Ana M. Fernandez,1,2 Edwin Hernandez-Garzón,1,2 Paloma Perez-Domper,1,2

Alberto Perez-Alvarez,1,3 Sara Mederos,1 Takashi Matsui,4 Andrea Santi,1,2

Angel Trueba-Saiz,1,2 Lucía García-Guerra,2,5 Julia Pose-Utrilla,2,5 Jens Fielitz,6,7

Eric N. Olson,8 Ruben Fernandez de la Rosa,9 Luis Garcia Garcia,9

Miguel Angel Pozo,9 Teresa Iglesias,2,5 Alfonso Araque,1 Hideaki Soya,4

Gertrudis Perea,1 Eduardo D. Martin,10 and Ignacio Torres Aleman1,2

Insulin Regulates Astrocytic GlucoseHandling Through CooperationWith IGF-IDiabetes 2017;66:64–74 | DOI: 10.2337/db16-0861

Brain activity requires a flux of glucose to active regionsto sustain increased metabolic demands. Insulin, themain regulator of glucose handling in the body, has beentraditionally considered not to intervene in this process.However, we now report that insulin modulates brainglucose metabolism by acting on astrocytes in concertwith IGF-I. The cooperation of insulin and IGF-I is neededto recover neuronal activity after hypoglycemia. Anal-ysis of underlying mechanisms show that the combinedaction of IGF-I and insulin synergistically stimulates amitogen-activated protein kinase/protein kinase Dpathway resulting in translocation of GLUT1 to the cellmembrane through multiple protein-protein interac-tions involving the scaffolding protein GAIP-interactingprotein C terminus and the GTPase RAC1. Our obser-vations identify insulin-like peptides as physiologicalmodulators of brain glucose handling, providing furthersupport to consider the brain as a target organ indiabetes.

Contrary to its glucoregulatory actions in peripheral tissues,physiological variations of circulating insulin levels donot modulate glucose handling by brain cells (1). Onlyunder pathological circumstances, such as diabetes, do

brain glucoregulatory actions of insulin manifest (2).Therefore, mechanisms of neurovascular coupling, wherebyactive brain regions locally increase glucose and oxygenuptake, are not considered to involve insulin under phys-iological circumstances. Moreover, both endothelial cellsand astrocytes, the main cellular constituents of the blood-brain barrier (BBB) express GLUT1 as their main facilitativetransporter (3), and GLUT1 is considered to be largely in-sulin insensitive (4). At the same time, there is evidencethat the structurally related peptide IGF-I affects glucosemetabolism in the brain (5). Importantly, in animal modelsof diabetes, not only is there brain insulin resistance (6),but also brain IGF-I levels are reduced (7). We now describea cooperative mechanism whereby insulin stimulates glu-cose uptake by forebrain astrocytes acting in concert withIGF-I. Cooperation of insulin and IGF-I (I+I) may explainbrain glucose uptake on demand without changes in circu-lating insulin levels.

RESEARCH DESIGN AND METHODS

AnimalsAdult (3–5 months old) and newborn C57BL6/J micewere used. To obtain mice with glial fibrillary acidic protein(GFAP)–specific deletion of PKD1, PKD1loxP/loxP mice (8)

1Cajal Institute, Consejo Superior de Investigaciones Científicas, Madrid, Spain2CIBERNED, Madrid, Spain3Center for Molecular Neurobiology Hamburg, Hamburg, Germany4Laboratory of Exercise Biochemistry and Neuroendocrinology, University of Tsu-kuba, Tsukuba, Japan5Instituto de Investigaciones Biomédicas “Alberto Sols,” Consejo Superior deInvestigaciones Científicas-Universidad Autónoma de Madrid, Madrid, Spain6Experimental and Clinical Research Center, Charité-Universitätsmedizin, MaxDelbrück Center for Molecular Medicine, Berlin, Germany7Brandenburg Heart Center and Medical University of Brandenburg, Brandenburg,Germany8University of Texas Southwestern Medical Center, Dallas, TX9Pluridisciplinary Institute, Complutense University of Madrid, Madrid, Spain

10Science and Technology Park, Institute for Research in Neurological Disabilities,University of Castilla-La Mancha, Albacete, Spain

Corresponding author: Ignacio Torres Aleman, torres@cajal.csic.es.

Received 19 July 2016 and accepted 28 September 2016.

This article contains Supplementary Data online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db16-0861/-/DC1.

A.M.F. and E.H.-G. contributed equally to this work.

© 2017 by the American Diabetes Association. Readers may use this article aslong as the work is properly cited, the use is educational and not for profit, and thework is not altered. More information is available at http://www.diabetesjournals.org/content/license.

64 Diabetes Volume 66, January 2017

SIG

NALTRANSDUCTIO

N

were crossed with PKD1loxP/loxP/GFAP-Cre mice. GFAP-Cremice where obtained from The Jackson Laboratory(B6.Cg-Tg(Gfap-cre)73.12Mvs/J: stock #012886). Only malePKD1loxP/loxP (PKD1floxed) and PKD1loxP/loxP/GFAP-Cre(PKD1D) mice were used. Mice were of 129SvEv/C57BL/6mixed background. Genotyping and recombination analy-sis in the PKD1loxP/loxP/GFAP-Cre mouse brain and inprimary cultures of astrocytes was performed by PCRusing specific pairs of primers (8). As a positive controlfor genomic amplification, oIMR7339 primers were used(The Jackson Laboratory protocols). Two-month-old malemice from both genotypes were used for brain cortexdissection and preparation of DNA and protein extracts,as well as for positron emission tomography (PET) anal-ysis. Primary cultures of astrocytes were obtained frombrain cortices of P1-P2 pups bearing the two genotypes.Animal procedures followed European Council Directives(86/609/EEC and 2003/65/EC) and approval of the localbioethics committees.

Plasmid Constructions and Viral PackagingPlasmids transfected into astrocytes were as follows: IGF-IKR, a negative-dominant form of the IGF-I receptor (IGF-IR)previously described (9). HIR-K1030R4 (10), a negative-dominant form of the IGF-IR, was acquired from Addgene(Cambridge, MA), and GLUT1-Exo Flag was a gift fromJeffrey C. Rathmell (11). Short hairpin RNAs (shRNAs)against GLUT1 were from Origene (Rockville, MD); theshRNA against GAIP-interacting protein C terminus(GIPC) was constructed (as described at www.addgene.org/tools/protocols/plko/) using the following primers:59CCGGACTCACCG AACCTCGGAAGGCCTCGAGGCCTTCCGAGGTTCGGTGAGTTTTTTG39 and 59AATTCAAAAAACTCACCGAACCTCGGAAGGCCTCGAGGCCTTCCGAGGTTCGGTGAGT39 directed against the 684–704 fragment of GIPC mRNA.

