DNA Replication

I. Terms:

• A. Genes- the segments of DNA that are the units of inheritance.

Found on chromosomes.

•

• They control the development of traits. (hair color, blood type. Etc.)

• B. DNA –(Deoxyribonucleic acid) chemical that codes for proteins and controls the development of traits and cellular activities.

• II. Watson and Crick proposed a model for the DNA structure.

III. Structure of DNA:

• A. very large molecule

• B. Made of nucleotides. Each nucleotides consists of:

• A phosphate group• a five carbon sugar (deoxyribose)• a nitrogen base

Phosphate groupPhosphate group

5 carbon sugar5 carbon sugar

Nitrogen baseNitrogen base

• C. The nucleotides are joined together by bonds between the phosphate group of one nucleotide and the sugar of the next nucleotide. They form chains called phosphate sugar chains.

• D. The DNA molecule is composed of two chains of nucleotides joined by weak hydrogen bonds between the nitrogen bases.

• The chains of nucleotides spiral around a common center, the shape is called the double helix or a twisted ladder.

E. DNA CodeE. DNA Code

• E. The DNA code---The chains of nucleotides in a DNA molecule connect together by bonds according to a code called the DNA code.

• The code is determined by the order of the nucleotides.

• The four bases are A=adenine, G=guanine, C=cytosine, T=thymine

• A joins to thymine, G joins to cytosine

• The order of the bases determine the genetic make up of the individual.

F. DNA vs. RNA

• DNA RNA • Double stranded Single Stranded• Contains deoxyribose Contains ribose sugar sugar

• Has A, G, C, T Has A, G, C, U (uracil)• Original genetic Copy of the genetic Code code

IV. DNA replication- DNA makes a copy of itself during interphase of the cell cycle.

• ***This occurs in the nucleus of the cell.

• Step 1- The double helix untwists and looks like a ladder.

• The hydrogen bonds between the bases.

• The two nucleotide chains begin to break and the chains open like a zipper.

• Step 2-Each chain serves as a pattern for the formation of a new chain of DNA.

• Bases on the free nucleotides found in the nucleus, join with the correct bases according to the DNA code.

• This type of replication is known as semi-conservitive.

• Step 3. -- bonds form between the phosphates and the sugars.

• Step 4.--the two new molecules of DNA become twisted again.

DNA Quiz: Copy the questions.

• Describe the make up of DNA.• What is the bonding pattern of the bases?• What type of bond joins the bases?• What determines the genetic code?• Why does DNA go through replication?

V. DNA Transcription

The process of producing messenger RNA (mRNA) in the nucleus.

• STEP 1: The DNA molecule carries the code to make a specific protein.

• The portion of DNA that contains the code for the specific protein untwists and unzips.

• Free RNA nucleotides found in the nucleus pair with the exposed DNA strand.

                                                                                                                              

http://www.johnkyrk.com/DNAreplication.html

http://www.dnai.org/a/index.html

• The RNA code is as follows:A – adenine joins with U – uracil

C – cytosine joins with G – guanine•

• A sequence of three bases on a mRNA molecule that codes for an amino acid is called a codon.

•

• The mRNA molecule is completed by the of formation of bonds between the RNA nucleotides. The mRNA molecule separates from the DNA molecule.

•The completed mRNA molecule leaves the nucleus through the nuclear membrane and moves to the ribosome in the cytoplasm.

DNA Transcription QuizDNA Transcription Quiz

1.1.What is being made in the What is being made in the process of transcription? process of transcription? 2.2.Give 2 ways RNA is different from Give 2 ways RNA is different from DNA.DNA.3.3.Where does transcription take Where does transcription take place in the cell?place in the cell?4.4.Write the complimentary DNA Write the complimentary DNA strand for the following: strand for the following: GTACCGGTAGGTACCGGTAG5.5.Write the RNA strand that would Write the RNA strand that would be made from this DNA: be made from this DNA: TACGGACTTTACGGACTT

VI. Translation: The assembly of a protein molecule according to the code in a mRNA which occurs in the cytoplasm.

• Step 1: One end of a mRNA molecule attaches to a ribosome.

• Step 2: Transfer RNA (tRNA) molecules in the cytoplasm pick up the amino acids. They are coded to correspond with a particular mRNA.

tRNA

• Step 3: A tRNA molecule with the right anticodon links to the complimetary codon on the mRNA.

• Step 4: As the mRNA moves along the ribosome, the next tRNA comes in contact with the ribosome.

• The next tRNA moves in position with its amino acid which is linked together by peptide bond.

• Step 5: The first tRNA molecule is released and the next codon comes into place . Then the next amino acid is attached.

• ******Steps 3 – 5 Are repeated until the entire message is translated. In this way chains of amino acids are formed. A protein molecule is built from one or more chains of amino acids. There are 20 essential amino acids in nature.

• transcription tranlation

• So: DNA ----→ mRNA ---- protein

DNA Technology• Brought about a whole new science called

molecular genetics scientists study DNA molecules and make changes in the DNA.

• Led to a new field called genetic engineering.

DNA extraction and Gel Electrophoresis

• Technique used to separate the DNA from the rest of the cell is called DNA extraction.

• Long molecules of DNA can be cut into smaller pieces for study using special restriction enzymes.

• Pieces of DNA are called fragments and can be separated using gel electrophoresis.

• DNA fragment patterns can be used to compare the DNA of different organisms, to match the DNA of a specific organism, and to identify one certain gene out of the thousands of genes in the genome of one individual.

• Also called DNA fingerprinting because each person’s DNA is unique.

• This procedure can be used to help prove or disprove a criminal’s identity, and it can also be used to show if two people are related to each other.

Recombinant DNA

• DNA extraction also makes possible something called recombinant DNA

• Takes short pieces of DNA from one organism and joins it to the DNA of a completely different organism.

• This can be placed back into a living cell by transformation.

• This is currently being used in medicine because scientists can transform bacteria so they will produce hormones or other chemicals that the body needs. Common example is insulin which some people do not produce enough of and have the disease diabetes.

• Scientists are working on methods to replace defective genes with normal genes. If this is perfected, it could assist in treating and possibly eliminating genetic diseases such as Huntington’s disease, cystic fibrosis, and sickle cell anemia.

Transgenic Organisms:

• If an organism contains genes from a different organism, they are called transgenic. Several transgenic animals have been developed. Transgenic animals have extra copies of growth hormone genes which cause them to grow larger and faster.

• Transgenic plants have been produced that are more resistant to diseases and pests so that farmers can grow larger crops without using as many chemicals and pesticides.

Disadvantages to transgenic organisms:– Could pollinate wild

plants and produce plants that could not be controlled by weed killers.

– Antibiotic resistant genes could spread into the environment and cause bacteria to become antibiotic resistant.

– Genetic pollution

Reproductive Cloning:

• Involves transferring the genetic material of a donor cell into an egg cell that has had its nucleus removed.

• The egg is stimulated by chemicals or electricity to cause it to divide.

• Then it is implanted into the uterus of a female for further development until birth.

• The cloned organism is genetically identical to the original or parent organism.

Copy and complete:

1. Who discovered the DNA structure?2. How is DNA different from RNA?3. What are the base pairs found in DNA?4. List the three steps in transcription.5. When in the cell cycle does DNA replication

occur?6. Where does transcription occur?7. What is the purpose of translation?

8. What is an organism that contains genes from a different organism?

9. Cloning produces organisms that are--?10. What is transformation?11 .What is DNA fingerprinting?12. What do scientists use to cut DNA in an

exact area?13. What is it called when changes are made to

DNA?