RESEARCH ARTICLE

The leptin system and its expression at different nutritional andpregnant stages in lined seahorse (Hippocampus erectus)Huixian Zhang1, Geng Qin1, Yanhong Zhang1, Shuisheng Li2 and Qiang Lin1,*

ABSTRACTLeptin is an essential hormone for the regulation of energymetabolism and food intake in vertebrate animals. To betterunderstand the physiological roles of leptin in nutrient regulation inpaternal ovoviviparous fish (family Syngnathidae), the present studycloned the full-length of leptin-a and leptin receptor (lepr) genesin lined seahorse (Hippocampus erectus). Results showed thatthere was a 576-bp intron between two exons in leptin-a gene but noleptin-b gene in seahorse. Although the primary amino acid sequenceconservation of seahorse leptin-a was very low, the 3-D structuremodeling of seahorse leptin-a revealed strong conservation of tertiarystructure with other vertebrates. Seahorse leptin-a mRNAwas highlyexpressed in brain, whereas lepr mRNA was mainly expressed inovary and gill. Interestingly, both leptin-a and lepr mRNA wereexpressed in the brood pouch of male seahorse, suggesting the leptinsystem plays a role during the male pregnancy. Physiologicalexperiments showed that the expression of hepatic leptin-a and leprmRNA in unfed seahorses was significantly higher than that in thosefed 100%, as well as 60%, of their food during the fasting stage,showing that seahorse might initiate the leptin system to regulateits energy metabolism while starving. Moreover, the expression ofleptin-a in the brood pouch of pregnant seahorse was significantlyupregulated compared with non-pregnant seahorse, whereas theexpression of lepr was downregulated, suggesting that the leptinsystem might be involved in the male pregnancy. In conclusion, theleptin system plays a role in the energy metabolism and food intake,and might provide new insights into molecular regulation of malepregnancy in seahorse.

KEY WORDS: Leptin, Leptin receptor, Nutrient, Pregnancy,Seahorse

INTRODUCTIONSeahorses, which belong to the family Syngnathidae, areovoviviparous fish whose embryos can obtain paternal nutrientsduring pregnancy through the male’s brood pouch and maternalnutrients from yolk (Foster and Vincent, 2004; Wilson et al., 2001).Seahorses mainly feed on planktonic crustaceans, such as copepods,amphipods, decapods and mysid shrimps (Kitsos et al., 2008; Lin

et al., 2009, 2010). However, sometimes seahorses might have toendure starvation because of their slow swimming ability and thepatchiness of prey distribution and abundance when they are takento a new place by water current in the wild, which often leads to highmortality, especially during the juvenile seahorse stage (Lourieet al., 1999; Vincent et al., 2011). Nonetheless, the molecularmechanism of energy regulation during seahorse starvation stage isstill unknown.

In teleosts and mammals, feeding is generally regulated by anumber of peptides produced in brain and peripheral tissues, such asleptin (Schwartz et al., 2000). Leptin is an important hormonesynthesized by the adipocytes which signal the peripheral energyreserves to the brain and regulate development, growth, energymetabolism and reproduction in mammals (Anubhuti and Arora,2008). As the protein product of the obese (ob) gene, leptin is a kindof type-I cytokine hormone secreted by the adipocytes that actsupon the central nervous system to regulate food intake and energymetabolism in mammals (Morton et al., 2006). In teleosts, theexistence of leptinwas first demonstrated in the pufferfish (Takifugurubripes) through the synteny analysis compared to mammal leptin(Kurokawa et al., 2005). Since then, the leptin genes have beenidentified in many fish species, such as the common carp (Huisinget al., 2006), zebrafish (Gorissen et al., 2009), Japanese medaka(Kurokawa and Murashita, 2009), rainbow trout (Oncorhynchusmykiss) (Pfundt et al., 2009), Atlantic salmon (Salmo salar)(Ronnestad et al., 2010), grass carp (Ctenopharyngodon idellus) (Liet al., 2010), Arctic charr (Salvelinus alpines) (Froiland et al., 2010),orange-spotted grouper (Epinephelus coioides) (Zhang et al., 2013),among others. Although the primary sequence conservation ofleptin in teleosts is extremely low, the secondary and tertiarystructure of the protein is highly conserved (Denver et al., 2011). Incontrast to mammals, the leptin of ectotherm vertebrates, includingfish, is rarely expressed in adipose tissue and is instead mainlyexpressed in the liver, brain and gonads in fish (Copeland et al.,2011).

Leptin stimulates downstream genes by binding to a variety ofreceptors. Several forms of leptin receptor have been identified inmammals (Tartaglia et al., 1995) and amphibians (Crespi andDenver, 2006). One long form and five short isoforms have beenreported in mammals, and only a long form of leptin receptor has theintracellular functional domains (Tartaglia, 1997). In teleosts,different isoforms of lepr have also been identified. Five differentlepr isoforms have been found in Atlantic salmon (Salmo salar)(Ronnestad et al., 2010), and three lepr isoforms have beenidentified in crucian carp (Carassius carassius) (Cao et al., 2011).The long form is the only one that conserves all the functionallyimportant domains in mammals, which include two JAK2 boxesand one STAT box (Ronnestad et al., 2010).

