molecular biology-2017 1 - university of...

Molecular Biology-2017 1

http://mysite.science.uottawa.ca/jbasso/molecular/home.htm


GENERAL DIRECTIVES

1. Attendance is mandatory. Please be on time.

2. Shoes and appropriate dress must be worn at all times.

3. Leave outerwear, backpacks, and any other extraneous materials in the lockers outside of the lab.

It is strongly recommended that you have a lock. We are not responsible for lost or stolen items.

4. Wear a lab coat and gloves at all times while working in the lab.

5. Remove your gloves anytime you walk out of the lab.

6. Remove your gloves when using either our or your own computers.

7. Always dispose of used pipettes, tips, microcentrifuge tubes, and other materials in the biohazard

bags provided so that they can be disposed of properly. Do NOT throw trash in the autoclave bag.

8. Never lick your fingers, or put your fingers in your mouth.

9. No eating or drinking in the lab.

10. No radios, MP3 players, or CD players in the lab.

11. No use of cell phones or texting in the lab.

12. Notify the T.A. or instructor of any accident, no matter how minor.

13. Notify the T.A. or instructor of any breakage or malfunction of the equipment supplied.

Material you MUST have to work in the molecular biology lab:

A lab coat

A thin tipped permanent, preferably black, marker for labelling.

A note book to record your results. Any type is acceptable. Do not waste your money.

A USB key to save your pictures

A calculator. The use of cell phone calculators is not allowed

Optional but strongly recommended:

Notify the instructor of any safety or medical concerns so that appropriate accommodations can be

taken. For example, allergies, diabetes, hypoglycemia, epilepsy, exposed wounds, color blindness,

etc..

Notify the instructor of any special needs you may require so that appropriate accommodations can

be taken. For example, if you write your exams with SASS.


Schedule

Introduction to the molecular biology lab Jan 9-13

Exercise 1 Jan. 16-20 Concentrations and Dilutions

Plasmid DNA isolation by alkaline lysis

Restriction digests & agarose gel electrophoresis

Exercise 2 Jan. 23-27 Restriction mapping of a recombinant plasmid

Plasmid DNA isolation with Qiagen

Restriction digests

Gel electrophoresis

Restriction mapping of a yeast gene – Southern analysis

Genomic DNA isolation

Restriction digests of genomic DNA

Gel electrophoresis

Exercise 3 Jan. 30-Feb. 3 Site directed mutagenesis and cloning of GFP

PCR amplification and mutagenesis of GFP

Purification of PCR reactions with QIAQUICK

Digestion of GFP PCR amplicons and pUC19 vector

Ligation of GFP amplicons

Exercise 4 Feb. 6-10 Mutagenesis and cloning of GFP - Analysis of transformations

Colony counts

Colony PCR

Restriction digests of colony PCR products

MIDTERM EXAM (Exercises 1-4) Feb. 13-17

STUDY BREAK Feb. 20-24


Exercise 5 Feb. 27- Mar. 3 Gene expression - Transcription

Yeast RNA isolation

RNA electrophoresis

Principals of RT-PCR

Exercise 6 Mar. 6-10 Transcriptional control of yeast CTT1 gene

RT-PCR

Northern analysis

Exercise 7 Mar. 13-17 Genomic fingerprinting

Isolation of human genomic DNA from cheek cells

PCR amplification of ApoC2 VNTR

PCR amplification of ApoB RFLP

Stringency – DNA melting curves

Exercise 8 Mar. 20-24 Protein expression

Preparation of protein extracts

Protein quantification – Bradford assay

Protein gel electrophoresis

THEORETICAL FINAL EXAM FINAL EXAM PERIOD


Grading scheme

Option I Option II

Quizzes 5% + *Bonus 2% 5% + *Bonus 2%

Assignments (X5) 15% 15%

Lab performance 10% 10%

Midterm 25% 15%

Final 45% 55%

Total 102% 102%

*You need to obtain 100% on at least 4 out of 8 quizzes to obtain the bonus

QUIZ

Each week, starting on week 2, a quiz will be available on Blackboard on the Saturday before the

following week’s lab which will be available between 9AM and 9PM. You will have 30 minutes to

complete the quiz. These quizzes will contribute towards 5% of your final grade. Additionally, a 2%

bonus will be added to the final grade of students who obtained 100% on at least 4 of the 8 quizzes.

ASSIGNMENTS

Assignments covering the procedures and the data you have obtained as well as associated

bioinformatics exercises. Assignments must be type written. All assignments may be submitted

individually or in groups of two (you and your teammate). A 10%/day penalty will be imposed on

late assignments. (Weekends will be considered as one day) Some parts of the assignment are to be

submitted on Blackboard and some parts are to be submitted as hard copies during your lab session.

In both cases, submission must be done by 5 pm the day of your lab.

ASSIGNMENT DUE DATES (Date of your section)

ASSIGNMENT 1: WEEK OF JANUARY 23-27

ASSIGNMENT 2: WEEK OF JANUARY 30-FEBRUARY 3

ASSIGNMENT 3: WEEK OF FEBRUARY 13-17

ASSIGNMENT 4: WEEK OF MARCH 13-17

ASSIGNMENT 5: WEEK OF MARCH 27-31


WRITTEN EXAMS

All exams are open book. Access to the internet will be allowed during both the final and

midterm exams. NO LAPTOPS are allowed. You must use the lab computers.

The breakdown of the midterm exam (2 hours) will be as follows:

8 calculation problems (12 points)

4 bioinfo exercises (4 points)

4 theoretical questions on bioinfo and molecular procedures (4 points)

2 out of 3 problems with an emphasis on data analysis and experimental design (10 points)

The breakdown of the final exam (3 hours), which is cumulative, will be as follows:

5 calculation problems (10 points)

10 bioinfo exercises (10 points)

5 theoretical questions on bioinfo and molecular procedures (5 points)

3 out of 4 problems with an emphasis on data analysis and experimental design (15 points)


Exercise 1

What are we doing today!

Concentrations and dilutions

Plasmid DNA isolation by alkaline lysis

Restriction digests & agarose gel electrophoresis


Introduction to concentrations One very important property of solutions that must be addressed is concentration. Concentration

generally refers to the amount of solute contained in a certain amount of solution. To deal with

concentration you must keep in mind the distinctions between solute, solvent and solution. Because

varying amounts of solute can be dissolved in a solution, concentration is a variable property and we

often need to have a numerical way of indicating how concentrated a solution happens to be. Over

the years a variety of ways have been developed for calculating and expressing the concentration of

solutions.

That can be done with percentages using measurements of weight (mass) or volume or both. It can

also be done using measurements that more closely relate to ways that chemicals react with one

another (moles).

In the pages that follow, several concentration types will be presented. They include volume

percent, weight percent, weight/volume percent, molarity (the workhorse of chemical

concentrations), and weight/volume.

You will get experience with more than one way of establishing the concentration of solutions. You

can prepare a solution from scratch and measure each of the components that go into the solution.

You can prepare a solution by diluting an existing solution. If an existing solution is colored, you can

determine its concentration by measuring the color intensity using colorimetry.

PERCENTAGE

The use of percentages is a common way of expressing the concentration of a solution. It is a

straightforward approach that refers to the amount of a component per 100. Percentages can be

calculated using volumes as well as weights, or even both together. One way of expressing

concentrations, with which you might be familiar, is by volume percent. Another is by weight

percent. Still another is a hybrid called weight/volume percent.

Volume percent is usually used when the solution is made by mixing two liquids.

For example, rubbing alcohol is generally 70% by

volume isopropyl alcohol. That means that

100mL of solution contains 70mL of isopropyl

alcohol. That also means that a litre (or 1000mL)

of this solution has 700mL of isopropyl alcohol

plus enough water to bring it up a total volume of

1 litre, or 1000mL.

Volume percent = volume of solute

volume of solution x 100


Mass percent is a way of expressing the concentration of a solution as the mass of solute/mass of

solution.

To calculate the mass percent of a solution, you must divide the mass of the solute by the mass of the

solution (both the solute and the solvent together) and then multiply by 100 to change it into percent.

Mass/volume percent

Another variation on percentage concentration is mass/volume percent. This variation measures the

amount of solute in grams but measures the amount of solution in millilitres. An example would be a

5% (m/v) NaCl solution. It contains 5g of NaCl for every 100mL of solution.

Volume percent = mass of solute (in g)

volume of solution (in mL) x 100

This is the most common way that percentage solutions are expressed in this lab course.

Mass percent = mass of solute

mass of solution x 100

As an example, let's consider a 12% by

weight sodium chloride solution. Such a

solution would have 12 grams of sodium

chloride for every 100 grams of solution. To

make such a solution, you could weigh out 12

grams of sodium chloride, and then add 88

grams of water, so that the total mass for the

solution is 100 grams. Since mass is

conserved, the masses of the components of

the solution, the solute and the solvent, will

add up to the total mass of the solution.

12 % NaCl solution = 12 g NaCl

100 g solution

12 g NaCl

(12 g NaCl + 88 g water) = 12% NaCl solution


MOLARITY

Another way of expressing a concentration is

called molarity. Molarity is the number of moles

of solute dissolved in one litre of solution. The

units, therefore are moles per litre, specifically

it's moles of solute per litre of solution.

Molarity = moles of solute

litre of solution

Rather than writing out moles per litre, these units are abbreviated as M. So when you see M it

stands for molarity, and it means moles per litre (not just moles). You must be very careful to

distinguish between moles and molarity. "Moles" measures the amount or quantity of material you

have; "molarity" measures the concentration of that material. So when you're given a problem or

some information that says the concentration of the solution is 0.1M that means that it has 0.1 moles

for every litre of solution; it does not mean that it is 0.1 moles.

WEIGHT/VOLUME

This means of expressing concentrations is very similar to that of percentages and is one of the most

popular ways used by molecular biologists. In contrast to percent, the concentration is expressed as a

mass per any volume the user wishes to use. Most commonly, these concentrations are expressed per

one measuring unit. For example, per 1mL, 1µL or 1L, etc. Essentially these expressions represent

the mass of solute present in a given amount of solution. For example a solution at a concentration of

1mg/mL contains 1 mg of solute in 1 mL of solution.

RATIOS

All the ways described above to express concentrations are done as a function of the total volume of

the solution which is the volume of the solvent and that of the solute. A common method used by

many molecular biologists and chemists is to express concentrations as ratios. In this case, the

relationship between the solvent and the solute is expressed independently of one another. For

example, we could say that the ratio between a solute and its solvent is 2 to 1. This indicates that for

two parts of the solute there is one part of solvent. Thus three parts total of solution.


Dilutions and the use of micropipettors

Dilutions: Being able to prepare dilutions is essential for the preparation of several reagents, reaction mixes,

and solutions used in a molecular biology lab. Basically, dilutions serve to reduce the initial

concentration of a compound in order to reach a new desired concentration. Solutions prepared by

the formulation of dilutions may be composed of one or more ingredients. The number of ingredients

within the solution does not in any way influence the formulation of dilutions. A brief overview of

the formulation of dilutions is presented below. Make sure that you fully understand their

preparation, since you will be called upon to prepare them throughout the semester as well as on the

final exam.

To comprehend how dilutions are prepared, you must grasp the following three concepts:

Concentration, dilution factor, and the dilution.

