page 1 of 18 practice theoretical bio3151 exammysite.science.uottawa.ca/jbasso/molecular/practice...

of 18 PRACTICE THEORETICAL BIO3151 EXAM

Part I : BIOINFORMATICS

1. From which organism does this sequence come from?

CCCATGGCTTCTTCACTAAAGAAGCTTATCACAAGCTTTCTACTTTTCTTTTTCTACACCATTATCGTCG

CCTCGTCAGAGCCATCATGTCGCCGTTACAAATCGATAATCAGCTTCGGTGATTCCATCGCTGACACCGG

AAACTATCTCCATCTCTCCGACGTCAACCATCCTCCTCAAGCAGCATTTCTTCCTTATGGAGAAACCTTC

TTTAGTGTTCCCACCGGACGTGACTCTGACGGCCGCCTCATCATCGATTTCATCGCTGAGTTCTTGGGAC

TACCGTATGTGCCGCCTTACTTTGGTTCCCAAAACGTGAGCTTCGAGCAAGGAGTCAATTTTGCTGTGTA

TGGAGCAACCGCTTTGGATCGTGCGTTTTTTATCGAAAAAGGAATTGTTTCTGATTTTACCAATGTTAGT

TTAAGTGTTCAACTTAACACTTTCAAGCAGATTTTACCTACCCTATGTGCCTCGTCTTCTCGTGATTGCA

GAGAGATGCTTGGAGACTCGCTAATACTCATGGGAGAGAGTGGAGGGAACGACTATAACTACCCCTTCTT

CGAAGACAAAAGTATCAATGAAATCAAAGAGCTTACTCCTCTAATTATCAAAGCTATTTCTGACGCAATT

GTGGATTTGATCGATTTGGGAGGCAAAACATTTCTGGTGCCCGGAAGCTTTCCAGTTGGATGTAGCGCCG

CGTATCTTACTCTATTCCAAACCGCAAAAGAAAAAGATTATGATCCTCTTACAGGTTGTCTCCCATGGCT

CAACGACTTTGGAAAGCACCACGATGAACAGCTCAAGACAGAAATTAGACGACTCCGAAAACTTTACCCT

CATGTGAACATCATGTATGCCGACTACTACAACTCTCTGTACCGACTTTACCAAAAGCCAACTAAATACG

GGTTTAAGAACCGACCTTTGGCTGC

2. Give the accession number of a protein orthologue of the above sequence from Medicago truncatula.

Use the following sequences to answer the questions that follow:

CGTATCTTACTCTATTCCAAATCATCCTTTTCTTCTTTTTGTACTGTGTAAGGAAGCGGATTGGATGCACA

TTTGTTGAAATCGCTTTCCTGAAAGTTCTTTCAGCATTCCATCAAACAAATTAAACAAGTAGTGAATGGAA

AAAACACTGAAAGAAATACGCAGTGCAACAGCAAACAGAATAGCAATAATACACTTTACAAATATAATTAT

CATTTCCTTGGTGAAGATTGTCATAATCAGCCTGCCATAGCAAAATAAGCGTAAATCAACACTGTTACGAA

GGTTGCTTTGTTGCATTTTTTCTGCCATGTAAAAGACGGCGTGGCTAATTGCAGGTCCAGCTTGAAGCTCC

GTCATCGCTAAAAGACGGCGGTCCCCGCGTCCATTATTCAGGGCACGCGCTGGCCGGGTTCGGGTCCGGAG

CTGGGGGCAGTCTCGCCGGAGGTGGTCCAGGCTGCCACAACGGAAGCATCTGGGTGCAGTCCTGGGGGGCC

GTAGCGCCGCTCGTTCCAGCTGTTCCACTTTCTTGGCCAGGTTGCCCATCTCCCTTATCATGGCGTCGATC

TTCTCGGCCATCTCTGACTTCTCTGTCTTTGCGACGCCGGCGCGGAGCTGCTGCTTCTCCTGGTAGCCGTC

CTCCACCTGGATTATCCTGGTGGCCAGCTTTCGAGCTTCGGCGAGGGTCGGCGGTTCCTGCAGCCGGATCG

CCCGGTAGACTTCCCTCGACGTTACCCCGCCGCTGAAACGTATCACGAGGTCGCGTTCTGAAACCCCCGCT

CTGCGTCCCAACTCTGCCACCTCCTGGGCGAACTGCTGGATGGATTGGCCTTCGCGTTGTCGCAGAGCGTG

GAATCGGTCGGTCAACATTGCCAGCGACTCCTCAGGACCATACGCGTTTAGCAGCCGTTTCTTCAGCTCCT

CGAAAGAGTCGTCCCTCACTTGTCCGGGTGGGTATAGCTCGCGGCGCACCGGGGCCGTCAGTAGGCGTCGT

CCGACAGCTCCATGATCCATCGTTGGTACCCCGCTGGCGCGGAGGAAGTCTTCCAGGTTCTCCACCCACTC

TTCGGCATCCATTCGATAATCAGCTTCGGTGATTCCATCGCTGAC

P1: CAAAAAGAAGAAAAGG P2: AGTCTTCCAGGTTCTC P3: GATCATCCTTTTCTTCT P4: TTTGTACTGTGTAAGCC

a. Which primer or primers could be used for a gene specific reverse transcriptase reaction of the longest protein coding mRNA encoded by this sequence?

b. According to the match with the highest coverage, what is the potential identity of the protein obtained from the longest ORF?


3. Use the sequence NM_167140 to answer the following questions:

a. Which of the following primers could be used to amplify at least 200bp of this sequence?

P1: CGGAACATACATAAGCCAAAATAG

P2: GAAGTGCACTTACCGTTGCTGTG

P3: TTCCCTTGATATCGATTGTTGAG

P4: TCCTTGCCGCGCATGTCCGAC

b. Which of the restriction sites from list 1 could be added to the chosen primers for the directional cloning of the PCR product within the restriction sites of the multiple cloning site indicated in list 2:

List 1: List 2:

AvrII: C▼CTAGG Bam HI : G▼GATCC Bcl I : T▼GATCA Pst I : CTGCA▼G ClaI : AT▼CGAT Sma I : CCC▼GGG Rsa I : GT▼AC Xba I : T▼CTAGA Sal I : G▼TCGAC Xho I : C▼TCGAG


Part II : RESTRICTION MAPPING

A recombinant plasmid was generated as follows: PCR was used to amplify a region of the yeast genome with a pair of “Forward” and “Reverse” primers which had the restriction sites Pst I and Pvu II added to their 5’ ends. Following digestion of the amplicon with Pst I and Pvu II, it was ligated into the pUC vector digested with Pst I and Sma I. Pst I Pvu II Sma I

To verify the identity of the recombinant plasmid, restriction digests followed by agarose gel electrophoresis were performed. The gel and the corresponding standard curve of the molecular size markers are illustrated. The values next to each band indicate the migration distances in mm.

1 000

10 000

100 000

0 5 10 15 20 25

1 000

10 000

100 000

0 5 10 15 20 25

Siz

e (b

p)

Migration distance (mm)

3.0

10

4.3

2.1

E X H X + E U

3.7

6.8

5.4

2.0 3.0 U: Uncut

E: EcoRI

H: HindIII

X: XhoI

2.1


1. Which lane or lanes demonstrate partially undigested plasmid DNA?

2. Which lane or lanes illustrate partially digested DNA?

3. Which lane or lanes illustrate complete digests?

4. What is the approximate size of the insert?

5. The PCR product inserted in the pUC vector was used as a probe for a Southern

analysis. Which bands in lane H would hybridize to the probe?

6. How many times does “H” cut within the insert?

7. What fragment size(s) would be predicted from a digest of the recombinant plasmid

with Pst I and SmaI?

8. What is the probable distance from the Eco RI going towards the insert to the Xho I

restriction site?

9. Given that all the digests were done with 0.1µg of DNA, how much DNA is probably

represented by the band with a migration distance of 6.8 mm in lane “X + E”?