The family Syngnathidae is a special fish group because of itsovoviviparous reproductive pattern through the male’s brood pouch.Interestingly, there is a gestation time before the offspring ofReceived 14 July 2016; Accepted 5 September 2016

1CAS Key Laboratory of Tropical Marine Bio-resources and Ecology, South ChinaSea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou,Guangdong 510301, China. 2State Key Laboratory of Biocontrol, School of LifeSciences, Sun Yat-Sen University, Guangzhou, Guangdong 510275, China.

*Author for correspondence (linqiang@scsio.ac.cn)

Q.L., 0000-0002-1102-4855

This is an Open Access article distributed under the terms of the Creative Commons AttributionLicense (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use,distribution and reproduction in any medium provided that the original work is properly attributed.

1508

© 2016. Published by The Company of Biologists Ltd | Biology Open (2016) 5, 1508-1515 doi:10.1242/bio.020750

BiologyOpen

mailto:linqiang@scsio.ac.cnhttp://orcid.org/0000-0002-1102-4855http://creativecommons.org/licenses/by/3.0http://creativecommons.org/licenses/by/3.0

seahorse are released (Wilson et al., 2001). The paternal nutrientsprovided to seahorse embryos during pregnancy are essential, inaddition to the maternal nutrients from the yolk (Linton and Soloff,1964). Therefore, the study of the regulation for nutrient transitionand pregnancy of these special animals may help to understand theevolutionary adaptability of nutrient regulation in teleosts. The linedseahorse (Hippocampus erectus) is a highly valued species in bothtraditional Chinese medicine and aquarium trades, and it also hasbeen widely used for some scientific research because it can beeasily bred in a laboratory (Lin et al., 2012, 2008; Qin et al., 2014).Lined seahorse is mainly found along the western Atlantic coast andGulf of Mexico from Florida to Nova Scotia (Foster and Vincent,2004). H. erectus has been included on the IUCN list of ThreatenedSpecies as ‘Vulnerable’ (Lourie et al., 1999). The present studyaimed to identify and characterize the leptin system in linedseahorse, and analyze the expression profiles of leptin system duringnutrient transition and pregnant stages to detect the physiologicalroles of leptin system in male pregnancy species.

RESULTSCharacterization of leptin-a and lepr genesFull-length cDNA sequences of leptin-a and lepr genes in adultseahorse were obtained through RACE-PCR. The leptin gene was656 bp in length and contained an open reading frame (ORF) of489 bp (GenBank Accession No. KP888952). The deduced leptin-aprotein was composed of 163 amino acid residues, with a 21-amino-acid signal region and a 141-amino-acid mature peptide. A 576-bpintron between the two exons was identified in seahorse (Fig. 1).Multiple sequence alignment was performed based on the amino

acid sequences of vertebrate leptins (Fig. 2A). The deduced aminoacid sequences of leptin-a in seahorse displayed a low identity with

other vertebrate leptins, but the 3-D structure modeling showed astrong conservation of the tertiary structure of leptin betweenseahorse and human, as both 3-D structures had the characteristicsof four-helix bundle topology and a disulfide bond (Fig. 2B). Aphylogeny analysis of the mature proteins revealed that vertebrateleptin sequences clustered into two groups. The first encompassedteleost leptin-b sequences, and the other encompassed teleostleptin-a and tetrapod sequences. The seahorse leptin-a sequencebranched within the Acanthopterygian leptin-a clade (Fig. S2A).

The seahorse lepr cDNA (GenBank Accession No. KP888953)contained a 3351-bp ORF with a coding potential for a 1116-aminoacid (aa) protein, with one 22-aa signal peptide region, one 795-aaextracellular segment, one 23-aa single transmembrane domain andone 298-aa intracellular segment (Fig. S1). The lepr in seahorse hadall functionally important domains which are conserved amongvertebrate leptin receptors. All of these leptin receptors included twoJAK2-binding motif boxes and one STAT-binding domain atthe intracellular segment. On the basis of the phylogeny analysisof leptin receptor proteins, the lepr in seahorse can be groupedin a teleost branch and clustered with orange-spotted grouper(Fig. S2B).

Tissue distribution of leptin-a and lepr genesThe leptin-a mRNAwas mainly expressed in brain, liver and broodpouch of male seahorses (Fig. 3B). In female seahorse leptin-a wasexpressed mainly in brain and ovary (Fig. 3A). In contrast, in maleseahorse lepr was expressed in gill, brain, liver, kidney and broodpouch (Fig. 3B), and lepr was highly expressed in ovary, gill,kidney, muscle and skin in female seahorse (Fig. 3A). Interestingly,both leptin-a and lepr genes were expressed in brood pouch of maleseahorse.

