sars-cov-2 variants of concern, gamma (p.1) and delta (b ......2021/07/14 · following the alpha...
TRANSCRIPT
1
SARS-CoV-2 variants of concern, Gamma (P.1) and Delta
(B.1.617), sensitive detection and quantification in
wastewater employing direct RT-qPCR
Karin Yaniv1†, Eden Ozer2† and Ariel Kushmaro1,3,4*
1 Avram and Stella Goldstein-Goren Department of Biotechnology Engineering, Ben-
Gurion University of the Negev, Beer-Sheva 84105, Israel.
2 Department of Life Sciences, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel.
3 The Ilse Katz Center for Meso and Nanoscale Science and Technology, Ben-Gurion University of the
Negev, Beer Sheva 8410501, Israel.
4 School of Sustainability and Climate Change, Ben-Gurion University of the Negev, Beer-Sheva 84105,
Israel
† These authors contributed equally.
* Corresponding author: [email protected]
Avram and Stella Goldstein-Goren Department of Biotechnology Engineering, Ben Gurion University,
Beer Sheva, 84105, Israel.
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint
NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice.
2
Abstract
SARS-CoV-2 variants of concern present a worldwide threat. Demonstrating higher infection rate
and durability to antibodies when compared to the original SARS-CoV-2 virus, the variants of concern
are responsible for continuing global outbreaks. Prompt identification of the infecting SARS-CoV-2
variant is essential for pandemic assessment and containment. However, variant identification is mainly
being performed using expensive, time-consuming next generation sequencing. Rapid identification
methodology for variants of concern is of great need and various variant-specific assays are being
developed. Amongst the variants of concern that have recently appeared, the Gamma variant (P.1,
Brazilian) and Delta variant (B.1.617, Indian) are the most prominent. Here we describe the development
of a sensitive RT-qPCR assay for the quick direct detection of the Gamma and Delta variants as part of a
methodical characterization and detection in municipal wastewater.
Key words
SARS-CoV-2; Variants of concern; Reverse Transcriptase Quantitative Polymerase Chain Reaction;
Molecular Probes; Wastewater-Based Epidemiological Monitoring
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint
3
Introduction
Since declaring COVID-19 a world pandemic in March 2020, the disease continues to evolve and
affect significant portion of the world population. Increasing circulation of the severe acute respiratory
syndrome coronavirus 2 (SARS-CoV-2) virus within the world population, results in a continued natural
processes of random mutations and evolution1. In some cases, a mutation will have an evolutionary
advantage and create a new viral lineage that will overpower previous forms. First evidence for such an
evolutionary event for the SARS-CoV-2 virus was in April 2020, when the D614G substitution enhanced
infectivity and transmission. The D614G mutation lineage became the dominant SARS-CoV-2 variant
form2,3. By late 2020, the term 'variants of concern’ emerged with regards to the high-numbered mutations
in a single variant and the increased pathogenicity4.
Variants of concern are mainly characterized through mutations in their spike protein gene (S
gene). Such mutations affect the receptor biding domain affinity5 and antibody neutralization efficiency6.
Gamma (P.1, Brazilian) and Delta (B.1.617, Indian) variants of concern were first detected in January
2021 and December 2020 respectively, and by now circulate globally7. High transmission rates and lower
vaccine efficacy towards these variants8–10 present a higher threat compared to the original virus.
Therefore, quick detection of recognized variants of concern is vital for initiating response and proper
policy for pandemic containment.
Currently, SARS-CoV-2 variant detection mainly relies on costly next generation sequencing,
where results are obtained within 3-5 days11,12. With new variants of interest constantly emerging,
sequencing-based approaches are important for their identification, however they present difficulties
considering special instruments and resources, including data analysis skills required. To ease on detection
a reverse transcriptase quantitative polymerase chain reaction (RT-qPCR)-based assay can provide rapid
results for detection of known variants of concern detection. Such an assay can help assess a variant’s
frequency within the population and contribute to policy guidelines. Indeed a number of publications
targeting variants of concern detection using RT-qPCR13–18 as well as available commercial kits (TaqPath
ThermoScientific, GT molecular, PerkinElmer, etc.), have emerged.
Urban morbidity monitoring through wastewater is a known practice19. Without the need for
cooperation by individuals, it is possible to receive viable important information regarding the spread of
a variant in population in a given area. Since erupting, the SARS-CoV-2 virus has been monitored in
wastewater around the world20–25. In order to detect specific variants such as the Gamma and Delta variants
of concern though, a direct and sensitive probe-based RT-qPCR assay with detection ability in wastewater
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint
4
samples is of great need and could help generate better health policies once employed in a given region.