Cell Cultures and TransfectionsAstroglial cultures with .95% GFAP-positive cells wereprepared as described previously (9). Postnatal (day 3–4)brains were dissected, and the cortex and hippocampuswere removed and mechanically dissociated. The resultingcell suspension was centrifuged and plated in DMEM/F-12(Life Technologies) with 10% FBS (Life Technologies) and a100 mg/mL antibiotic-antimycotic solution (Sigma-Aldrich,Madrid, Spain). After 15–20 days, astrocytes were replatedat 1.23 105 cells/well. Pure cerebellar granule neurons frompostnatal mouse cerebellum (.99% b3-tubulin–positivecells) were obtained as described previously (12). Briefly,P7 brains were dissected, and cerebella were removed, dis-sociated mechanically, and then enzymatically digested withpapain solution (Worthington Biochemical Corporation,Lakewood, NJ). Finally, neurons were plated in wellscovered with poly-L-lysine in medium with Neurobasalplus B27 medium (Life Technologies), glutamine, and25 mmol/L KCl. Endothelial cell cultures were performedas described previously (13). Briefly, dissection was per-formed on ice, and cortices were cut into small pieces(1 mm3) and digested in a mixture of collagenase/dispase

(270 units collagenase/mL and 0.1% dispase) and DNAse(10 units/mL) in DMEM (Life Technologies) for 1.5 h at37°C. The cell pellet was separated by centrifugation in20% BSA/DMEM (1,000g for 15 min) and incubated in acollagenase/dispase mixture for 1 h at 37°C. Capillary frag-ments were retained on a 10-mm nylon filter, removedfrom the filter with endothelial cell basal medium (LifeTechnologies), supplemented with 20% bovine plasma–derived serum and antibiotics (penicillin 100 units/mL,streptomycin 100 mg/mL), and seeded on 60-mm Petridishes coated with collagen type IV (5 mg/cm2). Puro-mycin 3 mg/mL was added for 3 days. Puromycin wasthen removed from the culture medium and replaced byfibroblast growth factor (2 ng/mL) and hydrocortisone(500 ng/mL).

For transfection, astrocytes were electroporated (2 3106 astrocytes with 2 mg of plasmid DNA) before seedingusing an astrocyte Nucleofector Kit (Amaxa; Lonza, Basel,Switzerland). After electroporation, cells were plated toobtain a final cell density on the day of the experimentsimilar to that obtained with the transfection method. Thetransfection efficiency was 60–80%, as assessed with a GFPvector expression.

Glucose UptakeWe used 6-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-6-deoxyglucose (6-NBDG) to measure glucose uptake inastrocytes, as has been shown by others (14). Briefly, cellswere starved in serum-free media for 3 h. Then IGF-I(ProSpec-Tany Technogene, Ness Giona, Israel), insulin(Sigma-Aldrich), or vehicle was added to a final concen-tration of 1 nmol/L. We then added 6-NBDG (SetarehBiotech, Eugene, OR) to a final concentration of 30 mmol/L.Cultures were kept for 3 h at 37°C; then ice-cold PBS wasadded; cells were trypsinized and collected; and FBS andPBS were added. Fluorescence intensity was measured byflow cytometry (FACSAria Cytometer; BD Biosciences).When pharmacological inhibitors were used, picropodo-phyllin (120 nmol/L), an IGF-IR–specific inhibitor (picropo-dophyllotoxin [PPP]; Merck Sharp & Dohme, Hoddesdon,U.K.), and S961 (10 nmol/L), a recently described (15)insulin receptor (IR)–specific inhibitor (Novo Nordisk,Bagsværd, Denmark), were added 1 h prior to the additionof insulin and/or IGF-I.

Glucose levels in astrocytes were determined by theglucose oxidase test (Thermo Scientific) following manu-facturer instructions. In brief, astrocyte cultures were washedthree times with PBS and starved over 3 h in low-glucosemedium without serum; cells were treated with or withoutIGF-I and insulin over 3 h. After treatments, cells were kepton ice, washed three times with Tris-buffered saline, andlysed with 100 mL of lysis buffer (150 mmol/L NaCl,20 mmol/L Tris HCl, pH 7.4, 5 mmol/L EDTA, 10%glycerol, and 1% Nonidet P-40). Samples were kept inthe freezer at least overnight and centrifuged at 5 min at4°C and 10,000 rotations/min. Supernatants were col-lected, and 50 mL was used, as indicated.

diabetes.diabetesjournals.org Fernandez and Associates 65

Membrane Translocation AssaysTranslocation of GLUT1-Flag to the cell membrane wasdetermined by flow cytometry following previously pub-lished procedures (16). In brief, cultured astrocytes werelabeled with anti-Flag M2 (1:1,000; F1804; Sigma-Aldrich)and secondary antibody Alexa Fluor 488 (1:1,000; A-11008;Life Technologies) and were fixed before assessing fluo-rescence intensity. In a second type of assay, cell surfaceproteins were biotinylated following manufacturer in-structions (EZ-LinkSulfo-NHS-SS-Biotin; Thermo Scien-tific). Briefly, astrocytes were washed three times withice-cold PBS (pH 8.0) and suspended at a concentrationof 25 3 106 cells/mL in PBS. Immediately before use, a10 mmol/L solution of Sulfo-NHS-SS-Biotin was preparedby adding 6 mg/mL ultrapure water, and ;80 mL of10 mmol/L Sulfo-NHS-SS-Biotin per mL reaction volumewas added and incubated at room temperature for 30 min.Cells were washed three times with ice-cold PBS. Proteinswere purified by affinity chromatography using NeutroAvidinAgarose Resin (Thermo Scientific). Biotinylated proteinswere resolved by Western blot. The membrane proteinNa+/K+ ATPase was used as a loading control.

In Situ Proximity Ligation AssaysGLUT1-IGF-IR interactions were detected in astrocytesgrown on glass coverslips using the Duolink II in situproximity ligation assay (PLA) detection kit (OLink AB,Uppsala, Sweden), as described previously (17). Astrocyteswere fixed in 4% paraformaldehyde for 10 min, washedwith PBS containing 20 mmol/L glycine to quench thealdehyde groups, permeabilized with the same buffer con-taining 0.05% Triton X-100 for 5 min, and successivelywashed with PBS. After immersion for 1 h at 37°C withthe blocking solution in a preheated humidity chamber,astrocytes were incubated overnight in antibody diluentmedium with the primary antibodies rabbit polyclonalanti-GLUT1 (1:100; catalog #sc-7903; Santa Cruz Biotech-nology) and monoclonal mouse anti–IGF-IR (1:100; catalog#sc-463; Santa Cruz Biotechnology), which were pro-cessed following the instructions of the supplier usingthe PLA probes detecting rabbit or mouse antibodies

(Duolink II PLA probe anti-Rabbit plus, and Duolink IIPLA probe anti-Mouse minus diluted in antibody diluentto a concentration of 1:5) and a DAPI-containing mount-ing medium. Samples were observed using an SP2 Confo-cal Microscope (Leica Microsystems, Wetzlar, Germany)equipped with an apochromatic 363 oil-immersion objec-tive. For images of each field, a maximum projection (super-imposed sections) in two channels (one per staining) of6–12 z stacks with a step size of 1 mm were acquired.

