supporting informationoperator, yielding almost identical results both times. these test ﬁelds...

Supporting InformationCowell et al. 10.1073/pnas.1204406109SI Materials and MethodsDNA-FISH.Nalm-6 or Nalm-6TOP2B−/− cells were inoculated at 1 ×105 to 5 × 105 cells/mL into 75 cm2

flasks containing mediumwith etoposide or vehicle alone. After 72 h incubation, cells werecollected by centrifugation, resuspended in PBS, and spottedonto poly-l-lysine–coated slides. Slides were fixed in ice-coldmethanol-acetic acid for 5 min, passed through an ethanol series,air dried, and transferred to acetone for 10 min. After air dryingagain, slides were treated with 100 μg/mL RNase A for 60 min at37 °C, washed and then permeabilized by pepsin treatment[0.01% (vol/vol) pepsin in 10 mM HCl] for 5 min at 37 °C. Afterwashing in PBS, cells were postfixed in 4% (wt/vol) para-formaldehyde in PBS for 5 min at 20 °C. Slides were then passedthrough an ethanol series and air dried before hybridizingovernight using an MLL break-apart DNA-FISH probe (VysisLSI MLL dual color break apart probe; Abbott Molecular).Hybridization and washes were carried out according to thesupplied protocol. Cells were counterstained with DAPI. Mi-croscopy was carried out using an Olympus IX81 motorizedmicroscope fitted with a grid confocal attachment, an Orca-AGcamera (Hamamatsu), and suitable narrow-band filter sets.Several fields of cells were imaged for each slide. Confocal im-ages were collected using a 60 × 0.95 NA objective. Imagecapture and analysis were carried out using Volocity software(Perkin-Elemer). Confocal stacks were compressed into maxi-mum density projections and cells were scored for the presenceof separated red and green signals. Experiments were carried outat least four times and for each experiment at least 200 nucleiwere scored for each treatment. Scoring was carried out by oneoperator for the data shown. Only nonapoptotic cells were scored.Repeat scoring of the same fields yielded very similar results.

RNA-FISH Probe Preparation. Hybridization probes were derivedfrom MLL introns 2, 3, 12, and 25 (using numbering shown inFig. 1 and Fig. S1); AF4 introns 1, 3, and 6; AF9 introns 2, 5, and8; ELL introns 1, 4, and 8; DCP1A introns 1, 3, and 5; andUGCG introns 1, 2, 3, and 4. Probe DNAs were amplified fromBAC clones (MLL RP11-770J1, AF4 CTD-2574C18, AF9 RP11-336O12, ELL RP11-937O22, DCP1A CTD-2545E6, and UGCGRP11-582I20). PCR primers incorporated a T7 polymeraseprimer sequence to permit in vitro transcription for the gener-ation of single-stranded probes where required. Primers usedwere as follows:

PCR products were transcribed in vitro using T7 RNA poly-merase (Transcript Aid kit; Fermentas) according to the manu-facturer’s protocol, to produce a sense-strand RNA. First-strandcDNA was synthesized with random priming essentially as de-scribed by Chakalova et al. (1), but using aminoallyl-dUTP inplace of biotin or digoxigenin-tagged dUTP. Reactive amino-labeled first strand (anti-sense) single-stranded DNA was thenconjugated to Alexa Fluor 488 or Alexa Fluor 555 succinimidylester (Invitrogen). For hybridization, MLL and AF4/AF9/ELL/DCP1A/UGCG probes were combined in hybridization buffer[10% (wt/vol) dextran sulfate, 50% (vol/vol) formamide, 2× SSC,1 mM EDTA, 50 mM sodium phosphate buffer (pH 7.0), 10ng/μL Cot-1 DNA, 0.5 μg/μL tRNA]. A total of 15 μL of probe

