be carried out in the presence of a commercial buffer from Fermentas.

Restriction enzymes vary in their preferred salt concentration and this can be achieved by using

buffers with different salt concentrations.

A few enzymes require an incubation temperature other than 37oC. Also note that restriction

enzymes having the same recognition sequence are called isoschizomers (e.g. SacII and SstII) and

that some enzymes with very similar names (EcoRI, EcoRV) have distinctively different recognition

sequences (so be sure to read the labels on the enzyme tubes carefully).

In principle, 1 unit of restriction enzyme digests 1 g of purified DNA to completion in 1 hr.

However, because we are often using crude DNA preparations, we routinely increase the amount of

enzyme used and for high complexity genomic DNAs, incubation times are usually extended as well.

Typically restriction enzymes are supplied in concentrations of 5-10 units/L.

The final volume of enzyme should not exceed 1/10 the total reaction volume, because the

glycerol in enzyme stocks, added to prevent freezing upon storage in the freezer, may inhibit the

reaction. Also note that solutions containing glycerol are more difficult to pipette accurately than

aqueous solutions, so carefully monitor the volumes in the pipette tips.

For an overview on restriction mapping visit the following web sites:

http://faculty.plattsburgh.edu/donald.slish/RestMap/RestMapTutorial.html

http://www.vivo.colostate.edu/hbooks/genetics/biotech/enzymes/maps.html

http://wps.prenhall.com/esm_klug_essentials_5/17/4576/1171606.cw/content/index.html

http://faculty.plattsburgh.edu/donald.slish/RestMap/RestMapTutorial.html

http://www.vivo.colostate.edu/hbooks/genetics/biotech/enzymes/maps.html

http://wps.prenhall.com/esm_klug_essentials_5/17/4576/1171606.cw/content/index.html


List of restriction enzymes available

ENZYME SITE

BamHI G▼GATCC

HindIII A▼AGCTT

PstI CTGCA▼G

PvuII CAG▼CTG

ScaI AGT▼ACT

XhoI C▼TCGAG

▼- indicates cleaved phosphodiester linkage


Method & Materials:

Some of the restriction enzymes you will be using can be found in your freezer box. If they

are not in your freezer box they are in the freezer box of the group facing you on the same

end of bench as you.

Your unknown recombinant plasmid, at a concentration of 100g/mL is in your freezer box.

10X Restriction enzyme buffers are in your freezer box.

Setting up your restriction digests: Since different enzymes require different buffers, you will need to be flexible in making a restriction

digest. Prepare a chart listing all the components that you intend to add and their volumes before you

begin. As you add a component to your labelled tube, cross out the entry on your list. Choose the

restriction buffer which gives a 100% activity with the chosen enzyme. (Consult the table on the next

page)

Reaction mix for a typical single digest in a 30µL volume:

Ingredients Final Concentration/µL

DNA (100ng/µL) 250ng total

10X restriction buffer 1X

Enzyme (approx. 10 units/µL) 10 units

Water Complete to 30µL


Enzyme Recommended buffer

for 100% activity

% activity in Fermentas buffers

B G O R Tango

(blue) (green) (orange) (red) (yellow)

1X 1X 1X 1X 1X

ApaI B 100 20-50 0-20 0-20 20-50

BamHI BamHI 20-50 100 20-50 50-100 100

BclI G 20-50 100 20-50 20-50 100

BglI O 0-20 50-100 100 100 0-20

BglII O 0-20 20-50 100 50-100 0-20

BstXI O 20-50 100 100 50-100 50-100

ClaI Tango 20-50 20-50 20-50 20-50 100

EcoRV R 0-20 50-100 50-100 100 20-50

EcoRI EcoRI 0-20 NR 100 100 NR

HincII Tango 50-100 50-100 20-50 50-100 100

HindIII R 0-20 20-50 0-20 100 50-100

HinfI R 0-20 20-50 50-100 100 50-100

HpaII Tango 50-100 50-100 0-20 20-50 100

HphI B 100 0-20 0-20 0-20 20-50

KpnI KpnI 20-50 0-20 0-20 0-20 20-50

MluI R 0-20 20-50 50-100 100 20-50

NcoI Tango 20-50 20-50 20-50 50-100 100

NdeI O 0-20 0-20 100 50-100 0-20

NheI Tango 100 20-50 0-20 0-20 100

PstI O 50-100 50-100 100 100 50-100

PvuI R 0-20 20-50 50-100 100 50-100

PvuII G 50-100 100 20-50 50-100 20-50

RsaI Tango 50-100 20-50 0-20 0-20 100

SacI SacI 50-100 20-50 0-20 0-20 50-100

SacII B 100 50-100 0-20 0-20 50-100

SalI O 0-20 0-20 100 20-50 0-20

ScaI ScaI 0-20 0-20 0-20 0-20 0-20

SmaI Tango 50-100 0-20 0-20 0-20 100

SspI G 20-50 100 0-20 50-100 100

TaqI TaqI 0-20 20-50 20-50 20-50 20-50

XbaI Tango 50-100 50-100 20-50 0-20 100

XhoI R 0-20 50-100 50-100 100 20-50

NR – Not recommended

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er141-apai

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er005-bamhi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er072-bcli

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er007-bgli

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er008-bglii

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er102-bstxi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er014-bsu15i

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er030-eco32i

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er027-ecori

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er049-hincii

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er050-hindiii

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er080-hinfi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er051-hpaii

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er110-hphi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er052-kpni

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er056-mlui

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er057-ncoi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er058-ndei

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er097-nhei

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er061-psti

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er062-pvui

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er063-pvuii

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er112-rsai

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er113-saci

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er064-sali

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er043-scai

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er066-smai

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er077-sspi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er067-taqi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er068-xbai

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er069-xhoi


Your digests:

1. Setup the following restriction digests of 0.25g of DNA.

BamHI

HindIII

PstI

PvuII

ScaI

2. Prepare a digestion control, which contains all the components except for enzyme.

3. Incubate at 37oC for 60 minutes.

4. While your digestions are incubating, prepare a 1.0% agarose gel containing ethidium bromide.

5. Following the incubation period, transfer 5µL of your digestions to new appropriately labelled

tubes and then add 5X DNA loading buffer to each of them in order to obtain a final

concentration of 1X or more.

6. Store the remainder of each of your digests (properly labelled) at –20oC.

7. Load the samples containing the loading buffer in the gel.

8. Load 5μL of the digested pUC9 vector which has been prepared for you.

9. Load 5µL of the molecular weight ladder.

10. Also load on this gel 5μL, not including the loading buffer, of the plasmid pGFPuv isolated by

the alkaline lysis and the Qiagen methods (performed later)

11. Carry out the electrophoresis at 100V.

12. Following the electrophoresis, examine your gel under the UV light and take a picture for

analysis.