Glycogen and Lactate Production AssayThe production of glycogen and lactate in astrocytes wasassessed using commercial kits (MAK016 Glycogen AssayKit; Sigma-Aldrich; MAK064 Lactate Assay Kit; Sigma-Aldrich) following the manufacturer instructions. Briefly,cells treated as described above were kept for 6 h at 37°C.Then, cells were washed with ice-cooled PBS and homog-enized in ice water. Samples were measured on a fluores-cence microplate reader (Fluostar Optima; BMG LABTECH,Ortenberg, Germany).

Quantitative PCRQuantitative real-time PCR analysis was carried out asdescribed previously (18). Results were expressed as rela-tive expression ratios on the basis of group means fortarget transcripts versus reference 18S transcript. At leastthree independent experiments were performed.

ImmunoassaysImmunocytochemical assays and Western blotting wereperformed as described previously (19). Antibodies and di-lutions used are shown in Table 1. Densitometric analysiswas performed using Analysis Image Program (Bio-Rad,Hercules, CA). A representative blot is shown from a totalof at least three independent experiments.

Immunopositive Particle Colocalization AssaysImmunocytochemistry was performed as explained above.Pictures of stained cultures were taken using a Leica TCS-SP5 Confocal Microscope equipped with a363 oil-immersionobjective (HCX PL APO CS,363/1.40–0.60). For each field, aseries of 8–12 z stacks with a step size of 0.29 mm in eachchannel (one per staining) was acquired. The quantification of

Table 1—Antibodies used in immunoassays

Antibody Reference WB dilution IC dilution Company

IGF-IRa sc-463 1:500 1:100 Santa Cruz Biotechnology

IGF-IRb sc-713 AC 1:200 Santa Cruz Biotechnology

IRb sc-711 1:1,000 Santa Cruz Biotechnology

IGF-IRb 9750 1:2,000 Cell Signaling Technology

GLUT1 sc-7903 1:1,000 1:100 Santa Cruz Biotechnology

GIPC sc-9648 1:1,000 1:200 Santa Cruz Biotechnology

b-Actin A5316 1:10,000 Sigma-Aldrich

PKD1/2 2035 1:1,000 Cell Signaling Technology

a-Tubulin T9026 1:1,000 Sigma-Aldrich

IC, immunocytochemistry; WB, Western blot.

66 Insulin Peptides Regulate Brain Glucose Diabetes Volume 66, January 2017

vesicles in each field was made enhancing the contrast andfinally applying a threshold to obtain the binary image andthe region of interest around each particle. The numberof colocalization particles among the different channelswas also determined. The number of particles was deter-mined taking 20–34 cells in five different fields using theFiji software package (20).

In Vivo Experiments

Astrocyte Glucose UptakeGlucose uptake by astrocytes was evaluated as previouslydescribed (21) following procedures that have alreadybeen reported (22). The administration of 6-NBDG, theexperimental stimulation paradigm, confocal microscopy,and data analysis are described in greater detail elsewhere(23).

18F-Fluorodeoxyglucose PET Imaging18F-fluorodeoxyglucose (FDG) PET was used to measurebrain glucose handling as described (23). Once the 18F-FDG uptake in the different brain regions was calculated(in kilobecquerels per cubic centimeter), the activity of eachleft hemisphere region was normalized to its homologousregion in the right hemisphere and expressed as propor-tional uptake (left/right).

Slice RecordingsCortical slices were obtained from C57BL/6 mice (12–16 weeks old). Animals were anesthetized and decapitated.The brain was rapidly removed and placed in ice-cold arti-ficial cerebrospinal fluid (ACSF). Slices (400 mm) were in-cubated for .1 h at room temperature (22–24°C) in ACSFcontaining the following (in mmol/L): NaCl 124, KCl 2.69,KH2PO4 1.25, MgSO4 2, NaHCO3 26, CaCl2 2, and glucose10, and gassed with 95% O2/5% CO2 (osmolarity 290–300 mOsm/L, pH 7.35). Slices were then transferred toan immersion recording chamber and perfused with gassedACSF at a rate of 1–2 mL/min and at 30–34°C. The record-ing area was visualized using an Olympus (Tokyo, Japan)BX50WI Microscope. For electrophysiology, bipolar platinum/iridium electrodes of 50 mm placed on layer 4 of somato-sensory cortex. To record excitatory synaptic activity glassmicroelectrodes of 3–5 mol/LV filled with NaCl 1 mmol/Lwere used and placed in layer 2, and slices were perfusedwith ACSF containing 50 mmol/L picrotoxin and 5 mmol/LCGP55845 to block GABAA and GABAB receptors, respec-tively, unless otherwise noted. In the ACSF external solu-tion with no added glucose, the concentration of NaCl wasadjusted so that the osmolarity becomes 290–300 mOsm/L.A stimulus intensity that evoked half-maximum amplitudefield excitatory postsynaptic potentials (fEPSPs) was used.Baseline responses were recorded for at least 10 min withtest stimuli given at a rate of 0.1 Hz. The slopes of thebaseline responses were set to 100%, and the slopes duringthe experiments are expressed as percentages of the base-line slope. IGF-IRs and IRs were selectively blocked by PPP(10 mmol/L) and S961 (10 nmol/L), respectively, addedto the ACSF. Data are presented as mean 6 SEM. The

Wilcoxon matched pair test was used to detect any signif-icant changes in synaptic activity by comparing the slopesof the baseline responses with those after the perfusionmedium was changed.

Statistical AnalysisNormal distribution tests were performed in all initialsets of experiments, and a nonparametric Wilcoxon testwas applied accordingly. For samples with normal distri-bution, parametric tests include one-way ANOVA fol-lowed by a Tukey honestly significant difference test or ttest. A P value ,0.05 was considered to be significant.

