successfully challenging the admissibility of mitochondrial dna evidence 2004 nlada annual...
TRANSCRIPT
![Page 1: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/1.jpg)
Successfully Challenging the Successfully Challenging the Admissibility of Mitochondrial Admissibility of Mitochondrial
DNA EvidenceDNA Evidence
2004 NLADA Annual ConferenceDecember 3, 2004
Amit MehtaEdward Ungvarsky
Public Defender Service for the District of Columbia
![Page 2: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/2.jpg)
The Big PictureThe Big Picture
What makes using mtDNA to identify a suspect in a criminal case problematic?
o mtDNA is NOT a unique identifiero Frequency of mtDNA is NOT knowno Evidentiary value of mtDNA is NOT known
![Page 3: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/3.jpg)
OverviewOverviewLaw of admissibilityWhat is mtDNA?Our case experience
![Page 4: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/4.jpg)
Standards of Admissibility of Standards of Admissibility of Expert TestimonyExpert Testimony
1. Frye v. United States, 293 F. 1013 (D.C. Cir. 1923).
2. Daubert v. Merrell Dow Pharm., 509 US. 579 (1993)
![Page 5: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/5.jpg)
FryeFrye Three requirements
1. Subject matter must be distinctively related to some science, profession, business, or occupation as to be beyond the ken of the average layperson.
2. Witness must have sufficient skill, knowledge, or experience in that field as to aid factfinder.
3. State of the art/knowledge must permit expert to assert a reasonable opinion to be admissible.
![Page 6: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/6.jpg)
FryeFrye Technique must be generally accepted in the
relevant scientific community Consensus versus controversy over a particular
technique, not its validity If scientists significant either in number or
expertise oppose new technique as unreliable, then it does not pass muster under Frye.
Reliability matters, but court should NOT try to determine which view is valid, but whether or not there is a controversy
![Page 7: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/7.jpg)
DaubertDaubert
The four Daubert criteria for evaluating the admissibility of expert testimony are:
1. Whether the methods upon which the testimony is based are centered upon a testable hypothesis;
2. The known or potential rate of error associated with the method;
3. Whether the method has been subject to peer review; and
4. Whether the method is generally accepted in the relevant scientific community.
Judge performs a “gatekeeping” function
![Page 8: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/8.jpg)
What is mitochondrial DNA?What is mitochondrial DNA?
How is mtDNA different than How is mtDNA different than nuclear DNA?nuclear DNA?
![Page 9: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/9.jpg)
Nuclear DNANuclear DNA
• DNA in Nucleus of Cell
• 23 Pairs of Chromosomes
• 1 set of 23 from Mother, 1 set of 23 from Father
![Page 10: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/10.jpg)
What is mtDNA?What is mtDNA? Energy producing cytoplasmic organellesEnergy producing cytoplasmic organelles
![Page 11: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/11.jpg)
Maternally InheritedMaternally Inherited
![Page 12: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/12.jpg)
Maternally InheritedMaternally Inherited= Same mtDNA = Female = Male
![Page 13: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/13.jpg)
Mutation/Heteroplasmy (Change)Mutation/Heteroplasmy (Change)
A change in the number, arrangement, or molecular sequence of a gene
For Example: TAGCTACCCCCACGTTAAGATGGGCC TAGCTACCCCCATGTTAAGATGGGCC Mutation can occur between people over
generations Mutation can occur within a person
– Person can have different mtDNA sequences– Called heteroplasmy
![Page 14: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/14.jpg)
What is the What is the inclusion/exclusion power of inclusion/exclusion power of
mtDNA?mtDNA?NOT a unique identifierMaternal relatives have the SAME mtDNANon-maternal relatives have DIFFERENT
mtDNATherefore can be used to exclude large
groups of people
![Page 15: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/15.jpg)
Advantages of mtDNAAdvantages of mtDNA
There are many copies of mitochondria in a cell (as compared to 1 nuclear DNA copy)
It is therefore useful when analyzing old or difficult samples (such as bone, hair without roots, and degraded skin or semen), as the higher number of mtDNA copies corresponds to a higher chance of finding mtDNA than nuclear DNA
![Page 16: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/16.jpg)
When has mtDNA been used?When has mtDNA been used?