Restriction analysis with double digests Following the analysis of your digests, you should have a list of restriction enzymes that cut within

the cloned fragment of your plasmid and the sizes of the fragments generated by these digests. Based

upon this information you will generate a preliminary restriction map (or maps if there was no unique

unambiguous map).

Next week you are to build upon that data and test the validity of the map that you proposed. Your

goal is to use double digests to confirm as precisely as possible the position of the restriction sites

within the insert and to resolve any ambiguity.

A simple example will illustrate this approach. Suppose after the first round of digestions with single

enzymes you found a single restriction site in the insert for the enzyme X and no restriction sites for

EcoRI. Knowing that EcoRI can be found in the polylinker, then a double digest with EcoRI + X will

give the distance from X to the known EcoRI site.

For next week's lab you must determine which double digests will allow you to most precisely map

all restriction sites located within your insert. Note that you may use a combination of any of the

restriction enzymes used in this week's lab.



Plasmid DNA isolation (Groups of 2)

Most methods used to isolate DNA rely on the disruption of cells in the presence of strong

denaturants. Disruption may be by freezing and fracturing cells by grinding or blending or by

chemical lysis with strong alkali. The denaturants are essential to inactivate exogenous and

endogenous nucleases, which would otherwise degrade the DNA. Examine the components of the

DNA extraction buffers and determine the purpose of each chemical.

Plasmids are non-obligate, circular, extrachromosomal bacterial replicons. Plasmid DNA isolation

requires separation of this DNA from the chromosomal DNA in the bacterial cell as well as from the

polysaccharides, lipids and proteins that constitute the cell. Subsequent manipulation, especially

enzymatic modification, of the plasmid DNA requires that it be free of these impurities.

Purifying plasmid DNA by alkaline lysis

In this protocol, cells are lysed by strong alkali (NaOH) and the proteins are denatured by a strong

alkali and a strong detergent (SDS). The detergent complexes are then precipitated with a

neutralizing salt (KOAC). The plasmid is separated from the bacterial DNA by virtue of the

plasmid's relative stability in alkali. Leaving the plasmid preparation in alkali for too long will

destroy the plasmid DNA as well. The chromosome is also attached to the membranes and will be

precipitated by the salt and detergent. It is therefore important not to mix the solution too vigorously

and release the chromosomal DNA from it trap. The plasmid is smaller and will remain free in

solution. The plasmid solution is then separated from the cellular debris by centrifugation and further

concentrated by an alcohol precipitation.


A. Preparing your solutions:

Prepare 1mL of solutions I & II as well as TE from the following stock solutions:

10M NaOH

10% (m/v) SDS

0.5M glucose

1M Tris-Cl (pH 8.0)

0.5M EDTA

3M KOAc pH 5

Isopropanol

RNase 10mg/mL

Solution I:

50mM Glucose (buffer)

25mM Tris-Cl (pH 8.0) (buffer)

10mM EDTA (pH 8.0) (Chelator)

Solution II:

0.2M NaOH (from 10M stock) (Alkali)

1% (m/v) SDS (Detergent)

T.E.:

10mM Tris-Cl pH 8.0

1mM EDTA pH 8.0

B. Protocol for isolation of pGFPuv plasmid:

1. Spin at maximal speed 1.5mL of the plasmid containing E.coli suspension given to you in the

microcentrifuge for 1 minute.

2. Carefully pour off supernatant without disturbing the cell pellet. Use a micropipettor to remove

any remaining supernatant.

3. Add 200L of Solution I to the pellet and suspend the pellet by vortexing.

4. Add 400L of solution II. Cap the tube and mix by inversion.

5. Add 300L of ice cold KOAc. Mix well and keep on ice for 5 minutes.

6. Spin tube in the microcentrifuge at maximum speed for 5-10 minutes. This pellets the proteins

and chromosomal DNA along the side of the tube.

7. Transfer 700µL of the supernatant to a new microcentrifuge tube. Add an equal volume of

isopropanol. Close cap and mix well by rapidly inverting the tubes.

8. Spin tube at maximum speed for 5 minutes. Pour off supernatant carefully.

9. The white pellet at the bottom of the tube contains plasmid DNA and RNA.

10. Suspend the pellet in 50L TE pH8.0.

11. Add 1L of an RNAse solution at 10mg/mL and incubate at 37oC 5-10min.

12. You will need a sample of this preparation in another section of this lab exercise.


Plasmid DNA isolation with the QIAGEN kit Another method for the isolation of plasmid DNA makes use of commercial kits such as the one

offered by Qiagen. Fundamentally, this technique is based on the alkaline lysis procedure that you

previously performed. In order to compare the two, you will repeat the DNA purification from the

same bacterial culture with the Qiagen kit. At the end of this procedure you are expected to be able to

compare these two methods with respect to their similarities and differences.

Step 1

Steps 2-5

Steps 6-7

Steps 8-9

Step 10

Bacterial pellet

Wash

Elute

Bind

Suspend

Lyse

Neutralize

Pure plasmid DNA


Protocol for isolation of the pGFPuv plasmid: 1. Obtain the 1.5mL plasmid containing E.coli culture that was prepared for you and harvest the

cells by centrifugation at maximum speed for 1 minute. Decant supernatant.

2. Suspend the cell pellet in 250L of Buffer P1 (+ RNAse) and transfer to a microcentrifuge tube.

No cell clumps should be visible after suspension of the pellet.

3. Add 250L of Buffer P2 (containing NaOH/SDS) and gently invert the tube 4-6 times to mix. Do

not vortex, as this will result in shearing of genomic DNA. If necessary, continue inverting the

tube until the solution becomes viscous and slightly clear, but do not extend the time longer than

5 min because the plasmid DNA may become irreversibly denatured.

4. Add 350L of Buffer N3 (neutralization, high salt buffer) and immediately invert the tube gently

4-6 times. The solution should become cloudy.

5. Centrifuge at maximum speed for 10 min. A compact white pellet will form with the “cleared

lysate” above it.

6. Using a pipette, transfer the supernatant from step 5 to the QIAprep column placed in a 2mL

collection tube.

7. Centrifuge 60 sec at maximum speed. Discard the flow-through volume in an organic waste

container.

8. Wash the QIAprep spin column by adding 0.375mL of Buffer PE (containing ethanol) and

centrifuge 60 sec. at maximum speed. Discard the flow-through (organic waste). Repeat a second

time.

9. Discard the flow-through (organic waste), transfer to a centrifuge tube with the cap cut off and

centrifuge for an additional 1 min to remove residual wash buffer.

IMPORTANT: Residual ethanol from Buffer PE may inhibit subsequent enzymatic reactions so

steps 8 and 9 are therefore very important.

10. Place the QIAprep column in a clean 1.5mL microcentrifuge tube with the cap cut off. To elute

DNA, add 50L of Buffer EB (elution buffer = 10mM Tris-HCl, pH 8.5) and centrifuge for 1

min.

