Transcript
Page 1: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

DNA Replication

Page 2: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

I. Terms:

• A. Genes- the segments of DNA that are the units of inheritance.

Page 3: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

Found on chromosomes.

Page 4: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• They control the development of traits. (hair color, blood type. Etc.)

Page 5: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• B. DNA –(Deoxyribonucleic acid) chemical that codes for proteins and controls the development of traits and cellular activities.

Page 6: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• II. Watson and Crick proposed a model for the DNA structure.

Page 7: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

III. Structure of DNA:

• A. very large molecule

Page 8: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• B. Made of nucleotides. Each nucleotides consists of:

• A phosphate group• a five carbon sugar (deoxyribose)• a nitrogen base

Page 9: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

Phosphate groupPhosphate group

5 carbon sugar5 carbon sugar

Nitrogen baseNitrogen base

Page 10: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• C. The nucleotides are joined together by bonds between the phosphate group of one nucleotide and the sugar of the next nucleotide. They form chains called phosphate sugar chains.

Page 11: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• D. The DNA molecule is composed of two chains of nucleotides joined by weak hydrogen bonds between the nitrogen bases.

Page 12: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• The chains of nucleotides spiral around a common center, the shape is called the double helix or a twisted ladder.

Page 13: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

E. DNA CodeE. DNA Code

Page 14: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• E. The DNA code---The chains of nucleotides in a DNA molecule connect together by bonds according to a code called the DNA code.

Page 15: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• The code is determined by the order of the nucleotides.

Page 16: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• The four bases are A=adenine, G=guanine, C=cytosine, T=thymine

• A joins to thymine, G joins to cytosine

• The order of the bases determine the genetic make up of the individual.

Page 17: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

F. DNA vs. RNA

• DNA RNA • Double stranded Single Stranded• Contains deoxyribose Contains ribose sugar sugar

• Has A, G, C, T Has A, G, C, U (uracil)• Original genetic Copy of the genetic Code code

Page 18: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

IV. DNA replication- DNA makes a copy of itself during interphase of the cell cycle.

• ***This occurs in the nucleus of the cell.

Page 19: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Step 1- The double helix untwists and looks like a ladder.

• The hydrogen bonds between the bases.

• The two nucleotide chains begin to break and the chains open like a zipper.

Page 20: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Step 2-Each chain serves as a pattern for the formation of a new chain of DNA.

• Bases on the free nucleotides found in the nucleus, join with the correct bases according to the DNA code.

• This type of replication is known as semi-conservitive.

Page 21: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Step 3. -- bonds form between the phosphates and the sugars.

• Step 4.--the two new molecules of DNA become twisted again.

Page 22: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

DNA Quiz: Copy the questions.

• Describe the make up of DNA.• What is the bonding pattern of the bases?• What type of bond joins the bases?• What determines the genetic code?• Why does DNA go through replication?

Page 23: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

V. DNA Transcription

The process of producing messenger RNA (mRNA) in the nucleus.

Page 24: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• STEP 1: The DNA molecule carries the code to make a specific protein.

• The portion of DNA that contains the code for the specific protein untwists and unzips.

Page 25: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Free RNA nucleotides found in the nucleus pair with the exposed DNA strand.

                                                                                                                              

Page 26: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

http://www.johnkyrk.com/DNAreplication.html

http://www.dnai.org/a/index.html

Page 27: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• The RNA code is as follows:A – adenine joins with U – uracil

C – cytosine joins with G – guanine•

Page 28: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• A sequence of three bases on a mRNA molecule that codes for an amino acid is called a codon.

Page 29: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• The mRNA molecule is completed by the of formation of bonds between the RNA nucleotides. The mRNA molecule separates from the DNA molecule.

Page 30: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

•The completed mRNA molecule leaves the nucleus through the nuclear membrane and moves to the ribosome in the cytoplasm.

Page 31: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

DNA Transcription QuizDNA Transcription Quiz

1.1.What is being made in the What is being made in the process of transcription? process of transcription? 2.2.Give 2 ways RNA is different from Give 2 ways RNA is different from DNA.DNA.3.3.Where does transcription take Where does transcription take place in the cell?place in the cell?4.4.Write the complimentary DNA Write the complimentary DNA strand for the following: strand for the following: GTACCGGTAGGTACCGGTAG5.5.Write the RNA strand that would Write the RNA strand that would be made from this DNA: be made from this DNA: TACGGACTTTACGGACTT

Page 32: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

VI. Translation: The assembly of a protein molecule according to the code in a mRNA which occurs in the cytoplasm.

Page 33: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Step 1: One end of a mRNA molecule attaches to a ribosome.