10. Which band in lane “U probably represents supercoiled plasmid DNA?


PART III : CALCULATIONS 1. Solution "A" has 1.20 µg of DNA per µl. Solution "B" has 3.10 µg of DNA per µL. If

you combine 34 µl of solution "A" with 19 µl of solution "B", what is the DNA concentration in µg/µl of the new solution? Round the answer to 2 decimal places.

2. The concentration of a salt solution is 3.8 mg/ml. 124 ml of this solution is placed in

a beaker and allowed to evaporate until 92 ml remains. What is the new salt concentration? (Assume that water evaporates but that the salt does not.) Round the answer to 1 decimal place.

3. You have 3g of NaCl [MW=58]. You need a 1M solution. How much solution can

you make?

4. You have a DNA solution with an absorbance at 260nm of 0.5. How much of this DNA solution and water would you need to prepare 1 ml of 10 μg/ml solution?

5. You need to administer 10mg of epinephrine to a patient to save her life. How much

of a 200 μg/ml solution of epinephrine would you administer?

6. You have 500 mL of a solution of 1M K2S and 0.5M K2SO4. How many moles of S are there for each mole of K+?

7. A PCR reaction is setup with an equal quantity in µg of a double stranded DNA

template of 10 000 base pairs and two single stranded primers (P1 and P2) which are 20 and 25 bases long respectively. What is the molar ratio between each of the primers and their respective templates? (Ex. P1:P2:template = 1:1:1)

8. A solution is prepared by mixing 15 parts of 1M glucose with 5 parts of 4.5M NaCl

and 100mL of water. Given that the final volume was 500 mL, what are the concentrations of glucose and NaCl in the final solution?

9. Vinegar is sold as a 5% (v/v) solution of acetic acid in water. What volume of water

should be added to 15 mL of pure acetic acid (100%) in order to generate a 5% (v/v) solution of acetic acid?

10. What is the molarity of a 60% (m/m) solution of ethanol (MW: 46.0) in water of which

the density is 0.8937 g/mL?

11. What are the molar concentrations of iron (Fe) and of sulfate (SO4) in a solution of 0.450M Fe2(SO4)3?

12. A car’s antifreeze mixture is made by mixing equal volumes of ethylene glycol (d =

1.114 g/mL, molar mass 62.07 g/mol) and water (d = 1.000 g/mL) at 20.0 °C. The density of the solution is 1.070 g/mL. Express the concentration of ethylene glycol as:

(a) volume percent (b) mass percent (c) molarity


13. A solution is prepared by dissolving 28.0 g of glucose in 350 g of water. The density of the resulting solution was 1.54. What is the molarity of the solution? (MW of glucose: 180g/mole)

14. How many mL of a 0.375 M solution can be made from 35.2 g of Ca3(PO4)2

(MW=310 g/mole)?

15. 315 mL of a 0.525 M solution of NaCl (MW=58 g/mole) is mixed with 188 mL of a 0.295 M solution of NaCl, then an additional 166 mL of water is added. What is the final molarity of the solution?

16. The term proof is defined as twice the percent by volume of pure ethanol in solution. Thus, a solution that is 95% (by volume) ethanol is 190 proof. What is the molarity of ethanol in a 92 proof ethanol/water solution?

Density of ethanol 0.80 g/ml Density of water 1.0 g/ml Molecular wt. of ethanol 46

17. 5.00 g of potassium chloride (KCl; MW: 74.5) is dissolved in enough water to

make 250.0 mL of a solution with a density of 1.14g/mL. What is the concentration of the solution in % (m/m), % (m/v), and molarity?

18. 650 mL of a 2M solution of compound X is totally evaporated leaving 120g of compound X. What is the molecular weight of compound X?