11. Transfer to a new microcentrifuge tube. Make sure to appropriately label and store this

preparation since you will need it for subsequent experiments and the final practical exam! Store in your freezer box at -20oC



PCR (Groups of 2) The ultimate goal of this project is to use PCR to change some of the amino acids in the GFP protein

encoded in the pGFPuv plasmid (See figure below). The strategy that will be used to achieve this

goal will be to use the polymerase chain reaction in order to perform site directed mutagenesis of the

gene while amplifying it. This project involves several parts which will be performed over the next

several weeks to come.


Primers have been designed to mutagenize and amplify part of the coding sequence of the GFP gene

located in the plasmid pGFPuv. The primers you will use are indicated below. Note that several

characteristics have been included to facilitate the cloning and the subsequent screening. Consult the

following web pages to refresh your knowledge on PCR:

http://www.maxanim.com/genetics/PCR/PCR.htm

http://www.dnalc.org/resources/animations/pcr.html

“Forward” primer: GFPfor

GCCAAGCTTGCATGCCTGCAGATCGAC

Characteristics:

A HindIII site is indicated in italics and underlined and will be used for cloning.

A one base change, indicated in red, underlined and in bold, represents a silent mutation which

abolishes a SalI restriction site.

“Reverse” primers:

GFPrev-1

TGTACTCGAGTTTGTGTCGGAGAATGTTTCCATC

GFPrev-2

TGTACTCGAGTTTGTGTCAGAGAATGTTTCCATC

GFPrev-3

TGTACTCGAGTTTGTGTGCGAGAATGTTTCCATC

GFPrev-4

TGTACTCGAGTTTGTG*CCGAGAATGTTTCCATC Characteristics:

An XhoI site is indicated in italics and underlined and will be used for cloning.

GFPrev-1 contains a one base change, indicated in red, underlined and in bold, which changes a

glycine codon to arginine.

GFPrev-2 contains a one base change, indicated in red, underlined and in bold, which creates a stop

codon.

GFPrev-3 contains a one base change, indicated in red, underlined and in bold, which changes a

glycine codon to alanine.

GFPrev-4 contains a one base deletion, indicated in red, underlined and in bold, which creates a -1

frameshift.

http://www.maxanim.com/genetics/PCR/PCR.htm

http://www.dnalc.org/resources/animations/pcr.html


Method:

Preparation of the pGFPuv DNA template: 1. Obtain the pGFPuv preparation you isolated by the Qiagen method.

2. Dilute a sample of your preparation by a factor of 100.

3. Use 5 µL of the diluted template for your PCR reaction.

PCR reaction setup:

Prepare your PCR reactions in a total reaction volume of 50L. In labelled PCR tubes (use 200L

thin walled PCR tubes) add the following ingredients in the order listed in the table below. For each

component use a new autoclaved tip. Note: The Taq polymerase will be added by the T.A.

Ingredients Stock Conc. Final Conc. Volume


Taq PCR buffer 10X 1X

GFPfor primer 2µM 0.2µM

*Assigned GFPrev primer 2µM 0.2µM

MgCl2 50mM 1.5mM

dNTP 2mM 200µM

pGFPuv - 5 µL

Taq polymerase 5 units/µL 0.05 units/µL

* Make sure that you record which GFP reverse primer you were assigned!

Once your reaction setup is completed give them to your teaching assistant. Your samples will be

returned to you next week.

PCR amplification conditions:

1. 1 cycle of 5min, 94oC to denature;

2. 30 cycles of 30sec 94oC to denature, 1 min at 68oC to anneal and extend.

3. 1 cycle of 5min, 72oC.

4. Cool to 4oC indefinitely.


Exercise 3


Project I: Verifying the restriction map of a DNA insert


Electrophoresis of GFP PCR amplicons

Digestion of GFP PCR amplicons and pGFPuv



Project I: Verifying the restriction map of a DNA insert You should already have determined which double digests you wish to perform for this week's

experiment. Note that for each double digest, you should also run the corresponding single digests on

your gel. For example if you wish to do a BamHI-EcoRI double digest, your gel should also include

BamHI and EcoRI single digests to facilitate the analysis.

Setting up your restriction digests: 1. Setup your restriction digests as previously. Note that since different enzymes require different

buffers you will need to be flexible in making your restriction digests. If both enzymes cut within

the same buffer, simply add 1.0L of each enzyme. However, if the two enzymes cut in different

buffers consult the compatibilities table in order to determine the best buffer for maximal activity

of the two enzymes.

2. Incubate your digests for 60 minutes at 37oC.

3. Fractionate your digests as previously on a 1% agarose gel. Make sure to use the appropriate

comb; that is the one that will provide the minimum number of required wells.


Project II: Site directed mutagenesis of GFP (Groups of 2)

Electrophoresis of GFP PCR amplicons Last week you performed a PCR amplification to amplify and mutagenize the GFP gene. This week

you will use agarose gel electrophoresis to determine whether your amplification was successful

before initiating the cloning.

1. Obtain your PCR reactions.

2. Transfer 8 L of your PCR products into new tubes and add 2.5L of 5X loading buffer. Return

the remainder on ice for subsequent experiments.

3. Load your samples on a 1% agarose gel, that has been prepared for you, containing ethidium

bromide and on which appropriate DNA size markers have been loaded.

4. Examine under UV light and take a picture for analysis.

Digestion of GFP PCR amplicons and pGFPuv The PCR products you amplified and analyzed by gel electrophoresis can now be cloned. Recall that

during the PCR reaction, restriction sites included to allow the directional cloning of the PCR

product. We will now have to digest both the pGFPuv plasmid and the PCR products in order to

generate compatible ends for the subsequent ligation reaction. Since the digestions and ligation

reactions are performed in different buffers, we will need to purify the DNA between these steps in

order to optimize the next reaction. The order of the steps is:

PCR reactions (stored in the freezer)

Digestion of amplicons and of pGFPuv

Purification of the PCR products digested with HindIII and XhoI

Ligation of amplicons in pGFPuv for subsequent transformation


Purification with the QIAQUICK purification kit of digested amplicons

Method: (Assigned groups of 2)

1. Add 5 volumes of Buffer PB to 1 volume of the PCR reaction and mix by inversion.

2. Place a QIAQUICK spin column in a 2mL collection tube.

3. To bind DNA, apply the sample to the QIAQUICK spin column and centrifuge for 1 minute.

4. Discard the flow-through to ORGANIC WASTE and place the QIAQUICK spin column back

into the same tube.

5. To wash, add 0.375mL of Buffer PE to the column and centrifuge for 1 minute.

6. Discard the flow-through to ORGANIC WASTE.

7. Wash again by adding 0.375mL of Buffer PE to the column and centrifuge for 1 minute.

8. Discard the flow-through to ORGANIC WASTE. Place the QIAQUICK spin column back into

the same tube. Centrifuge for 1 minute. This second centrifugation removes any residual ethanol

from Buffer PE that may elute with the DNA and interfere with subsequent steps.

