role of the and untranslated regions in … · the author has grantecl a non- exc1usive licmce...
TRANSCRIPT
ROLE OF THE 5' AND 3' UNTRANSLATED REGIONS
IN TRANSLATIONAL CONTROL OF
APOLIPOPROTEIN B mRNA
A thesis submitted in eonformity witb the requirements
for the degree of Mastem of Science .
Department of Labonatory Medicine & Pathobiology
University of Toronto
O Copyright by Louisa Pontrdli (2001)
The author has grantecl a non- exc1usive Licmce allowing the National Libraxy of Canada to reproduce, Ioan, distrihie or seii copies of this thesis in microform, papa or electronic formats.
The author retains ownership of the copunght in diis thesis. Neither the thesis nor substantial extracts &om it may be printed or othenuise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive permettant A la Bibliothhue nationale du Canada de reproduire, preter, distribuer ou venâre des copies de cette thèse sous la forme de microfiche/film, de reproduction sur papier ou sur format électronique.
L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
ABSTRACT
Role of tbe 5' and 3' Untranslatecl Regions in Translatioaal Control of Apolipoprotein B mRNA
Louisa Pontrelli Masters of Science 2001
Department of Laboratory Medicine & Pathobiology University of Toronto
Molecular mechanisms goveming translational control of apolipoprotein B
rnRNA are unknown. Computer analysis revealed that apoB 5' and 3'UTR sequences
have potential to foxm secondary structure. Biological activity of the putative RNA
motifs was assessed by hansiently transfecting HepG2 cells with constnicts
containing the apoB S'UTR andlor 3'UTR sequences linked to a luciferase (LUC)
reporter gene. We obsenred statistically significant increases in LUC activity for the
S'UTRpGL3 and 5'/3WïRpGL3 constnicts. LUC mRNA levels were not altered,
suggesting that increased LUC activity was post-transcriptional in nature. When RNA
isolat4 nom îransfected cells was translated in vitro, parallel increases in translatable
LUC activity were observed. Metabolic studies of transfected cells treated with
insulin and thyroid hormone did not exhibit any significant differences in LUC
activity. Our data suggests that putative S'üTR motifs are important for optimal
translation of apoB mRNA and may involve potential cis-tram interactions with RNA
binding proteindtranslational factors.
ACKNOWLEDGEMENTS
First and foremost, 1 would lüce to thank my graduate supervisor Dr. Khosrow
Adeli for his continued supp~rt, guidance and encouragement throughout my studies
and also for the oppomuiity to conduct my graduate research in his laboratory.
1 would like to acknowledge and thank my cornmittee members, Dr. Cole and
Dr. Diamandis for their support, advice and guidance.
1 would like to acknowledge both the Banting and Best Diabetes Centre/Novo
Nordisk and the University of Toronto/Richard Lewar Centre of Excellence
Studentship Awards for providing fbnding for this project.
1 would also like to express my appreciation and gratitude to my entire farnily
and to my Rends for their support, caring, and sense of humour but most importantly
for their faith in me.
DEDICATION
It is with great honour that 1 dedicate this achievement to my mom and dad,
and to my brother, Pat, my sisters, C m and Linda, my sister-in-law, Geni and my
brother-in-law, Terry. Their immense love, faith and encouragement have given me
the strength and tenacity to embark on any goal 1 set out to achieve. In addition, 1
dedicate this to my nephews, Nicholas and Jonrnichael and to my nieces, Laura and
Mikayla, for the love, sweetness, joy and laughter they have added to my life.
1 also wish to dedicate this achievement to the special niends who have stood
by and believed in me. You have al1 touched my life and my heart.