1. Mass disasters (9-11)
2. Unknown soldiers / grave sites
3. Ancestry Verification
4. Studying human migration patterns
5. Medical studies
6. Criminal cases/forensic use
![Page 17: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/17.jpg)
mtDNA in Criminal CasesmtDNA in Criminal Cases
No universe of known samples (in most cases) Process:
1. Crime Scene sample mtDNA sequence determined
2. Suspect mtDNA sequence determined
3. Report an inclusion, exclusion, or inconclusive
4. If an inclusion (often inaccurately referred to by the prosecution as a “match”), used as corroborative evidence of identity
![Page 18: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/18.jpg)
What does “potentially What does “potentially included” mean?included” mean?
This question is what our admissibility hearing was about
When a “match” is reported, it potentially inculpates everyone in that specific maternal line
Degree of that inclusion affects relevance and weight of the evidence
Most courts only permit introduction of DNA evidence (nuclear or mtDNA) accompanied by some statistical explanation
![Page 19: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/19.jpg)
FBI DatabaseFBI Database Scientific Working Group on DNA Analysis
Methods (SWGDAM) Database divided into 14 racial categories (e.g.
African-American, Native American, Egyptian) These racial sub-databases have wildly different
numbers of profiles Profiles come from “convenience” samples from a
few specific locations
![Page 20: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/20.jpg)
Race Number 11/04African-Americans 1148
Apaches 180
Caucasians 1814
China/Taiwan 356
Egyptians 48
Guam 87
Hispanics 759
India 19
Japanese 163
Koreans 182
Navajos 146
Pakistan 8
Sierra Leone 109
Thai 52TOTAL 5071
![Page 21: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/21.jpg)
The “Counting Method” The “Counting Method” (The prosecution’s statistical (The prosecution’s statistical
mtDNA methodology)mtDNA methodology) Compare suspect sequence to SWGDAM database Report number of times the sequence is in the
database Report the number of profiles the sequence was
compared against Generate frequency statistic Put confidence interval around frequency statistic Report upper and lower confidence interval There is criticism of this approach
![Page 22: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/22.jpg)
Who is Publicly Commenting Who is Publicly Commenting on mtDNA?on mtDNA?
In September, American Association of Anthropologists held a conference on race and identity
In October, Johns Hopkins held a conference on race and genetics
In November, Nature Genetics published a special supplement on race and genetics
Lawyers and scientists in courtrooms across the country
![Page 23: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/23.jpg)
Potential Attacks on Potential Attacks on Prosecution’s Statistical Prosecution’s Statistical
EvidenceEvidence
1. The prosecution undercounts matches in its database
a) There are errors in the database
b) Heteroplasmy – inconsistent interpretations
c) Ignoring Useful, Observed, Relevant Information
![Page 24: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/24.jpg)
Potential Attacks (cont)Potential Attacks (cont)
2. The database is not representative of the relevant population: Database does not take into account migration patterns or regional differences
![Page 25: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/25.jpg)
Database ErrorsDatabase Errors
Transcription errors – 58% of published mtDNA sequences contained errors of some kind (Peter Forster, To Err is Human, 67 Annals of Human Genetics 2,3 (2003))
SWGDAM found to contain errors Only a small portion of the sequences have
had their accuracy manually verified Machine errors – 1% base-calling error rate
in its sequencing process
![Page 26: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/26.jpg)
HETEROPLASMYHETEROPLASMY
A one-base pair difference is not a match for database purposes but is sometimes treated as a match when deciding whether defendant is included as potential contributor
![Page 27: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/27.jpg)
FBI Heteroplasmy AnalysisFBI Heteroplasmy Analysisin Determining Inclusion in Determining Inclusion
Crime Scene Sample: TAGCTACCCCCACGTTAAGATGGGCC Suspect Sample: TAGCTACCCCCATGTTAAGATGGGCC When comparing a crime scene sample with a
suspect sample as above, under certain circumstances, the FBI will call the suspect as included as a potential contributor, despite the one-base pair of heteroplasmy present.