9. Place the QIAQUICK spin column into a new labelled 1.5mL microcentrifuge tube.

10. To elute DNA add 30L of Buffer EB (10mM Tris-HCl, pH 8.5) to the centre of the QIAQUICK

spin column, wait 1 minute and then centrifuge for 1 minute.

11. Using a new pipette tip, transfer the recovered liquid BACK onto the center of the QIAQUICK

spin column and centrifuge for 1 minute.

12. Transfer the recovered liquid into a labelled 1.5mL microcentrifuge tube and store until needed.

(If you were unable to recover 30.0L, add elution buffer to bring the volume up to 30.0L).

Digestion of purified GFP amplicons or of pGFPuv vector


One of the groups of two will perform the digestion of the GFP amplicon whereas the other

group of two will perform the digestion of the pGFPuv plasmid.

1. Setup as follows a reaction mixture of 50µL to perform HindIII-XhoI double digests of both the

GFP PCR product and the plasmid pGFPuv that you purified by the Qiagen method in week 2.

Volume PCR Volume Vector

GFP PCR product 10µL ---------

OR pGFPuv plasmid --------- 5µL

Red 10X Restriction buffer 1X 1X

HindIII 1µL 1µL

XhoI 1µL 1µL

Water Complete to 50µL Complete to 50µL

2. Perform the digestion at 37oC for 1 hour.


Purification with QIAQUICK purification kit of digested GFP amplicons or pGFPuv vector


1. Add 5 volumes of Buffer PB to 1 volume of the restriction mixture and mix by inversion.

2. Place a QIAQUICK spin column in a 2mL collection tube.

3. To bind DNA, apply the sample to the QIAQUICK spin column and centrifuge for 1 minute.

4. Discard the flow-through to ORGANIC WASTE and place the QIAQUICK spin column back

into the same tube.

5. To wash, add 0.375mL of Buffer PE to the column and centrifuge for 1 minute.

6. Discard the flow-through to ORGANIC WASTE.

7. Wash again by adding 0.375mL of Buffer PE to the column and centrifuge for 1 minute.

8. Discard the flow-through to ORGANIC WASTE. Place the QIAQUICK spin column back into

the same tube. Centrifuge for 1 minute. This second centrifugation removes any residual ethanol

from Buffer PE that may elute with the DNA and interfere with subsequent steps.

9. Place the QIAQUICK spin column into a new labelled 1.5mL microcentrifuge tube.

10. To elute DNA add 30L of Buffer EB (10mM Tris-HCl, pH 8.5) to the centre of the QIAQUICK

spin column, wait 1 minute and then centrifuge for 1 minute.

11. Using a new pipette tip, transfer the recovered liquid BACK onto the center of the QIAQUICK

spin column and centrifuge for 1 minute.

12. Transfer the recovered liquid into a labelled 1.5mL microcentrifuge tube and store until needed.

(If you were unable to recover 30.0L, add elution buffer to bring the volume up to 30.0L).


QIAquick Spin Purification

Procedure

PCR reaction

or

Solubilized gel slice

or

Enzyme reaction

Bind

Wash

Elute


Project II: Site directed mutagenesis of GFP (Groups of 4)


Having digested the GFP PCR amplicon and the pGFPuv vector you will now proceed with the

ligation. Your ultimate goal is to substitute the wild type GFP sequence in the plasmid with the one

you mutagenized by PCR.

Ingredient Tube 1 Tube 2

Digested pGFPuv plasmid 5.0L 5.0L

10 X ligase buffer 2.0L 2.0L

GFP PCR amplicon 5.0L 0.0L

Water add water to complete the volume to 19.0L

Ligase 1.0L 1.0L

GIVE YOUR LABELED SAMPLES TO THE DEMONSTRATOR

The ligations will be incubated at room temperature until tomorrow and then stored at –20oC


Exercise 4


Project I: Verifying the restriction map of a DNA insert (XhoI)


Transformation of ligation mixtures

Project III: Genomic fingerprinting

Isolation of human genomic DNA from cheek cells

PCR amplification of ApoC2 VNTR

PCR amplification of ApoB RFLP


Project I: Verifying the restriction map of a DNA insert (XhoI) Following the analysis of your results you were able to precisely map all restriction sites within your

insert. You will now use this information to map a novel restriction site; XhoI. It was found that this

enzyme cuts once within your insert. Design a proper and appropriate experiment to determine the

precise position of the XhoI site.


Transformation of ligation mixtures (Groups of 4)

Last week you did ligations to substitute the wild type GFP sequence in the plasmid with the one you

mutagenized by PCR. To isolate, amplify, and maintain the desired recombinants you will now

introduce these plasmid recombinants into E.coli. You will transform Escherichia coli XL-1 cells

with your ligation mixtures from last week. Normally, E. coli does not readily take up DNA but these

have been treated with CaCl2 to alter the bacterial cell wall so that the cells you receive are now

COMPETENT for DNA uptake. However, even with this treatment only a small percentage of cells

uptake DNA. In order to identify these, a selectable marker, ampicillin resistance, is included in the

vector. Consequently, only cells which uptake a circular plasmid that can be replicated and

maintained will express this resistance and therefore grow on plates containing ampicillin. All cells

that do not uptake DNA or that uptake linear DNA, which cannot be replicated or maintained, will

not express this resistance and therefore will die on selective plates.

Materials:

Competent E.coli XL-1 Cells

YT-AMP plates (Supplemented with 50 g/mL ampicillin for selection).

Method:

1. Appropriately label 2 disposable tubes (15-mL polypropylene snap-cap tubes) and store on ice.

2. Dispense 90L of cells into each of the tubes, being careful not to contaminate the sides of the

tube with the micropipettor.

3. Add 5L of the correct ligation mixture to the labelled tube. Mix by swirling gently, and keep on

ice for 30 minutes.

4. Incubate for exactly 45 seconds in a 42oC water bath. This heat shock step is necessary to get

good transformation efficiency but if you hold the cells at 42oC too long you will kill the cells.

Then immediately transfer on ice.

5. Add 0.9 mL of pre-warmed (37oC) SOC broth. Incubate at 37oC for 1 hour with shaking to allow

the cells to start expressing the antibiotic resistance gene.

6. Spread 100μL & 200L of each transformation mixture onto YT-AMP plates and incubate

overnight at 37oC. Make sure your plates are clearly labelled and placed upside down in the 37oC

incubator overnight.

The following transformation controls will be performed by your demonstrators:

Cells treated with plasmid DNA (~5 pg of circular pUC)

Always use biohazard waste containers to dispose of microbial or recombinant DNA waste.