RESULTS

I+I Cooperate in Glucose Uptake by AstrocytesAs described over a century ago (24), neuronal activityincreases local blood flow through neurovascular couplingat the BBB, and blood nutrients are taken up by the activebrain region. Because endothelial cells and astrocytes arethe key cell constituents of the BBB involved in bloodglucose uptake, we analyzed the effect of I+I on glucosecapture by these two types of cells using the fluorescentglucose analog 6-NBDG (25). Whereas neither insulin norIGF-I modulated glucose uptake in these cells, the com-bined addition of I+I stimulated it in astrocytes but notin endothelial cells (Fig. 1A and Supplementary Fig. 1A).Glucose uptake by neurons, the major energy consumersof the brain, was not affected by insulin peptides either(Supplementary Fig. 1B). Increased glucose uptake by as-trocytes after I+I was reflected by increased glucose con-tent in these cells (Fig. 1B).

Because glucose uptake by astrocytes is stimulatedwhen both I+I are added simultaneously, an interaction ofboth hormones through their respective receptors wasdeemed probable. We confirmed by quantitative PCR(data not shown) that insulin and IGF-IRs are expressedby astrocytes (26,27) and inhibited them with drug an-tagonists. We found that either S961, an inhibitor of IR,or PPP, an inhibitor of IGF-IR, blocked the effects of I+I(Fig. 1C and D). In addition, the expression of dominant-negative forms of either IGF-IR or IR abolished the stim-ulatory actions of I+I (Fig. 1E and F). Reduced IR activityhad a pronounced effect on astrocytic basal glucose up-take (Fig. 1E). Therefore, both receptors are required tostimulate astrocyte glucose uptake because inhibiting ei-ther one is sufficient to block the effect of I+I.

Because blood-borne glucose is captured by the brainthrough GLUT1, the most abundant type of facilitativetransporter in brain endothelia and astrocytes (28), wedetermined whether this transporter is involved in glu-cose uptake after I+I. Indeed, the amount of GLUT1translocated to the astrocyte cell membrane was signifi-cantly increased in the presence of I+I, as determined byflow cytometry of tagged GLUT1 (Fig. 2A and Supplemen-tary Fig. 1C), or by biotinylation of membrane proteins(Fig. 2B), whereas GLUT1 immunostaining in astrocyteswas redistributed to the cell membrane only in the presence

diabetes.diabetesjournals.org Fernandez and Associates 67

of I+I (Supplementary Fig. 1D), suggesting its mobilizationfrom internal stores. Furthermore, when GLUT1 levelsin astrocytes were reduced with shRNA (Supplementary

Fig. 2A), basal glucose uptake was drastically reduced andthe stimulatory action of I+I no longer seen (Fig. 2C). Be-cause glucose uptake in astrocytes is associated with glu-coneogenesis (29), we determined glycogen levels inastrocytes exposed to I+I and found them significantlyelevated (Fig. 2D), whereas the production of lactate, amajor glucose metabolite in astrocytes, was unaffected(Supplementary Fig. 2B). As previously reported, insulinalso increased glycogen levels without affecting lactateproduction (30).

I+I Modulate Neuronal Activity: Role of GlucoseHandling by AstrocytesAlthough it is widely assumed that pancreatic insulin under-lies the brain actions of this hormone (31), it is now firmlyestablished that the brain also produces insulin (32). Thesame is true for IGF-I, a hormone that reaches the brainfrom the circulation (33) but is also locally produced (34).To determine whether locally produced I+I participate inbrain glucose metabolism, we analyzed the effect of theblockade of IRs/IGF-IRs in neuronal activity using brainslices under changing energy demands. Importantly, bothinsulin and IGF-I mRNA are detected in brain slices usedfor these experiments (Supplementary Fig. 2C). We tookadvantage of the fact that during high energy needs neu-rons rely on astrocytes for energy supply (35) and thatneuronal activity triggers both insulin release (36) andIGF-I release (37). We submitted cortical slices to hypogly-cemia in the presence of drugs blocking IRs/IGF-IRs. Asexpected, fEPSPs decayed after glucose withdrawal (Fig.3A) and glucose readdition to the medium triggered therecovery of fEPSPs. However, in the presence of either PPPor S961, recovery was significantly reduced (Fig. 3A).

Figure 2—GLUT1 is involved in glucose uptake in response to I+I.A: GLUT1 in the astrocyte cell membrane is significantly increasedby the combined addition of I+I but not by either of them alone (INS,insulin). Levels of GFP-tagged GLUT1 in the cell membrane weredetermined by flow cytometry (n = 6; ***P < 0.001 vs. control).B: Biotinylation of membrane proteins followed by Western blotconfirms increased levels of GLUT1 in the cell membrane of astro-cytes stimulated with I+I. The cell membrane marker Na+/K+ ATPaseis shown in the bottom blot. C: Reduction of GLUT1 by shRNA in-terference drastically reduces 6-NBDG accumulation by astrocytesand abrogates the stimulatory effects of I+I (n = 4; *P < 0.05 and***P < 0.001 vs. basal control levels). D: Levels of glycogen in astro-cytes are stimulated by IGF-I and I+I (n = 6; *P < 0.005 vs. basalcontrol). Data are presented as the mean 6 SEM.

Figure 1—I+I cooperate to increase glucose uptake in astrocytes. A: Astrocytes exposed to insulin (INS) plus IGF-I (I+I) showed increasedaccumulation of the fluorescent glucose analog 6-NBDG (n = 10; **P< 0.01 vs. basal control [Cont] levels). B: Intracellular levels of glucoseare significantly increased by I+I (n = 5; *P < 0.05). Stimulated uptake of 6-NBDG after I+I uptake is abrogated by a specific IR antagonist(S961) (C) or IGF-IR antagonist (D) (PPP; n = 6; *P < 0.05 vs. basal control, **P < 0.01 vs. I+I alone, and #P < 0.05 vs. I+I alone). Increasedglucose uptake after I+I is blocked in astrocytes expressing either (E ) a dominant negative IR (DN-IR) (n = 6; *P < 0.05 and ***P < 0.001 vs.control) or (F ) IGF-IR (n = 6; *P < 0.05 vs. control).

68 Insulin Peptides Regulate Brain Glucose Diabetes Volume 66, January 2017

We next determined whether astrocytes are involvedin the actions of I+I on neuronal activity. For these ex-periments, we took advantage of two previous obser-vations: 1) upon sensory stimulation, glucose uptake insomatosensory cortex is predominantly mediated byastrocytes (21); and 2) direct application of the IGF-IRblocker PPP to the somatosensory cortex attenuatesneuronal firing elicited by sensory stimulation (19). Inthis regard, it is important to note that stimulation ofthe whiskers activates both IGF-IR and IRs in somato-sensory cortex (Supplementary Fig. 3A). Using in vivofluorescence microscopy of the mouse somatosensorycortex and whisker stimulation (21), we observed reducedglucose uptake (detected with the green fluorescent marker6-NBDG) in astrocytes (identified with the astrocyte-specific fluorescent red marker SR101) of mice receiving

a local infusion of PPP compared with saline-infused mice(Fig. 3).