MLL_1_1f_T7 GAAATTAATACGACTCACTATAGGCACATACTCCTGGAGGAAATCATC

MLL_I1r1 TTCATACATCTGCACACAAAACTGCCAMLL_2_2f_T7 GAAATTAATACGACTCACTATAGGATG

ACTACCAGTCTACCTTGAATGMLL-I2R2 CTTAGCACTGGCCATTTTGTACGMLL_IVS11_FT7 GAAATTAATACGACTCACTATAGGTGAC

TGTGCTTAGAGTATTGCTTTCMLL_I11r1 AGCTGCTGTAAGAAAATATAATGGCAMLL_IVS24_FT7 GAAATTAATACGACTCACTATAGGATAT

CAGTAAGTAGCACTATAAGMLL_I24r1 GAAAATCATCATAAGGGAGAGGAAF4_IVS1_1FT7 GAAATTAATACGACTCACTATAGGTTCT

GGGTGGAGCTCTGCTGTCTGAF4_IVS1_1r CTTTAAGGATGTCAACACAGAATAC

AF4_IVS1A_FT7 GAAATTAATACGACTCACTATAGGCGAGGTTCGTTTCTGATGGAGTTC

AF4_IVS1_r2 TTGTCAGGCATACTTACATGTGAGAF4_IVS3_FT7 GAAATTAATACGACTCACTATAGGAAGG

ACTTGTTCCCTGTAAATTGAF4r_IVS3_r1 AATGCTAAGTCTGTGCAACATGAGAF4_IVS6_F1T7 GAAATTAATACGACTCACTATAGGGCCC

GACTATATTGCTACAGTATTGAF4_IVS6_r1 TATCACAAAGGACAGCCAAGATTCAF9_IVS2_f3_T7 GAAATTAATACGACTCACTATAGGACTT

GCGATATGGAGCGCCAACAF9_IVS2_r1 CTATCAACACTGGGTGGTCTTCAF9_IVS56_F_T7 GAAATTAATACGACTCACTATAGGTGGA

TCTGGACCCTCACTAACTTGAF9_IVS56_r1 TCAAGCTCTGGAGTGATACATAF9_IVS8_F_T7 GAAATTAATACGACTCACTATAGGAGCT

ATGTCTTGGAGCCGAGAGGAF9_IVS8_r1 ACCGCAAAGGATGAAATGGGAGELL_IVS1_FT17 GAAATTAATACGACTCACTATAGGTGGG

TAATCCCGAGAGTCACAGELL_IVS1_R1 ATGAGGCTTCCTGTGCATATCGELL_IVS1_F2T7 GAAATTAATACGACTCACTATAGGGATG

CGCAGCCCTGTCCATAGAAGELL_IVS1_R2 CTGCAACCTGGGAAGGAATCTGELL_IVS4_F1T7 GAAATTAATACGACTCACTATAGGCTTT

AGTGGGCTGTTAGCTTTGGGELL_IVS4_R1 AAGCCTCAGCCAGAGCCATGTGELL_IVS8_R1 AGCCTGCCAAGAGCAGTTTGAGELL_IVS8_F1T7 GAAATTAATACGACTCACTATAGGCGCA

TGAAGGCAGCCAGAGCTTACDCP1A_IVS1_FT7 GAAATTAATACGACTCACTATAGGTGCC

GCCTGGCCCTGAGGACDCP1AIVS1_R1 CTTCACCATTTGTCGGCAATCCDCP1A_IVS3_FT7 GAAATTAATACGACTCACTATAGGACCA

CACTTTGGAAGCTGTATTTTAAGGDCP1A_IVS3_R1 TTAGGAGGTGTGATAGGACATTTCDCP1A_IVS5_FT7 GAAATTAATACGACTCACTATAGGAAAC

AGATGTGTCTTACAATTTTAAACDCP1A_IVS5_R1 GAGTCTCATTATTACAAGTGCTCATTCUGCG_F1T7 GAAATTAATACGACTCACTATAGGCACT

AAGTAGCAGGCATTTCACUGCG_R1 TACTTGAGGGTAGCTAATATTTAAGGUGCG_F2T7 GAAATTAATACGACTCACTATAGGTGAT

TCATTATCCCTGCCTTTCTCUGCG_R2 GGTTCTGCTGAACCAATTTATCUGCG_F3T7 GAAATTAATACGACTCACTATAGGTTTA

AGTGGGTTGAGGAGAAAGUGCG_R3 TTATGACAGGTTCACTGTTAAGUGCG_R4 CACACCACCCATAGGTATATCAACUGCG_F4T7 GAAATTAATACGACTCACTATAGGGTCC

TATGCTTGAGTTAATCATTC

Cowell et al. www.pnas.org/cgi/content/short/1204406109 1 of 10

www.pnas.org/cgi/content/short/1204406109

mix was used per spot of cells and covered with a 22-mm di-ameter coverslip.