Fig. 1. The nucleotide and deduced protein sequences of leptin cDNA in the lined seahorse Hippocampus erectus. (A) Gene structure. The boxesrepresent coding exons. The numbers show the base pairs and amino acids (aa). (B) The signal peptide is shown in shadow. The cysteine residues used indisulfide linkages are circled.

1509

RESEARCH ARTICLE Biology Open (2016) 5, 1508-1515 doi:10.1242/bio.020750

BiologyOpen

http://bio.biologists.org/lookup/doi/10.1242/bio.020750.supplementalhttp://bio.biologists.org/lookup/doi/10.1242/bio.020750.supplementalhttp://bio.biologists.org/lookup/doi/10.1242/bio.020750.supplemental

Expression profiles of the leptin system at differentnutritional and pregnant stagesThe expression of hepatic leptin-a and lepr mRNA in unfedseahorses was significantly higher than those of 100% (leptin-a:P=0.014, lepr: P=0.034; P0.05) groups (Fig. 4).

The expression of leptin-a in brood pouch of early pregnant(P=0.173; P

early- (P=0.0178; P

leptins identified with four-helix bundle topology. The two conservedcysteine residues in seahorse leptin-a predict the formation of a disulfidebond, which is a prerequisite for tertiary structure and bioactivity ofleptin in human (Rock et al., 1996). This conserved tertiary structure ofleptin shows that leptin is constrained by the structure of the receptorbinding pocket, and can explain why frog leptin can activate mouseleptin receptor in vitro (Crespi and Denver, 2006).The protein sequence of seahorse lepr showed low identity with

mammalian leptin recetpor, but the protein structure was similar tothat of mammals (Fig. S1). A phylogenetic analysis of lepr proteinsclearly clustered the seahorse gene within lepr genes in teleosts. Inmammals, the alternative splicing at the 3′ end of the gene producesat least six distinct mRNA transcripts and generates several kinds ofleptin receptor protein isoforms (Zabeau et al., 2003). The long-form leptin receptor identified in the present study has allfunctionally important domains, such as WSXWS motifs, a pairof JAK2-binding motif boxes and a STAT-binding domain. Thebiological activities of long-form leptin receptor via the JAK/STATpathway in maintaining body weight and energy homeostasis havebeen demonstrated in mammals (Bates et al., 2003). Through theresult of 3′RACE of seahorse lepr, there is no other short isoform ofleprwhich included the functional domains in intracellular segmentof lepr in lined seahorse.Seahorse leptin-amRNAwasmainly expressed in brain and liver,

which is consistent with the pattern in Japanese medaka (Kurokawaand Murashita, 2009), Atlantic salmon (Ronnestad et al., 2010)and orange-spotted grouper (Zhang et al., 2013). The expression ofleptin-a and lepr in tissues, such as kidney, heart, eye, muscle andskin, indicates that leptin-a has multiple functions in addition to theregulation of energy homeostasis.The mRNA transcripts of leptin-a and lepr have been found in

many peripheral tissues that have no direct relationship withfeeding, such as gills and ovaries. The high expression of lepr ingills was also found in marine medaka (Wong et al., 2007) andcrucian carp (Cao et al., 2011). These results may be related to theleptin functioning in the endocrine regulation of environmentalhypoxia. The high expression of leptin-a and lepr in seahorse ovary,as found in zebrafish (Gorissen et al., 2009) and Atlantic salmon(Ronnestad et al., 2010), suggests that leptin-a has some functionsin reproductive process in teleosts. Interestingly, both leptin-a andleprwere expressed in brood pouch of seahorse, which suggests thatthe leptin system might play roles during the energy transfer frommale seahorses to its offspring in brood pouch.The mRNA expression of leptin-a increased significantly in liver

but not in brain after fasting in seahorses, suggesting that the liver is

the center of energy metabolism regulation, and this result is similarto reports in goldfish (Tinoco et al., 2012) and orange-spottedgrouper (Zhang et al., 2013). A significant level of hepatic leptin-aexpression was induced by food deprivation in juvenile seahorses,but there was no change in leptin-a expression in seahorsessubjected to rationed feeding (60% of full ration for 7 days). Theseresults are consistent with previous studies in rainbow trout and fineflounder, which showed elevated plasma leptin levels when fastedfor 1-3 weeks (Fuentes et al., 2012; Kling et al., 2009). However,the rationed feeding (60% of full ration for 10 months) in Atlanticsalmon resulted in significantly reduced growth and significantlyincreased hepatic leptin-a compared with animals in a normalfeeding group (Ronnestad et al., 2010). These results demonstratethat the mRNA expression of leptin-a in fish may increasesignificantly to regulate energy metabolism, allowing the animalsto survive when they encounter food shortages for an extendedperiod of time.