In this study, we present a sensitive RT-qPCR assay design for the direct detection of Gamma and Delta
variants of concern and its employment in wastewater sampling.
Methodology
Primers and probes design
The original sequence of SARS-CoV-2 (NC_045512.2) was taken from NCBI database. Gamma
variant (P.1, Brazilian, EPI_ISL_981709) and Delta variant (B.1.617, Indian, EPI_ISL_1704637)
sequences were taken from GISAID database7. The probe design focused on the end of ORF8 and the
beginning of N gene 28227-28286 bp location that includes the Gamma variant insertion, or S gene 21989-
22083 bp location that includes the Delta variant deletion 157-158. All primers and probes were purchased
through Integrated DNA Technologies (IDT). ZEN Quencher was added to the probes as a second, internal
quencher in qPCR 5’-nuclease assay. Probes were assigned a 6-carboxy-fluorescein (FAM) fluorophore.
Wastewater RNA extraction
Wastewater samples were collected in the city of Modiin, Israel for 24 hours composite sewage
samples. Samples were taken from different manholes and immediately transferred to the lab under chilled
conditions. Direct RNA was extracted twice according to Zymo Environmental Water RNA (Zymo
Research R2042) manufacture protocol. For internal control, we added 105 copies MS2 phage to the lysis
buffer in each RNA extraction. RNA was eluted with 35 μL of RNase free water. The fresh wastewater
samples were kept at 4oC until processed. RNA samples were kept at –80oC.
RT-qPCR
RT-qPCR was executed as previously described17. Reaction final volume is 20 µL with primers
concentration of 0.5 µM and probe concentration of 0.2 µM. The reaction contained 5 µL of RNA sample
and ROX as a reference dye. Reaction steps was executed according to manufacture recommended
protocol (One Step PrimeScript III RT-qPCR mix RR600 TAKARA, Japan) using Applied Biosystems,
Thermo Scientific). Each RT-qPCR run included relevant quality controls, Non template control (NTC)
and MS2 phage detection for wastewater RNA sample26.
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint
5
Calibration curves and limit of detection determination
Calibration curves were performed on a known-positive DNA gene block. Three different gene
blocks were used; (1) containing SARS-CoV-2 S gene sequence as reported for Wuhan-Hu-1
(NC_045512.2):TACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGT
TCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTA
CTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAG
AAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCT
ACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATG
ATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAG
AGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCT
TGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGT
TATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTT
TTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTT
TACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGT
GCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGG; (2) containing the end of ORF8 until the
beginning of N gene carried on a plasmid matching the reported 4 nucleotides insertion of the Gamma
variant:TAATTGCCAGAAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGAAGA
CTTTTTAGAGTATCATGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAACAAACTA
AAATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACC
CTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGC; (3) containing S gene
sequence matching the reported 157-158 deletion of the Delta variant:
TTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGATGTTTATTACCACA
AAAACAACAAAAGTTGGATGGAAAGTGGAGTTTATTCTAGTGCGAATAATTGCACTTTTGA
ATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTA
GGG. Calibration of P.1 probe was performed using the second gene block, while calibration of S∆157
probe was performed with the third gene block. Negative control for the P.1 probe was performed using
Wastewater samples confirmed as positive for the original variant or Alpha variant of concern, and
negative control for the S∆157 probe was performed using the first gene block. Serial dilutions for the
relevant gene block were prepared based on copy number calculations. The resulting Ct values were
plotted against the log copy number of the gene block template. Each concentration was examined by six
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint
6
repetitions and a standard deviation was calculated. Linear regression was performed between the log
copy number and the Ct values from the RT-qPCR results.
Complex matrix detection
In order to validate the RT-qPCR designed assay’s sensitivity in a wastewater matrix, RNA
extracted from pre-determined negative wastewater sample for SARS-CoV-2 was examined using
standard CDC’s detection sets. The negative RNA sample was supplemented with known concentrations
of a desired gene block (100/101/102). All experiments executed with the matrix pre-determined as
negative for additional verification of the sample as negative. Eight repetitions were performed for each
viral concentration or control. Ct results were plotted to represent the new probes limit of detection in a
complex environment.