RNA-FISH Hybridization and Microscopy. Cells were collected bycentrifugation, washed in ice-cold PBS, and spotted onto coldpoly-L-lysine–coated slides. Cells were fixed in 4% (wt/vol)paraformaldehyde, 5% (vol/vol) acetic acid, 0.15 M NaCl for 17min at 20 °C before washing in PBS and then equilibrating in 0.1M Tris-HCl pH 7.5; 0.15 M NaCl. Cells were permeabilized bypepsin treatment [0.01% (vol/vol) pepsin in 10 mM HCl] for 5min at 37 °C. After washing in PBS, cells were postfixed in 4%(vol/vol) paraformaldehyde in PBS for 5 min at 20 °C. Slideswere then passed through an ethanol series and air dried beforehybridizing overnight. Hybridization was carried out at 37 °C inhybridization buffer containing 50% (vol/vol) formamide (seeabove) (1). Slides were washed extensively in 2× SSC at 37 °C,dried, and counterstained with DAPI. Images were collected asdescribed for DNA-FISH. For each probe combination, the ex-periments were carried out at least three times and at least 200nuclei were scored for each treatment. Fields of cells were se-lected randomly and all scorable cells (i.e., full included in theimage and not overlapping or exhibiting high background) werescored for each field. Scoring was carried out by a single oper-ator. To check scoring reproducibility, some MLL+AF9 andMLL+UGCG fields were subsequently rescored by the sameoperator, yielding almost identical results both times. These testfields were also scored blindly by a second operator, againyielding very similar results (in both cases for the selected fields,both scorers recorded between 4.7 and 5.3% of cells bearingoverlapping MLL and AF9 signals and 0% MLL and UGCG).

Chromosome Conformation Capture (3C) Analysis.The 3C assay (2, 3)was adapted to verify interaction between break site clusters ofthe MLL and AF-9 genes. KG1 cells were fixed in 2% (vol/vol)formaldehyde for 5 or 10 min at room temperature. Nuclei (106)were digested overnight with 600 units of MfeI. Digested chro-matin (2.5 μg/mL) was ligated with 20,000 cohesive end units ofT4 DNA ligase overnight in 16 °C. DNA (150 ng) was then usedas a template in qPCR reaction. Primer sequences and locationsare shown in Fig S3.

Antibody Validation. Before MLL and AF9 ChIP, we used thesystem reported by Ju et al. (4) to validate our antibodies forChIP. In these studies the authors report estradiol-induced re-cruitment of topoisomerase IIβ to the pS2/TFF1 promoter inMCF7 breast carcinoma cells. As shown in Fig. S4, anti-topoisomerase IIβ (3535) and antitopoisomerase IIα (3116) bothyielded ChIP signals well above the control antibody (anti-GFP)and binding of topoisomerase IIβ was significantly increased byestradiol treatment. ChIP was subsequently performed in KG1cells using these antibodies and with a second topoisomerase IIβantibody (30400).

KG1 ChIP. KG1 cells were cultured to 9 × 105/mL and incubatedwith 100 μM etoposide or vehicle for 1 h. After treatment, cellswere cross-linked with formaldehyde [final concentration 1%(vol/vol)] for 10 min at room temperature and then formal-dehyde was neutralized with glycine. Cells were split intosamples of 2 × 107 cells and lysed sequentially with cell andnuclear lysis buffers provided with the EZ-Magna ChIP kit(Millipore). Chromatin was sonicated using a Bandelin SanoPlus HD70 sonicator in 6 × 15 s cycles at 20% power. The sizerange of the sonicated chromatin fragments was checked on2% agarose gels. Multiple samples treated under the sameconditions were combined to obtain consistent chromatinsamples for the entire experiment.Sonicated chromatin (50 μL) was diluted 10 times with ChIP

dilution buffer and protease inhibitor mixture provided in the kit

and used for immunoprecipitation with IgGs. IgGs were addedto 25 μL of protein-A magnetic beads, provided with the kit andincubated for 30 min at room temperature. Tubes with beads andantibodies were placed on ice and diluted chromatin was added.Incubation was performed for 4.5 h in 4 °C. After immunopre-cipitation, beads were washed with buffers provided with the kit:low salt buffer, high salt buffer, LiCl buffer, and TE buffer. Afterwashing, the beads were suspended in 100 μL of ChIP elutionbuffer containing proteinase K and reverse cross-linking wascarried out for 2 h at 63 °C. ChIP DNA was purified using spincolumns provided with the kit and was finally eluted in 50 μL.ChIP DNAwas used as a template in qPCR. Primers used were

as follows:

All qPCR was performed in a total volume of 25 μL, usinga Bio-Rad MyIQ Single Color Real-Time PCR Detectionsystem. Quantitation of DNA was based on SYBR Green as-say. All primers were designed with Clone Manager 9 softwareand synthesized by VH-Bio. Positive control reactions were per-formed on template obtained from acetylated histone H3 ChIP

mll1forw AGTACAACTCTTTCTCAGGGAGTAGmll1rev GCCAAGTTGATCAGGTGAAATAGGmll3forw TCTCCACAGGAGGATTGTGAAGmll3rev CTACTGGCACAGAGAAAGCAAACCmll4forw TAAGAGTGTGGTTGGATTATGGmll4rev CTCATTGTAAAGGTGGTACATACTGmll5forw TGACCAGTGCTTGATAAACTCTCmll5rev GGTTTATGTCTGCAACTTGTTCTCmll6forw AAGGACGTTCTCGTATTTAACCmll6rev GGAATTATTGGGACAATTGGmll7b forw AAGGACAAACCAGACCTTACmll7b rev CATGCTAAGTGACCTAAGAGmll7forw TGAATCTCCCGCAGTGTCCAATACmll7rev GGCTCACAACAGACTTGGCAATACmll8forw CTGTGGTGCAGTCTGTCACTCmll8rev GCACAGTCATCCTTGGTTTCCmll9forw GTTTATACGGGAAGTGTTAAGGmll9rev CACTTTGGGAAATACTAGCTTAGAGmllPROMforw CAGCCGCCGCGTTATACTGGAAGmllPROMrev TTGAGCGCCGAGAGGCCGATTACAF9 5.1 forw CTTAAGTCCTCCACTTGAGTTGAF9 5.1 rev GAGAGCACGTGTGCATAATTCAF9 5.2 forw CAAGAATGTCTGGGTCACTTGAF9 5.2 rev TCTCATGTTGGTCTGGGTATTGAF9 5.3 forw GCCTCCTTCTCAATCTTGTTCAF9 5.3 rev TCCTGGAGGATAAACAGGTAGAF9 1.1 forw TTTCTGCTCCTCACCAACACATCAF9 1.1 rev GCTGGCAGCTATTAACTACACCTACAF9 1.2 forw GGTGAGAGGGATGGAACAAGAF9 1.2 rev TGCTGAAGTCAGAGGAGAAGAF9 1.3 forw GGAGTCATGGTGCCTGTTTAAAGAF9 1.3 rev ACTCACCCATTCACTCCAGTTAGAF9 1.4 forw TATAAGCAGCAGCATTCCTCAF9 1.4 rev GAAGTCCCTCTATCTTAGTGAF9 1.6 forw AATGCCTGGATCTCCACTATCAACAF9 1.6 rev GAATCTCACACTTTGGTGGACAACAF9 2.1 forw GCTTAAGTGATGGCAGCGATAGTGAF9 2.1 rev TAAGGGTGGTGGAGGTTCGTGATGTAGAF9 2.2 forw CTAGGCAGAACTTTGAAGGCTATGAF9 2.2 rev CAAAGACCACGGATTTAAGGGCAAGACAF9 2.5 forw GGCCTTCTGTGCTGTAGCACTTACGAF9 2.5 rev ATCATATCCCGCTGCCTCCCACGATCCAF9 2.6 forw CCCACCAAAGCTTCTATACAF9 2.6 rev TCTGCTGTTTCAGCATGACTACAF9 int forw AGGGCATGTGGTCACTGTAGTTTCGAF9 int rev CACAGCCCAACCAAACCATATGCATC



with primers for the GAPDH gene supplied with the ChIP kit.All PCR reactions were performed in triplicate. Standard curveswere included in every plate to ensure that ChIP DNA and inputsample dilutions were within the linear range.Note, during the execution of these experiments, the properties

of the supplied protein-A magnetic beads changed. The datashown in Figs. S4 and S5 were obtained using a different batch ofprotein-A magnetic beads than the data shown in Fig. 4, resultingin differences in absolute recovery efficiencies between these setsof data. For this reason we were unable to combine the data inFig. S4 and Fig. 4.Data were analyzed by the ΔCt method. Quantity of DNA

fragments recovered in the ChIP fraction was presented aspercent of input calculated by the following formula:% input = 100/2[SAMPLE Ct − (INPUT Ct − Log2INPUT dilution fold)].