PART IV PROBLEMS 1. Below are the DNA fingerprints of 5 people including: a child (C), the mother (M) ,

and three potential fathers of the child (F1, F2, F3). In this experiment, three different

loci (A, B, and C) containing a VNTR were amplified from the genomes of each

individual.

a. Who can be eliminated as the biological father of child "C"?

b. Which man or men can be the biological father of child “C”?

c. A 5Kbp PCR amplified fragment includes two RFLPs. The restriction sites of the

RFLPs are labelled “X” and “Y”. The mutant alleles of "X" and “Y” cannot be cut, but

the normal alleles can. The positions of the restriction sites on the PCR fragment

are as follows:

You do a digest of the PCR products from two individuals. Based on the gel below and the map above, what are the phenotypes of each individual for each allele: homozygous mutant (-/-), heterozygous (+/-), or homozygous normal (+/+)? Indicate the correct combination from the table below. (Ex. AE)

d. In the case of individual 1, how would the results observed on the gel be different if

the genomic DNA had been digested before performing the PCR?

Individual 1: Individual 2:

A B C D

X(-/-) Y(-/-) X(+/-) Y(+/+) X(-/-) Y(+/-) X(+/+) Y(-/-)

E F G H

X(-/-) Y(-/-) X(+/-) Y(+/+) X(-/-) Y(+/-) X(+/+) Y(-/-)

VNTR A VNTR B VNTR C

X Y 2Kbp 2Kbp 1Kbp

Individual 1 Individual 2

6Kbp

5Kbp

4Kbp

3Kbp

2Kbp

1Kbp


2. Southern hybridizations were performed on Bam HI digested genomic DNA from either humans or chimpanzees. The hybridizations were performed with varying concentrations of formamide (lanes 1-6) and two DNA probes derived from a given gene.

2a. Probes 1 and 2 represent DNA from the same organism. From which

organism were the probes most probably derived? Justify your answer. 2b. BamHI cuts how many times within the region of the human genome spanned

by probe 1?

2c. BamHI cuts how many times within the region of the chimpanzee genome spanned by probe 1?

1 2 3 4 5 6

Human genomic DNA Chimpanzee genomic DNA

Probe 1

Probe 2

1 2 3 4 5 6

1 2 3 4 5 6

1 2 3 4 5 6


3’ TGCTAGCTGAAATCGATCCG………………………………CCGGCCCCGCTGGATCCAG 5’

5’ ACGATCGACTTTAGCTAGGC………………………………GGCCGGGGCGACCTAGGTC 3’

A probe was synthesized from the above sequence (“My Gene”) by performing a PCR reaction with the following single primer: 5’ ACGATCGACTTTAGCTAGG 3’, in the presence of a labelled nucleotide. Below is a diagram showing a northern hybridization with this probe to RNA isolated from the thymus. The membrane was also probed at the same time with a second probe against actin; a house keeping gene. The time indicates how long the cells were incubated in the presence of a drug before the RNA was isolated.

3a. According to the results obtained, which of the above indicated strands of “My Gene”

is negative? (Top or Bottom?) 3b. What is the effect of the drug on the expression of “My Gene”? Justify your answer.

3c. You wish to repeat this experiment by performing a gene specific RT-PCR. Indicate the sequence of a 10 base primer that could be used for the reverse transcription of “My Gene”. Make sure to label your ends.

My Gene

Actin


4. 5’TGCTAGCTGAAATCGATCCG…………………………………………CCGGCCCCGCTGGATCCAG3’

3’ACGATCGACTTTAGCTAGGC…………………………………………GGCCGGGGCGACCTAGGTC5’

A probe was synthesized from the above sequence by performing a PCR reaction with the following primer: TAGCTGAAATCGATCC in the presence of radioactive nucleotides. A Southern (panel “A”) and a Northern (panel “B”) were then hybridized with the probe generated. Panel A: Southern of genomic DNA digested with “F”, “R”, or “E”. Panel B: Northern of total RNA isolated from cells in conditions “1” and “2”. a. If the sequence represented by the probe is only found once within the genome, how

many times do each of the enzymes “F”, “R” and “E” cut within the probe’s sequence?

b. According to the results of the Northern, the sequence of which of the two strands

must have been read to generate the mRNA? (Top or Bottom) c. According to the Northern, does either of the conditions result in the induction of

transcription? If so, which one? Briefly justify.

d. Indicate in the table below which of the single stranded sequences indicated in the column “probe” could hybridize to the target sequence at the indicated temperatures.