![Page 28: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/28.jpg)
FBI Heteroplasmy AnalysisFBI Heteroplasmy Analysisin Database Comparisonin Database Comparison
Database Sequence: TAGCTACCCCCACGTTAAGATGGGCC Suspect Sample: TAGCTACCCCCATGTTAAGATGGGCC When comparing the suspect sample with the database
sequences to determine the number of “matches” in the relevant database, the FBI will NEVER treat the above two sequences as a match.
This affects the resulting statistics in a way that does not benefit the suspect.
![Page 29: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/29.jpg)
(Under)counting Methods (Under)counting Methods
FBI does not count the suspect sample in number of matches
FBI does not count the evidence sample in number of matches
![Page 30: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/30.jpg)
The database is not The database is not representativerepresentative
![Page 31: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/31.jpg)
mtDNA DiversitymtDNA Diversity
The FBI assumes mtDNA sequences are homogenous within racial groups
Genetic anthropologists disagreeGreat variety between and within racial
groupsMust understand migration patterns and
geography of samples
![Page 32: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/32.jpg)
mtDNA DiversitymtDNA Diversity
Many studies have been published that correlate mtDNA genetic variability with geography and immigration history
Different geographic regions demonstrate strikingly different mtDNA patterns (including within racial groups)
![Page 33: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/33.jpg)
Representative list of articlesRepresentative list of articles1. Yong-Gang Yao et al., Phylogeograhic Differentiation of
Mitochondrial DNA in Han Chinese, 70 Am. J. Hum. Genet. 635-649 (2002);
2. Salas, Antonio, et al., The African Diaspora: Mitochondrial DNA and the Atlantic Slave Trade, 74 Am. J. Hum. Genet. 454-465 (2004);
3. Forster et al., Continental and Subcontinental Distributions of mtDNA Control Region Types, 116 Int. J. Legal Med. 99-108 (2002);
4. Pereira et al., Prehistoric and Historic Traces in the mtDNA of Mozambique: Insights into the Bantu Expansions and the Slave Trade, 65 Am. Hum. Genet., 439-458 (2001);
5. Rando et al., Phylogeographic Patterns of mtDNA Reflecting the Colonization of the Canary Islands, 63 Am. Hum. Genet., 413- 428 (1999).
![Page 34: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/34.jpg)
![Page 35: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/35.jpg)
mtDNA, inherited maternally, consists of European haplogroups H, I, J, K, T, U, V, W and X; Asian haplogroups A, B, C, D, F, G, M and Z; and African haplogroups L1, L2 and L3. Asian- and African-specific lineages exist at very low frequencies throughout Europe.
![Page 36: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/36.jpg)
![Page 37: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/37.jpg)
FBI ViewFBI View
mtDNA sequences in North America demonstrate little to no diversity
The types of mtDNA sequences and their frequencies do not vary significantly across the country
A sequence derived from a sample collected in D.C. need not be compared against a database of D.C. sequences
![Page 38: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/38.jpg)
Documented Regional Documented Regional DifferencesDifferences
Regional mtDNA differences in North America have been documented in scientific research
1. Parra & Marcini et al., Estimating African American Admixture Proportions by Use of Populations-Specific Alleles, Am. J. Hun. Genet. 63: 1839-1851 (1998);
2. Parra & Kittles et al., Ancestral Proportions and Admixture Dynamics in Geographically Defined African Americans Living in South Carolina Am. J. Phys. Anthropol. 114:18-29 (2001).
![Page 39: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/39.jpg)
Parra & Marcini et al.Parra & Marcini et al.