Preparation of Chromatin for Paired-End Library Construction andIllumina Sequencing. Control and etoposide-treated (100 μM,1 h) KG1 (9 × 105) cells were washed with PBS containingprotease inhibitors, counted, and split into samples of 107 cellseach. Each sample was lysed with cell and nuclear lysis buffersprovided with the EZ-Magna ChIP A kit (Millipore). Chromatinwas sonicated using a Bandelin Sano Plus HD70 sonicator in five10-s cycles at 20% power, resulting in fragmentation to an av-erage size of 500 bp. After sonication and centrifugation, sam-ples were combined into control and etoposide-treated pools.For each immunoprecipitation, sonicated chromatin (50 μL)from each pool was diluted 10 times and immunoprecipitatedwith the following antibodies:

Incubation was performed for 16 h in 4 °C.After immunoprecipitation, beads were washed with buffers

provided with the kit: Low salt buffer, high salt buffer, LiCl buffer,and TE buffer. After washing, the beads were suspended in100 μL of ChIP elution buffer containing proteinase K.To obtain “input” DNA, 2.5 μL (5%) of sonicated chromatin

was diluted in 100 μL of ChIP elution buffer containing pro-teinase K.After 3 h reverse cross-linking (proteinase K, 63 °C + 10 min

in 90 °C), ChIP DNA was purified using spin columns. ChIPDNA was eluted with 60 μL of TE buffer. To release DNA 5′ends that may be blocked for ligation by topoisomerase-de-rived 5′-phosphotyrosyl residues that will remain after pro-teinase K digestion, eluted DNA was treated with 8 μL (1.12μg) of the 5′-tyrosyl DNA phosphodiesterase TTRAP/TDP2protein (Abnova) for 40 min in 37 °C. DNA was subsequentlydigested with type I restriction enzyme BsmAI (5′-GTCTC(N)1/3′-CAGAG(N)5) to optimize for library construction.Finally, samples were heat deactivated in 80 °C for 10 min andDNA was purified using spin columns. Samples were elutedwith TE buffer to final volume of 60 μL and were forwarded toSource Bioscience (Nottingham) for library construction andIllumina sequencing. In subsequent analysis of sequence datafor topoisomerase cleavage sites, paired-end sequence endscontaining the BsmAI sites were ignored.

RNA Polymerase Immunofluorescence. KG1 cells were spread inPBS on poly-L-lysine–coated coverslips, briefly extracted in CSKbuffer [100 mM NaCl, 300 mM sucrose, 3 mM mgCl2, 10 mMPipes pH 6.8, 0.5% (vol/vol) Triton X-100] on ice and fixed in4% paraformaldehyde in PBS at room temperature. Immuno-fluorescent staining was carried out as described previously (5)using anti-RNA polymerase II CTD-4H8 (Abcam) and anti-mouse Alexa 488 second antibody (Invitrogen). Image captureand processing (iterative restoration) was carried out using Vo-locity software (Perkin-Elmer).

1. Chakalova L, Carter D, Fraser P (2004) RNA fluorescence in situ hybridization taggingand recovery of associated proteins to analyze in vivo chromatin interactions.MethodsEnzymol 375:479–493.

2. Dekker J, Rippe K, Dekker M, Kleckner N (2002) Capturing chromosome confor-mation. Science 295:1306–1311.

3. Osborne CS, et al. (2004) Active genes dynamically colocalize to shared sites of ongoingtranscription. Nat Genet 36:1065–1071.

4. Ju BG, et al. (2006) A topoisomerase IIbeta-mediated dsDNA break required forregulated transcription. Science 312:1798–1802.

5. Cowell IG, Papageorgiou N, Padget K, Watters GP, Austin CA (2011) Histonedeacetylase inhibition redistributes topoisomerase IIβ from heterochromatin toeuchromatin. Nucleus 2:61–71.

3116 (TOP2a) 2 μL (5 μg) (3 IPs)3535 (TOP2b) 2 μL (4 μg) (3 IPs)GFP (negative control) 5 μL (1 μg) (3 IPs)AcH3 (positive control) 5 μL (according to kit

protocol)(2 IPs)



Fig. S1. MLL locus showing various relevant features. (A) Genomic organization (cyan boxes, exons), showing breakpoint cluster region (black rectangle).Beneath the genomic organization diagram is shown corresponding Open Chromatin (DNase-seq F-seq density, ENCODE Open Chromatin Duke DNase tracks)derived from GM12878 (EBV-immortalized human lymphoblastoid cell line), K562 (human chronic myelogenous leukemia cell line), HeLa (human cervicalcarcinoma cell line), and HepG2 (human hepatocellular carcinoma cell line) cells and CTCF occupancy data from the ENCODE project. Data were accessed via theUniversity of California Santa Cruz (UCSC) genome browser (http://genome.ucsc.edu/) (1–3). The DNaseI HS peak within the BCR corresponds to a previouslymapped DNase hypersensitive region (4–6). (B) Enlarged segment of the MLL locus encompassing the breakpoint region. Colored symbols represent sequencedder (6) patient-derived breakpoints (7–14). Black triangles, primers used for ChIP Q-PCR. Black rectangles correspond to region of DNaseI hypersensitivity andCTCF occupancy derived from ENCODE data (see above).