Use the symbols “+” and “-“ to indicate whether or not hybridization would occur.

Probe

Target sequence: GATCCAGCATCGGACAAATGAT

Hybridization Temperatures

45 56 65

ATCATTTGTCCGATGCTGGATC

ATCACCCGTCCGATGCTGGATC

ATCACTTGTAAAATGCTGGATC

1 2 B.

←House keeping RNA

← RNA of interest

F R A.

E


PART V: THEORY For each group of statements, indicate in the space provided which one (s), are true. If none are true indicate "0":

I. Both plasmid isolation methods as well as the RNA isolation method used in this lab make use of a strong alkali to lyse the cells.

II. The Qiagen plasmid isolation method uses chromatography to remove proteins whereas the alkaline lysis procedure uses differential sedimentation.

III. Both plasmid isolation methods as well as the RNA isolation method used in this lab make use of differential sedimentation to obtain the desired nucleic acids.

I. Isoschizomers are different enzymes from a same bacterial species which recognize and cut the same sequence.

II. Neoschizomers necessarily generate compatible ends.

III. Ends generated by two isocaudaumers can be ligated to one another.

I. Given that ethidium bromide binds DNA by electrostatic interactions one would expect the ethidium bromide to migrate towards the negative electrode.

II. Supercoiled plasmid DNA migrates through agarose with the least resistance.

III. Denatured RNA would be expected to migrate faster through agarose than non-denatured RNA.

I. A selectable marker is included in cloning vectors to increase the number of cells which uptake a plasmid.

II. All vectors are circular DNA molecules.

III. All vectors are plasmids and all plasmids are vectors.

I. The Tm of nucleic acids decreases with increasing concentrations of positive ions.

II. Formamide and formaldehyde decrease the Tm of nucleic acids.

III. At high stringency it is more likely to obtain hybridization of a sequence with a high %GC rather than a high %AT.

a.

c.

b. b.

d.

e.


Part I : BIOINFORMATICS

4. From which organism does this sequence come from?

Brasica napus

5. Give the accession number of a protein orthologue of the above sequence from Medicago truncatula.

XP_003593736.1 Use the following sequences to answer the questions that follow:

c. Which primer or primers could be used for a gene specific reverse transcriptase reaction of the longest protein coding mRNA encoded by this sequence?

P3

d. According to the match with the highest coverage, what is the potential identity of the protein obtained from the longest ORF?

Zinc finger protein

6. Use the sequence NM_167140 to answer the following questions:

a. Which of the following primers could be used to amplify at least 200bp of this sequence?

P1 & P4

b. Which of the restriction sites from list 1 could be added to the chosen primers for the directional cloning of the PCR product within the restriction sites of the multiple cloning site indicated in list 2: AvrII & SalI


Part II : RESTRICTION MAPPING

11. Which lane or lanes demonstrate partially undigested plasmid DNA?

X 12. Which lane or lanes illustrate partially digested DNA?

H 13. Which lane or lanes illustrate complete digests?

E & X+E 14. What is the approximate size of the insert?

Approx 8.0 Kbp 15. The PCR product inserted in the pUC vector was used as a probe for a Southern

analysis. Which bands in lane H would hybridize to the probe?

all of them 16. How many times does “H” cut within the insert?

twice 17. What fragment size(s) would be predicted from a digest of the recombinant plasmid

with Pst I and SmaI?

11Kbp 18. What is the probable distance from the Eco RI going towards the insert to the Xho I

restriction site?