When the seahorses live in food-deficient conditions, they willendocrine the leptin hormone to regulate its energy metabolism tosuit the environmental condition. Therefore, the down-regulation ofappetite leading to the suppression of physical behavior in seahorsesmay be a survival strategy which is energetically advantageous.Such anorexic behavioral responses can be mediated by increasingleptin levels in liver and brain, which may trigger the activation ofcatabolic pathways of lipid depletion and energy metabolism inseahorse; whereas in mammals, leptin has been shown to report totallipid stores to the central nervous system, such that changes in lipidstores can be sensed rapidly and physiologically adjusted to allowsurvival from starvation events (Ahima et al., 2000).

Previous studies suggest that leptin can regulate food intake andenergy metabolism in teleost and mammals (Copeland et al., 2011;Spiegelman and Flier, 2001). Recent studies on the link betweenleptin and stress hormones have focused on the relationship betweenstress and energy metabolism. In the common carp, chronic hypoxiaand food restriction elicited gradual and parallel increases in theexpression of liver leptin-a-I, leptin-a-II and lepr (Bernier et al.,2012). Meanwhile, the plasma cortisol level in catfish was elevatedafter fasting (Barcellos et al., 2010), and hypoxia can trigger asignificant upregulation of leptin-a and lepr in zebrafish (Chu et al.,2010). Therefore, fishes are able to survive in environments of fooddeprivation and oxygen stress. This implies that hormones thatregulate energy metabolism such as leptin and cortisol are involvedin these complex processes.

The mRNA expression of leptin-a in brood pouch of pregnantseahorses was significantly higher than that of non-pregnant

Fig. 5. The mRNA expressions of leptin-aand lepr during different pregnant stages.(A)The mRNA levels were qualified by real-time PCR. The asterisks denote significantdifferences between pregnant and non-pregnant stages (P

seahorses. It has been suggested that leptin-a can regulate paternalenergy during the pregnant stages and may function in the energytransition between the paternal body to embryos in brood pouch. Inmammals, the serum levels of maternal leptin increase graduallyduring the first and second trimesters and become highest in latesecond or early third trimester (Hardie et al., 1997). These highlevels are maintained throughout the remainder of gestation anddecline drastically postpartum (Schubring et al., 1998). Theseresults demonstrate the functional importance of leptin duringpregnancy.Conversely, the mRNA expression of lepr in brood pouch of

pregnant seahorses was significantly lower than that of non-pregnant seahorses, indicating that the expression profile of leptinreceptor was not synchronized with leptin in seahorse. In mammals,hyperleptinemia in maternal serum during the pregnant stage leadsto central leptin resistance by downregulating OB-Rb in thehypothalamic ventromedial nuclei and increasing circulatingOB-Rb (Brunton and Russell, 2008). These results demonstratethat the function of leptin at the peripheral tissues as a paracrine/autocrine factor is capable of modifying energy metabolism. Inzebrafish, a leptin receptor knockout study showed that leptin playeda role in the regulation of glucose homeostasis and as a gating factorin reproductive competence (Michel et al., 2016).In conclusion, leptin-a and lepr genes were identified in lined

seahorse H. erectus, and both leptin-a and lepr mRNA wereexpressed in the brood pouch of male seahorse. As the regulatedhormone for seahorse nutrient transition and food intake, leptinplayed an essential role in regulating the physiological andbehavioral responses to adapt to food deficiency. Interestingly,leptin-amRNAwas significantly upregulated in the brood pouch ofpregnant seahorse, suggesting the functional importance of leptin-aduring pregnancy. The present study offers new perspectives forunderstanding the ecological adaptability regulated by leptin-a inovoviviparous family Syngnathidae.

MATERIALS AND METHODSExperimental seahorsesLined seahorses were cultured in Shenzhen Seahorse Center of the SouthChina Sea Institute of Oceanology, Chinese Academy of Sciences (SCSIO-CAS), with animal ethics approval for experimentation granted by the ChineseAcademyofSciences. The seahorsesweremaintained in re-circulatingholdingtanks (90×70×60 cm)with seawater pumped directly from theSouthChina seaand treated with double sand filtration. They were fed three times a day (0900,1200, and 1600 h) with frozen Mysis spp. Feces, and uneaten food wassiphoned off daily. Temperature, salinity, pH, light intensity, dissolved oxygen(DO), and photoperiod were maintained at (mean±s.d.) 25±0.5°C, 32±1.0‰,7.9±0.4, 2000 lx, 6.5±0.5 mg l−1, and 16 h light:8 h dark, respectively. Fortissue distribution analysis, three pairs of adult seahorses (body height,15.3±1.6 cm) were collected, anesthetized with MS222 and sacrificed bydecapitation. Their tissues were dissected, frozen immediately with liquidnitrogen, and stored at −80°C until RNA extraction.