Study of the amount of African American mtDNA of European derivation in 8 American cities and Jamaica– Charleston 6.46%– Baltimore 14.94%– New York 9.11%– Houston 6.8%– Jamaica 12.93%– Philadelphia – 1 11.02%– Philadelphia – 2 2.84%
![Page 40: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/40.jpg)
Parra & Kittles et al.Parra & Kittles et al. Charleston, South Carolina one of the most important
ports in the slave trade from West and Central Africa Extent of European admixture was estimated in six
different samples from South Carolina – – Gullah 3.5% – Low Country
Berkeley 10.9% Charleston 9.9% Colleton 13.6% Dorchester 14.0%
– Columbia 17.7%
![Page 41: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/41.jpg)
African-American Migration African-American Migration PatternsPatterns
Dr. Rick Kittles, a geneticist at Ohio State University: The slave trade in the USA brought about significant regional differences in the ethnic and geographic ancestry of African Americans
Different regions in the USA imported slaves from different regions in Africa
Grain Coast Africa (Sierra Leone, Liberia, Senegambia) South Carolina
Angola Louisiana Gold Coast Africa (Ghana) Bristow & Richmond Region
(VA)
![Page 42: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/42.jpg)
![Page 43: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/43.jpg)
![Page 44: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/44.jpg)
African-American DatabaseAfrican-American Database This led to geographic clusters of mtDNA
sequences among the African-American population These geographic clusters still exist today Why? Because there are consistent migration
patterns in the USA– South Carolina Philadelphia, New York City– Louisiana Detroit, Chicago, Cleveland (up
Mississippi River) The FBI database does not account for this
geographic diversity
![Page 45: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/45.jpg)
FBI Native American FBI Native American DatabaseDatabase
326 profiles in the database Dr. Frederika Kaestle, a genetic anthropologist at
Indiana University, analyzed the database in relation to the extensive research she has conducted on the mtDNA diversity of Native Americans
Her analysis showed that entire groups of common sequences were not represented in the database, and that the ones that were represented had significantly different percentages than the percentages found in anthropological databases
![Page 46: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/46.jpg)
FBI Native American FBI Native American DatabaseDatabase
Dr. Kaestle concluded that the FBI Native American database was not representative of the mtDNA diversity of Native American people
![Page 47: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/47.jpg)
![Page 48: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/48.jpg)
ConclusionsConclusions
Kittles and Kaestle – Need regional databases– If crime scene sample comes from DC, need a
database that consists of DC samplesScholars who study other minority groups
agree Scholars who study mtDNA in general
agree
![Page 49: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/49.jpg)
Our case - U.S. v. Ida ChaseOur case - U.S. v. Ida Chase
mtDNA Admissibility Hearing July 15-22, 2004
The judge ruled mtDNA was admissibleThe judge has not as yet given a reason for
her decision
![Page 50: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/50.jpg)
Lessons LearnedLessons Learned
Need to pursue experts outside of the scientists used by law enforcement and even by other defenders
Excite people to work with you Think creatively Change the conversation, do not just challenge the
underlying science, here, challenge the concept of identity as defined in the database
![Page 51: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/51.jpg)
Fundamental QuestionsFundamental Questions
1. Human genomic variation ask questions about race, ethnicity, ancestry – and individual identification
2. If we do not discuss human genomic variation, we miss the emerging study of:
– Who are we– Where do we come from
![Page 52: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/52.jpg)
Fundamental QuestionsFundamental Questions
3. FBI / state crime labs/prosecution ignore these questions when using mtDNA evidence to “solve” crimes
4. Our goal in litigation and today: To ensure that science is not abused in court to detriment of persons accused of crimes and facing loss of liberty
![Page 53: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/53.jpg)
“[S]cientists [and defense lawyers] are faced with this situation in genomics, where existing biological models or paradigms of ‘racial’ and ‘ethnic’ categorizations cannot accommodate the uniqueness of the individual and universality of human kind that is evident in new knowledge emerging from human genome sequenced variation research and molecular anthropological research.”
Royal, C.D.M. & Dunston, G.M. Changing the paradigm from ‘race’ to human genome variation, 36 Nature Genetics Supplement 11 (Nov. 2004).
![Page 54: Successfully Challenging the Admissibility of Mitochondrial DNA Evidence 2004 NLADA Annual Conference December 3, 2004 Amit Mehta Edward Ungvarsky Public](https://reader035.vdocuments.us/reader035/viewer/2022062714/56649d025503460f949d55d9/html5/thumbnails/54.jpg)
Questions?Questions?