4.0 or 7.0 Kbp 19. Given that all the digests were done with 0.1µg of DNA, how much DNA is probably

represented by the band with a migration distance of 6.8 mm in lane “X + E”? Approx. 40ng

20. Which band in lane “U probably represents supercoiled plasmid DNA?

3.0 band


PART III : CALCULATIONS 19. Solution "A" has 1.20 µg of DNA per µl. Solution "B" has 3.10 µg of DNA per µL. If

you combine 34 µl of solution "A" with 19 µl of solution "B", what is the DNA concentration in µg/µl of the new solution? Round the answer to 2 decimal places.

1.88 20. The concentration of a salt solution is 3.8 mg/ml. 124 ml of this solution is placed in

a beaker and allowed to evaporate until 92 ml remains. What is the new salt concentration? (Assume that water evaporates but that the salt does not.) Round the answer to 1 decimal place.

5.1 21. You have 3g of NaCl [MW=58]. You need a 1M solution. How much solution can

you make? 51.7ml

22. You have a DNA solution with an absorbance at 260nm of 0.5. How much of this DNA solution and water would you need to prepare 1 ml of 10 μg/ml solution?

400ul DNA + 600ul water 23. You need to administer 10mg of epinephrine to a patient to save her life. How much

of a 200 μg/ml solution of epinephrine would you administer? 50ml

24. You have 500 mL of a solution of 1M K2S and 0.5M K2SO4. How many moles of S are there for each mole of K+?

0.5 25. A PCR reaction is setup with an equal quantity in µg of a double stranded DNA

template of 10 000 base pairs and two single stranded primers (P1 and P2) which are 20 and 25 bases long respectively. What is the molar ratio between each of the primers and their respective templates? (Ex. P1:P2:template = 1:1:1)

500:400:1 26. A solution is prepared by mixing 15 parts of 1M glucose with 5 parts of 4.5M NaCl

and 100mL of water. Given that the final volume was 500 mL, what are the concentrations of glucose and NaCl in the final solution?

0.6M glucose, 0.9M NaCl 27. Vinegar is sold as a 5% (v/v) solution of acetic acid in water. What volume of water

should be added to 15 mL of pure acetic acid (100%) in order to generate a 5% (v/v) solution of acetic acid?

285mL 28. What is the molarity of a 60% (m/m) solution of ethanol (MW: 46.0) in water of which

the density is 0.8937 g/mL? 11.6M

29. What are the molar concentrations of iron (Fe) and of sulfate (SO4) in a solution of 0.450M Fe2(SO4)3?

0.9M Fe, 1.35M SO4 30. A car’s antifreeze mixture is made by mixing equal volumes of ethylene glycol (d =

1.114 g/mL, molar mass 62.07 g/mol) and water (d = 1.000 g/mL) at 20.0 °C. The density of the solution is 1.070 g/mL. Express the concentration of ethylene glycol as:

(a) volume percent 50% (b) mass percent 52.7% (c) molarity 8.97M


31. A solution is prepared by dissolving 28.0 g of glucose in 350 g of water. The density of the resulting solution was 1.54. What is the molarity of the solution? (MW of glucose: 180g/mole)

0.63M 32. How many mL of a 0.375 M solution can be made from 35.2 g of Ca3(PO4)2

(MW=310 g/mole)? 302.8mL

33. 315 mL of a 0.525 M solution of NaCl (MW=58 g/mole) is mixed with 188 mL of a 0.295 M solution of NaCl, then an additional 166 mL of water is added. What is the final molarity of the solution?

0.33M

34. The term proof is defined as twice the percent by volume of pure ethanol in solution. Thus, a solution that is 95% (by volume) ethanol is 190 proof. What is the molarity of ethanol in a 92 proof ethanol/water solution? 8M

Density of ethanol 0.80 g/ml Density of water 1.0 g/ml Molecular wt. of ethanol 46

35. 5.00 g of potassium chloride (KCl; MW: 74.5) is dissolved in enough water to

make 250.0 mL of a solution with a density of 1.14g/mL. What is the concentration of the solution in % (m/m), % (m/v), and molarity? 1.75% (m/m), 2% (m/v), 0.27M

36. 650 mL of a 2M solution of compound X is totally evaporated leaving 120g of compound X. What is the molecular weight of compound X?