Cloning of leptin-a and lepr genesLiver and brain tissue from adult seahorses was used to clone the leptin-aand lepr genes. Total RNAwas isolated from the frozen tissue samples usingTRIzol reagent (Invitrogen, USA). One microgram of isolated RNA wasused to synthesize first-strand cDNA using the Genome Erase cDNASynthesis Kit (TAKARA, Japan). The leptin-a and lepr fragment cDNAwere identified in big-belly seahorse transcriptomes (Whittington et al.,2015). To amplify these cDNA fragments, specific PCR primers weredesigned by using Primer 5.00 (Palo Alto, CA); these primers are shownin Table 1. The full-length cDNA sequences were obtained by the 5′- and3′-rapid amplification of cDNA ends (RACE) using BD SMART RACEcDNA Amplification Kit (Clontech, USA) (Table 1).

All PCR reactions in the present study were carried out using the followingPCR cycling parameters: denaturation at 94°C for 3 min, followed by 35cycles at 94°C for 20 s, 52-56°C for 20 s and 72°C for 1.5-2 min. The reactionwas terminated after an extension step of 10 min at 72°C. The amplificationproducts were purified using the E.Z.N.AGel Extraction Kit (Omega BioTek,USA) and subcloned into the PMD18/T vector (TAKARA, Japan). Twoselected clones from each amplicon were sequenced using an ABI 3700sequencer (Applied Biosystems).

Structural and phylogenic analysis of leptin-a and lepr genesThe leptin-a amino acid sequence was translated from the nucleotide sequenceusingDNASTAR software (Burland, 1999). The peptide structural features andtertiary configuration of mature seahorse leptin-a were predicted using theSWISS-MODEL automated protein modeling server (http://www.expasy.org/swissmod/SWISS-MODEL.html) (Schwede et al., 2003) based on the humanleptin (1AX8A.pdb) Protein Data Bank (PDB) (http://www.rcsb.org/pdb/home/home.do). The putative signal peptides and cleavage sites of seahorse leprwere predicted using SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/).The putative transmembrane domain was predicted by using TMHMMServer V2.0 (http://www.cbs.dtu.dk/services/TMHMM). Multiple sequencealignments of amino acids were performed with ClustalX2.0 (Larkin, et al.,2007). Protein phylogenetic analyses were conducted with MEGA 4.0(Tamura et al., 2007) using the neighbor-joining method.

Tissue expression of leptin-a and lepr mRNAThe expression patterns of leptin-a and lepr mRNA in the various tissuesof the adult seahorses were analyzed by real-time PCR. Total RNA wasisolated from the brains, gills, livers, intestines, kidneys, muscles, broodpouches, skin and gonads of male and female seahorses. The tissuedistribution PCR primers were designed from the putative leptin-a and leprgene-coding sequences (Table 1). The housekeeping genes β-actin and 18 srRNA were screened by PCR in tandem on the same samples to verify theintegrity of cDNA template across tissues.

Expression profiles of leptin-a and lepr genes in juvenileseahorses at different nutritional statusesThree treatments (100% feeding, 60% feeding and non-feeding), each withone-month seahorses (n=8) from the same brood, were used to compare theregulation of the leptin-a and lepr genes between fed and unfed juveniles.The seahorses in the feeding treatments were fed twice a day (0900 and1600 h) with frozenMysis spp. feces. The amount of food administered was

Table 1. Nucleotide sequences used in 5′ RACE PCR, 3′ RACE PCR andqPCR assays for leptin-a, lepr and the internal reference gene β-actin inlined seahorse (Hippocampus erectus)

Primer sequences

Gene Purpose Primer 5′-3′ sequence

leptin-a Partial cDNA lepa F1 AGTCCAAGCAGCTGGTTGCClepa R1 CGAAGCTTCGCTGACTTTGC

5′RACE lepa R2 (first) AACTCTTCAGCCACGAGATClepa R3 (nest) GGAGTGTCACCACTGAAGAG

3′RACE lepa F2 (first) TCAGACTCTCTGAACGTGTClepa F3 (nest) TGGCTGAAGAGTTACCTCGG

Real-time PCR lepa qF CGACAAGCTCATCTCAGACTClepa qR AGGATGTCCTTGACTCTGACC

lepr Partial cDNA lepr F1 CAAAGGATTCCTCCAGGTGClepr R1 TGAGCTGCAGCTCATCAAGC

5′RACE lepr R2 (first) ACCTGCATGGTGTAGTTGAClepr R3 (nest) CTTTTGGTTCATCCCACTGC

3′RACE lepr F2 (first) CAACTTCAAGAAGGCTGACAClepr F3 (nest) CATGGAAAAGGCTAACATGTC

Real-time PCR lepr qF CCTACAACTCAGTGGAAGAAClepr qR TGTACGGTGCAGTCCTGAAC

β-actin Real-time PCR β-actin qF TTCACCACCACAGCCGAGAβ-actin qR TGGTCTCGTGGATTCCGCAG