Project III: Genomic fingerprinting (Groups of 2) The analysis of Polymorphisms (SNP) has become a current trend to identify disease and non-disease

genotypes.

VNTR

The evolutionary principle of variation within a population is a cornerstone in biology. This variation

results from subtle differences in the DNA sequence in individuals of a given species. Variation

commonly originates by the mistaken duplication of a small sequence of nucleotides when only one

copy was present before replication. This results in a tandem repeat of the original sequence. If this

mistake occurs again in another round of replication, then three copies of a sequence will be in

tandem (figure). These tandem repeats are part of our chromosomes and as such, they will be

inherited according to Mendelian genetics. Over the centuries, the number of tandem repeat units has

increased, therefore each of us has inherited a variable number of tandem repeats (VNTRs) at many

loci scattered throughout our genomes. A VNTR can be thought of as a locus with each particular

number of repeated units being analogous to different alleles. Therefore, each human (except for

identical twins) carries a unique combination of VNTRs and these alleles can be used in population

studies or to identify a particular individual.

Figure. Illustration of variable number of tandem repeats (VNTRs). Single strands of DNA from the

same locus from three different individuals are shown. Within this region, the trinucleotide repeat

CAT is present once, twice, or three times which results in alleles of three different lengths.

RFLP

Another type of polymorphism which occurs is called restriction length Polymorphisms (RFLP).

These polymorphisms occur when a single nucleotide change occurs in a restriction site, thus

abolishing or changing it. Consequently, a given region of the genome may possess a restriction site

that is absent from the same region in another copy of the genome or in the genome of a different

individual.

In this project, you will determine your genotype of two polymorphism, a VNTR and an RFLP,

associated with the genes ApoC2 and ApoB respectively.


Isolation of human genomic DNA from cheek cells:

1. One person from each group of two should use a sterile cotton swab to gently scrape the inside of

one cheek six times. Without rotating the swab, move the swab directly over to the inside of the

other cheek and gently scrape six times.

2. Insert the cotton portion of the swab into a 1.5mL microcentrifuge tube. Then, break off the stick

just above the cotton so that the cotton part falls into the tube.

3. Add 400µL of 1X PBS pH 7.4 to your sample tube.

4. Add 20µL of proteinase K followed by 400µL buffer AL. Mix immediately by vortexing for 15

sec. Do not add proteinase K directly to buffer AL.

5. Incubate at 56oC for 10 min. Spin briefly to remove drops from tube walls and lid.

6. Add 400µL 99% ethanol. Vortex 8 to 10 sec to mix. Spin briefly to remove drops from tube walls

and lid.

7. Apply 600µL of your mixture to the column. Cap to avoid aerosols and centrifuge at 8k rpm for

1min. Change collection tube.

8. Apply remaining mixture to the column. Cap to avoid aerosols and centrifuge at 8k rpm for 1min.

Change collection tube.

9. Add 500µL AW1 buffer. Cap and centrifuge at 8k rpm for 1min. Change collection tube.

10. Add 500µL AW2 buffer. Cap and centrifuge at maximum rpm for 3min. Change collection tube.

11. Centrifuge at maximum rpm for 1 min to remove residual buffer and reduce carryover.

12. Place the QIAprep column in a clean 1.5-mL microcentrifuge tube with the cap cut off. Add

150µL AE buffer to the column. Wait 1 min and then centrifuge at 8k rpm for 1 min to elute.

13. Transfer eluted DNA to a new properly labelled tube and store for future use.


PCR amplification of VNTR of ApoC2 & the RFLP of ApoB

Method:

Even numbered groups will amplify RFLP of ApoB Gene

Odd numbered groups will amplify the VNTR of ApoC2

Prepare your PCR reactions in a total reaction volume of 50L. In labelled PCR tubes (use 200L

thin walled PCR tubes) add the following ingredients in the order listed in the table below. For each

component use a new autoclaved tip. Note: the Taq polymerase will be added by the T.A.

Ingredients Stock

Conc.

Final Conc. Volume


Taq PCR buffer 10X 1X

ApoB For or D1S80 For primer 2µM 0.2µM

ApoB Rev or D1S80 Rev primer 2µM 0.2µM

MgCl2 50mM 2.0mM

dNTP 2mM 200µM

Cheek Genomic DNA 5µL 5µL

Taq polymerase 5 units/µL 0.05 units/µL

Once your reaction setup is completed give them to your teaching assistant. Your samples will be

returned to you next week.


1. 1 cycle of 5min, 94oC to denature;

2. 35 cycles of 30sec 94oC denature, 30sec 55oC (ApoB) or 65 oC (ApoC2) anneal, 1min 72oC

extend.

3. 1 cycle of 5min, 72oC.

4. Cool to 4oC indefinitely.


Exercise 5



PCR screening of transformants

Analysis of colony PCR products

Patching

Project III: Genomic fingerprints


E.coli RNA isolation



PCR screening of transformants (Groups of 2)

If your transformations were successful, you will observe many colonies on your plates representing

independent E.coli clones that harbour plasmid. Your first task will be to enumerate these colonies

on all the transformation plates, including the ligation controls, as well as the transformation

controls. Record the number of colonies on each plate.

MAKE SURE TO TAKE AN ADEQUATE RECORD OF THE RESULTS; THESE WILL

NOT BE GIVEN OUT TO YOU AFTERWARDS!!

Once you have recorded your counts you will use PCR and restriction digestion to screen the

recombinants for inserts (and view PCR products after electrophoresis).

Method:

1. Label 8 microcentrifuge tubes from 1-8 and draw a grid on a YT+ amp plate labelled 1-8.

2. Add 50L of water to each of the tubes. Using a sterile pipette tip, pick one of the colonies on

your plate representing the transformation of plasmid + insert. Gently streak it on the quadrant of

the plate labelled 1 and then place the tip in the corresponding tube labelled 1.

3. Repeat the above procedure for 7 more colonies. Place your agar plates at the designated area so

that they may be incubated.

4. Briefly vortex each of the 8 tubes containing the pipette tip, to suspend the colony (Hold the tip

while vortexing).

5. Remove the tip from each tube, close the tube, and boil for 5 minutes. Place on ice for 1 minute.

6. Centrifuge at maximum speed for 5 minutes. You will be using the supernatant for the PCR

analysis.

7. Prepare a PCR cocktail for 9 reactions of 20L. KEEP ON ICE. Below is the recipe for a single

20L reaction.

PCR Reaction

Solution Stock conc. Final conc.

Water L to a final volume of 20 L

Taq PCR buffer 10 X 1 X

MutScreenFor primer 2 M 0.2 M

MutScreenRev primer 2 M 0.2 M

MgC12 50 mM 2.5 mM

dNTPs 2 mM 200 M

Taq DNA Pol. 5 U/L 2.5 U

8. Distribute 19L of cocktail to each of 8 appropriately labelled PCR tubes (ON ICE)

9. Add 1L of each of the colony supernatants you obtained in step 6 to each of the appropriate

PCR tubes.