A concentration is defined as the quantity of a given element for a total volume of solution. Since a

quantity may be expressed in several different ways, concentrations are expressed as the unit of

measure of the quantity of the element/total final volume.

Ex. Grams/Litre

Molecules/Litre

Moles/Litre

Etc.

The dilution factor represents the multiple by which an initial concentration must be divided by in

order to obtain the desired final concentration. For example, if a solution contains 30g of caffeine per

litre of solution and you wish to reduce the caffeine concentration to 0.3 g/L, then you will have to

divide the initial concentration by 100, which represents the dilution factor. You can use the

following formula in order to determine a dilution factor.

The dilution represents the fraction of the component being investigated. For example, in the

previous problem a dilution of 1/100 was prepared. The dilution is expressed as a fraction of 1 over

the dilution factor. That is to say that the initial solution is represented as a fraction of the original

over the total. For example if you determined that a 1/100 dilution has to be prepared, this means that

one hundredth of the new solution must be represented by the original solution. Therefore for a total

volume of let’s say 2mL, 0.02mL must be represented by the original solution.

Dilution factor = Initial concentration

Final Concentration OR

What I have

What I want


Preparing a solution that requires the dilution of more than one ingredient:

The basis for the formulation of a solution that requires the dilution of more than one ingredient is

the same as that of a solution with only one ingredient. The only difference is the volume of solvent

that must be added.

Let’s take as an example that we wish to prepare 10mL of a 0.1M solution from a stock solution of

2M.

To calculate the dilution factor:

Thus the required dilution is 1/20, which means that one twentieth of the total must be represented by

the original solution.

Therefore to prepare 10mL we must add 0.5mL of the stock solution and make up the volume with

9.5mL of solvent.

If the solution to be prepared includes a second ingredient; let’s say that the final concentration of

this one must be 0.5M and that the stock solution is 3M.

Once again to calculate the dilution:

Thus the required dilution is 1/6, which means that one sixth of the total volume must be represented

by the original solution.

Therefore, to prepare 10mL one must add 0.5mL of the first solution, 1.7mL of the second solution

and complete to the total volume with 7.8mL of solvent.

If the above explanations are not sufficient you can always consult the following web site:

http://www.wellesley.edu/Biology/Concepts/Html/dilutions.html

What I have

What I want =

2M

0.1M = 20

What I have

What I want =

3M

0.5M = 6

http://www.wellesley.edu/Biology/Concepts/Html/dilutions.html


Use of micropipettors

Micropipettes are indispensable tools in modern biology laboratories. How accurate are yours? How

precise are yours? What is the difference between accuracy and precision?

Accuracy refers to performance with respect to a standard value. Precision refers to the reliability or

repeatability of performance and doesn’t necessarily depend on a standard at all. These two features

are independent of each other. It is possible to have an instrument that is precisely inaccurate (or

accurately imprecise)!

Target analogy to illustrate accuracy and precision

Here, the bull’s-eye represents the "standard" against which accuracy is judged. To simultaneously

evaluate the accuracy and precision of your pipettes you must conduct multiple measurements and

compute the % Error of the Mean and Standard Deviation of the measurements for each pipette.

Directions for use of Gilson micropipettors

You have 3 sizes of micropipette. The P-1000, the P-200 and the P-20. The model numbers refer to

the maximum volume in microliters. Initially you will need to determine which pipette to use in a

given circumstance. For example, if you need to transfer 0.18ml you would probably need to use the

P-200 because 0.18ml = 180µL and because the P-200 will measure this volume with greater

accuracy and precision than the P-1000 will.

Rules:

Always use a disposable tip. The P-20 and P-200 use the smaller tips and the P-1000 uses the

bigger ones.

Never draw any fluid into the white barrel of the pipette itself.

Never lay a pipette down while there is fluid in the tip. The fluid may accidentally find its

way into the barrel.

Never turn the adjustment scale below or above the full range settings.

To maximize precision, Always use the smallest volume pipette for a given total volume.

1. Set the desired volume:

Turn the volume up just a bit past the desired setting, then back down.

2. Attach a tip:

Press it on firmly, with a slight twisting motion. The tip must make an air-tight seal

with the pipette barrel.

Accurate & Precise Precise & Inaccurate Imprecise & Inaccurate


3. Depress the plunger to first stop.

4. Insert the tip in the liquid you want to transfer. Not far, just a bit below the surface.

5. Slowly release plunger.

6. As you withdraw the tip, touch it to the side wall of the tube to remove excess fluid from the

exterior.

7. To dispense, depress plunger slowly to the first stop; then depress all the way.

Never dispense a small volume into thin air. Always dispense into a liquid or onto the

wall of a tube so that adhesion will draw the expelled liquid off the tip.

8. With the plunger still fully depressed, remove tip from the liquid.

REMEMBER THAT YOUR MICROPIPETTORS ARE EXPENSIVE PIECES OF

EQUIPMENT!

Dilutions exercise with micropipettors (Groups of 2)

These exercises are included so that you will be familiar with the basics of solution preparation,

micropipetting, and the use of tips. (ALWAYS LABEL YOUR TUBES!! ).

Materials: Solution I (1% Compound “A” (m/v); M.W. 250g/mole)

Solution II (1.5M Compound “B” M.W. 480g/mole; Density of compound “B”: 1.6g/mL)

Method:

1. Prepare 1mL of each of the following solutions from the above stock solutions.

a. A 0.2mM solution of compound “A”.

b. A 0.72% (m/v) solution of compound “B”.

c. A 5% (v/v) solution of solution I.

d. A solution containing 0.1mg of compound “A” and 0.1% (v/v) of compound “B”.

e. A solution with the following ratio: solution I: solution II : water : 2 : 1 : 247

2. Transfer 150 µL from each of the solutions to the appropriate wells of a 96 well plate as shown

below:

96 well plate layout (one plate/table)

Soln. a Soln. b Soln. c Soln. d Soln. e Person 1 Group 1

Soln. a Soln. b Soln. c Soln. d Soln. e Person 2








More dilutions: Determining the concentration of DNA (Groups of 2) As with most compounds, the concentration of nucleic acids can be determined

spectrophotometrically. To do so, the absorbance of the compound is determined at the wavelength

for maximal absorption. In the case of nucleic acids, this is in the UV range at a wavelength of

260nm. In the following exercise you will prepare samples at different known concentrations of

DNA and then use the absorbance values obtained to generate a standard curve representing

absorbance Vs DNA concentration (NOT AMOUNT). The standard curve generated will then allow

you to determine the concentration of an unknown DNA sample as well as determining the

relationship between DNA concentration and absorbance at a wavelength of 260nm. Specifically you

want to determine what concentration of DNA (in µg/mL or ng/µL) is equal to an absorbance of 1.0.

Materials

Salmon sperm DNA (200µL at 0.5mg/mL)

Salmon sperm DNA (200µL of unknown concentration)

Method:

1. Prepare 500µL in water of each of the following DNA standard solutions from the DNA sample

of known concentration: 0.0, 0.05, 0.025, 0.01, 0.005 and 0.0025mg/mL.

2. Prepare 500µL samples in water representing 1/4 and 1/10 dilutions of the unknown DNA

sample.

3. Transfer 200µL of each of the standard DNA solutions to a microtiter plate as indicated in the

plan below.

4. Transfer 200µL of each of the unknown DNA solutions to a microtiter plate as indicated in the

plan below.

5. Measure absorbance at 260nm.

DNA assay plate layout

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 1

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 2

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 3

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 4

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 5

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 6

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 7

0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK

1/4

UNK

1/10 Group 8


Plasmid DNA isolation (Groups of 2) Most methods used to isolate DNA rely on the disruption of cells in the presence of strong

denaturants. Disruption may be by freezing and fracturing cells by grinding or blending or by

chemical lysis with strong alkali. The denaturants are essential to inactivate exogenous and

endogenous nucleases, which would otherwise degrade the DNA. Examine the components of the

DNA extraction buffers and determine the purpose of each chemical.

Plasmids are non-obligate, circular, extrachromosomal bacterial replicons. Plasmid DNA isolation

requires separation of this DNA from the chromosomal DNA in the bacterial cell as well as from the

polysaccharides, lipids and proteins that constitute the cell. Subsequent manipulation, especially

enzymatic modification, of the plasmid DNA requires that it be free of these impurities.

Purifying plasmid DNA by alkaline lysis

In this protocol, cells are lysed by strong alkali (NaOH) and the proteins are denatured by a strong

alkali and a strong detergent (SDS). The detergent complexes are then precipitated with a

neutralizing salt (KOAc). The plasmid is separated from the bacterial DNA by virtue of the plasmid's

relative stability in alkali. Leaving the plasmid preparation in alkali for too long will destroy the

plasmid DNA as well. The chromosome is also attached to the membranes and will be precipitated

by the salt and detergent. It is therefore important not to mix the solution too vigorously and release

the chromosomal DNA from it trap. The plasmid is smaller and will remain free in solution. The

plasmid solution is then separated from the cellular debris by centrifugation and further concentrated

by an alcohol precipitation.


A. Preparing your solutions:

Prepare 1mL of solutions I & II as well as T.E. from the following stock solutions:

10M NaOH

10% (m/v) SDS

0.5M glucose

1M Tris-Cl (pH 8.0)

0.5M EDTA

3M KOAc pH 5.0

Isopropanol

RNase 10mg/mL

Solution I:

50mM Glucose (buffer)

25mM Tris-Cl (pH 8.0) (buffer)

10mM EDTA (pH 8.0) (Chelator)

Solution II:

0.2M NaOH (Alkali)

1% (m/v) SDS (Detergent)

T.E.:

10mM Tris-Cl pH 8.0

1mM EDTA pH 8.0

B. Protocol for isolation of a pUC9 recombinant plasmid:

1. Spin at maximal speed in the microcentrifuge for 1 minute 1.5mL of the plasmid containing

E.coli suspension provided to you.

2. Carefully pour off supernatant without disturbing the cell pellet. Use a micropipettor to remove

any remaining supernatant.

3. Add 200L of Solution I to the pellet and suspend the pellet by vortexing.

4. Add 400L of solution II. Cap the tube and mix by inversion.

5. Add 300L of ice cold KOAc. Mix well and keep on ice for 5 minutes.

6. Spin tube in the microcentrifuge at maximum speed for 5-10 minutes. This pellets the proteins

and chromosomal DNA along the side of the tube.

7. Transfer 700µL of the supernatant to a new microcentrifuge tube. Add an equal volume of

isopropanol. Close cap and mix well by rapidly inverting the tubes.

8. Spin tubes at maximum speed for 5 minutes. Pour off supernatant carefully.

9. The white pellet at the bottom of the tube contains plasmid DNA and RNA.

10. Suspend the pellet in 50L TE pH8.0.

11. Add 1L of an RNAse solution at 10mg/mL and incubate at 37oC 5-10 min.


Restriction digests & agarose gel electrophoresis (Groups of 2) The use of restriction endonucleases to cleave DNA at specific sites was a key breakthrough in

opening up the field of molecular biology in the mid-1970's. There are now several hundred different

restriction enzymes that are commercially available, and you can find detailed information about

some (including the ones that you will be using in this course) in catalogues from commercial

suppliers. Their specificity makes them very useful for several tasks including but not limited to the

mapping of DNA, cloning and subcloning of DNA, etc. The goal of this exercise is to introduce

you to restriction enzyme mapping and analysis. At the end of this exercise you should be able

to answer the following questions:

Which enzymes cut within the plasmid insert?