TABLE OF CONTENTS
ABSTRACT
ACKNOWLEDGEMENTS
DEDICATION
LIST OF TABLES
LIST OF FIGURES
LIST OF ABBREVIATIqNS
...................................................... x
. . ................................................... X l l
CHAPTER 1
INTRODUCTION
1.1 Lipoproteins ...................................................................................................... 1
1.2 Apolipoprotein B: Structure. Function & Regulation ....................................... 9
Structure of the Human ApoB Gene ..................................................... 9
Apolipoprotein B mRNA ....................................................................... 13
Apolipoprotein B mRNA Editing .............................................................. 14
Structural Domains of ApoB Protein ......................................................... 19
Transcriptional Regulation of the ApoB Gene .................................. ... . 24
Post-Transcriptional Control of Apolipoprotein B Secretion .................... 25
......................................................... 1.2.6.1 Translocational Control of ApoB 25
1.2.6.2 Assembly & Secretion of ApoB-Containing Lipoproteins .................. 27
1.2.6.3 Intracellular Degradation of ApoB ................................................... 29
1.2.7 Translational Regulation of ApoB Synthesis ........................................... 30
1.3 Factors in Translational Control ......................................................... 32
..................................... Initiation .. ............ ...........:..... ......................... 32
.......................................................................................... Leaky Scaaning 33
.............................................................................. Upstream AUG codons 33
.................................................................... Intemal Ribosome Entry Sites 34
mRNA Stability ........................................................................................ 35
...... Secondary Structure and Sequence Elemeats within UTR Sequences 37
............. Evidence of Translational Control Mediated by UTR Sequences 38
........................... 1.4 Rationale for Smdying ApoB mRNA Translational Control 41
1.4.1 Hypothesis ................. A........*... ............................................................ 46
.......................................................................................... 1 A 2 Specific Aims 4 6
CHAPTER 2
MATERIALS & METHODS
................................................................................... 2.1 Chernicals and Reagents 48
....................................................................... 2.2 DNA S ynthesis and Sequencing 49
....................................................... 2.3 Ce11 Culture and Tissue Culture Reagents 4 9
................................................................ 2.4 Laboratory Supplies and Apparatus 50
2.5 IsolationofPlasrnid DNA ....................... ,. ................................................. 50
................................ 2.6 Preparation of the ApoB WTR-LUC Reporter Consûucts 51
2.6.1 Preparation of the S'UTRpGL3 Constnict ......... .... ............................ 52
2.6.2 Preparation of the 3'UTRpGL3 Constnrct ................................................. 57
............................................. 2.6.3 Preparation of the 5'/3'UTRpGL3 Constmct 59
....................................... 2.6.4 Preparhtion of the Negative Control Construct 6 1
2.7 Ce11 Culture ....................................................................................................... 64
2.7.1 Subculturing of HepG2 Cells ............................................................. 6 4
...................................... 2.8 Transient Transfections of LUC Reporter Constructs 65
2.9 RNA Isolation of Transfected Cells .............................................................. 6 6
2.1 0 RT-PCR Analysis of LUC Reporter Constnicts ........................................... 6 7
2.1 1 In Vitro Translation of LUC Reporter Consûucts .......................................... 68
2.12 Metabolic Studies ....................................................................................... 6 9