Mechanisms of Cooperation Between Insulin and IGF-IIntracellular signaling pathways downstream of coopera-tive actions of I+I were then examined. We measuredphosphorylation of AKT and mitogen-activated proteinkinase (MAPK) because these two kinases form part of thecanonical signaling of both IRs and IGF-IRs. As shown inFig. 4A, phospho-MAPK, but not phospho-AKT (Supple-mentary Fig. 3B) was synergistically elevated by I+I inastrocytes. As potential downstream mechanisms, we fo-cused on protein kinase D (PKD [also known as PKCm]), adiacylglycerol-binding kinase that may act downstream ofMAPKs (38). PKD regulates the translocation of GLUTs(39) and is specifically associated with IGF-IR, but not

Figure 3—In vivo glucose uptake by brain cells is blocked by I+I receptor antagonists. A: Insulin and IGF-IR activation is involved in therecovery of hypoglycemia-induced depression of synaptic transmission. Top: Representative fEPSP traces in response to glucose depri-vation in control conditions (black; scale bar, 0.1 mV, 60 ms), in the presence of the IR inhibitor S961 (blue; scale bar, 0.1 mV, 30 ms), or in thepresence of the IGF-IR inhibitor PPP (red; scale bar, 0.1 mV, 50 ms). Letters a–d denote synaptic responses before glucose deprivation(baseline; a), during hypoglycemia onset (b), during the hypoglycemia plateau (c), and recovery after adding glucose-ACSF (d) in control(black bar), S961, or PPP conditions (blue and red bars, respectively). Middle: Time course of fEPSP slope changes during hypoglycemia(gray bar) in control (white; n = 10 slices), PPP (10 mmol/L; red; n = 10), or S961 (10 nmol/L; blue; n = 12) conditions. Bottom: Relative changesof the area for the fEPSP slope recovery after the addition of glucose-ACSF under control (black), PPP (red), or S961 (blue). Data arepresented as the mean6 SEM. *P< 0.05 vs. control. B: Representative 6-NBDG fluorescence traces of astrocytes of somatosensory cortexunder basal conditions or after bathing the cortical surface with the IGF-IR blocker PPP. Photomicrographs: representative measurements ofSR101-labeled somatosensory cortex astrocytes accumulating 6-NBDG (middle image) after stimulation (Stim). Merged confocal micro-graphs are shown in the bottom panel. Astrocytes were stained with the specific astrocyte dye SR101 administered by intraperitonealinjection, whereas glucose uptake was determined using the green fluorescent analog 6-NBDG delivered by intrafemoral vein injection. Scalebar, 50 mm. C: Cortical administration of PPP (n = 188) did not modify the number of astrocytes responding to sensory stimulation (lefthistograms), while the uptake of glucose was markedly diminished (right histograms; ***P < 0.0001 vs. control, n = 108).

diabetes.diabetesjournals.org Fernandez and Associates 69

with IR (40) (see below). PKD was synergistically stimu-lated by I+I, as documented by increased levels of phos-pho-Ser-PKD (Fig. 4B), and in a MAPK-dependent manner(Fig. 4C). Further, the PKD inhibitor CID755673 (CID)abrogated increased glucose uptake by astrocytes in re-sponse to I+I (Fig. 4D). To determine the in vivo signifi-cance of these findings, we analyzed brain glucose uptakein mice lacking PKD in GFAP astrocytes (SupplementaryFig. 4A–D). Glucose uptake in response to whisker stim-ulation in somatosensory cortex was significantly moreincreased in PKD1floxed littermates than in PKD1D ani-mals (Fig. 4E). Collectively, these data support a cooper-ative action of I+I in glucose handling by astrocytes throughthe synergistic activation of MAPK42–44 and PKD.

Since GLUT1 is involved in glucose uptake promotedby I+I, we examined the mechanisms linking MAPK/PKDactivation with its translocation to the cell membrane.GIPC (41,42) is a scaffolding protein that participates inthe trafficking of GLUT1 (42). We observed that GIPCinteracts with GLUT1 in response to I+I (Fig. 5A). Fur-thermore, GIPC also interacts with IGF-IR, but not withIR, after I+I (Fig. 5A). Because GIPC modulates the activity

of the small GTPase RAC1 (43), which is involved in thetranslocation of GLUTs from intracellular compartmentsto the cell membrane (44), we also analyzed its possibleinvolvement in the action of I+I. We found that I+I pro-moted the interaction of RAC1 with GIPC, GLUT, IR, andIGF-IR (Fig. 5A). Reversed coimmunoprecipitation usinganti-RAC1 or anti–IGF-IR antibodies confirmed these inter-actions (Fig. 5B and C). Further, the activity of RAC1 wasincreased after I+I administration, although IGF-I also in-creased it when given alone (Fig. 5D). To link the observedprotein-protein interactions promoted by I+I with activa-tion of PKD by I+I, we analyzed whether the inhibitionof PKD with CID altered these interactions. Indeed, CIDmarkedly decreased the association of RAC1 with GLUT1after I+I administration (Fig. 5E), or the interaction ofGLUT1 with IGF-IR, as measured by PLAs (Fig. 5F).

Using the immunocytochemistry of GIPC, IGF-IR, andGLUT1 in astrocytes, we confirmed that I+I increases inter-actions among these proteins. The addition of insulingreatly decreased all types of immunostained puncta,and IGF-I slightly modified some of them; whereas I+Isynergistically increased the interactions of IGF-IR/ GLUT1,

Figure 4—Cooperativity of I+I involves a MAPK/PKD pathway. A: Levels of phosphorylated MAPK42–44 (pMAPK) were synergisticallyelevated by coaddition of I+I to astrocytes. Levels of pMAPK were normalized by total levels of MAPK42–44. Representative blot after15 min of stimulation with insulin (INS), IGF-I, or both is shown. Bars show quantification of the ratio pMAPK/MAPK after 5, 10, and 15 minof stimulation (*P < 0.05 vs. insulin or IGF-I alone, n = 3). B: PKD phosphorylation is synergistically increased by I+I. Representative blotafter 15 min of stimulation with insulin, IGF-I, or both is shown. Bars show quantification of the ratio pPKD/PKD (*P < 0.05 vs. basal; n = 5).C: Increased PKD phosphorylation after I+I depends on MAPK, because in the presence of the MAPK inhibitor U0126 the increase wasabolished. Representative blot after 15 min of stimulation with I+I, U0126, or I+I+U0126 is shown. Bars show quantification of thepPKD/PKD ratio (*P < 0.05 vs. basal; n = 3). D: Stimulated uptake of 6-NBDG after I+I is abrogated by the PKD inhibitor CID (10 mmol/L)(*P < 0.05 vs. basal control; n = 6). E: Mice where PKD1 has been deleted in astrocytes (PKD1D) show reduced glucose uptake insomatosensory cortex in response to whisker stimulation than their PKD1floxed littermates. Animals were submitted to PET scans, and,after basal measurements of 18F-FDG uptake, they received sensory stimulation (n = 5; *P < 0.05 vs. littermates).