Which enzymes do not cut within the plasmid insert?

What is the size of the plasmid insert?

What are the possible positions of the different restriction sites?

The DNA fragment was inserted in which restriction site within the MCS?

For more information on restriction enzymes and their use consult the following web site.

http://askabiologist.asu.edu/expstuff/mamajis/restriction/restriction.html

Agarose gel electrophoresis

Agarose gel electrophoresis is the most commonly used technique to answer these questions. This

technique involves the separation of DNA molecules based on their size and conformation through

an agarose gel using an electric current. The electrophoretic migration of a DNA fragment through

agarose is inversely proportional to the logarithm of its molecular weight (for certain size classes

under defined conditions). [Tip! When you are estimating the sizes of restriction fragments, be sure

to keep in mind the accuracy that is warranted - i.e. the number of significant digits.] The

concentration of agarose used depends on the sizes of the DNAs being studied; for separating linear

DNAs in the 0.5 kb to 10 kb range, a 1% agarose gel is commonly used. After electrophoresis the

gels will be viewed under ultraviolet light and a digital picture will be taken. The intensity of

fluorescence is proportional to the amount (and length) of linear DNA and this method can be used

for a rough estimate of the quantity of DNA in the samples.

Agarose gel electrophoresis is performed at voltage levels that are potentially hazardous. The gel

boxes have a safety interlock feature and the leads must be removed before opening the lid.

ALWAYS TURN THE POWER SUPPLY OFF BEFORE DISCONNECTING THE LEADS.

Ethidium bromide, which is used in staining agarose gels to visualize DNA under ultraviolet light, is

a potential carcinogen; so always wear gloves when handling anything containing it. The UV light

source is also extremely hazardous to skin and particularly your eyes, so be sure to use proper

protection (gloves, lab coat, face mask) when viewing your agarose gels.

http://askabiologist.asu.edu/expstuff/mamajis/restriction/restriction.html


Each gel apparatus has two gel casting plates and three combs (8-wells, 10 wells, and 14-wells

holding about 14L, 12L, and 6L respectively). Remember that the 8 and 10-wells gels require

about twice as much DNA as the 14-wells one because of the difference in well size. Also if you

wish to visualize fairly small fragments (<500bp) which are less intensely stained you may consider

using more DNA and perhaps a higher percentage of agarose (e.g. 1.5% instead of the more standard

1%) for a better resolution.

Method:

A. Preparation of an agarose gel (8 well comb)

Materials:

Agarose

10X TBE

1. Prepare 200mL TBE buffer at a final concentration of 1X in your graduated cylinder. Mix well.

2. Mix the appropriate amount of agarose to obtain a final concentration of 1.0% m/v) in 25 mL of

1X TBE.

3. To dissolve the agarose, microwave (25-45 sec.). Loosely cover the mouth of the flask with

plastic to prevent evaporation. Once the agarose is totally dissolved, allow the flask to cool to 50-

60 oC (5 minutes or so).

4. Add 50 L of a stock solution of ethidium bromide at 1mg/mL (CAUTION! CARCINOGEN!)

and mix well.

5. Pour into the gel tray. After pouring the gel, place the 8 well comb (Well capacity approx. 14 L)

and remove any air bubbles (e.g. with a small tip). Allow to solidify at least 15-20 minutes.

6. Once the gel has solidified, remove the dams. Pour a sufficient amount of 1X TBE to cover the

gel by approx. 0.5cm.

7. Carefully remove the comb.


B. Checking the good operation of your gel

8. Attach electrodes so that the cathode (negative electrode) is at the "origin" end of the gel and the

samples will run through the gel towards the anode (positive electrode). (CAUTION! HIGH

VOLTAGE!)

9. Set the power supply at 100V. Turn on the power supply. Verify that the amperage is in the 40-55

mA range. If it is not there is a problem.

Possible problems:

The buffer is at the wrong concentration

The buffer in the gel is at the wrong concentration

You forgot to put buffer in the gel

C. Analysis of restriction digests

10. Load the following DNA samples. The unknown is a recombinant of the pUC9 vector:

a. 1Kbp molecular weight markers (5µL)

b. Recombinant pUC9 plasmid DNA you previously purified, 5µL

c. Recombinant pUC9 plasmid cut with BamHI, 5µL

d. Recombinant pUC9 plasmid cut with EcoRI, 5µL

e. Recombinant pUC9 plasmid cut with HindIII, 5µL

f. Recombinant pUC9 plasmid cut with EcoRI + HindIII, 5µL

g. Recombinant pUC9 plasmid cut with PstI, 5µL

h. Vector pUC9 cut with BamHI, 5µL

11. Carry out the electrophoresis at 100V for approx. 45 minutes and ask a teaching assistant to take

a picture.


DNA Size Markers


Exercise 2


Restriction mapping of a recombinant plasmid

Plasmid DNA isolation with Qiagen

Restriction digests

Agarose gel electrophoresis

Restriction mapping of a yeast gene – Southern analysis

Genomic DNA isolation

Restriction digest of genomic DNA

Gel electrophoresis


Restriction enzymes and agarose gel electrophoresis Following most restriction digest reactions it is necessary to answer the following questions:

Was the DNA digested?

Was the digest complete or partial?

Is there partially digested DNA?

Is there partially undigested DNA?

Have the DNA samples completely digested? If there is only partial cleavage of the DNA (for

example - low enzyme activity due to inappropriate reaction conditions or impurities in the DNA that

inhibit the enzyme), the slower migrating species (representing uncleaved fragments containing a site

for the enzyme used) are usually present in sub-stoichiometric amounts. In other words, because the

UV fluorescence intensity is proportional to the amount of ethidium bromide bound (and therefore

the amount/length of DNA), these species are not as intense as they would be if present in equimolar

amounts to the completely digested fragments.

Are the calculated sizes of restriction fragments internally consistent? If you are running different

digests of cloned DNA, it is important to check that the calculated sizes of the fragments add up to

approximately the same value in each of the different lanes (that is, the size of the intact DNA

molecule). Because there are inaccuracies in estimating sizes from the standard markers (and those in

the non-linear part of the curve have greater error), there usually is only approximate agreement

(perhaps 200-300 bp differences for a 5 Kbp recombinant plasmid). If there are greater discrepancies,

consider the following: Might there be co-migrating species? (Clues from relative fluorescence

intensity) Are partial digestion products being included in the calculation? Might there be multiple

low MW fragments (of correspondingly lower intensity that you cannot easily see)? Could you be

using the size of fragments which are the result of a partial digest in your calculation? Are linear size

markers being used to size linear (as opposed to non-linear) DNA molecules? Remember that linear,

relaxed circular and supercoiled double-stranded DNA molecules have different migration properties

under our conditions of agarose gel electrophoresis. Because the size markers that we are using are

linear ones, can they be used to estimate the size of an uncut recombinant plasmid?


Restriction mapping of a recombinant plasmid (Groups of 2) The goal of this experiment is to give you an understanding of the technique of restriction mapping.

Each group of two will be working with a plasmid that contains an insert representing one of the

genes listed under the heading “sequences” > “Unknown "genes” on this course's web site. These

inserts were all obtained from a genomic library created in the cloning vector pUC19. Briefly,

genomic DNA was isolated from an organism, digested, and the resulting fragments were then

ligated into the vector pUC19 which was linearized with an appropriate restriction enzyme whose

site is within the multiple cloning site. (See figure on next page).

The goals of this project are:

Using an experimental approach to: o Determine the insertion site

o Verify the size of the insert

o Verify the orientation of the insert

o Determine the restriction map

Tips for working with restriction enzymes

Always keep the enzyme stocks on ice when they're out of the -20oC freezer, and plan your setup for

that time to be as short as possible.

The enzyme is always the last component added to a reaction mixture, and it is added directly into

the solution in the bottom of the tube rather than as a drop on the side of the tube.

Make sure the solution is well mixed (e.g. "flicking" the tube with your finger) and if any drops are

along the side of the tube, spin them down using the microcentrifuge. Alternatively, the sample can

be mixed by vortexing (unless you are using high molecular weight genomic DNA in which case

there is the danger of shearing it).

Never touch the end of the plastic pipette tips with your fingers or anything except the solution that

you are transferring.

Always use a clean tip for each operation and dispose of the used tips at once.

In compliance with the BIOHAZARD GUIDELINES, all disposable items (micropipette tips,

microcentrifuge tubes, etc.) used when working with recombinant DNAs and bacterial host cells

must be placed in special waste containers (that is, the disposal boxes at your work stations which

you will then transfer to orange bags) to be autoclaved before disposal.


The following enzymes do not cut pUC19: AdeI, AloI, ApaI, AscI, BaeI, BbvCI, BclI, BcuI, BglII, BoxI, BpiI, BplI, Bpu10I,

Bpu1102I, BsaAI, BsaBI, BseRI, BsgI, BshTI, BsmFI, Bsp68I, Bsp119I, Bsp120I,

Bsp1407I, BspTI, Bst1107I, BstXI, Bsu15I, BtrI, Cfr42I, CpoI, DsaI, Eco32I,

Eco47III, Eco52I, Eco72I, Eco81I, Eco91I, Eco105I, Eco130I, Eco147I, FseI, Kpn2I,

KspAI, MlsI, MluI, Mph1103I, MssI, MunI, Mva1269I, NcoI, NheI, NotI, PacI, PauI,

PdiI, Pfl23II, PsiI, Psp5II, PsyI, SacII, SanDI, SexAI, SfiI, SgfI, SgrAI, SmiI,

SrfI, SstII, Van91I, XagI, XcmI, XhoI, XmaJI.

The pUC vectors are small, high copy number, plasmids that have a multiple cloning site (MCS), the

pMB1 origin of replication responsible for the replication of the plasmid (source – plasmid pBR322),

and the bla gene, coding for beta-lactamase, which confers resistance to ampicillin (source – plasmid

pBR322). Note that all the restriction sites within the multiple cloning site occur only once.

pUC19

MCS of pUC19


Tips for restriction enzyme cleavage of plasmids

Amount of DNA to use:

The ease of detection of your restriction fragments (by UV fluorescence after ethidium bromide

staining where fluorescence intensity is proportional to the mass of DNA in a fragment) will depend

on the amount of DNA used (and also parameters such as gel well width, sharpness of bands, etc.).

Typically, 200-600ng plasmid DNA/lane is used for digests with a single enzyme. For digests that

result in many fragments you may need to restrict 400-1,000ng so that the smallest fragment can be

visualized after staining (WHY??)

After taking DNA samples from the freezer, be sure to completely thaw them before pipetting (to

obtain the correct amount of DNA in a given volume).

Your digestions will be carried out in the presence of a commercial buffer from Fermentas.

Restriction enzymes vary in their preferred salt concentration and this can be achieved by using

buffers with different salt concentrations.