1. Dreszer TR, et al. (2012) The UCSC Genome Browser database: extensions and updates 2011. Nucleic Acids Res 40(Database issue):D918–D923.2. Rosenbloom KR, et al. (2012) ENCODE whole-genome data in the UCSC Genome Browser: Update 2012. Nucleic Acids Res 40(Database issue):D912–D917.3. Celniker SE, et al.; modENCODE Consortium (2009) Unlocking the secrets of the genome. Nature 459:927–930.4. Stanulla M, Wang J, Chervinsky DS, Thandla S, Aplan PD (1997) DNA cleavage within the MLL breakpoint cluster region is a specific event which occurs as part of higher-order

chromatin fragmentation during the initial stages of apoptosis. Mol Cell Biol 17:4070–4079.5. Strissel PL, Strick R, Rowley JD, Zeleznik-Le NJ (1998) An in vivo topoisomerase II cleavage site and a DNase I hypersensitive site colocalize near exon 9 in the MLL breakpoint cluster

region. Blood 92:3793–3803.6. Strissel PL, et al. (2000) DNA structural properties of AF9 are similar to MLL and could act as recombination hot spots resulting inMLL/AF9 translocations and leukemogenesis.HumMol Genet

9:1671–1679.7. Atlas M, et al. (1998) Cloning and sequence analysis of four t(9;11) therapy-related leukemia breakpoints. Leukemia 12:1895–1902.8. Gu Y, et al. (1994) Sequence analysis of the breakpoint cluster region in the ALL-1 gene involved in acute leukemia. Cancer Res 54:2327–2330.9. Langer T, et al. (2003) Analysis of t(9;11) chromosomal breakpoint sequences in childhood acute leukemia: Almost identical MLL breakpoints in therapy-related AML after treatment

without etoposides. Genes Chromosomes Cancer 36:393–401.10. Libura J, Slater DJ, Felix CA, Richardson C (2005) Therapy-related acute myeloid leukemia-like MLL rearrangements are induced by etoposide in primary human CD34+ cells and remain

stable after clonal expansion. Blood 105:2124–2131.11. Raffini LJ, et al. (2002) Panhandle and reverse-panhandle PCR enable cloning of der(11) and der(other) genomic breakpoint junctions of MLL translocations and identify complex

translocation of MLL, AF-4, and CDK6. Proc Natl Acad Sci USA 99:4568–4573.12. Reichel M, et al. (2001) Biased distribution of chromosomal breakpoints involving the MLL gene in infants versus children and adults with t(4;11) ALL. Oncogene 20:2900–2907.13. Reichel M, et al. (1998) Fine structure of translocation breakpoints in leukemic blasts with chromosomal translocation t(4;11): The DNA damage-repair model of translocation.

Oncogene 17:3035–3044.14. Whitmarsh RJ, et al. (2003) Reciprocal DNA topoisomerase II cleavage events at 5′-TATTA-3′ sequences in MLL and AF-9 create homologous single-stranded overhangs that anneal to

form der(11) and der(9) genomic breakpoint junctions in treatment-related AML without further processing. Oncogene 22:8448–8459.


http://genome.ucsc.edu/


Fig. S2. DNase I hypersensitivity and CTCF binding across the MLL, AF4, and AF9 loci. Scale bars are shown, breakpoint cluster regions are indicated by thehorizontal bars beneath the gene intron–exon diagrams. Note, AF9 is truncated at the 5′ end, the first exon shown is exon 3. Data are from the ENCODE openchromatin tracks (1) accessed via the UCSC Genome bioinformatics suite (2–4). Duke DNase-seq F-Seq density signal (Duke University Institute for GenomeSciences and Policy) and UT ChIP-seq F-Seq density signal (University of Texas at Austin).

1. Chakalova L, Carter D, Fraser P (2004) RNA fluorescence in situ hybridization tagging and recovery of associated proteins to analyze in vivo chromatin interactions. Methods Enzymol375:479–493.