Results and Discussion
Following the Alpha variant B.1.1.7 (British) eruption and containment in Israel, the Gamma and
Delta variants were believed to be the most urgent variants in need for rapid detection. Previously we
developed direct RT-qPCR detection assays for Alpha variant (B.1.17, British) and Beta variant (B.1.315,
South Africa)17. During the new outbreak we further developed a direct RT-qPCR detection assays for
Gamma variant (P.1, Brazilian) and Delta variant (B.1.617, Indian). Our design for detection of these two
variants (Fig. 1) is based on the differences in gene sequence from the original SARS-CoV-2 sequence
(NC_045512.2). The Gamma variant contains an insertion in the ORF8 region, and the Delta variant S
gene contains a deletion known as Δ157-158. Accordingly, our designed primers-probe sets for variants
detection focused on these regions and is presented in Figure 1.
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint
7
Figure 1. RT-q-PCR primers-probe sets design for Gamma and Delta variants detection. (a) Designed detection sets for
differentiation and identification of SARS-CoV-2 Gamma variant (P.1) and Delta variant (B.1.617). Design was based on
sequence changes between the original SARS-CoV-2 virus and variants of concern, with insertion after ORF8 for Gamma
variant and deletion in the S gene of the Delta variant. (b) List of primers and probes sequences. (c) Calibration curves for
primers-probe sets developed for variants of concern detection. Resulted Ct value plotted against the tested Log copy number.
Error bars present standard deviation for ten replicates. Positive DNA template for S∆157 set, corresponded to ∆156-157
deletion site in B.1.617 S gene. Positive DNA template for P.1 set, corresponded to the DNA segment from the end of ORF8
and the beginning of N gene including the 4 nucleotides insertion. (d) List of Limit of detection, Linear regression R2, and Y
intercept values extracted from the devised calibration curves.
For Gamma variant detection, the designed forward primer is located at the end of ORF8 gene and
the reverse primer is located at the beginning of the nucleocapsid gene (N gene), meaning 28227-28286
bp of the original sequence. Within this range, the original SARS-CoV-2 and Gamma variant sequences
are completely identical, apart from a 4 nucleotides insertion in the Gamma lineage (Fig. 1a). Using a
detection set comprised of two primers meant to amplify the target region, a single probe (P.1 probe) was
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint
8
designed for the detection of the Gamma variant only (corresponding to the insertion). For Delta variant
detection, the designated detection region was chosen from within the S gene. Focusing on S gene's 21989-
22083 bp of the original sequence, the original SARS-CoV-2 sequence is identical to the Delta variant
sequence with the exception of a 6 nucleotides deletion in the Delta lineage (Fig. 1a). Using a detection
set comprised of two primers meant to amplify the target region, a single probe (S∆157 probe) was
designed for the detection of the Delta variant only (corresponding to the deletion).
To ensure functionality, the described sets of primers and probes underwent characterization.
Initially, a calibration curve was generated for the two primers-probe sets, using dsDNA as a template. A
detection range of between 106 copies and 100 copies per µL was tested for each set (Fig. 1c). Linear
regression performed for the two probes demonstrated strong correlation. A limit of detection (LOD) could
be determined for each primers-probe set and was identified as 100 copies per µL for the two sets (Fig.
1d), meaning highly sensitive detection. Specificity of the described sets was examined with either dsDNA
fragments from the original SARS-CoV-2, relevant to the assigned detection regions, or using wastewater
found positive for the original SARS-CoV-2 and the Alpha variant. Both sets did not manifest a signal
when tested with such negative controls and were therefore found to be highly specific.
Primers-probe sets were further characterized within a more intricate matrix. Wastewater from
Binyamina, Israel served as a more complex environment for the RT-qPCR assay, as sewage samples
contain a variety of materials and organisms. Wastewater samples were pre-determined as negative for
SARS-CoV-2 using N gene detection. After confirming that the wastewater samples were negative,
relevant dsDNA template copies were added exogenously at known concentrations (Fig. 2). These samples
were then used for detection by the examined primers-probe sets. As can be seen in Figure 2, despite the
wastewater matrix, P.1 and S∆157 probes maintained high functionality with a LOD of 100 copies per µL,
proving their sensitivity and stability.
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint
9
Figure 2. Lower detection limit of P.1 and S∆157 primers–probe sets in wastewater matrix. RNA extracted from negative
detection wastewater sample (No virus) spiked with known concentrations of positive template corresponding to each probe
accordingly (100–102 S gene template copies per μL) and Non-Template Control (NTC, water). Positive DNA template for P.1
set, corresponded to the DNA segment from the end of ORF8 and the beginning of N gene including the 4 nucleotides insertion
in the Gamma variant. Positive DNA template for S∆157 set, corresponded to ∆156-157 deletion site in the Delta variant. ND
- not detected. Solid lines indicate the median and dashed lines indicate the detection limit as decided by clinical guidelines.