1513

RESEARCH ARTICLE Biology Open (2016) 5, 1508-1515 doi:10.1242/bio.020750

BiologyOpen

http://www.expasy.org/swissmod/SWISS-MODEL.htmlhttp://www.expasy.org/swissmod/SWISS-MODEL.htmlhttp://www.expasy.org/swissmod/SWISS-MODEL.htmlhttp://www.rcsb.org/pdb/home/home.dohttp://www.rcsb.org/pdb/home/home.dohttp://www.cbs.dtu.dk/services/SignalP/http://www.cbs.dtu.dk/services/SignalP/http://www.cbs.dtu.dk/services/TMHMMhttp://www.cbs.dtu.dk/services/TMHMM

15% or 9% of the wet body weight of the seahorses for the 100% feeding(4.35±0.61 g; mean body weight±s.e.m.) and 60% feeding (3.87±0.52 g;mean body weight±s.e.m.) groups, respectively, while the seahorses in thenon-feeding group (3.23±0.48 g; mean body weight±s.e.m.) were starvedfor 7 days. At 1200 h of the 8th day, six seahorses randomly collected fromeach tank were anesthetized by MS222, individually weighed andsubsequently killed by decapitation. The liver and brain samples forquantitative RT-PCR measurement of mRNA were immediately frozen byliquid nitrogen and then stored at −80°C until RNA extraction.

Expression profile of the leptin system during the stages ofpregnancyAdult seahorses were allowed to mate freely before being subjected to astandardized assessment of pregnancy status on the basis of courtshipbehaviors. Pregnant seahorses were maintained in single-sex tanks beforeeuthanasia to sample brood pouch tissues at key stages throughoutpregnancy. The targeted time periods included the following: 1-8 dayspost fertilization (dpf) (early pregnancy) and 9-16 dpf (late pregnancy). Theembryos are attached to the brood pouch in the early pregnant stage. Whilein the late pregnant stage, the embryos were released from the brood pouch(Fig. 5B). We sampled six seahorses per time point (n=8) and detected theexpression profiles of leptin-a and lepr genes by using real-time PCR.

Quantitative real-time PCRThen expression levels of leptin-a and lepr in lined seahorse weredetermined by quantitative real-time PCR (qPCR). qPCR was performedon a Roche Light-Cycler 480 real time PCR system using SYBR Premix ExTaq™ (TAKARA, Japan) according to the manufacturer’s protocol. qPCRconditions were as follows: denaturation at 94°C for 3 min, followed by 40cycles at 94°C for 15 s, 55-58°C for 15 s and 72°C for 20 s. The standardcurves of amplification for leptin-a, lepr and housekeeping genes weregenerated using serial dilutions of plasmid constructs as the templates. Afteramplification, the fluorescence data were converted to threshold cyclevalues (CTs). The concentration of the template in the sample wasdetermined by relating the CT value to the standard curve (Livak andSchmittgen, 2001). The transcript levels of leptin-a and lepr were comparedwith the β-actin and 18 s rRNA gene transcripts.

Statistical analysesAll the data were expressed as the means±standard error of mean (s.e.m.)and evaluated by one-way analysis of variance (ANOVA) followed by theDuncan’s multiple-range tests. The results were considered to be statisticallysignificant at a P-value

Lin, Q., Lin, J. and Zhang, D. (2008). Breeding and juvenile culture of the linedseahorse, Hippocampus erectus Perry, 1810. Aquaculture 277, 287-292.

Lin, Q., Lin, J. and Huang, L. (2009). Effects of substrate color, light intensityand temperature on survival and skin color change of juvenile seahorses,Hippocampus erectus Perry, 1810. Aquaculture 298, 157-161.

Lin, Q., Lin, J. and Huang, L. (2010). Effects of light intensity, stocking density andtemperature on the air-bubble disease, survivorship and growth of early juvenileseahorse Hippocampus erectus Perry, 1810. Aquacult. Res. 42, 91-98.

Lin, Q., Li, G., Qin, G., Lin, J., Huang, L., Sun, H. and Feng, P. (2012). Thedynamics of reproductive rate, offspring survivorship and growth in the linedseahorse, Hippocampus erectus Perry, 1810. Biol. Open 1, 391-396.

Linton, J. R. andSoloff, B. L. (1964). The physiology of the brood pouch of themalesea horse Hippocampus erectus. Bull. Mar. Sci. 14, 45-61.

Livak, K. J. and Schmittgen, T. D. (2001). Analysis of relative gene expression datausing real-time quantitative PCR and the 2−ΔΔCT Method.Methods 25, 402-408.

Lourie, S. A., Vincent, A. C. J. and Hall, H. J. (1999). Seahorse: An IdentificationGuide to the World’s Species and their Conservation. London: Project Seahorse.

Michel, M., Page-McCaw, P. S., Chen, W. and Cone, R. D. (2016). Leptin signalingregulates glucose homeostasis, but not adipostasis, in the zebrafish. Proc. Natl.Acad. Sci. USA 113, 3084-3089.

Morton, G. J., Cummings, D. E., Baskin, D. G., Barsh, G. S. and Schwartz, M. W.(2006). Central nervous system control of food intake and body weight. Nature443, 289-295.