Page 34: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Step 2: Transfer RNA (tRNA) molecules in the cytoplasm pick up the amino acids. They are coded to correspond with a particular mRNA.

Page 35: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

tRNA

Page 36: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Step 3: A tRNA molecule with the right anticodon links to the complimetary codon on the mRNA.

Page 37: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Step 4: As the mRNA moves along the ribosome, the next tRNA comes in contact with the ribosome.

Page 38: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• The next tRNA moves in position with its amino acid which is linked together by peptide bond.

Page 39: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance
Page 40: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Step 5: The first tRNA molecule is released and the next codon comes into place . Then the next amino acid is attached.

Page 41: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• ******Steps 3 – 5 Are repeated until the entire message is translated. In this way chains of amino acids are formed. A protein molecule is built from one or more chains of amino acids. There are 20 essential amino acids in nature.

• transcription tranlation

• So: DNA ----→ mRNA ---- protein

Page 42: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance
Page 43: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

DNA Technology• Brought about a whole new science called

molecular genetics scientists study DNA molecules and make changes in the DNA.

• Led to a new field called genetic engineering.

Page 44: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

DNA extraction and Gel Electrophoresis

• Technique used to separate the DNA from the rest of the cell is called DNA extraction.

Page 45: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Long molecules of DNA can be cut into smaller pieces for study using special restriction enzymes.

Page 46: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Pieces of DNA are called fragments and can be separated using gel electrophoresis.

Page 47: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• DNA fragment patterns can be used to compare the DNA of different organisms, to match the DNA of a specific organism, and to identify one certain gene out of the thousands of genes in the genome of one individual.

Page 48: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Also called DNA fingerprinting because each person’s DNA is unique.

• This procedure can be used to help prove or disprove a criminal’s identity, and it can also be used to show if two people are related to each other.

Page 49: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

Recombinant DNA

• DNA extraction also makes possible something called recombinant DNA

• Takes short pieces of DNA from one organism and joins it to the DNA of a completely different organism.

• This can be placed back into a living cell by transformation.

Page 50: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance
Page 51: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• This is currently being used in medicine because scientists can transform bacteria so they will produce hormones or other chemicals that the body needs. Common example is insulin which some people do not produce enough of and have the disease diabetes.

Page 52: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Scientists are working on methods to replace defective genes with normal genes. If this is perfected, it could assist in treating and possibly eliminating genetic diseases such as Huntington’s disease, cystic fibrosis, and sickle cell anemia.

Page 53: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

Transgenic Organisms:

• If an organism contains genes from a different organism, they are called transgenic. Several transgenic animals have been developed. Transgenic animals have extra copies of growth hormone genes which cause them to grow larger and faster.

Page 54: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Transgenic plants have been produced that are more resistant to diseases and pests so that farmers can grow larger crops without using as many chemicals and pesticides.

Page 55: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

Disadvantages to transgenic organisms:– Could pollinate wild

plants and produce plants that could not be controlled by weed killers.

– Antibiotic resistant genes could spread into the environment and cause bacteria to become antibiotic resistant.

– Genetic pollution

Page 56: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

Reproductive Cloning:

Page 57: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

• Involves transferring the genetic material of a donor cell into an egg cell that has had its nucleus removed.

• The egg is stimulated by chemicals or electricity to cause it to divide.

• Then it is implanted into the uterus of a female for further development until birth.

• The cloned organism is genetically identical to the original or parent organism.

Page 58: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance
Page 59: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

Copy and complete:

1. Who discovered the DNA structure?2. How is DNA different from RNA?3. What are the base pairs found in DNA?4. List the three steps in transcription.5. When in the cell cycle does DNA replication

occur?6. Where does transcription occur?7. What is the purpose of translation?

Page 60: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

8. What is an organism that contains genes from a different organism?

9. Cloning produces organisms that are--?10. What is transformation?11 .What is DNA fingerprinting?12. What do scientists use to cut DNA in an

exact area?13. What is it called when changes are made to

DNA?

Page 61: DNA Replication. I. Terms: A. Genes- the segments of DNA that are the units of inheritance

Top Related