A few enzymes require an incubation temperature other than 37oC. Also note that restriction

enzymes having the same recognition sequence are called isoschizomers (e.g. SacII and SstII) and

that some enzymes with very similar names (EcoRI, EcoRV) have distinctively different recognition

sequences (so be sure to read the labels on the enzyme tubes carefully).

In principle, 1 UNIT OF RESTRICTION ENZYME DIGESTS 1g OF PURIFIED DNA TO

COMPLETION IN 1 HR. However, because we are often using crude DNA preparations, we

routinely increase the amount of enzyme used and for high complexity genomic DNAs, incubation

times are usually extended as well. Typically restriction enzymes are supplied in concentrations of 5-

10 units/L.

The final volume of enzyme should not exceed 1/10 the total reaction volume, because the

glycerol in enzyme stocks, added to prevent freezing upon storage in the freezer, may inhibit the

reaction. Also note that solutions containing glycerol are more difficult to pipette accurately than

aqueous solutions, so carefully monitor the volumes in the pipette tips.

For an overview on restriction mapping visit the following web sites:

http://faculty.plattsburgh.edu/donald.slish/RestMap/RestMapTutorial.html

http://www.vivo.colostate.edu/hbooks/genetics/biotech/enzymes/maps.html

http://wps.prenhall.com/esm_klug_essentials_5/17/4576/1171606.cw/content/index.html

http://faculty.plattsburgh.edu/donald.slish/RestMap/RestMapTutorial.html

http://www.vivo.colostate.edu/hbooks/genetics/biotech/enzymes/maps.html

http://wps.prenhall.com/esm_klug_essentials_5/17/4576/1171606.cw/content/index.html


List of restriction enzymes available

ENZYME SITE

BamHI G▼GATCC

HindIII A▼AGCTT

PstI CTGCA▼G

XbaI T▼CTAGA

▼- indicates cleaved phosphodiester linkage


Method & Materials:

Some of the restriction enzymes you will be using can be found in your freezer box. If they

are not in your freezer box they are in the freezer box of the group facing you on the same

end of bench as you.

Your unknown recombinant plasmid, at a concentration of 100g/mL, is in your freezer box.

10X Restriction enzyme buffers are in your freezer box.

Setting up your restriction digests: Since different enzymes require different buffers, you will need to be flexible in making a restriction

digest. Prepare a chart listing all the components that you intend to add and their volumes before you

begin. As you add a component to your labelled tube, cross out the entry on your list. Choose the

restriction buffer which gives a 100% activity with the chosen enzyme. (Consult the table on the next

page)

Reaction mix for a typical single digest in a 30µL volume:

Ingredients Final Concentration/µL

DNA (100ng/µL) 8.3ng/ µL

10X restriction buffer 1X

Enzyme (approx. 10 units/µL) 0.3 units/ µL

Water Complete to 30µL

For single digests, use the recommended restriction buffer for 100% activity.

For double digests, your reactions must contain each enzyme at a final concentration of 0.3

units/ µL. Use the restriction buffer with the best compatibility for both enzymes.


Enzyme Recommended buffer

for 100% activity

% activity in Fermentas buffers

B G O R Tango

(blue) (green) (orange) (red) (yellow)

1X 1X 1X 1X 1X

ApaI B 100 20-50 0-20 0-20 20-50

BamHI BamHI 20-50 100 20-50 50-100 100

BclI G 20-50 100 20-50 20-50 100

BglI O 0-20 50-100 100 100 0-20

BglII O 0-20 20-50 100 50-100 0-20

BstXI O 20-50 100 100 50-100 50-100

ClaI Tango 20-50 20-50 20-50 20-50 100

EcoRV R 0-20 50-100 50-100 100 20-50

EcoRI EcoRI 0-20 NR 100 100 NR

HincII Tango 50-100 50-100 20-50 50-100 100

HindIII R 0-20 20-50 0-20 100 50-100

HinfI R 0-20 20-50 50-100 100 50-100

HpaII Tango 50-100 50-100 0-20 20-50 100

HphI B 100 0-20 0-20 0-20 20-50

KpnI KpnI 20-50 0-20 0-20 0-20 20-50

MluI R 0-20 20-50 50-100 100 20-50

NcoI Tango 20-50 20-50 20-50 50-100 100

NdeI O 0-20 0-20 100 50-100 0-20

NheI Tango 100 20-50 0-20 0-20 100

PstI O 50-100 50-100 100 100 50-100

PvuI R 0-20 20-50 50-100 100 50-100

PvuII G 50-100 100 20-50 50-100 20-50

RsaI Tango 50-100 20-50 0-20 0-20 100

SacI SacI 50-100 20-50 0-20 0-20 50-100

SacII B 100 50-100 0-20 0-20 50-100

SalI O 0-20 0-20 100 20-50 0-20

ScaI ScaI 0-20 0-20 0-20 0-20 0-20

SmaI Tango 50-100 0-20 0-20 0-20 100

SspI G 20-50 100 0-20 50-100 100

TaqI TaqI 0-20 20-50 20-50 20-50 20-50

XbaI Tango 50-100 50-100 20-50 0-20 100

XhoI R 0-20 50-100 50-100 100 20-50

NR – Not recommended

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er141-apai

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er005-bamhi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er072-bcli

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er007-bgli

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er008-bglii

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er102-bstxi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er014-bsu15i

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er030-eco32i

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er027-ecori

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er049-hincii

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er050-hindiii

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er080-hinfi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er051-hpaii

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er110-hphi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er052-kpni

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er056-mlui

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er057-ncoi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er058-ndei

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er097-nhei

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er061-psti

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er062-pvui

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er063-pvuii

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er112-rsai

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er113-saci

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er064-sali

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er043-scai

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er066-smai

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er077-sspi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er067-taqi

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er068-xbai

http://www.fermentas.com/en/products/all/conventional-restriction-enzymes/er069-xhoi


Your digests:

1. Setup the following restriction digests of 0.25g of DNA.

BamHI HindIII + PstI PstI + XbaI

HindIII HindIII + XbaI

PstI

XbaI

2. Prepare a digestion control, which contains all the components except for enzyme. (You may use

any of the restriction enzyme buffers for this reaction)

3. Incubate at 37oC for 60 minutes.

4. While your digestions are incubating, prepare a 1.0% agarose gel containing ethidium bromide.

5. Following the incubation period, transfer 5µL of your digestions to new appropriately labelled

tubes and then add 5X DNA loading buffer to each of them to obtain a final concentration of 1X

or more.

6. Load the samples containing the loading buffer in the gel.

7. Load 5μL of the digested pUC19 vector which has been prepared for you.

8. Load 5µL of the molecular weight ladder.

9. Carry out the electrophoresis at 100V.

10. Following the electrophoresis, examine your gel under the UV light and take a picture for your

analysis.


Plasmid DNA isolation with the QIAGEN kit Another method used for the isolation of plasmid DNA makes use of commercial kits such as the one

offered by Qiagen. Fundamentally, this technique is based on the alkaline lysis procedure that you

previously performed. In order to compare the two, you will use the Qiagen kit for the purification

of the pUC19 vector. At the end of this procedure you are expected to be able to compare these two

methods with respect to their similarities and differences.

Step 1

Steps 2-5

Steps 6-7

Steps 8-9

Step 10

Bacterial pellet

Wash

Elute

Bind

Suspend

Lyse

Neutralize

Pure plasmid DNA


Protocol for the purification of the pUC19 vector: 1. Obtain the 1.5mL plasmid containing E.coli culture that was prepared for you and harvest the

cells by centrifugation at maximum speed for 1 minute. Decant supernatant.

2. Suspend the cell pellet in 250L of Buffer P1 (+ RNAse) and transfer to a microcentrifuge tube.

No cell clumps should be visible.

3. Add 250L of Buffer P2 (containing NaOH/SDS) and gently invert the tube 4-6 times to mix. Do

not vortex, as this will result in shearing of genomic DNA. If necessary, continue inverting the

tube until the solution becomes viscous and slightly clear, but do not exceed 5 min because the

plasmid DNA may become irreversibly denatured.

4. Add 350L of Buffer N3 (neutralization, high salt buffer) and immediately invert the tube gently

4-6 times. The solution should become cloudy.

5. Centrifuge at maximum speed for 10 min. A compact white pellet will form with the “cleared

lysate” above it.

6. Using a pipette, transfer the supernatant from step 5 to the QIAprep column placed in a 2mL

collection tube.

7. Centrifuge 60 sec. at maximum speed. Discard the flow-through volume in an organic waste

container.

8. Wash the QIAprep spin column by adding 0.375mL of Buffer PE (containing ethanol) and

centrifuge 60 sec. at maximum speed. Discard the flow-through (organic waste). Repeat a second

time.

9. Discard the flow-through (organic waste), transfer to a centrifuge tube with the cap cut off and

centrifuge for an additional 1 minute to remove residual wash buffer.

IMPORTANT: Residual ethanol from Buffer PE may inhibit subsequent enzymatic reactions so

steps 8 and 9 are therefore very important.

10. Place the QIAprep column in a clean 1.5mL microcentrifuge tube with the cap cut off. To elute

DNA, add 50L of Buffer EB (elution buffer = 10mM Tris-HCl, pH 8.5) and centrifuge for 1

minute.

11. Transfer to a new microcentrifuge tube. MAKE SURE TO APPROPRIATELY LABEL THIS

PREPARATION AND TO STORE THE REMAINDER AT -20OC IN YOUR FREEZER

BOX SINCE YOU WILL NEED IT FOR EXERCISE 3 AS WELL AS FOR THE

PRACTICAL EXAM!

12. Transfer 5L of your preparation to a new tube and add a sufficient amount of loading dye to

have a final concentration of 1X or more.

13. Load your sample in the prepoured gel which has been prepared for you.


Mapping of a yeast gene – Southern analysis (Groups of 2) Restriction mapping of plasmids is a relatively simple task given the low complexity of plasmids.

The same cannot be said of genomic DNA. A technique which was developed to perform restriction

analysis of complex DNA such as genomes is the Southern. The principal of this technique relies on

the digestion of the DNA of interest, followed by electrophoresis, denaturation, transfer to a solid

support and finally hybridization to a complementary probe directed against the region of interest.

Given the advent of PCR and sequencing, Southern analysis is not much used nowadays. However,

this type of analysis remains useful to…

― find the position of a sequence in a large DNA fragment

― detect chromosomal rearrangements

― determine the number of copies of a gene

― find sequences with low homology

― analyze unsequenced DNA from an unknown organism

Isolation of yeast genomic DNA

Materials provided:

Pellet from 2mL yeast culture

Lysis buffer

Screw cap tube containing glass beads and 200μL phenol:chloroform:isoamyl alcohol (25:24:1)

99% ETOH

RNAse (In ice bucket at the front)

4M ammonium acetate

Method:

1. Suspend yeast pellet in 200μL of lysis buffer.

2. Transfer yeast suspension to screw cap tube containing glass beads and 200μL

phenol:chloroform:isoamyl alcohol (25:24:1).

3. Vortex for 1 minute, then place on ice for 1 minute.

4. Repeat step 3 two more times.

5. Centrifuge at maximum speed for 5 minutes. Transfer the upper aqueous phase to a new

microcentrifuge tube. AVOID TAKING ANY OF THE INTERPHASE!