10. Prepare a 1.25% agarose gel containing ethidium bromide.



i. 1 cycle of 5min, 94oC to denature;

ii. 30 cycles of 30sec 94oC to denature, 1 min at 68oC to anneal and extend.

iii. 1 cycle of 5min, 72oC.

iv. Cool to 4oC indefinitely.

Restriction digestion of colony PCR products:

1. Obtain your PCR reactions.

2. Prepare 8 SalI digestions, one for each of your PCR reactions, in a final volume of 20µL

containing 5µL of each of your PCR reactions.

3. Prepare an undigested control, using any of the 8 PCR reactions.

4. Digest for one hour.

4. Following the digestion, add 5µL loading buffer to each sample.

5. Load 10L of each mixture, as well as the molecular weight ladder, on your 1.25% agarose.

Migrate for 1 to 1.5 hours at 100 V.

6. Take a picture of your gel.

Project III: Genomic fingerprints (Groups of 2)

ApoB gene:

1. Obtain your PCR reactions for the ApoB gene.

2. Use 10µL of the PCR reaction to set up a restriction digest with the enzyme EcoRI in a final

volume of 20µL.

3. One group in the class will prepare an undigested control as well.

4. After having performed the digest for one hour, add loading dye and load on the pre-poured gel.

5. Once everyone has loaded the gels, these will be migrated and a picture taken for your analysis.

ApoC2 gene 1. Obtain your PCR reactions for the ApoC2 gene.

2. Add loading dye to a 10µL sample of the PCR reaction.

3. Load on the pre-poured gel.

4. Once everyone has loaded the gels, these will be migrated and a picture taken for your analysis.



E.coli RNA isolation This week you will initiate experiments which will allow you to examine the transcriptional

regulation of the GFP gene which is under the control of the LacZ promoter in pGFPuv. You will

examine the relative abundance of the GFP transcript in E.coli cells grown under different

conditions. The method which will be used is referred to as a northern analysis. This technique

involves the isolation, fractionation and transfer of RNA.

As with all experiments, the isolation of the starting material in a pure form is crucial. You will be

isolating RNA from E.coli cells and then use spectroscopy to estimate the RNA concentration and

purity.

Working with RNA is more demanding than working with DNA as RNA is more susceptible to

degradation. Thus you must be very careful not to contaminate any solution.

Always wear gloves!! Method:

Each group of 2 will be assigned one of the following growth conditions from which you will isolate

RNA:

Culture grown in LB.

Culture grown in LB + glucose.

Culture grown in LB + lactose.

Culture grown in LB + IPTG.

1. Centrifuge at maximum speed for 1 minute 1.5mL of the assigned bacterial culture.

2. Remove supernatant and then add 0.5mL RNAzol reagent. Resuspend pellet by vortexing.

3. Incubate for 5 min at 65oC.

4. Add 0.2 mL chloroform, vortex vigorously for 15 sec and keep at R.T. for 2-3 min.

5. Centrifuge at maximum speed for 5 min.

6. Transfer approximately 75% of the upper aqueous phase (without disturbing the phases) to a new

microcentrifuge tube and add 1 volume of isopropanol.

7. Store at room temperature for 5 minutes.

8. Centrifuge at maximum speed for 5 minutes. Remove supernatant.

9. Briefly air-dry the pellet.

10. Resuspend the pellet in formamide.

RNAzol:

1.86 M guanidine isothiocyanate

12 mM sodium citrate

87 mM sodium acetate pH 4.0

0.37% sarcosyl

42 mM 2-mercaptoethanol


Determining the RNA concentration and your recovery by spectroscopy

1. Prepare a 1/20 dilution in water in a final volume of 100l of an aliquot of your RNA and

measure the absorbance at both 260nm and 280nm against a blank. Sore the remainder of your

sample in an appropriately labelled tube in your freezer box until next week.

2. You can estimate the RNA concentration using the formula (for single-stranded RNA) that an

absorbance of 1.0 at 260nm is equivalent to an RNA concentration of 40g/mL. If the ratio of

A260/A280 is >1.90 the RNA is relatively pure and free from proteins.

3. Calculate the amount of RNA you have recovered.


Exercise 6



RNA gel electrophoresis

Northern transfer



RNA gel electrophoresis Northern blot analysis can be used to detect an individual RNA species within a population of total

RNA from an organism. Before a northern blot can be performed the RNA molecules are resolved as

a function of their size on a denaturing agarose gel. The most common type of RNA gel is

formaldehyde. This type of gel provides denaturing conditions that prevent base-pairing and thus

reduce RNA secondary structure. This is important because unlike double-stranded DNA fragments,

which have the same conformation regardless of length, single-stranded RNAs can adopt different

conformations due to intra-strand base-pairing. This would affect electrophoretic migration and make

size estimation inaccurate.

Materials:

Ribonucleases are everywhere! To minimize the danger of RNA degradation, wear gloves and keep

samples on ice unless otherwise specified.

Formaldehyde and formamide are toxic chemicals. Wear gloves when handling these solutions and

work in the fume hood whenever possible.

Methods:

A. Preparation of an agarose-formaldehyde gel (One gel per groups of 4) 1. To prepare a 1.5% agarose-formaldehyde gel (25mL) (using the 8 well comb), combine the

following:

5X MOPS buffer 5 mL

H20 15.5 mL

Agarose 0.375 g

2. Dissolve agarose in microwave oven. Cool slightly; then add 4.5mL of formaldehyde (37%

solution) (WORK IN THE FUMEHOOD. CAUTION! VOLATILE FUMES). Swirl to mix

and cast the gel immediately.

3. Close the cover and let the gel set for at least 30 minutes.


B. Preparation of RNA samples (per groups of 4)

You will prepare four different RNA samples. It is important that equal amounts of RNA be

loaded in each lane.

You will need the following RNA samples:

Total RNA sample from cultures grown in LB.

Total RNA sample from cultures grown in LB + glucose.

Total RNA sample from cultures grown in LB + lactose.

Total RNA sample from cultures grown in LB + IPTG.

1. To prepare the RNA samples prior to loading on the gel, mix the following components using

labelled tubes KEPT ON ICE:

Final volume = 30 L

RNA sample: L (This volume of sample should contain 5g in a maximum volume of 9

L)

Loading buffer: 21L (RNA loading buffer not the DNA loading buffer)

Water to 30 L: L

2. Incubate your samples at 700C for 10 minutes and then place the samples on ice. If there is liquid

on the side of the tube, spin in the microcentrifuge for a few seconds.

3. Each group of 4 should load a gel as follows: Load 14L aliquots of each of the RNA samples

from the different growth conditions on one gel as follows:

LANE SAMPLE 1 Empty

2 Empty

3 RNA from cultures grown in LB.

4 RNA from cultures grown in LB + glucose.

5 RNA from cultures grown in LB + lactose.

6 RNA from cultures grown in LB + IPTG.

7 Empty

8 Empty

This will result in one gel containing samples from two groups of 4 and duplicate gels per table.