70 Insulin Peptides Regulate Brain Glucose Diabetes Volume 66, January 2017

IGF-IR/GIPC, and GLUT1/GIPC (Fig. 6A and B; P , 0.05vs. basal conditions). To link the pattern of puncta mobi-lization after I+I and glucose uptake, we inhibited thelatter by blocking PKD with CID (Fig. 4D). CID drasticallyaltered the pattern of puncta mobilization elicited by I+I(Fig. 6B), further supporting a role for this pattern ofprotein-protein interactions in glucose uptake. To firmlyestablish a role of GIPC in the interaction between IGF-IRand GLUT1, we reduced GIPC levels in astrocytes usingGIPC shRNA (Supplementary Fig. 4E). GIPC is required tosort GLUT1 to the plasma membrane (45). Accordingly,GIPC reduction decreased the amount of GLUT1 in the cellmembrane (Fig. 6C), and as a result, basal glucose uptakewas reduced and stimulation by I+I impaired (Fig. 6D).

DISCUSSION

These results present evidence of a cooperative mecha-nism between insulin and IGF-I for glucose uptake byastrocytes of consequence on brain glucose handling. Theprocess invokes an interaction of I+I in active brainregions to synergistically stimulate MAPK/PKD, which inturn promotes the translocation of GLUT1 to the cellmembrane. The latter involves the interaction of GLUT1with the scaffolding protein GIPC, which also interacts

with the IGF-IR, and the GTPase RAC1 that is activatedand interacts with both the IGF-IR and IR (SupplementaryFig. 4F). The presence of additional protein-protein inter-actions is likely and will require further study.

The role of insulin in the regulation of glucose han-dling by the brain remains elusive (46), because underphysiological circumstances it does not seem to modulateit (1); whereas, in pathologies such as diabetes, brain glu-cose metabolism is modulated by insulin (2), and, in nor-mal brains, hippocampal GLUT4 is translocated to the cellmembrane in response to this hormone (47). It is possiblethat our understanding of the role of this hormone inbrain glucose metabolism has been hindered by the factthat a concerted action with IGF-I seems to be required.Because astrocytes may be involved in energy allocation toneurons through the so-called “lactate shuttle” (48), ourexperiments in brain slices suggest that local I+I regulateneuronal function under changing energy demands, prob-ably by modulating astrocyte support. Favoring the latteris the observation that the blockade of IGF-IRs in somato-sensory cortex inhibits both neuronal activity in responseto sensory stimulation (19) and glucose uptake by astro-cytes (Fig. 3B and C). The experiments using brain slicesalso favor the notion that local I+I is sufficient to modulate

Figure 5—Role of protein interactions with GIPC in cooperativity of I+I. A: Addition of I+I increases the interaction of GLUT1, IGF-IR, andRAC1 with GIPC. GIPC was not associated with IRs after I+I. B: Immunoprecipitation (IP) with anti–IGF-IR show the same interactions. C: IPwith anti-RAC1 show that this GTPase interacts not only with GLUT1, IGF-IR, and GIPC, but also with IR. D: Addition of I+I stimulatesRAC1 activity, although IGF-I alone also stimulated it. The right part of the blot shows a control experiment in the presence of guanosine59-diphosphate (GDP; negative control) and guanosine 59-triphosphate (GTP; positive control). E: The PKD inhibitor CID reduces theassociation of GLUT1 with RAC1 induced by I+I. Representative blots are shown (n = 3). F: PLAs in astrocyte cultures show aninteraction of IGF-IR with GLUT1 (white dots) that is absent when antibodies are omitted (control). DAPI staining of astrocyte nucleiare shown in blue. Histograms: Quantification of PLA shows a significant increase in the association of GLUT1 with IGF-IR in responseto I+I that is abrogated by PKD inhibition with CID (n = 4; **P < 0.01). INS, insulin.

diabetes.diabetesjournals.org Fernandez and Associates 71

glucose handling. The fact that brain insulin may modu-late glucose handling by this organ, in concert with brainIGF-I, may explain the difficulty in determining a role forcirculating insulin in brain glucose handling. Because dia-betes impacts the brain at biochemical, structural, andbehavioral levels (6), it is possible that the action of braininsulin may be also altered, unveiling a role for circulatinginsulin in the diabetic state (2). Furthermore, a role forcirculating I+I cannot be entirely ruled out yet, because, atleast for the latter, neuronal activity triggers its entranceinto the brain (19). Thus, while we still do not knowwhether circulating insulin enters the brain in responseto neuronal activation, it is possible that both insulin andIGF-I increase locally on demand and may in this waycontribute to glucose uptake by astrocytes located in thevicinity of active neurons.

The fact that insulin acts in concert with IGF-I to mod-ulate GLUT1 may also imply a role of the latter in theinteraction with other energy substrates, such as ketone

bodies and amino acids. Hence, not only insulin deficiencybut also IGF-I deficits may potentially impact these path-ways in the face of increasing energy demands, such as duringhypoglycemia. These intriguing possibilities also requirefurther analysis.

Collectively, these results indicate that an interactivenetwork of I+I plays an essential role in glucose handlingby astrocytes impacting in brain glucose metabolism. Theseobservations may open a new path for future therapeuticapproaches for brain complications in diabetes (49) and fordiabetes-like pathology in neurodegenerative diseases suchas Alzheimer dementia (50).

Acknowledgments. The authors thank M. Garcia (Cajal Institute) andL. Guinea (Cajal Institute) for technical support. The authors also thankNovo Nordisk (Denmark) for providing S961 insulin receptor inhibitor.Funding. This work was funded by MINECO (Spain) grants SAF2010-60051and SAF2013-40710-R, and by CIBERNED. E.H.-G. was partially funded by a fellow-ship from ColFuturo and CIBERNED. T.I. is funded by MINECO (SAF2014-52737-P).