6. Add 1ml of 99% ETOH to the aqueous phase, mix well by inversion and spin at maximum speed

for 2 minutes.

7. Discard supernatant and suspend pellet in 400μL water.

8. Add 2μL RNAse and incubate at 37oC 15 minutes.

9. Add 10μL 4M ammonium acetate, 1mL 99% ETOH, and Mix well.

10. Centrifuge at maximum speed for 2 minutes.

11. Discard supernatant and suspend pellet in 100μL water.

12. Prepare a 1/10 dilution in water in a final volume of 250μL of a sample of your genomic DNA

isolation.

13. Label your diluted sample and give it to your teaching assistant so that he will obtain the reading

at 260nm.

14. Determine the concentration of your preparation.


Digestion and electrophoresis of yeast genomic DNA

Method:

15. Having determined the concentration of your genomic DNA preparation, prepare a digestion of

5μg of DNA with 20 units of the enzyme BamHI in a reaction volume of 50μL.

16. Perform the digestion for 1 hour at 37oC.

17. Following the incubation period, transfer 15μL to a new tube and then add a sufficient amount of

5X DNA loading buffer to obtain a final concentration of 1X or more.

18. A picture of the gels will be taken following their migrations. The gels will then be transferred to

a membrane which will be hybridized with a probe against a yeast gene.

19. The results of the hybridizations will be available on the T:\ drive.


Exercise 3


Site directed mutagenesis and cloning of GFP

PCR amplification and mutagenesis of GFP

Purification of PCR reactions with QIAQUICK

Digestion of GFP PCR product and pUC19 vector

Ligation of GFP amplicons


Site directed mutagenesis and cloning of GFP (Groups of 2)

The ultimate goal of this project is to use PCR to mutagenize the GFP protein. To achieve this goal

you will use the polymerase chain reaction to amplify and perform site directed mutagenesis of the

gene. This project involves several parts which will be performed over the next two weeks. Consult

the following web pages to refresh your knowledge on PCR:

http://www.maxanim.com/genetics/PCR/PCR.htm

http://www.dnalc.org/resources/animations/pcr.html

Overview of the steps which will be performed are presented in the flowchart below.

PCR amplification and mutagenesis of GFP (Step I)

Cleanup of GFP PCR products (Step II)

Digestion of GFP PCR products with HindIII and EcoRI (Step III)

Digestion of Qiagen purified pUC19 with HindIII and EcoRI (Step III)

Cleanup of digested GFP PCR products or digested pUC19 vector (Step IV)

Ligation of GFP PCR products in digested pUC19 vector (Step V)

Transformation of ligations in E.coli Xl-1 (Step VI; this will be done for you)

Screening of transformants (Step VII; to be done next week)

http://www.maxanim.com/genetics/PCR/PCR.htm

http://www.dnalc.org/resources/animations/pcr.html


Step I: PCR amplification and mutagenesis of GFP Primers have been designed to amplify and mutagenize the coding sequence of the GFP gene in the

plasmid pGFPuv. The primers you will use are indicated below.

“Forward” primers:

GFPfor-1: CGCCAAGCTTGCATGCCTGCAGGTCG

GFPfor-2: CGCCAAGCTTGcCATGCCTGCAGGTCG

GFPfor-3: CGCCAAGCTTGaCATGCCTGCAGGTCG

Characteristics:

A HindIII (AAGCTT) site is indicated in italics and underlined and will be used for cloning.

“Reverse” primer:

GFPrev: CCGTCTCCGGGAGCTGCATGTGTCAG Method:

Prepare your PCR reactions in a total reaction volume of 50L. In labelled PCR tubes (use 200L

thin walled PCR tubes) add the following ingredients in the order listed in the table below. For each

component use a new autoclaved tip. Note: The Taq polymerase will be added by the T.A.

Ingredients Stock Conc. Final Conc. Volume


Taq PCR buffer 10X 1X

*Assigned GFPfor primer 2µM 0.2µM

GFPrev primer 2µM 0.2µM

MgCl2 50mM 1.5mM

dNTP 2mM 200µM

pGFPuv - 5 µL

Taq polymerase 5 units/µL 0.05 units/µL

* Make sure that you record which reverse GFP primer you were assigned!

Once your reaction setup is completed give them to your teaching assistant.

PCR amplification conditions:

1. 1 cycle of 5min, 94oC to denature;

2. 30 cycles of 30sec 94oC to denature, 1 min at 68oC to anneal and extend.

3. 1 cycle of 5min, 72oC.

4. Cool to 4oC indefinitely.


Electrophoresis of GFP PCR amplicons Once the PCR reactions completed you will use agarose gel electrophoresis to determine whether

your amplification was successful before initiating the cloning.

Method:

1. Obtain your PCR reactions.

2. Transfer 8 L of your PCR products into new tubes and add 2.5L of 5X loading buffer. Return

the remainder on ice for subsequent experiments.

3. Load your samples on a 1% agarose gel, that has been prepared for you, containing ethidium

bromide and on which appropriate DNA size markers have been loaded.

4. Examine under UV light and take a picture for analysis.

Step II: Purification of PCR reactions with the QIAQUICK purification kit (Assigned groups of 2)

Method:

1. Add 5 volumes of Buffer PB to 1 volume of the PCR reaction and mix by inversion.

2. Place a QIAQUICK spin column in a 2mL collection tube.

3. To bind DNA, apply the sample to the QIAQUICK spin column and centrifuge for 1 minute.

4. Discard the flow-through to ORGANIC WASTE and place the QIAQUICK spin column back

into the same tube.

5. To wash, add 0.375mL of Buffer PE to the column and centrifuge for 1 minute.

6. Discard the flow-through to ORGANIC WASTE.

7. Wash again by adding 0.375mL of Buffer PE to the column and centrifuge for 1 minute.

8. Discard the flow-through to ORGANIC WASTE. Place the QIAQUICK spin column back into

the same tube. Centrifuge for 1 minute. This second centrifugation removes any residual ethanol

from Buffer PE that may elute with the DNA and interfere with subsequent steps.

9. Place the QIAQUICK spin column into a new labelled 1.5mL microcentrifuge tube.

10. To elute DNA add 30L of Buffer EB (10mM Tris-HCl, pH 8.5) to the centre of the QIAQUICK

spin column, wait 1 minute and then centrifuge for 1 minute.

11. Using a new pipette tip, transfer the recovered liquid BACK onto the center of the QIAQUICK

spin column and centrifuge for 1 minute.

12. Transfer the recovered liquid into a labelled 1.5mL microcentrifuge tube and store until needed.

(If you were unable to recover 30L, add elution buffer to bring the volume up to 30L).


Step III: Digestion of GFP PCR product and pUC19 vector (Assigned groups of 2)

Method:

One of the groups of two will perform the digestion of the GFP amplicon whereas the other

group of two will perform the digestion of the pUC19 vector.

1. Setup a reaction mixture of 50µL to perform HindIII-EcoRI double digests of the GFP PCR

product and the pUC19 vector you purified by the Qiagen method last week.

Volume PCR Volume Vector

GFP PCR product 10µL ---------

OR pUC19 vector --------- 5µL

Red 10X Restriction buffer 5µL 5µL

HindIII 1µL 1µL

EcoRI 1µL 1µL

Water Complete to 50µL Complete to 50µL

2. Perform the digestion at 37oC for 1 hour.

Step IV: Purification with the QIAQUICK kit of digested PCR products or

pUC19 (Assigned groups of 2)

Method:

1. Add 5 volumes of Buffer PB to 1 volume of the restriction mixture and mix by inversion.

2. Place a QIAQUICK spin column in a 2mL collection tube.

3. To bind DNA, apply the sample to the QIAQUICK spin column and centrifuge for 1 minute.

4. Discard the flow-through to ORGANIC WASTE and place the QIAQUICK spin column back

into the same tube.

5. To wash, add 0.375mL of Buffer PE to the column and centrifuge for 1 minute.

6. Discard the flow-through to ORGANIC WASTE.

7. Wash again by adding 0.375mL of Buffer PE to the column and centrifuge for 1 minute.

8. Discard the flow-through to ORGANIC WASTE. Place the QIAQUICK spin column back into

the same tube. Centrifuge for 1 minute. This second centrifugation removes any residual ethanol

from Buffer PE that may elute with the DNA and interfere with subsequent steps.

9. Place the QIAQUICK spin column into a new labelled 1.5mL microcentrifuge tube.

10. To elute DNA add 30L of Buffer EB (10mM Tris-HCl, pH 8.5) to the centre of the QIAQUICK

spin column, wait 1 minute and then centrifuge for 1 minute.

11. Using a new pipette tip, transfer the recovered liquid BACK onto the center of the QIAQUICK

spin column and centrifuge for 1 minute.

12. Transfer the recovered liquid into a labelled 1.5mL microcentrifuge tube and store in your

freezer box. (If you were unable to recover 30L, add elution buffer to bring the volume up to

30L).


QIAquick Spin Purification

Procedure

PCR reaction

or

Solubilized gel slice

or

Enzyme reaction

Bind

Wash

Elute


Step V: Ligation of GFP amplicons Having digested the GFP PCR amplicon and the pUC19 vector you will now proceed with the

ligation. Your ultimate goal is to clone the amplified GFP sequence in the pUC19 vector.

Ingredient Tube 1 Tube 2

Digested pUC19 5.0L 5.0L

10 X ligase buffer 2.0L 2.0L

Digested GFP PCR amplicon 5.0L 0.0L

Water add water to complete the volume to 19.0L

Ligase 1.0L 1.0L

GIVE YOUR LABELED SAMPLES TO THE DEMONSTRATOR

The ligations will be incubated at room temperature until tomorrow and then transformed in E.coli

Xl-1.


Exercise 4


Mutagenesis and cloning of GFP - Analysis of transformations

Colony counts

Colony PCR

Restriction digest of colony PCR products


Mutagenesis and cloning of GFP (Groups of 4)

Analysis of transformation results

The ligations you performed last week were used to transform the E.coli strain Xl-1 blue. You have

been supplied with the transformation plates to continue with the analysis of the cloning experiment.

Obtain the following data for each of the transformation plates provided:

Reverse primer used for the amplification and mutagenesis

Total number of colonies observed

Number of white colonies

Number of blue colonies

Number of green fluorescent colonies

Make sure to obtain this data for each of the mutagenesis experiments performed (i.e. each of the

three different forward primers.

PCR screening of transformants

Once you have recorded your counts you will use PCR and a digestion to screen the recombinants

for inserts (and view PCR products after electrophoresis).

Method:

1. Label 7 microcentrifuge tubes from 1-7.

2. Add 50L of water to each of the tubes.

3. Using a sterile pipette tip, pick one of the blue colonies from a plate representing the

transformation of plasmid + insert and place the tip in the corresponding tube labelled 1.

4. Repeat the above procedure for 6 white colonies. If you had white colonies which were

fluorescent and some which were not, pick three of each. If all the white colonies were also

fluorescent, then pick 6 of these.

5. Briefly vortex each of the 7 tubes containing the pipette tip, to suspend the colony (Hold the tip

while vortexing).

6. Remove the tip from each tube, close the tube, and boil for 5 minutes. Place on ice for 1 minute.

7. Centrifuge at maximum speed for 5 minutes. You will be using the supernatant for the PCR

analysis.