2. Dreszer TR, et al. (2012) The UCSC Genome Browser database: Extensions and updates 2011. Nucleic Acids Res 40(Database issue):D918–D923.3. Rosenbloom KR, et al. (2012) ENCODE whole-genome data in the UCSC Genome Browser: Update 2012. Nucleic Acids Res 40(Database issue):D912–D917.4. Celniker SE, et al.; modENCODE Consortium (2009) Unlocking the secrets of the genome. Nature 459:927–930.



Fig. S3. The 3C assay. The 3C assay (2, 3) was used to examine interactions between break site clusters of MLL and AF-9 genes compared with MLL anda control gene UGCG. KG1 cells were fixed in 2% formaldehyde for 5 or 10 min at room temperature. A total of 106 nuclei were digested overnight with 600units of MfeI (NEB). Digested chromatin (150 ng, 250 μg/mL) was ligated with 20,000 cohesive end units of T4 DNA ligase overnight at 16 °C DNA. Ligationproducts were then quantified by qPCR. (A–C) Map positions of 3C primers. (D) DNA sequences of primers used. (E) Combinations of primers used for qPCRreations (key for gel in F). (F) Representative gel of qPCR reations after 10 min of cross-linking using 2% paraformaldehyde. Test tracks are in the Top Left;remaining panels are negative controls.

Fig. S4. TFF1/pS2 topoisomerase II ChIP. To confirm that our antitopoisomerase IIα and -IIβ antibodies were suitable for ChIP analysis we tested their ability toreplicate the previously reported estradiol-induced increase in topoisomerase II binding at pS2 promoter (1, 2). Chromatin was immunoprecipitated withtopoisomerase IIα (3116α) or topoisomerase IIβ (3535β)-specific antibodies (IgGs) or negative control anti-GFP antibody or positive control antibody (AcH3).Real-time PCR was performed using the primers shown as triangles at the Bottom of the diagram. Figures are expressed as percentage of input recovered. TheLower part of the figure shows salient features of the pS2 promoter. Statistical significance was determined using an unpaired, two-tailed t test.

1. Ju BG, et al. (2006) A topoisomerase IIbeta-mediated dsDNA break required for regulated transcription. Science 312:1798–1802.2. Perillo B, et al. (2008) DNA oxidation as triggered by H3K9me2 demethylation drives estrogen-induced gene expression. Science 319:202–206.



Fig. S5. MLL topoisomerase II ChIP analysis. Cross-linked chromatin was isolated from untreated KG1 cells (Con) or from KG1 cells treated with 100 μMetoposide (Etop) for 1 h. Chromatin was fragmented to an average of 500 bp by sonication, before immunoprecipitation with topoisomerase IIα (3116α),topoisomerase IIβ (30400β or 3535β)-specific antibodies (IgG), or control anti-GFP antibody (IgG). Real-time PCR was performed using the primers indicated andshown in the Upper part of the diagram as black triangles. “Prom” refers to a promoter-derived promoter pair. Data are expressed as percentage of inputrecovered. The ratio of the values for control and etoposide-treated cells is given as the fold increase. The colored symbols in the Upper part of the diagramcorrespond to patient-derived breakpoints; see Fig S1 for key.

Fig. S6. AF9 topoisomerase II ChIP analysis. Legend as for Fig. S4 except colored symbols indicate sequenced AF4 patient-derived breakpoint; int, primer pairin intron 11 (outside of the BCRs).



Fig. S7. Topoisomerase IIα and -IIβ in-cell cleavage across the MLL BCR. Upper part, MLL gene and BCR region with published mapped and sequenced MLLder11 break points derived from acute leukemia patient samples harboringMLL–AF4 and MLL–AF9 translocations. Breakpoints are classified as therapy related(diamonds), neonatal (presentation at <1 y, triangles), or de novo (presentation at >1 y, pentagons); colors refer to sources of data (1–8) (see Fig. S1 for key).PCR primers used in Fig. 5 are also shown (as black triangles) for orientation. Lower part, in-cell cleavage analysis for topoisomerase IIα and -IIβ across the MLLBCR. Illumina read ends are aligned to the Upper part of the diagram. Letters A–H highlight clusters of cleavage sites or translocation sites. Cells were treatedwith etoposide or vehicle alone and sonicated chromatin was collected without cross-linking. Topoisomerase II–DNA covalent complexes were immunopurifiedand DNA recovered from these complexes was subject to Illumina paired-end sequencing. The positions of the resulting read ends are shown as arrows (seeMaterials and Methods for more experimental details). Where the first base of a read end is within 10 bp of an MLL leukemia breakpoint the arrow is coloredred and where it is between 11 and 20 bp it is colored blue. The read end highlighted with an asterisk corresponds to the breakpoint hotspot shown as “I”. Theread ends and their alignment to MLL leukemia breakpoints are shown in Fig. S8.