Pfundt, B., Sauerwein, H. and Mielenz, M. (2009). Leptin mRNA and proteinimmunoreactivity in adipose tissue and liver of rainbow trout (Oncorhynchus mykiss)and immunohistochemical localization in liver. Anat. Histol. Embryol. 38, 406-410.

Qin, G., Zhang, Y., Huang, L. and Lin, Q. (2014). Effects of water current onswimming performance, ventilation frequency, and feeding behavior of youngseahorses (Hippocampus erectus). J. Exp. Mar. Biol. Ecol. 461, 337-343.

Rock, F. L., Altmann, S. W., van Heek, M., Kastelein, R. A. and Bazan, J. F.(1996). The leptin haemopoietic cytokine fold is stabilized by an intrachaindisulfide bond. Horm. Metab. Res. 28, 649-652.

Ronnestad, I., Nilsen, T. O., Murashita, K., Angotzi, A. R., Gamst Moen, A.-G.,Stefansson, S. O., Kling, P., Thrandur Bjornsson, B. andKurokawa, T. (2010).Leptin and leptin receptor genes in Atlantic salmon: cloning, phylogeny, tissuedistribution and expression correlated to long-term feeding status. Gen. Comp.Endocrinol. 168, 55-70.

Schubring, C., Englaro, P., Siebler, T., Blum, W. F., Demirakca, T., Kratzsch, J.andKiess,W. (1998). Longitudinal analysis of maternal serum leptin levels duringpregnancy, at birth and up to six weeks after birth: relation to body mass index,skinfolds, sex steroids and umbilical cord blood leptin levels.Horm. Res. Paediatr.50, 276-283.

Schwartz, M. W., Woods, S. C., Porte, D., Jr, Seeley, R. J. and Baskin, D. G.(2000). Central nervous system control of food intake. Nature 404, 661-671.

Schwede, T., Kopp, J., Guex, N. and Peitsch, M. C. (2003). SWISS-MODEL: anautomated protein homology-modeling server.Nucleic Acids Res. 31, 3381-3385.

Spiegelman, B. M. and Flier, J. S. (2001). Obesity and the regulation of energybalance. Cell 104, 531-543.

Stolting, K. N. and Wilson, A. B. (2007). Male pregnancy in seahorses andpipefish: beyond the mammalian model. Bioessays 29, 884-896.

Tamura, K., Dudley, J. Nei, M. and Kumar, S. (2007). MEGA4: MolecularEvolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24,1596-1599.

Tartaglia, L. A. (1997). The leptin receptor. J. Biol. Chem. 272, 6093-6096.Tartaglia, L. A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R.,

Richards, G. J., Campfield, L. A., Clark, F. T., Deeds, J. et al. (1995).Identification and expression cloning of a leptin receptor, OB-R. Cell 83,1263-1271.

Tinoco, A. B., Nisembaum, L. G., Isorna, E., Delgado, M. J. and de Pedro, N.(2012). Leptins and leptin receptor expression in the goldfish (Carassius auratus).Regulation by food intake and fasting/overfeeding conditions. Peptides 34,329-335.

Vincent, A. C. J., Foster, S. J. and Koldewey, H. J. (2011). Conservation andmanagement of seahorses and other Syngnathidae. J. Fish Biol. 78, 1681-1724.

Whittington, C. M., Griffith, O. W., Qi, W., Thompson, M. B. and Wilson, A. B.(2015). Seahorse brood pouch transcriptome reveals common genes associatedwith vertebrate pregnancy. Mol. Biol. Evol. 32, 3114-3131.

Wilson, A. B., Vincent, A., Ahnesjo, I. and Meyer, A. (2001). Male pregnancy inseahorses and pipefishes (family Syngnathidae): rapid diversification of paternalbrood pouch morphology inferred from a molecular phylogeny. J. Hered. 92,159-166.

Wong,M.M. L., Yu, R. M. K., Ng, P. K. S., Law, S. H.W., Tsang, A. K. C. andKong,R. Y. C. (2007). Characterization of a hypoxia-responsive leptin receptor (omLepR(L)) cDNA from the marine medaka (Oryzias melastigma). Mar. Pollut. Bull. 54,797-803.

Zabeau, L., Lavens, D., Peelman, F., Eyckerman, S., Vandekerckhove, J. andTavernier, J. (2003). The ins and outs of leptin receptor activation. FEBS Lett.546, 45-50.

Zhang, H., Chen, H., Zhang, Y., Li, S., Lu, D., Zhang, H., Meng, Z., Liu, X. and Lin,H. (2013). Molecular cloning, characterization and expression profiles of multipleleptin genes and a leptin receptor gene in orange-spotted grouper (Epinepheluscoioides). Gen. Comp. Endocrinol. 181, 295-305.