8. Prepare a PCR cocktail for 8 reactions of 20L. KEEP ON ICE. Below is the recipe for a single

20L reaction.

PCR Reaction

Solution Stock conc. Final conc.

Water L to a final volume of 20 L

Taq PCR buffer 10 X 1 X

MutScreenFor primer 2 M 0.2 M

MutScreenRev primer 2 M 0.2 M

MgC12 50 mM 2.5 mM

dNTPs 2 mM 200 M

Taq DNA Pol. 5 U/L 0.25U/L


9. Distribute 19L of cocktail to each of 7 appropriately labelled PCR tubes (ON ICE)

10. Add 1L of each of the colony supernatants you obtained in step 7 to each of the appropriate

PCR tubes.

11. Prepare a 1.25% agarose gel containing ethidium bromide.

PCR conditions:

i. 1 cycle of 5min, 94oC to denature;

ii. 30 cycles of 30sec 94oC to denature, 1 min at 68oC to anneal and extend.

iii. 1 cycle of 5min, 72oC.

iv. Cool to 4oC indefinitely.

Primers:

Forward : AGCTCACTCATTAGGCACCCCAGGC

Reverse: ATCGGTGCGGGCCTCTTCGC

Restriction digestion of colony PCR products:

1. Obtain your PCR reactions.

2. Prepare 7 BamHI digestions, one for each of your PCR reactions, in a final volume of 20µL

containing 5µL of each of your PCR reactions.

3. Prepare an undigested control, using any of the 7 PCR reactions.

4. Digest for one hour.

5. Following the digestion, add 5µL loading buffer to each sample.

6. Load 10L of each mixture, as well as the molecular weight ladder, on your 1.25% agarose.

Migrate for 1 to 1.5 hours at 100 V.

7. Take a picture of your gel.


Exercise 5


Gene expression - Transcription

Yeast RNA isolation

RNA electrophoresis

Principals of RT-PCR


Gene expression - Transcription The information contained within our genomes is of little use, unless the cell can decode it to

produce useful products that can perform work. This information is contained within units called

genes (or coding DNA). The expressed product of a gene can be either RNA or protein. However,

not every gene product is needed at all times, nor are they needed in the same amounts. It would be

very energetically demanding and wasteful for a cell to express every gene all the time. Furthermore,

an inappropriate ratio between the different gene products may hinder their function and be harmful

to the cell or the organism. Consequently, the cell regulates the expression of genes in response to

different intracellular and extracellular cues. The first step in gene expression is transcription a

process whereby the enzyme RNA polymerase reads the DNA sequence of a gene to generate either

a coding transcript (mRNA) or a non-coding transcript such as ribosomal RNA or tRNA. Thus the

first step in the study of gene expression is to examine the relative abundance of an RNA of interest

among the population of total RNA expressed at a given time under different conditions.

Yeast RNA isolation (Groups of 2)

Each group of two will be provided with a yeast culture which was subjected to one of the following

environmental condition:

Cultures exposed to 0.85M NaCl for 0 minutes.




Make sure you record which environmental condition you were assigned. You will need this

RNA preparation for experiments which are to be performed next week.

Method: (Steps 1-3 have been done for you)

1. Obtain 10mL of the assigned yeast culture.

2. Centrifuge for 10 minutes at 7 000 rpm.

3. Discard supernatant.

4. Suspend pellet in 200μL lysis buffer.

5. Transfer to a screw cap tube containing glass beads and 200μL phenol : chloroform : isoamyl

alcohol (25:24:1).

6. Vortex 2 minutes and then place on ice two minutes.

7. Repeat step 6 two more times.

8. Centrifuge at maximum speed for 5 minutes. Transfer the upper aqueous phase to a new tube.

9. Add 0.1 volumes of 3M NaOAc and 1mL 99% ETOH. Mix by inversion and centrifuge at

maximum speed for 2 minutes.

10. Discard supernatant and suspend pellet in 100μL DEPC treated water.

11. Determine yield and purity.


RNA electrophoresis (Groups of 4) Having isolated total RNA from a given condition, it can be run on an agarose gel to assess, its

quality and to verify the correspondence with the predicted yield according to the absorbance at

260nm. Typically, RNAs are separated as a function of their size on denaturing formaldehyde

agarose gels. This type of gel provides denaturing conditions that prevent base-pairing and thus

reduce RNA secondary structure. This is important because unlike double-stranded DNA fragments,

which have the same conformation regardless of length, single-stranded RNAs can adopt different

conformations due to intra-strand base-pairing. This would affect electrophoretic migration.

Methods:

A. Preparation of an agarose-formaldehyde gel (One gel per groups of 4) 1. To prepare a 1.5% agarose-formaldehyde gel (25mL) (using the 8 well comb), combine the

following:

5X MOPS buffer 5mL

H20 15.5mL

Agarose 0.375g

2. Dissolve agarose in microwave oven. Cool slightly; then add 4.5mL of formaldehyde (37%

solution) (WORK IN THE FUMEHOOD. CAUTION! VOLATILE FUMES). Swirl to mix

and cast the gel immediately.

3. Close the cover and let the gel set for at least 30 minutes.

B. Preparation of RNA samples (Each group of 2)

1. To prepare the RNA samples prior to loading on the gel, each group of two will mix the

following components using labelled tubes KEPT ON ICE:

Final volume = 30L

RNA sample: L (This volume should contain 5g in a maximum volume of 9L)

Loading buffer: 21L (RNA loading buffer not the DNA loading buffer)

Water to 30 L: L

2. Incubate your samples at 700C for 10 minutes and then place the samples on ice. If there is liquid

on the side of the tube, spin in the microcentrifuge for a few seconds.

3. Load 14L aliquots of each of the RNA samples on your gel:

C. Gel electrophoresis 1. The gel running buffer will be 1X MOPS buffer. Run the gel at 80 V (current ~80 mA) until the

bromophenol blue dye is further than half way down the gel.

2. Remove the gel from the electrophoresis chamber, observe under U.V. and take a picture.

NB: Formaldehyde gels are MORE FRAGILE than non-denaturing gels so be extra careful!


PRINCIPALS OF RT-PCR (Groups of 2) A method commonly used for the analysis of RNA transcripts is RT-PCR, or a technique derived

from this one, Q-PCR (Real time PCR).

In contrast to standard PCR reactions, RT-PCR is an amplification that uses RNA rather than DNA

as template. However, since the thermostable DNA polymerase that is used in the PCR reaction can

only use DNA as a template, the RNA of interest must first be transcribed into DNA. This can be

accomplished by the RNA-dependent DNA polymerase reverse transcriptase (RT). Initially, reverse

transcriptase is used to synthesize a single-stranded complementary DNA (cDNA) strand of the RNA

of interest. Once the cDNA has been generated, a standard PCR reaction can be used to amplify the

DNA sequence complementary to the mRNA. This can be done either through end-point PCR

(classical PCR) or real time PCR.

Consult the following web site for an overview of RT-PCR:

http://www.bio.davidson.edu/courses/Immunology/Flash/RT_PCR.html

The following experiment has been designed to show you the principals of RT-PCR. We will

examine the expression of the yeast gene YRA1. Essentially, total RNA will be isolated from yeast

cells. Then, all mRNA which are typically polyadenylated will be converted to cDNA using an oligo

dT primer and reverse transcriptase. Specific primers against the YRA1 gene will then be used on the

cDNA template to perform an end point PCR. Following the analysis of the results obtained, you

should be able to answer the following questions:

Are the amplification products observed derived from cDNA or contaminating genomic DNA? In

other words are the products RT dependent or independent?

Is the gene expressed under the conditions examined?

Is the transcript processed?

Isolation of total RNA (R)

↓

DNase treatment of RNA (DR)

↓

Reverse transcriptase reaction of non-DNase treated (R) and DNase treated (DR) RNA

↓

End-point PCR

http://www.bio.davidson.edu/courses/Immunology/Flash/RT_PCR.html


Method:

Step I: Preparation of RNA samples for RT reactions:

1. Prepare the following mixture from your RNA preparation. This dilution will then be used as

your source of RNA for all the following reactions. Store the remainder of your undiluted

RNA in your freezer box until next week.

4.0g of your RNA sample

5.0L of 10X DNAse I Buffer

Water to a final volume of 48L

LABEL THIS SAMPLE “R”: NON-DNASE TREATED RNA

STORE THE REMAINDER OF YOUR UNDILUTED RNA PREPARATION IN YOUR

FREEZER BOX. YOU WILL NEED IT FOR EXPERIMENTS TO BE PERFORMED NEXT

WEEK

Step II: DNAse treatment of total RNA:

2. Prepare the following reaction mixture to treat your RNA with DNAse:

24L of non-DNase treated RNA prepared above (R)

1L DNAse I

3. Incubate at room temperature for 15 minutes. Following the DNAse I treatment, inactivate the

enzyme by adding 2.5L of 25mM EDTA and heating at 65oC for 10 minutes. Chill on ice.

LABEL THIS SAMPLE “DR”: DNASE TREATED RNA


Step III: Reverse transcriptase reactions:

4. Prepare the following RT reactions in 2 PCR tubes labelled RT-R and RT-DR. Use a new

autoclaved tip for each component added.

5. Add 19L of DEPC treated water to each tube

6. Add 4.0L of the oligo-dT primer to each tube.

7. Add 4.0L of a 2mM dNTP mixture to each tube.

8. Add 2L of your non-DNAse treated RNA (R) to the tube labelled RT-R.

9. Add 2L of your DNase treated RNA (DR) to the tube labelled RT-DR.

10. Allow annealing of the oligo-dT primer by incubating your RT pre-reaction mixture at 70oC for 5

minutes.

11. Let your tubes slowly cool down on the bench for 5 minutes.

12. Add 8.0L of 5X RT buffer to each tube.

13. Add 2.0L of 100mM DTT for a final concentration of 5mM to each tube.

14. Add 1.0 L MMLV reverse transcriptase at 200U/L for a final concentration of 5U/L to each

tube.

15. Incubate at 42oC for 60 minutes.

16. Inactivate the RT enzyme by incubating the reaction mixture at 70oC for 15 minutes.

Step IV: PCR reactions: 1. Following the RT reactions, prepare 5 PCR reactions with the following templates:

Reaction Template Volume to be used in PCR

reaction

PCR-1 R (Step I) 1L of a 1/20 dilution

PCR-2 DR (step II) 1L of a 1/20 dilution

PCR-3 RT-R (step III) 1L

PCR-4 RT-DR (step III) 1L

PCR-5 Yeast genomic DNA (Provided) 1L

Ingredient Stock conc. Final conc. Vol. for 50L reaction

Water - - L to a final volume of 49L

Taq buffer 10 X 1X

Template (see above) - - 1L

YRA (For) primer 2M 0.2M

YRA (Rev) primer 2M 0.2M

MgCl2 50 mM 2.0mM

dNTP 2mM 200M

Taq Polymerase 5 units/µL 0.05 units/µL

Primers:

YRA (FOR) CCCGTGTCGGTGGTACTCGTG

YRA (REV) GTCCGCCATTTCCTTGTCCAGAT


2. Once your PCR reactions have been prepared, place them in the ice bucket at the front for the

PCR to be performed.