92.3g/mole


PART IV PROBLEMS 1.

d. Who can be eliminated as the biological father of child "C"?

F1 and F3

e. Which man or men can be the biological father of child “C”?

F2

f.

e. no product.

3a. Probes 1 and 2 represent DNA from the same organism. From which

organism were the probes most probably derived? Justify your answer.

Humans. Probe hybridizes at a higher stringency than with chimpanzee DNA 3b. BamHI cuts how many times within the region of the human genome spanned

by probe 1? 0

3c. BamHI cuts how many times within the region of the chimpanzee genome spanned by probe 1?

1

4.

4a. According to the results obtained, which of the above indicated strands of “My Gene” is negative? (Top or Bottom?)

Bottom

6b. What is the effect of the drug on the expression of “My Gene”? Justify your answer.

Repressed after 90 min. Normalized value is lower.

4c. You wish to repeat this experiment by performing a gene specific RT-PCR. Indicate the sequence of a 10 base primer that could be used for the reverse transcription of “My Gene”. Make sure to label your ends.

5’ ACGATCGACT3’

Individual 1: Individual 2:

A B C D

X(-/-) Y(-/-) X(+/-) Y(+/+) X(-/-) Y(+/-) X(+/+) Y(-/-)

E F G H

X(-/-) Y(-/-) X(+/-) Y(+/+) X(-/-) Y(+/-) X(+/+) Y(-/-)


4. e. If the sequence represented by the probe is only found once within the genome, how

many times do each of the enzymes “F”, “R” and “E” cut within the probe’s sequence?

F(0), R(1), E(2) f. According to the results of the Northern, the sequence of which of the two strands

must have been read to generate the mRNA? (Top or Bottom)

top g. According to the Northern, does either of the conditions result in the induction of

transcription? If so, which one? Briefly justify. Yes condition 2. Normalized value is about 4X higher

h. Indicate in the table below which of the single stranded sequences indicated in the

column “probe” could hybridize to the target sequence at the indicated temperatures.

Use the symbols “+” and “-“ to indicate whether or not hybridization would occur.

Probe

Target sequence: GATCCAGCATCGGACAAATGAT

Hybridization Temperatures

45 56 65

ATCATTTGTCCGATGCTGGATC + + -

ATCACCCGTCCGATGCTGGATC + + -

ATCACTTGTAAAATGCTGGATC + - -


PART V: THEORY For each group of statements, indicate in the space provided which one (s), are true. If none are true indicate "0":

IV. Both plasmid isolation methods as well as the RNA isolation method used in this lab make use of a strong alkali to lyse the cells.

V. The Qiagen plasmid isolation method uses chromatography to remove proteins whereas the alkaline lysis procedure uses differential sedimentation.

VI. Both plasmid isolation methods as well as the RNA isolation method used in this lab make use of differential sedimentation to obtain the desired nucleic acids.

IV. Isoschizomers are different enzymes from a same bacterial species which recognize and cut the same sequence.

V. Neoschizomers necessarily generate compatible ends.

VI. Ends generated by two isocaudaumers can be ligated to one another.

IV. Given that ethidium bromide binds DNA by electrostatic interactions one would expect the ethidium bromide to migrate towards the negative electrode.

V. Supercoiled plasmid DNA migrates through agarose with the least resistance.

VI. Denatured RNA would be expected to migrate faster through agarose than non-denatured RNA.

IV. A selectable marker is included in cloning vectors to increase the number of cells which uptake a plasmid.

V. All vectors are circular DNA molecules.

VI. All vectors are plasmids and all plasmids are vectors.

IV. The Tm of nucleic acids decreases with increasing concentrations of positive ions.

V. Formamide and formaldehyde decrease the Tm of nucleic acids.

VI. At high stringency it is more likely to obtain hybridization of a sequence with a high %GC rather than a high %AT.

a. iii

c. i + ii

b. b. iii

d. 0

e. iii

page 1 of 18 practice theoretical bio3151 exammysite.science.uottawa.ca/jbasso/molecular/practice...

Documents