2.12.1 hsulin H o m n e Treatment of Transiently Transfected Cells ................. 69
2.12.2 Thyroid Hormone Treatment of Transiently Transfected Cells ............... 70
2.13 Secondary Structure Analysis of the ApoB 5'üTR ........................................ 70
2.14 Statistical Analysis ......................................................................................... 70
CHAPTER 3
RESULTS
3.1 Construction of the UTR-Reporter Constructs ............................................... 71
3.1.1 Construction of the S'UTRpGL3 Construct ............................................... 71
3.1.2 Construction of the 3VTRpGL3 Constmct ............................................... 74
............................................ 3.1.3 Construction of the 5'/3'UTRpGL3 Constniet 74
................................................... 3.1.4 Construction of the NCSpGL3 Constnict 79
3.2 Influence of the apoB 5' and 3 W R on LUC Expression in Ce11 Culture ........ 84
3.3 Determination of LUC mRNA Levels h m Transfected Cells ........................ 87
3 -4 Innuence of the apoB 5' and 3'UTR on Translational Efficiency In Vitro ....... 88
3.5 Effact of Insulin Hormone Treatment on Luciferase Expression ..................... 93
................. 3.6 Effect of Thyroid Hormone Treatment on Luciferase Expression 102
3.7 Secondary Structure Redictions of the apoB S'UTR ..................................... 102
CHAPTER 4
DISCUSSION
Future Directions
REFERENCES
APPENDIX
................. A 1 . 1 Preparation of the ApoB 15 Constmcts .. ................................ 135
. A 1.1 1 Pnparation of the ApoB 15 Conml Constnict ..................................... 135
. A 1 1.2 Reparation of the S'UTRApoB 15 Construct ....................................... 142
A 1.1.3 Preparation of the ApoB 15-3'UTR Construct ...................................... 145
.......................... A 1.1.4 Preparation of the SWTR-ApoB 15-3'UTR Constnict 149
LIST OF TABLES
Table 1. Chernical and Physical Characteristics of the Major Plasma Lipoproteins ... 2
Table 2. Characteristics and Functions of Apolipoproteins ......................................... 4
Figun 1. Spatial Organization of Sequence Elements Required for ApoB mRNA
Editing. ................................................................................................................. 16
Figure 2. Spatial Organization of the Structural Domains within the Human
Apolipoprotein B Sequence. ............. . ....................... ...................... ...... ..... ........... 2 1
Figun 3. Analysis of the Human ApoB S'UTR mRNA Sequence. ........................... 42
Figure 4. Analysis of the Human ApoB 3VTR mRNA Sequence. ........................... 44
Figure 5. Circle Map of the POU-Control Vector. ................................................. 53
Figun 6. Chimenc UTR-LUC constnicts carrying the 5' andlor 3'UTR of apoB ..... 72
Figure 7. Digestion of the S'UTRpGL3 Construct with Hindm Restriction
Enzyme. ...........................................m... ....................... .......* ....... ..... ............. .. 75
Figure 8. Digestion of the 3'UTRpGL3 Construct with XbaI Restriction Enzyme. .. 77
Figure 9. Digestion of the 5'/3WRpGU Construct with Hindm, NcoI and XbaI
. . Restriction Enzymes. . . . . .. .. .. .... . ... . ... .. .. .. ... . .. . . . . . . . . . . . . . . . . . . . . . . . . . 80
Figure 10. Digestion of the NCSpGL3 Consmict with Hindm and NcoI Restriction
Enzymes ............................... . . . . . .................... . ................. . . . . . 8 2
Figun I l . Transient transfection of Hep02 cells with the chimenc UTR-LUC
constructs. ................................... ....... ............. ......................... 85
Figure 12. Assessment of LUC M A levels following transient transfection of the
c himenc WR-LUC Constnicts. . . .. .. . . . . .. . . ... .. . ... .... ... .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 9
Figure 13. In vitro translation of RNA products derived from transient transfection of
HepG2 cells with the chimeric UTR-LUC conscnicts .......................................... 91
Figure 14. Effect of insulin hormone treatment (48 hours) on LUC activity in HepG2