C. Gel Electrophoresis and Northern Transfer 1. The gel running buffer will be 1X MOPS buffer. Run the gel at 80 V (current ~80 mA) until the

bromophenol blue dye is further than half way down the gel.

2. Remove the gel from the electrophoresis chamber, observe under U.V. and take a picture.

NB: Formaldehyde gels are MORE FRAGILE than non-denaturing gels so be extra careful!

3. Wash the gel 2 times with 5 volumes of water, then 1 time with 2 volumes of 10 X SSC for about

5 min each time. This is necessary to wash away the formaldehyde which otherwise would

prevent hybridization.

D. Capillary transfer (per groups of 4)

You will be provided with a nylon membrane as well as filter paper that were cut to the same size as

the gel. Avoid as much as possible handling the membrane with your fingers.

1. Label the membrane on one end with your lab day, group number, and “RNA”.

2. Wet membrane in a tray of distilled water, and then in 2X SSC.

3. Set up your northern transfer as shown on the next page. Make sure to surround the periphery of

your gel with Saran wrap so as to avoid a short circuit.

4. Following the transfer, the membrane is dried, labelled, UV cross-linked and stored in a plastic

bag.


4.

5.

6.

7.

8.

9.

10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30.

SOUTHERN BLOT SETUP

Nylon membrane cut to

exact size of gel

Gel

Face down

Two layers of filter paper

soaked in 20X SSC

Filter paper dipping in

20X SSC

Glass or plastic plate

support over tray filled

with 20X SSC

Stack of paper towels Weight

Capillary flow

Northern capillary transfer


Exercise 7



Northern hybridizations


Yeast RNA isolation

RT-PCR



Northern hybridizations (Groups of 4) In past weeks you have generated a Northern. This week you will prepare these membranes for

hybridizations with a Dig-labelled probe.

General information about hybridization of nucleic acids:

Before you hybridize your probe to a membrane, a prehybridization step is performed. This step is

necessary to reduce both background and non-specific hybridization. Background is defined as

non-specific binding of your probe to the membrane and does not involve hybridization. Non-

specific hybridization represents hybridization of you probe to sequences that possess a low degree

of identity. In order to reduce both of these events the membranes are initially exposed to a blocking

reagent that usually includes a high concentration of non-specific DNA, such as salmon sperm DNA.

The purpose of this reagent is to saturate any binding sites on the membrane as well as non-specific

hybridization sites on the nucleic acids.

Following the prehybridization step, the membranes are exposed to the labelled probe, once again in

the presence of the blocking reagent. Depending on the stringency conditions, the probe will easily

out-compete non-specific DNA binding and thus hybridize specifically to complementary sequences.

Excess probe, which remained unhybridized, or that is weakly hybridized to poorly complementary

sequences is then removed by a series of washes of varying stringency. Note that stringency is

determined by both temperature and salt concentration. Both of these parameters determine the level

of homology required to allow hybridization. The lower the stringency the more permissive the

hybridization conditions and thus the lower the degree of complementarity required to allow the

formation of stable hybrids. Inversely, the higher the stringency the less permissive are the

hybridization conditions and thus the higher the degree of complementarity that is required to allow

the formation of stable hybrids.


Prehybridization

You should have duplicate northern membranes on each bench.

Prehybridization/Hybridization Solution:

5X SSC (20X SSC: 3M NaCl et 0.3M NaCitrate)

0.02% sodium dodecyl sulfate (SDS)

20 mM sodium maleate, pH 7.5

4M Urea

100μg/mL Salmon sperm DNA

1. Place your northern blot in a 50mL Falcon tube that has been clearly labelled with your group’s

name. Add 10mL of prehybridization mix to the tube and close tightly.

2. Place your tube in the hybridization oven glass tube. Be careful not to scratch the inside of the

glass tube.

3. Clamp the glass tube into the rotator wheel in the hybridization oven. Ensure that the tubes are

balanced by placing a second glass tube on the opposite side of the rotator.

4. Rotate gently (setting #3) at 42oC for a minimum of 1 hour.

Hybridizations:

You are now ready to initiate the hybridization with the either a probe against the GFP gene

(experimental) or the bla gene (internal control). But before you can do the hybridization, the

labelled DNA must be denatured. Make sure to record which probe you were assigned!

1. Boil the probe you were assigned for 3 minutes and then quickly chill by placing the tube in an

ice bath. Spin in a microcentrifuge to bring any liquid to the bottom.

Setting up you hybridizations

2. Decant the prehybridization solution from the tube containing your northern membrane.

3. Immediately add 10 mL fresh hybridization mix to each tube.

4. Then, carefully add 50L of either the denatured GFP or bla probe (as assigned) directly into the

hybridization mix of the tube with the northern membrane. Avoid direct contact of the

concentrated probe with the membrane. Cap the tubes tightly and place them in the hyb oven as

previously.

5. Carry out the hybridization of your northern membranes at 42oC overnight.

FOLLOWING THE HYBRIDIZATION, THE MEMBRANES WILL BE WASHED BY THE

T.A.S AND THEN STORED FOR LATER USE


Project V: RT-PCR of the yeast ribosomal protein URP1 (Groups of 2)

Yeast RNA isolation (Steps 1-3 have been done for you)

1. Obtain 10mL of a yeast culture.

2. Centrifuge for 10 minutes at 7 000 rpm.

3. Discard supernatant.

4. Suspend pellet in 200μL lysis buffer.

5. Transfer to a screw cap tube containing glass beads and 200μL phenol:chloroform:isoamyl

alcohol (25:24:1).

6. Vortex 2 minutes and then place on ice two minutes.

7. Repeat step 6 two more times.

8. Centrifuge at maximum speed for 5 minutes. Transfer the upper aqueous phase to a new tube.

9. Add 0.1 volumes of 3M NaOAc and 1mL 99% ETOH. Mix by inversion and centrifuge at

maximum speed for 2 minutes.

10. Discard supernatant and suspend pellet in 100μL DEPC treated water.

11. Determine yield and purity.

RT-PCR Another method that can be used to compare the relative abundance of a transcript under different

conditions is RT-PCR. In contrast to northern analysis, this method is more sensitive and ideal for

weakly expressed transcripts.

In contrast to standard PCR reactions, such as the one you performed from genomic DNA, RT-PCR

is an amplification that uses RNA rather than DNA as template. However, since the thermostable

DNA polymerase that is used in the PCR reaction can only use DNA as a template, the RNA of

interest must first be transcribed into DNA. This can be accomplished by the RNA-dependent DNA

polymerase reverse transcriptase (RT). Initially, reverse transcriptase is used to synthesize a single-

stranded complementary DNA (cDNA) strand of the RNA of interest. An oligo dT primer will be

used for this reaction. Once the cDNA has been generated, a standard PCR reaction can be used to

amplify the DNA sequence complementary to the mRNA.