1515

RESEARCH ARTICLE Biology Open (2016) 5, 1508-1515 doi:10.1242/bio.020750

BiologyOpen

http://dx.doi.org/10.1016/j.aquaculture.2008.02.030http://dx.doi.org/10.1016/j.aquaculture.2008.02.030http://dx.doi.org/10.1016/j.aquaculture.2009.10.015http://dx.doi.org/10.1016/j.aquaculture.2009.10.015http://dx.doi.org/10.1016/j.aquaculture.2009.10.015http://dx.doi.org/10.1111/j.1365-2109.2010.02573.xhttp://dx.doi.org/10.1111/j.1365-2109.2010.02573.xhttp://dx.doi.org/10.1111/j.1365-2109.2010.02573.xhttp://dx.doi.org/10.1242/bio.2012398http://dx.doi.org/10.1242/bio.2012398http://dx.doi.org/10.1242/bio.2012398http://dx.doi.org/10.1006/meth.2001.1262http://dx.doi.org/10.1006/meth.2001.1262http://dx.doi.org/10.1073/pnas.1513212113http://dx.doi.org/10.1073/pnas.1513212113http://dx.doi.org/10.1073/pnas.1513212113http://dx.doi.org/10.1038/nature05026http://dx.doi.org/10.1038/nature05026http://dx.doi.org/10.1038/nature05026http://dx.doi.org/10.1111/j.1439-0264.2009.00951.xhttp://dx.doi.org/10.1111/j.1439-0264.2009.00951.xhttp://dx.doi.org/10.1111/j.1439-0264.2009.00951.xhttp://dx.doi.org/10.1016/j.jembe.2014.09.001http://dx.doi.org/10.1016/j.jembe.2014.09.001http://dx.doi.org/10.1016/j.jembe.2014.09.001http://dx.doi.org/10.1055/s-2007-979871http://dx.doi.org/10.1055/s-2007-979871http://dx.doi.org/10.1055/s-2007-979871http://dx.doi.org/10.1016/j.ygcen.2010.04.010http://dx.doi.org/10.1016/j.ygcen.2010.04.010http://dx.doi.org/10.1016/j.ygcen.2010.04.010http://dx.doi.org/10.1016/j.ygcen.2010.04.010http://dx.doi.org/10.1016/j.ygcen.2010.04.010http://dx.doi.org/10.1159/000023290http://dx.doi.org/10.1159/000023290http://dx.doi.org/10.1159/000023290http://dx.doi.org/10.1159/000023290http://dx.doi.org/10.1159/000023290http://dx.doi.org/10.1093/nar/gkg520http://dx.doi.org/10.1093/nar/gkg520http://dx.doi.org/10.1016/S0092-8674(01)00240-9http://dx.doi.org/10.1016/S0092-8674(01)00240-9http://dx.doi.org/10.1002/bies.20626http://dx.doi.org/10.1002/bies.20626http://dx.doi.org/10.1093/molbev/msm092http://dx.doi.org/10.1093/molbev/msm092http://dx.doi.org/10.1093/molbev/msm092http://dx.doi.org/10.1074/jbc.272.10.6093http://dx.doi.org/10.1016/0092-8674(95)90151-5http://dx.doi.org/10.1016/0092-8674(95)90151-5http://dx.doi.org/10.1016/0092-8674(95)90151-5http://dx.doi.org/10.1016/0092-8674(95)90151-5http://dx.doi.org/10.1016/j.peptides.2012.02.001http://dx.doi.org/10.1016/j.peptides.2012.02.001http://dx.doi.org/10.1016/j.peptides.2012.02.001http://dx.doi.org/10.1016/j.peptides.2012.02.001http://dx.doi.org/10.1111/j.1095-8649.2011.03003.xhttp://dx.doi.org/10.1111/j.1095-8649.2011.03003.xhttp://dx.doi.org/10.1093/molbev/msv177http://dx.doi.org/10.1093/molbev/msv177http://dx.doi.org/10.1093/molbev/msv177http://dx.doi.org/10.1093/jhered/92.2.159http://dx.doi.org/10.1093/jhered/92.2.159http://dx.doi.org/10.1093/jhered/92.2.159http://dx.doi.org/10.1093/jhered/92.2.159http://dx.doi.org/10.1016/j.marpolbul.2007.01.025http://dx.doi.org/10.1016/j.marpolbul.2007.01.025http://dx.doi.org/10.1016/j.marpolbul.2007.01.025http://dx.doi.org/10.1016/j.marpolbul.2007.01.025http://dx.doi.org/10.1016/S0014-5793(03)00440-Xhttp://dx.doi.org/10.1016/S0014-5793(03)00440-Xhttp://dx.doi.org/10.1016/S0014-5793(03)00440-Xhttp://dx.doi.org/10.1016/j.ygcen.2012.09.008http://dx.doi.org/10.1016/j.ygcen.2012.09.008http://dx.doi.org/10.1016/j.ygcen.2012.09.008http://dx.doi.org/10.1016/j.ygcen.2012.09.008