3. Your PCR reactions will be returned to you once completed.

Your PCR reactions will be performed under the following conditions:

i. 1 cycle: 5 min, 94oC denaturation;

ii. 30 cycles: 30 sec, 94oC denaturation; 30 sec, 70oC annealing and extension.

iii. 1 cycle: 5 min, 72oC.

iv. Cool down at 4oC.

Step V: Analysis of RT-PCR reactions

1. Pour a 1.5% agarose gel.

2. Obtain your RT-PCR reactions.

3. Add the appropriate amount of DNA loading buffer to 10µL samples of each of your reactions.

4. Load and fractionate at 100V.

5. Following the migration, visualize under UV and take a picture.


Exercise 6


Transcriptional control of yeast CTT1 gene

RT-PCR

Northern analysis


Transcriptional control of the yeast CTT1 gene (Groups of 2) Several different conditions influence the expression of global response networks which comprise

several genes which are coordinately regulated to cope with various stressors. One of these genes is

the CTT1 gene of the yeast Saccharomyces cerevisiae, which is part of a network of stress-protective

genes. The CTT1 gene codes for the enzyme catalase. Catalase is an enzyme found in the cells of

most aerobic organisms which breaks down free radicals resulting from oxidative metabolism.

Specifically, catalase carries out the following reaction:

This week we will examine the expression of CTT1 at the transcriptional level following an osmotic

shock of yeast cells. RT-PCR will be used to examine the expression of the CTT1 gene in yeast cells

exposed to an osmotic shock for different durations. To compare the relative abundance, and thus

expression of the CTT1 gene, normalization will be performed to a second gene, a house keeping

gene; actin. Actin expression is known to not be part of the global stress network of genes and its

expression should therefore remain constant. This experimental approach will be compared to

another method, northern analysis. In this case, RNA is fractionated on a denaturing gel, as you did

last week, transferred to a solid support and then probed with sequences targeting the transcripts of

interest.

Method:

1. Last week, each group of two isolated total RNA from a yeast culture representing one of the

following conditions:





Obtain your RNA sample from your freezer box and prepare the following mixture. This dilution will

be used as your source of RNA for all subsequent reactions.

4.0g of your RNA sample

5.0L of 10X DNAse Buffer

Water to a final volume of 48L

2. Prepare the following reaction mixture to treat your RNA with DNAse:

24L of the RNA dilution prepared in step 1

1L DNAse I

3. Incubate at room temperature for 15 minutes. Following the DNAse I treatment, inactivate the

enzyme by adding 2.5L of 25mM EDTA and heating at 65oC for 10 minutes. Chill on ice.

2H2O2 2H2O + O2


4. Prepare the following reverse transcriptase reaction:

Ingredient Volumes

DEPC treated Water 19L

Oligo dT 4L

2mM dNTP 4L

DNase treated RNA 2L

Allow annealing of the oligo-dT primer by incubating your RT pre-

reaction mixture at 70oC for 5 minutes.

Then let your tubes slowly cool down on the bench for 5 minutes.

Following the annealing step, add the following ingredients 5X RT buffer 8L

100mM DTT 2L

MMLV 1L

Incubate at 42oC for 60 minutes. Then, inactivate the RT enzyme by

incubating the reaction mixture at 70oC for 15 minutes.

5. Following the RT reaction, prepare two PCR reactions: One to amplify actin and one to amplify

CTT1.

Ingredient Stock conc. Final conc. Volumes

Water L to a final volume of 50L

Taq buffer 10X 1X

Template (see above) - - 1L cDNA from step 4

Actin primer (For)

or

CTT1 primer (For) 2M 0.2M

Actin primer (Rev)

or

CTT1 primer (Rev) 2M 0.2M

MgCl2 50mM 2.0mM

dNTP 2mM 200M

Taq Polymerase 5 units/µL 0.05 units/µL

6. Once your PCR reactions have been prepared, place them in the ice bucket at the front for the

PCR to be performed.

7. Your PCR reactions will be returned to you once completed.


Analysis of RT-PCR reactions (Groups of 4)

1. Pour a 1.5% agarose gel with the 10 wells comb.

2. Obtain your RT-PCR reactions.

3. Add 15µL of 5X DNA loading buffer to the total volume of each of your two PCR reactions.

4. Each group of 4 will load a gel as follows. Note that the 4 groups of a given table will have to

share their samples among themselves.

Lane Molecular weight ladder

1 RT-PCR of actin from cultures exposed to 0.85M NaCl for 0 minutes.




5 Empty

6 RT-PCR of CTT1 from cultures exposed to 0.85M NaCl for 0 minutes.




10 Empty

5. Carry out the migration at 100V for approx. 45 minutes.

6. Following the migration, visualize under UV and take a picture.


Northern analysis Since the advent of RT-PCR and Q-PCR, the use of a Northern analysis to study gene expression has

been almost phased out. However, some information can still be obtained from a northern

hybridization which cannot easily be obtained by PCR based techniques. These include the analysis

of the size of the transcript and post-transcriptional processing. As with Southern analysis, the RNA

to be analysed is initially separated according to size on a denaturing agarose gel after which it is

transferred and probed. In the following exercise you will perform an analysis of a northern blot

which was performed on RNA isolated from yeast under the same growth conditions as you did for

the RT-PCR. You will then compare the results of this analysis to those you obtained by RT-PCR.

Method: (Note, this must be completed during the lab period)

1. Provided to you are two northern hybridizations of duplicate RNA gels representing yeast

subjected to an osmotic shock for varying durations. One of the gels was probed with the CTT1

gene whereas the other was probed with the house keeping gene; actin. These blots are available

on this course’s web page.

2. Use the program ImageJ to analyze each of these gels. Follow the tutorial for the use of ImageJ

available on this course’s web page. The program is available on the hard drive of your computer

in the week 5 folder.

3. Complete the following table and then ask one of your teaching assistants top verify that you’ve

completed the task.

Source of

RNA

Raw data from Image J Normalized values of

CTT1

Relative

expression* CTT1 Actin

0.85M NaCl

0 minute

1

0.85M NaCl

30 minutes

0.85M NaCl

60 minutes

0.85M NaCl

120 minutes

* Indicate the relative expression of CTT1 as compared to the zero minute exposure.


Exercise 7


Genomic fingerprinting

Isolation of genomic DNA from cheek cells

PCR amplification of ApoC2 VNTR

PCR amplification of ApoB RFLP

Stringency – DNA melting curves


Genomic fingerprinting (Groups of 2) The analysis of genomic polymorphisms has become a current trend to identify disease and non-

disease genotypes.

VNTR

The evolutionary principle of variation within a population is a cornerstone in biology. This variation

results from subtle differences in the DNA sequence in individuals of a given species. Variation

commonly originates by the mistaken duplication of a small sequence of nucleotides when only one

copy was present before replication. This results in a tandem repeat of the original sequence. If this

mistake occurs again in another round of replication, then three copies of a sequence will be in

tandem (figure). These tandem repeats are part of our chromosomes and as such, they will be

inherited according to Mendelian genetics. Over the centuries, the number of tandem repeat units has

increased, therefore each of us has inherited a variable number of tandem repeats (VNTRs) at many

loci scattered throughout our genomes. A VNTR can be thought of as a locus with each particular

number of repeated units being analogous to different alleles. Therefore, each human (except for

identical twins) carries a unique combination of VNTRs and these alleles can be used in population

studies or to identify a particular individual.

Figure. Illustration of variable number of tandem repeats (VNTRs). Single strands of DNA from the

same locus from three different individuals are shown. Within this region, the trinucleotide repeat

CAT is present once, twice, or three times which results in alleles of three different lengths.

RFLP

Another type of polymorphism which occurs is called restriction length Polymorphisms (RFLP).

These polymorphisms occur when a single nucleotide change occurs in a restriction site, thus

abolishing or changing it. Consequently, a given region of the genome may possess a restriction site

that is absent from the same region in another copy of the genome or in the genome of a different

individual.


Isolation of genomic DNA from cheek cells:

1. One person from each group of two should use a sterile cotton swab to gently scrape the inside of

one cheek six times. Without rotating the swab, move the swab directly over to the inside of the

other cheek and gently scrape six times.

2. Insert the cotton portion of the swab into a 1.5mL microcentrifuge tube. Then, break off the stick

just above the cotton so that the cotton part falls into the tube.

3. Add 400µL of 1X PBS pH 7.4 to your sample tube.

4. Add 20µL of proteinase K followed by 400µL buffer AL. Mix immediately by vortexing for 15

seconds. Do not add proteinase K directly to buffer AL.

5. Incubate at 56oC for 10 minutes. Spin briefly to remove drops from tube walls and lid.

6. Add 400µL 99% ethanol. Vortex 8 to 10 seconds to mix. Spin briefly to remove drops from tube

walls and lid.

7. Apply 600µL of your mixture to the column. Cap to avoid aerosols and centrifuge at 8k rpm for 1

minute. Change collection tube.

8. Apply remaining mixture to the column. Cap to avoid aerosols and centrifuge at 8k rpm for 1

minute. Change collection tube.

9. Add 500µL AW1 buffer. Cap and centrifuge at 8k rpm for 1 minute. Change collection tube.

10. Add 500µL AW2 buffer. Cap and centrifuge at maximum rpm for 3 minutes. Change collection

tube.

11. Centrifuge at maximum rpm for 1 minute to remove residual buffer and reduce carryover.

12. Place the QIAprep column in a clean 1.5-mL microcentrifuge tube with the cap cut off. Add

150µL AE buffer to the column. Wait 1 minute and then centrifuge at 8k rpm for 1 minute to

elute.

13. Transfer eluted DNA to a new properly labelled tube and store for future use.


PCR amplification of VNTR of ApoC2 & the RFLP of ApoB Even numbered groups will amplify the RFLP of ApoB

Odd numbered groups will amplify the VNTR of ApoC2

Method:

Prepare your PCR reactions in a total reaction volume of 50L. In labelled PCR tubes (use 200L

thin walled PCR tubes) add the following ingredients in the order listed in the table below. For each

component use a new autoclaved tip. Note: the Taq polymerase will be added by the T.A.

Ingredients Stock

Conc.

Final Conc. Volume


Taq PCR buffer 10X 1X

ApoB For or D1S80 For primer 2µM 0.2µM

ApoB Rev or D1S80 Rev primer 2µM 0.2µM

MgCl2 50mM 2.0mM

dNTP 2mM 200µM

Cheek Genomic DNA 5µL 5µL

Taq polymerase 5 units/µL 0.05 units/µL

Once your reaction setup is completed give them to your teaching assistant.

PCR amplification conditions:

1. 1 cycle of 5min, 94oC to denature;

2. 35 cycles of 30sec 94oC denature, 30sec 55oC (ApoB) or 65 oC (ApoC2) anneal, 1min 72oC

extend.

3. 1 cycle of 5min, 72oC.

4. Cool to 4oC indefinitely.

Analysis of DNA fingerprints

ApoB gene:

1. Obtain your PCR reactions for the ApoB gene.

2. Use 10µL of the PCR reaction to set up a restriction digest with the enzyme EcoRI in a final

volume of 20µL.