Figure 6—Mechanisms of cooperativity of I+I to stimulate glucose uptake. A: Representative confocal microscopy images showing staining forIGF-IR, GIPC, and GLUT1 in cultured astrocytes. Single-, double-, and triple-stained particles were scored. Representative images of double- andtriple-particle staining are codified with different colors and are shownwith34magnification to better illustrate them. Scale bar, 10mm.B: Coadditionof I+I significantly stimulated the relative amount of IGF-IR/GIPC-, IGF-IR/GLUT1-, GIPC/GLUT1-, and IGF-IR/GLUT1/GIPC-immunopositive particlescompared with insulin (INS) or IGF-I given alone. However, when PKDwas inhibited with CID, the pattern of immunopositive particles after I+I wasdrastically changed. The different types of particles were scored using ImageJ analysis software. n = 22 cells for control, n = 28 for insulin, n =33 for IGF-I, n = 20 for I+I, and n = 46 for I+I+CID (*P< 0.05 vs. insulin, IGF-I, and I+I+CID and #P< 0.05 vs. basal). C: Reduction of GIPC resultsin reduced levels of GLUT1 in the membrane and abrogation of the stimulatory effects of I+I (n = 6; *P< 0.05 and ***P < 0.001 vs. basal controllevels). D: Reduced GIPC also impedes stimulation by I+I of 6-NBDG uptake by astrocytes (n = 6; *P < 0.05 and **P < 0.01 vs. control levels).

72 Insulin Peptides Regulate Brain Glucose Diabetes Volume 66, January 2017

T.I. and I.T.A. are funded by CIBERNED and Comunidad de Madrid, Spain(P2010/BMD-2331-Neurodegmodels).Duality of Interest. No potential conflicts of interest relevant to this articlewere reported.Authors Contributions. A.M.F. designed and performed in vivoexperiments and analyzed the results. E.H.-G. designed and performed in vivoand in vitro experiments and analyzed the results. P.P.-P. designed andperformed in vitro experiments and analyzed the results. A.P.-A. performedconfocal microscopy experiments and analyzed the results. S.M. performedslice experiments. T.M. performed brain glycogen experiments and analyzed theresults. A.S., A.T.-S., and L.G.-G. performed in vitro experiments in astrocytes.J.P.-U. characterized in vitro PKD1 astrocytes. J.F. and E.N.O. designed andobtained PKD floxed mice. R.F.d.l.R. performed PET experiments. L.G.G. charac-terized PKD1 mice brain tissue and performed PET experiments. M.A.P. analyzedPET results. T.I. designed and obtained PKD-KO mice. A.A. designed confocalmicroscopy experiments. H.S. designed brain glycogen experiments and ana-lyzed the results. G.P. performed and analyzed the slice experiments. E.D.M.designed and performed confocal experiments. I.T.A. designed the study andwrote the manuscript. I.T.A. is the guarantor of this work and, as such, had fullaccess to all the data in the study and takes responsibility for the integrity of thedata and the accuracy of the data analysis.Prior Presentation. A preliminary version of this work was published inBioRxiv (available at http://biorxiv.org/content/early/2015/07/31/023556).

References1. Hasselbalch SG, Knudsen GM, Videbaek C, et al. No effect of insulin onglucose blood-brain barrier transport and cerebral metabolism in humans. Di-abetes 1999;48:1915–19212. Hirvonen J, Virtanen KA, Nummenmaa L, et al. Effects of insulin on brainglucose metabolism in impaired glucose tolerance. Diabetes 2011;60:443–4473. Simpson IA, Vannucci SJ, Maher F. Glucose transporters in mammalianbrain. Biochem Soc Trans 1994;22:671–6754. Peters A, Schweiger U, Frühwald-Schultes B, Born J, Fehm HL. The neu-roendocrine control of glucose allocation. Exp Clin Endocrinol Diabetes 2002;110:199–2115. Cheng CM, Reinhardt RR, Lee WH, Joncas G, Patel SC, Bondy CA. Insulin-like growth factor 1 regulates developing brain glucose metabolism. Proc NatlAcad Sci USA 2000;97:10236–102416. Fadel JR, Reagan LP. Stop signs in hippocampal insulin signaling: the roleof insulin resistance in structural, functional and behavioral deficits. Curr OpinBehav Sci 2016;9:47–547. Busiguina S, Chowen JA, Argente J, Torres-Aleman I. Specific alterations ofthe insulin-like growth factor I system in the cerebellum of diabetic rats. En-docrinology 1996;137:4980–49878. Fielitz J, Kim MS, Shelton JM, et al. Requirement of protein kinase D1 forpathological cardiac remodeling. Proc Natl Acad Sci USA 2008;105:3059–30639. Fernandez AM, Fernandez S, Carrero P, Garcia-Garcia M, Torres-Aleman I.Calcineurin in reactive astrocytes plays a key role in the interplay betweenproinflammatory and anti-inflammatory signals. J Neurosci 2007;27:8745–875610. Jacob KK, Whittaker J, Stanley FM. Insulin receptor tyrosine kinase activ-ity and phosphorylation of tyrosines 1162 and 1163 are required for insulin-increased prolactin gene expression. Mol Cell Endocrinol 2002;186:7–1611. Wieman HL, Wofford JA, Rathmell JC. Cytokine stimulation promotes glu-cose uptake via phosphatidylinositol-3 kinase/Akt regulation of Glut1 activity andtrafficking. Mol Biol Cell 2007;18:1437–144612. Gonzalez de la Vega A, Buño W, Pons S, Garcia-Calderat MS, Garcia-Galloway E, Torres-Aleman I. Insulin-like growth factor I potentiates kainate re-ceptors through a phosphatidylinositol 3-kinase dependent pathway. Neuroreport2001;12:1293–129613. Perrière N, Demeuse P, Garcia E, et al. Puromycin-based purification of ratbrain capillary endothelial cell cultures. Effect on the expression of blood-brainbarrier-specific properties. J Neurochem 2005;93:279–289