cells transiently transfected with the chimeric UTR-LUC consûucts. ................. 94
Figure 15. Effect of insulin hormone treatment (6 h o u ) on LUC activity in HepG2
cells tmnsiently transfected with the chimeric UTR-LUC constnicts .................. 96
Figure 16. Effect of insulin hormone treatment (1 2 hours) on LUC activity in Hep02
cells transiently îransfected with the chimenc UTR-LUC consûucts. ................. 98
Figure 17. Effect of insulin hormone treatment (1 8 hours) on LUC activity in-Hep02
cells transiently transfected with the chimenc UTR-LUC constructs. ............... 100
Figun 18. Effect of thyroid hormone treatment on LUC activity in Hep02 cells
transientl y transfected with the chimenc UTR-LUC consmicts. .. ........... . .. . .. . .. .IO3
Figure 19 A-H. Secondary Structure Rcdictions of the apoB S'UTR Generated by
M-f01d ................................. . . .m. . .m.om.oee. . . .m. . . . . . . . . .m. . .o .m.. . . . . . . . . . . . ............ .. . . . 1 0 5
Figure 20. ApoB15 Consmcts Cairying the 5' ancilor 3WTR sequences of apoB
M A .............................. .......e....... . o............... ............... . ....................... 136
Figure 21. Digestion of the ApoB15 Control Consmi« with Hindm and Xbd
Restriction Enzymes. ....... . .... ....... ..... . ... .o..... . . . . . . . . . . . .. . . ..... . . . 143
Figure 22. Digestion of the 5'UTRApoBlS Constnict with HindID and XbaI
. . Restnciion Enzymes. . . .... . . . .... . . . .... . . . . . .. ... . . . . . . .. . . . . . . . . . . .........m . . . . . . . . . . . . . . . . . . . . . . . . . . . 146 Figure 23. Digestion of the ApoB 15-3'UTR Constnict with XbaI Restriction
Enzyme. ..................... ......m..e..m..o......m....m.. .................................. . ............ 1 5 0
Figure 24. Digestion of the S'UTR-ApoB 15-3WïR Consmict with XbaI Restriction
Enzyme. ........................... ... ... ....mo .................... . ...................... . .o . . . . . . . . . 152
a-MEM
AMP
APO
APOBEC- 1
ARE
ATP
CE
CETP
CAD
CHOL
DEPC
DMSO
eIFs
ER
EîBr
FBS
HDL
H e 2
HL
D L
IRE
IRES
Eagle's minimum essential medium (alpha) powder
ampicillin
apolipoprotein
apoB mRNA editing catalytic component 1
AU-rich element
ademsine S'-triphosphate
cholesterol ester
cholesterol ester transi fer protein
coronary artery disease
cholesterol
diethylp yrocarbonate
dimethysulphoxide
eukaryotic initiation factors
endoplasmic reticulum
ethidium bromide
fetal bovine senun
high density lipoprotein
human hepatoma ce11 line
hepatic lipase
intermediate density lipoprotein
iron-responsive element
intemal ribosome entry sites
IRP
LCAT
LDL
LDL R
LPL
LUC
InRNA
MTP
PCR
PD1
pGL3 -control
PL
pRL-TK
RER
RLU
SEM
- SER
SV40
T3
TG
uORF
UTR
VLDL
iron regdatory protein
lecithin-cholesterol acyltransferase
low density lipoprotein
low density lipoprotein receptor
lipoprotein lipase
luci ferase
messenger ribonucleic acid
microsomal triglyceride transfer protein
polymerase chah reaction
protein disulfide isomerase
fire fl y luci ferase conûol vec tor
phospholipid
renilla luciferase-thymidine kinase promoter vector
rwgh endoplaanic reticulum
relative light units
standard error of the mean
smooth endoplasmic reticulum
simian virus 40
triiodo-L-thyronine
trigl yceride
upstruun open reading hune
untranslated ngion
very low density lipoprotein
Dietary lipids and lipids synthesized endogenously by the liver and adipose
tissue are transported in the plasma to various tissues and organs throughout the body
for utilization and storage. Lipids are insoluble in water and thus their transport
through blood plasma, an aqueous environment, poses a challenge. This is achieved
by the interaction of hydrophobic lipids such as triglycerides and cholesterol esters
with amphipathic lipids and proteins. Arnphipathic lipids, such as phospholipids and
cholesterol, as well as proteins, have hydrophilic and hydrophobic domains that allow
for the transport of h ydrophobic lipids in the form of a lipoprotein particle. In general,
circulating plasma lipoprotein particles are spherical aggngates that contain a neutrd
lipid con consisting of triglycerides and cholesterol esters smunded by a surface
layer of phospholi pids, cholesterol and apoproteins.