After fully characterizing the developed primers-probe sets, revealing their specificity, sensitivity
and durability, it was possible to employ them on recently collected wastewater samples. Until recently,
the Alpha variant was most dominant in Israel, however a noticeable decrease was observed in the past
months. In the past month (May-June 2021), reports indicated that the Delta variant had reached Israel
and is responsible for the majority of new morbidity cases. Knowing this, samples from different locations
at the city of Modi’in were collected and tested for general SARS-CoV-2 presence, using N gene detection,
and Alpha and Delta variants presence, using relevant S gene detection (Table 1).
Table 1: Modi'in city manholes detection for SARS-CoV-2 N gene (CDC’s N2, Improved N3), Alpha variant S gene (SΔ69)
and Delta variant S gene (S∆157)
*Previously published primers-probe set for SΔ69 Alpha variant (B.1.1.7) detection and Improve
N3 original SARS-CoV-2 general detection17.
**ND – not detected
Ct RNA copies per Liter
in wastewater
Location/target gene CDC’s
N2 SΔ69* SΔ157
Improve
N3*
CDC’s
N2 SΔ69* SΔ157
Improve
N3*
North neighborhoods 35.1 ND** 36.56 33.61 2.09E+04 - 2.68E+03 1.55E+05
Center and East neighborhoods 37.16 ND** ND** ND 5.01E+03 - - -
South-East neighborhoods 30.82 ND** 33.64 31.19 4.07E+05 - 1.88E+04 9.57E+05
South-West neighborhoods 32.82 ND** 36.27 32.8 1.02E+05 - 3.31E+03 2.85E+05
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint
10
As can be seen in Table 1, all of the tested samples were positive to SARS-CoV-2 presence through
N gene detection. However, none of the samples resulted in a positive detection for the Alpha variant,
corresponding to the disappearance of this variant in clinical tests as reported by health officials.
Furthermore, all samples, apart from one, resulted in a positive signal for the Delta variant using the
designed primers-probe set described here. These field results indicated the new probe sets ability to
correctly detect and quantify the Delta variant in a sensitive manner, even within a complex environment,
and provide an assessment for variant of concern geographical spread in the population. Considering the
importance of wastewater monitoring, as well as the possibility of clinical employment, we hope the
developed sets can serve for variants of concern detection.
Author Contributions
K.Y. and E.O. share equal contribution to this manuscript. K.Y. designed sequence, conceived, performed
and analyzed experiments and authored this manuscript. E.O. designed sequence, conceived and analyzed
experiments and authored this manuscript. A.K. conceived experiments, supervised, provided research
facilities and edited the manuscript.
Acknowledgement
We thank KANDO and the Israeli Ministry of Health for providing us with the sewage samples. We
gratefully acknowledge GISAID database for access to SARS-CoV-2 variants sequences. We gratefully
acknowledge Esti Kramarsky-Winter assistance for comments and scientific editing of the manuscript.
Funding Sources
We would like to acknowledge funding from Ben Gurion University, The Corona Challenge Covid-19
(https://in.bgu.ac.il/en/corona-challenge/Pages/default.aspx) and funding from the Israeli ministry of
Health.
References
1. Harvey, W. T. et al. SARS-CoV-2 variants, spike mutations and immune escape. Nat. Rev.
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint
11
Microbiol. 19, 409–424 (2021).
2. Korber, B. et al. Tracking Changes in SARS-CoV-2 Spike: Evidence that D614G Increases
Infectivity of the COVID-19 Virus. Cell 182, 812-827.e19 (2020).
3. Hou, Y. J. et al. SARS-CoV-2 D614G variant exhibits efficient replication ex vivo and
transmission in vivo. Science (80-. ). 370, 1464–1468 (2021).
4. Davies, N. G. et al. Estimated transmissibility and impact of SARS-CoV-2 lineage B.1.1.7 in
England. Science (80-. ). 372, eabg3055 (2021).
5. Thomson, E. C. et al. Circulating SARS-CoV-2 spike N439K variants maintain fitness while
evading antibody-mediated immunity. Cell 184, 1171-1187.e20 (2021).
6. Weisblum, Y. et al. Escape from neutralizing antibodies by SARS-CoV-2 spike protein variants.
Elife 9, 1 (2020).