1. Atlas M, et al. (1998) Cloning and sequence analysis of four t(9;11) therapy-related leukemia breakpoints. Leukemia 12:1895–1902.2. Gu Y, et al. (1994) Sequence analysis of the breakpoint cluster region in the ALL-1 gene involved in acute leukemia. Cancer Res 54:2327–2330.3. Langer T, et al. (2003) Analysis of t(9;11) chromosomal breakpoint sequences in childhood acute leukemia: Almost identical MLL breakpoints in therapy-related AML after treatment

without etoposides. Genes Chromosomes Cancer 36:393–401.4. Libura J, Slater DJ, Felix CA, Richardson C (2005) Therapy-related acute myeloid leukemia-like MLL rearrangements are induced by etoposide in primary human CD34+ cells and remain

stable after clonal expansion. Blood 105:2124–2131.5. Raffini LJ, et al. (2002) Panhandle and reverse-panhandle PCR enable cloning of der(11) and der(other) genomic breakpoint junctions of MLL translocations and identify complex

translocation of MLL, AF-4, and CDK6. Proc Natl Acad Sci USA 99:4568–4573.6. Reichel M, et al. (2001) Biased distribution of chromosomal breakpoints involving the MLL gene in infants versus children and adults with t(4;11) ALL. Oncogene 20:2900–2907.7. Reichel M, et al. (1998) Fine structure of translocation breakpoints in leukemic blasts with chromosomal translocation t(4;11): The DNA damage-repair model of translocation.

Oncogene 17:3035–3044.8. Whitmarsh RJ, et al. (2003) Reciprocal DNA topoisomerase II cleavage events at 5′-TATTA-3′ sequences in MLL and AF-9 create homologous single-stranded overhangs that anneal to

form der(11) and der(9) genomic breakpoint junctions in treatment-related AML without further processing. Oncogene 22:8448–8459.



Fig. S8. Comparison of in-cell cleavage sites and patient-derived translocation break sites. Illumina sequence read ends are shown in red (10 or fewer basepairs from a translocation breakpoint) or blue (11–20 bp from a translocation breakpoint). Patient-derived MLL translocation breakpoints are shown below inblack and identified by publication and origin [tAML, Inf (infant), Ad (adult) or by age at presentation]. The topoisomerase II break sites identified by Miraultet al. (1) are shown (in purple). Sequences containing an ATTA or ATTT motif are boxed and the sequence shown beneath the boxes (cATTAt or its reversecomplement) is the etoposide-induced cleavage site identified in the TFF1/pS2 promoter (2). This cleavage site sequence is also shown in the Inset. The ATTAmotif is not present at all sites of cleavage nor at all of the t-AML–associated translocation sites, but two other topoisomerase IIβ in-cell cleavage sites that mapwithin 10 bp of a patient-derived breakpoint also terminate adjacent to an ATTA or ATTT motif (in cluster D and A, respectively, and Fig. S6). Similarly, one ofthe topoisomerase IIα read ends maps to the cluster of three neonatal AML breakpoints marked as H in Fig. S7. One of these breakpoints terminates 2 bp fromthe end of the read end and is centered on a sequence differing in only 1 bp from the ATTA motif (ATTT) (RE_21_a+VP; Fig. S7).



Fig. S9. Focal distribution of RNA polymerase II in KG1 nuclei. KG1 cells grown under normal conditions were immunostained with MAB CTD-4H8, whichspecifically detects initiating/elongating RNA polymerase II in which the CTD heptad repeat is phosphorylated at Ser5. Grid confocal images were collected witha z spacing of 0.15 μm. Confocal images were deconvolved and focal immunofluorescence signals were counted manually from sections of each of three nucleidisplayed as maximum intensity projections.

1. Mirault ME, Boucher P, Tremblay A (2006) Nucleotide-resolution mapping of topoisomerase-mediated and apoptotic DNA strand scissions at or near an MLL translocation hotspot. Am JHum Genet 79:779–791.

2. Ju BG, et al. (2006) A topoisomerase IIbeta-mediated dsDNA break required for regulated transcription. Science 312:1798–1802.



supporting informationoperator, yielding almost identical results both times. these test ﬁelds...

Documents