14. Barros LF, Bittner CX, Loaiza A, et al. Kinetic validation of 6-NBDG as aprobe for the glucose transporter GLUT1 in astrocytes. J Neurochem 2009;109(Suppl. 1):94–10015. Schäffer L, Brand CL, Hansen BF, et al. A novel high-affinity peptide an-tagonist to the insulin receptor. Biochem Biophys Res Commun 2008;376:380–38316. Koshy S, Alizadeh P, Timchenko LT, Beeton C. Quantitative measurement ofGLUT4 translocation to the plasma membrane by flow cytometry. J Vis Exp 2010;(45):e242917. González S, Moreno-Delgado D, Moreno E, et al. Circadian-related heter-omerization of adrenergic and dopamine D₄ receptors modulates melatoninsynthesis and release in the pineal gland. PLoS Biol 2012;10:e100134718. Pfaffl MW. A new mathematical model for relative quantification in real-timeRT-PCR. Nucleic Acids Res 2001;29:e4519. Nishijima T, Piriz J, Duflot S, et al. Neuronal activity drives localized blood-brain-barrier transport of serum insulin-like growth factor-I into the CNS. Neuron2010;67:834–84620. Schindelin J, Arganda-Carreras I, Frise E, et al. Fiji: an open-source platformfor biological-image analysis. Nat Methods 2012;9:676–68221. Chuquet J, Quilichini P, Nimchinsky EA, Buzsáki G. Predominant en-hancement of glucose uptake in astrocytes versus neurons during activation ofthe somatosensory cortex. J Neurosci 2010;30:15298–1530322. Pérez-Alvarez A, Araque A, Martín ED. Confocal microscopy for astrocytein vivo imaging: recycle and reuse in microscopy. Front Cell Neurosci 2013;7:5123. Hernandez-Garzón E, Fernandez AM, Perez-Alvarez A, et al. The insulin-likegrowth factor I receptor regulates glucose transport by astrocytes. Glia 2016;64:1962–197124. Roy CS, Sherrington CS. On the regulation of the blood-supply of the brain.J Physiol 1890;11:85–158.1725. Kim WH, Lee J, Jung DW, Williams DR. Visualizing sweetness: increasinglydiverse applications for fluorescent-tagged glucose bioprobes and their recentstructural modifications. Sensors (Basel) 2012;12:5005–502726. Albrecht J, Wróblewska B, Mossakowski MJ. The binding of insulin tocerebral capillaries and astrocytes of the rat. Neurochem Res 1982;7:489–49427. Baron-Van Evercooren A, Olichon-Berthe C, Kowalski A, Visciano G, VanObberghen E. Expression of IGF-I and insulin receptor genes in the rat centralnervous system: a developmental, regional, and cellular analysis. J Neurosci Res1991;28:244–25328. Leino RL, Gerhart DZ, van Bueren AM, McCall AL, Drewes LR. Ultrastructurallocalization of GLUT 1 and GLUT 3 glucose transporters in rat brain. J NeurosciRes 1997;49:617–62629. Wiesinger H, Hamprecht B, Dringen R. Metabolic pathways for glucose inastrocytes. Glia 1997;21:22–3430. Heni M, Hennige AM, Peter A, et al. Insulin promotes glycogen storage andcell proliferation in primary human astrocytes. PLoS One 2011;6:e2159431. Gray SM, Meijer RI, Barrett EJ. Insulin regulates brain function, but howdoes it get there? Diabetes 2014;63:3992–399732. Kuwabara T, Kagalwala MN, Onuma Y, et al. Insulin biosynthesis in neuronalprogenitors derived from adult hippocampus and the olfactory bulb. EMBO MolMed 2011;3:742–75433. Reinhardt RR, Bondy CA. Insulin-like growth factors cross the blood-brainbarrier. Endocrinology 1994;135:1753–176134. Rotwein P, Burgess SK, Milbrandt JD, Krause JE. Differential expression ofinsulin-like growth factor genes in rat central nervous system. Proc Natl Acad SciUSA 1988;85:265–26935. Nagase M, Takahashi Y, Watabe AM, Kubo Y, Kato F. On-site energy supplyat synapses through monocarboxylate transporters maintains excitatory synaptictransmission. J Neurosci 2014;34:2605–261736. Clarke DW, Mudd L, Boyd FT Jr, Fields M, Raizada MK. Insulin is releasedfrom rat brain neuronal cells in culture. J Neurochem 1986;47:831–83637. Cao P, Maximov A, Südhof TC. Activity-dependent IGF-1 exocytosis iscontrolled by the Ca(2+)-sensor synaptotagmin-10. Cell 2011;145:300–311

diabetes.diabetesjournals.org Fernandez and Associates 73

38. Celil AB, Campbell PG. BMP-2 and insulin-like growth factor-I mediateOsterix (Osx) expression in human mesenchymal stem cells via the MAPK andprotein kinase D signaling pathways. J Biol Chem 2005;280:31353–3135939. Chen J, Lu G, Wang QJ. Protein kinase C-independent effects of proteinkinase D3 in glucose transport in L6 myotubes. Mol Pharmacol 2005;67:152–16240. Hermanto U, Zong CS, Li W, Wang LH. RACK1, an insulin-like growth factor I(IGF-I) receptor-interacting protein, modulates IGF-I-dependent integrin signalingand promotes cell spreading and contact with extracellular matrix. Mol Cell Biol2002;22:2345–236541. Booth RA, Cummings C, Tiberi M, Liu XJ. GIPC participates in G proteinsignaling downstream of insulin-like growth factor 1 receptor. J Biol Chem 2002;277:6719–672542. Bunn RC, Jensen MA, Reed BC. Protein interactions with the glucosetransporter binding protein GLUT1CBP that provide a link between GLUT1 and thecytoskeleton. Mol Biol Cell 1999;10:819–83243. Elfenbein A, Rhodes JM, Meller J, Schwartz MA, Matsuda M, Simons M.Suppression of RhoG activity is mediated by a syndecan 4-synectin-RhoGDI1complex and is reversed by PKCalpha in a Rac1 activation pathway. J Cell Biol2009;186:75–83

44. Sylow L, Jensen TE, Kleinert M, et al. Rac1 is a novel regulator of con-traction-stimulated glucose uptake in skeletal muscle. Diabetes 2013;62:1139–115145. Reed BC, Cefalu C, Bellaire BH, et al. GLUT1CBP(TIP2/GIPC1) interactionswith GLUT1 and myosin VI: evidence supporting an adapter function forGLUT1CBP. Mol Biol Cell 2005;16:4183–420146. Csajbók EA, Tamás G. Cerebral cortex: a target and source of insulin?Diabetologia 2016;59:1609–161547. Grillo CA, Piroli GG, Hendry RM, Reagan LP. Insulin-stimulated translocationof GLUT4 to the plasma membrane in rat hippocampus is PI3-kinase dependent.Brain Res 2009;1296:35–4548. Allaman I, Bélanger M, Magistretti PJ. Astrocyte-neuron metabolic rela-tionships: for better and for worse. Trends Neurosci 2011;34:76–8749. Strachan MW, Reynolds RM, Marioni RE, Price JF. Cognitive function, de-mentia and type 2 diabetes mellitus in the elderly. Nat Rev Endocrinol 2011;7:108–11450. Trueba-Saiz A, Torres Aleman I. Insulin-like peptides signaling in Alz-heimer’s disease: on the road to alternative therapeutics. Curr Opin Behav Sci2016;9:15–25

74 Insulin Peptides Regulate Brain Glucose Diabetes Volume 66, January 2017