Consult the following web site for an overview of RT-PCR:

http://www.bio.davidson.edu/courses/Immunology/Flash/RT_PCR.html

http://www.bio.davidson.edu/courses/Immunology/Flash/RT_PCR.html


Method:

Each group will perform the following 5 reactions:

PCR reaction of DNAse treated RNA not treated with RT

PCR reaction of RT reaction on DNAse treated RNA

PCR reaction of RT reaction on RNA NOT treated with DNAse

PCR reaction of RNA NOT treated with either DNAse or RT

PCR reaction without RNA (No template)

Preparation of RNA samples for RT reactions:

Prepare a dilution mixture of your RNA as follows. This dilution will then be used as your source of

RNA for all the required reactions described in this section.

4.0g of your RNA sample

5.0L of 10X DNAse I Buffer

Water to a final volume of 48L

DNAse treatment of total RNA:

1. Before you initiate the RT reaction, you want to ensure that you eliminate any contaminating

DNA from your RNA. In a final volume of 25L add the following:

24L of your diluted RNA sample

1L DNAse I

2. Incubate at room temperature for 15 minutes. Following the DNAse I treatment, inactivate the

enzyme by adding 2.5L of 25mM EDTA and heating at 65oC for 10 minutes. Chill on ice.

Reverse transcriptase reactions:

3. Prepare your RT reactions in PCR tubes as indicated below. Use a new autoclaved tip for each

component added.

4. Add 19L of DEPC treated water to each of two labelled PCR tubes labelled as follows:

+DNAse and -DNAse

5. Add 4.0L of the oligo-dT primer to each tube.

6. Add 4.0L of a 2mM dNTP mixture to each tube.

7. Add 2L of your DNAase treated RNA to the tube labelled + DNAse.

8. Add 2L of your untreated RNA dilution to the tube labelled -DNAse.

9. Allow annealing of the oligo-dT primer by incubating your RT pre-reaction mixture at 70oC for 5

minutes.

10. Let your tubes slowly cool down on the bench for 5 minutes.

11. Add 8.0L of 5X RT buffer to each tube.

12. Add 2.0L of 100mM DTT for a final concentration of 5mM to each tube.

13. Add 1.0 L MMLV reverse transcriptase at 200U/L for a final concentration of 5U/L to each

tube.

14. Incubate at 42oC for 60 minutes.

15. Inactivate the RT enzyme by incubating the reaction mixture at 70oC for 15 minutes.


PCR reactions: 1. Following the RT reactions, prepare the following PCR reactions in 6 appropriately labelled

PCR tubes:

PCR reaction of yeast genomic DNA (Will be provided)

PCR reaction of DNAse treated RNA not treated with RT

PCR reaction of RT reaction on DNAse treated RNA

PCR reaction of RT reaction on RNA NOT treated with DNAse

PCR reaction of RNA NOT treated with either DNAse or RT

PCR reaction without RNA (No template)

Primers:

URP (FOR) GTGCAATTTCAGGCATTACCG

URP (REV) CTGGGGCCAAAGTTTGAGGAAC

Sample Stock conc. Final conc.

Water L to a final volume of 49L

Taq PCR buffer 10 X 1X

URP (For) primer 2M 0.2M

URP (Rev) primer 2M 0.2M

MgCl2 50 mM 2.0mM

dNTP 2mM 200M

Taq Polymerase 5units/µL 2.5units/reaction

2. Add 1L of each of the appropriate templates or water to each of the appropriate PCR mixes.

Once your PCR reactions have been prepared, place them in the ice bucket at the front for the

PCR to be performed.

3. Your PCR reactions will be returned to you next week.

Your PCR reactions will be performed under the following conditions:

i. 1 cycle: 5 min, 94oC to denature;

ii. 30 cycles: 30sec@94oC to denature, 30sec@ 58oC to anneal, 1.0 min 72oC to extend.

iii. 1 cycle: 5 min, 72oC.

iv. Cool to 4oC.


Exercise 8





Immunodetection of northerns


Analysis of RT-PCR reactions





Immunodetection of northern blots Having performed the hybridizations of the northern membranes you will now carry out a procedure

to detect the hybrids. Note that the membranes have been washed for you to remove free as well as

weakly hybridized probe.

All treatments are carried out at room temperature

1. Place the membrane in a small plastic bag.

2. Add 15 mL of maleic acid buffer 1X. Incubate with shaking for 15 min. Discard.

3. Add 20 mL of blocking solution. Incubate with shaking for 30 min. Discard.

4. Add 10 mL of antibody solution. Incubate with shaking for 30 min. Discard.

5. Transfer membranes to Tupperware containers. DO NOT LET MEMBRANES DRY! Add 50

mL of washing buffer and incubate with shaking for 15 min. Discard and repeat step 5 once

more.

6. Add 50 mL of maleic acid buffer 1X and incubate with shaking for 15 min. Discard.

7. Add 10 mL of detection buffer and incubate with shaking for 5 min. Discard.

8. The next steps must be completed quickly and in a coordinated fashion. Inform your teaching

assistant or the lab technician before proceeding. Put 2.5mL of the CDP-Star solution in a corner

of the container and allow it to flow over the membrane until it is covered. DO NOT PUT the

solution directly on the membrane. Incubate for 5 minutes in the dark in your drawer

9. Place your membrane, RNA side up, on a Whatman filter paper.

10. Place 2 membranes, RNA side up, in the photography apparatus. Have a picture taken of the

chemiluminescence reaction (exposure 2 to 10 minutes).



Analysis of RT-PCR reactions 1. Pour a 1.5% agarose gel.

2. Obtain your RT-PCR reactions from the freezer.

3. Add the appropriate amount of DNA loading buffer to 10µL samples of each of your reactions.

4. Load and fractionate at 80V.

5. Following the migration, visualize under UV and take a picture.


Appendices


Amino acid 3 letter code One letter code

alanine ala A

arginine arg R

asparagine asn N

aspartic acid asp D

asparagine or aspartic acid asx B

cysteine cys C

glutamic acid glu E

glutamine gln Q

glutamine or glutamic acid glx Z

glycine gly G

histidine his H

isoleucine ile I

leucine leu L

lysine lys K

methionine met M

phenylalanine phe F

proline pro P

serine ser S

threonine thr T

tryptophan try W

tyrosine tyr Y

valine val V


Spectrophotometric Conversions

1 A 260 unit of double-stranded DNA = 50 µg/ml

1 A 260 unit of single-stranded DNA = 33 µg/ml

1 A 260 unit of single-stranded RNA = 40 µg/ml

molecular biology-2016 1 - university of...

Documents