7. Shu, Y. & McCauley, J. GISAID: Global initiative on sharing all influenza data – from vision to
reality. Eurosurveillance 22, 2–4 (2017).
8. Hoffmann, M. et al. SARS-CoV-2 variant B.1.617 is resistant to Bamlanivimab and evades
antibodies induced by infection and vaccination. Cell Rep. 109415 (2021).
doi:10.1016/j.celrep.2021.109415
9. Bernal, J. L. et al. Effectiveness of COVID-19 vaccines against the B.1.617.2 variant. medRxiv 1–
14 (2021).
10. Wang, Z. et al. mRNA vaccine-elicited antibodies to SARS-CoV-2 and circulating variants.
Nature 592, 616–622 (2021).
11. Khan, M. I. et al. Comparative genome analysis of novel coronavirus (SARS-CoV-2) from
different geographical locations and the effect of mutations on major target proteins: An in silico
insight. PLoS One 15, 1–18 (2020).
12. Andrés, C. et al. Naturally occurring SARS-CoV-2 gene deletions close to the spike S1/S2
cleavage site in the viral quasispecies of COVID19 patients. Emerg. Microbes Infect. 9, 1900–
1911 (2020).
13. Vogels, C. B. F. et al. Multiplex qPCR discriminates variants of concern to enhance global
surveillance of SARS-CoV-2. PLoS Biol. 19, 1–12 (2021).
14. Gand, M. et al. Deepening of in silico evaluation of sars-cov-2 detection rt-qpcr assays in the
context of new variants. Genes (Basel). 12, 1–14 (2021).
15. Vega-Magaña, N. et al. RT-qPCR Assays for Rapid Detection of the N501Y, 69-70del, K417N,
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint
12
and E484K SARS-CoV-2 Mutations: A Screening Strategy to Identify Variants With Clinical
Impact. Front. Cell. Infect. Microbiol. 11, 1–11 (2021).
16. Barreto, H. G., de Pádua Milagres, F. A., de Araújo, G. C., Daúde, M. M. & Benedito, V. A.
Diagnosing the novel SARS-CoV-2 by quantitative RT-PCR: variations and opportunities. J. Mol.
Med. 98, 1727–1736 (2020).
17. Yaniv, K. et al. Direct RT-qPCR assay for SARS-CoV-2 variants of concern (Alpha, B.1.1.7 and
Beta, B.1.351) detection and quantification in wastewater. Environ. Res. 201, 111653 (2021).
18. Wang, H. et al. Multiplex SARS-CoV-2 Genotyping RT-PCR for Population-Level Variant
Screening and Epidemiologic Surveillance. J. Clin. Microbiol. (2021). doi:10.1128/JCM.00859-
21
19. Martin, J. et al. Tracking SARS-CoV-2 in Sewage: Evidence of Changes in Virus Variant
Predominance during COVID-19 Pandemic. Viruses 12, 1144 (2020).
20. Bar-Or, I. et al. Regressing SARS-CoV-2 sewage measurements onto COVID-19 burden in the
population: A proof-of-concept for quantitative environmental surveillance. medRxiv 1–11
(2020). doi:10.1101/2020.04.26.20073569
21. Ahmed, W. et al. First confirmed detection of SARS-CoV-2 in untreated wastewater in Australia:
A proof of concept for the wastewater surveillance of COVID-19 in the community. Sci. Total
Environ. 728, 138764 (2020).
22. La Rosa, G. et al. First detection of SARS-CoV-2 in untreated wastewaters in Italy. Sci. Total
Environ. 736, 139652 (2020).
23. Trottier, J. et al. Post-lockdown detection of SARS-CoV-2 RNA in the wastewater of
Montpellier, France. One Heal. 10, 100157 (2020).
24. Westhaus, S. et al. Detection of SARS-CoV-2 in raw and treated wastewater in Germany –
Suitability for COVID-19 surveillance and potential transmission risks. Sci. Total Environ. 751,
141750 (2021).
25. Wu, F. et al. SARS-CoV-2 Titers in Wastewater Are Higher than Expected from Clinically
Confirmed Cases. mSystems 5, 1–9 (2020).
26. Dreier, J., Störmer, M. & Kleesiek, K. Use of bacteriophage MS2 as an internal control in viral
reverse transcription-PCR assays. J. Clin. Microbiol. 43, 4551–4557 (2005).
All rights reserved. No reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
The copyright holder for this preprintthis version posted July 16, 2021. ; https://doi.org/10.1101/2021.07.14.21260495doi: medRxiv preprint