3. One group in the class will prepare an undigested control as well.

4. After having performed the digest for one hour, add loading dye and load on the pre-poured gel.

5. Once everyone has loaded the gels, these will be migrated and a picture taken.

ApoC2 gene 1. Obtain your PCR reactions for the ApoC2 gene.

2. Add loading dye to a 10µL sample of the PCR reaction.

3. Load on the pre-poured gel.

4. Once everyone has loaded the gels, these will be migrated and a picture taken for your analysis.


Stringency This parameter describes the extent to which annealing can occur between strands of nucleic acids

under given environmental conditions. High-stringency conditions require a high degree of

complementarity between the molecules, while low-stringency conditions permit annealing even if

there are some mismatched bases. Typically, high-stringency conditions are achieved either by

reducing NaCl concentration or increasing temperature. Lower-stringency conditions are achieved by

increasing NaCl concentration or decreasing temperature. The level of stringency can be varied by

adjusting temperature, salt concentration or other chemical which impact the melting temperature of

nucleic acid hybrids.

This concept can be illustrated by the following formula: Notice that the percentage of G:C base

pairs has a direct impact on the melting point (Tm) of nucleic acid hybrids.

Below the Tm, double stranded nucleic acid hybrids will be favored. Whereas above the Tm, the

single stranded state will be favored. Consequently, any environmental condition (or chemical)

which reduces the Tm will increase stringency.

Tm = 81.5 + 16.6 (log M [Na+]) + 0.41 (%G+C) – 0.72 (% formamide) – 500/n – (% mismatches)

M : Molarity of monovalent positive ions

n : Length in bases of nucleic acid

For example, let’s determine the Tm of a 1 kb nucleic acid molecule which is 50% G : C in the

presence of either 0.1 or 0.2M NaCl .

Tm (0.1M NaCl) = 81.5 + 16.6(log 0.1) + 0.41(50) – 0.72(0) – 0.5 = 84.9oC

Tm (0.2M NaCl) = 81.5 + 16.6(log 0.2) + 0.41(50) – 0.72(0) – 0.5 = 89.9oC

Consequently, at 68oC a double stranded state would be favored at 0.2M NaCl, but the single

stranded state would be favored at 0.1M NaCl. Thus NaCl effectively decreased the stringency by

increasing the Tm and thus the maximum temperature at which the double stranded state can be

maintained.

Stringency - DNA melting curves (Groups of 2) Hyperchromicity or the hyperchromic effect is the property of biological polymers, and in particular

DNA and RNA, to see their UV absorption increase when they undergo denaturation. This property

is commonly used in biology to analyze spectrophotometrically the structure of nucleic acids

according to physico-chemical parameters (temperature, pH, ions…). Hyperchromicity can be used

to track the condition of DNA as temperature changes.


In this exercise we will examine the effect of different environmental conditions on the denaturation

profile of genomic DNA. Specifically, you will determine the Tm based on different physico-

chemical parameters: temperature, formamide concentration, urea concentration, and the

concentration of positive ions.

Materials:

Heat blocks set at 55, 60, 65, 70, 75, 80, 85 and 90oC

Salmon sperm genomic DNA (50µg/mL)

1M NaCl

1M MgCl2

100% Formamide

50% Urea

Method:

1. Each group will be assigned one of the chemicals above. Prepare 9 500μL solutions with a final

concentration of 5µg/mL DNA and a final concentration of the assigned chemical as indicated

below:

0.25M NaCl

0.25M MgCl2

25% Formamide

25% Urea

2. Incubate for 5 minutes each of the eight mixtures at the temperatures indicated above in the

preset heat blocks.

3. Keep the ninth mixture at room temperature.

4. Following the incubation, rapidly chill on ice each of the eight mixtures.

5. Distribute 200µL of each mixture in a 96-well plate as shown below.

6. Once the plate has been loaded, the absorbance at 260nm will be determined.

Layout of the 96 well DNA assay plate

220C 550C 600C 650C 700C 750C 800C 850C 900C Group 1

220C 550C 600C 650C 700C 750C 800C 850C 900C Group 2

220C 550C 600C 650C 700C 750C 800C 850C 900C Group 3

220C 550C 600C 650C 700C 750C 800C 850C 900C Group 4

220C 550C 600C 650C 700C 750C 800C 850C 900C Group 5

220C 550C 600C 650C 700C 750C 800C 850C 900C Group 6

220C 550C 600C 650C 700C 750C 800C 850C 900C Group 7

220C 550C 600C 650C 700C 750C 800C 850C 900C Group 8


EXERCISE 8


Protein expression


Protein quantification – Bradford assay

Protein gel electrophoresis


Protein expression (Groups of 2) Throughout the semester we’ve examined the various techniques used in molecular biology to

analyse DNA and RNA. This week, we will see one of the most common techniques used to study

the proteins expressed within an organism. Specifically we will compare the protein profile within

the muscle tissues from different organisms. Assigned groups will be provided with frozen samples

from ground muscle tissues from different organisms.


1. Suspend the tissue sample in 500µL lysis buffer [62.5 mM Tris-HCl, pH 6.8, 2% SDS].

2. Transfer the suspension to a screw cap tube containing glass beads.

3. Vortex for 1 minute followed by cooling on ice for 1 minute.

4. Repeat the previous step 3 times.

5. Centrifuge for 10 minutes at maximum speed in the microcentrifuge.

6. Transfer the supernatant to a new tube and keep on ice for further use.

Bio-Rad protein assay This method which is based on the method of Bradford, is used for determining concentration of

solubilised protein. It involves the addition of an acidic dye to a protein solution, and subsequent

measurement at 595nm with a spectrophotometer. Comparison to a standard curve provides a relative

measurement of protein concentration.

Materials

Dye reagent

BSA 5mg/mL

Method:

1. Prepare 200µL of each of the protein standard solutions of BSA at concentrations of 0.0, 0.05,

0.1, 0.2, 0.4 and 1.0mg/mL.

2. Prepare 200µL samples of your protein extracts which represent 1/4 and 1/10 dilutions.

3. Pipette 20μL of each standard and each of the protein extracts in appropriately labelled

microcentrifuge tubes.

4. Add 400μL of diluted dye reagent to each tube. Vortex each mix for 2-3 seconds.

5. Incubate at room temperature for at least 15 minutes.

6. Load 200μL of each of the reaction mixtures in the wells of a 96 well plate as illustrated below.

7. Obtain the readings of the absorbance at 595nm.

Bradford assay plate layout

0.0 0.05 0.1 0.2 0.4 1.0 BSA Group 1

0 1/4 1/10 Protein

0.0 0.05 0.1 0.2 0.4 1.0 BSA Group 2

0 1/4 1/10 Protein

0.0 0.05 0.1 0.2 0.4 1.0 BSA Group 3

0 1/4 1/10 Protein

0.0 0.05 0.1 0.2 0.4 1.0 BSA Group 4

0 1/4 1/10 Protein


SDS POLYACRYLAMIDE GEL ELECTROPHORESIS A common method for separating proteins by electrophoresis uses a discontinuous polyacrylamide

gel as a support medium and sodium dodecyl sulfate (SDS) to denature the proteins. SDS is an

anionic detergent, meaning that when dissolved its molecules have a net negative charge. A

polypeptide chain binds amounts of SDS in proportion to its relative molecular mass. The negative

charges on SDS destroy most of the complex structure of proteins, and are strongly attracted toward

the positively-charged electrode in an electric field. Polyacrylamide gels restrain larger molecules

from migrating as fast as smaller molecules. Because the charge-to-mass ratio is nearly the same

among SDS-denatured polypeptides, the final separation of proteins is dependent almost entirely on

the differences in relative molecular mass of polypeptides. In a gel of uniform density the relative

migration distance of a protein is negatively proportional to the log of its mass. Protein separation by

SDS-PAGE can be used to estimate relative molecular mass, the relative abundance of major

proteins in a sample, and to determine the distribution of proteins among fractions.

Materials:

2X Laemmli buffer (4% SDS, 20% glycerol, 125mM Tris pH 6.8, 0.004% bromphenol blue)

Prtotein extracts previously prepared

Protein molecular weight standards

Method:

1. Prepare your protein sample for loading on the SDS PAGE as follows:

Final volume = 10µL

Protein sample: µL (This volume should contain 20g in a maximum volume of 5L)

Loading buffer: 5µL 2X Laemmli loading buffer

Water (up to 5µl): µL

2. Heat for 10 minutes at 70oC, then chill on ice. Centrifuge for 1-2 secondes.

3. Load the whole sample on the prepoured 10% SDS PAGE gel.

4. Carry out the migration at 200V for approximately 30-40 minutes.

5. Once the migration complete, dissassemble and place the resolving gel in the coomasie staining

solution.

6. Microwave for 1 minute, and shake on the rocker for 10-20 minutes.

7. Replace the staining solution with the destain solution.

8. Microwave for 1 minute, then shake on the rocker until the bands become clearly visible.

9. Pour out the destain solution and replace with distilled water.

10. Take a picture.


Staining Solution:

0.5 g Coomassie Brilliant blue R

800 ml methanol

Stir until dissolved. Then add:

140 ml acetic acid

Distilled water to 1L

Destaining Solution

40% methanol

7% acetic acid

The following is a list of the proteins common to all animal muscle, adapted from Alberts et al. 1994.

Protein MW (in kD) Function

Titin 3000 centers myosin in sarcomere

Dystrophin 400 anchoring to plasma membrane

Filamin 270 cross-links actin filaments into gel

Myosin heavy chain 210 slides actin filaments

Spectrin 265 attaches actin filaments to plasma membrane

M1/M2 190 myosin breakdown product

M3 150 myosin breakdown product

C protein 140 myosin breakdown product

Nebulin 107 regulates actin assembly

A-actinin 100 bundles actin filaments

Gelsolin 90 fragments actin filaments

Fimbrin 68 bundles actin filaments

Actin 42 forms filaments

Tropomyosin 35 strengthens actin filaments

Troponin (T) 30 regulates contraction

Myosin light chains 24, 17, 15 slides actin filaments

Troponin (I) 19 regulates contraction

Troponin (C) 17 regulates contraction


Appendices


Amino acid 3 letter code One letter code

alanine ala A

arginine arg R

asparagine asn N

aspartic acid asp D

asparagine or aspartic acid asx B

cysteine cys C

glutamic acid glu E

glutamine gln Q

glutamine or glutamic acid glx Z

glycine gly G

histidine his H

isoleucine ile I

leucine leu L

lysine lys K

methionine met M

phenylalanine phe F

proline pro P

serine ser S

threonine thr T

tryptophan try W

tyrosine tyr Y

valine val V


Spectrophotometric Conversions

1 A 260 unit of double-stranded DNA = 50 µg/ml

1 A 260 unit of single-stranded DNA = 33 µg/ml

1 A 260 unit of single-stranded RNA = 40 µg/ml

Protein/DNA Conversions

1 kb DNA → 333 amino acids

→ 37 kDa protein

Average MW of an amino acid ≈ 110 daltons

Dalton (Da) is an alternate name for the atomic mass unit, and kilodalton (kDa) is 1,000

daltons. Thus a protein with a mass of 64 kDa has a molecular weight of 64,000 grams

per mole

molecular biology-2017 1 - university of...

Documents