Five main classes of lipoproteins have been identified according to their
buoyancy as determined by ultracentrifugation. These include chylomicrons, very
low densi ty lipoproteins (VLDL), low density li poproteins (LDL), intermediate
densi ty li poproteins (DL) and high densit y lipoproteins (HDL). These li poproteins
have also k e n characterized according their size. density and composition and are
listed in Table 1. The largest of the lipoprotein pdcles are chylomicmns (density <
0.95 glml) which are synthesized in intestinal cells. Chylornicmns are triglyceride-
nch particles whose role is to transport exogenous lipids derived h m intestinal
Table 1.
Table 1. Chemical and Physical Characteristics of the Major Plasma Lipoproteins
Lipoprotein Density Diameter L i ~ i d (% Cornmition) 6m) (nm) TG CHOL PL
Ch ylornicmns 0.95 75-200 80-95 2-7 3-9
VLDL 0.95- 1.006 30-80 55-80 5-15 10-20
D L 1.006-1 .O19 25-35 20-50 20-40 15-25
LDL 1 .O 19- 1 .O63 18-25 5-15 40-50 20-25
HDL 1.063-1.21 5-1 2 5- 10 15-25 20-30
(Adapted from Ginsberg 1998)
absorption of dietary lipids; thus their metabolism is directed via the exogenous
pathway. VLDL particles (density c 1.006 glrnl) are üiglyceride-rich and are mainly
synthesized and secreted by the liver. Their role is to transport endogenous
triglycerides and cholesterol produced in the liver. Thus, VLDL particles are
metabolized via the endogenous pathway. D L particles (1.006-1.019 %ml) are
metabolic products of VLDL and serve as precursors to the formation of LDL-
particles. LDL are dense particles (1 .ON- 1.063 gfml) produced by further
metabolism of IDL and are the main plasma carriers of cholesterol. HDL particles
are very dense particles (1.063-1.21 g/ml) which participate in the metabolism of
VLDL, chylornicrons and cholesterol. Two distinct fractions of HDL exist: HDL2
(1 .MM .O125 g/ml) and HDL (1.125- 1.2 1 @ml).
Apolipoproteins constitute the protein component of lipoprotein particles and
they possess certain structural characteristics such as the presence of amphipathic
a-helices within their secondary structure (Knott, et ai., 1986a. Segnst, et ai., 1994).
This structural feature allows the protein to interact with lipids and plasma and also
allows for dissociation and exchange of apolipoproteins from the surface of
- lipoprotein particles. Some apolipoproteins srne as CO-factors for lipid mdfying
enzymes dwing lipoprotein metabolism. Apolipoproteins such as apoA-1, apoA-II,
apoA-N, apoC-1, apoC-Ii, apoC-ïîi and apoE are exchangeable as they are soluble in
aqueous environments. ApoB48 and apoBlOO are insoluble in aqueous environments
and thus are non-exchangeable lipoproteins. The properties and functions of the
apolipoproteins are summarized in Table 2 (Ginsberg, 1998).
Table 2.
Table 2. Charactenstics and Functions of Apolipoproteins
Apoli poprotein Molecular Weight Li poproteins W a )
Metablic Functions
28 HDL, ch ylomicrons Structural component of HDL; LCAT activator
46 HDL, chylomicrons Unknown; rnay facilitate the transfer of other apos bctween HDL and chylomicrons
- - - -- - - -- - --
264 Ch y lomicrons Ntctssary t'or asscmbl y and secretion of chylomicrons îkt small intestine
540 VLDL, IDL, LDL Necessary for assembly and secietion of W L fmm the liver; structural pmtcin of VLDL, IDL, LDL; ligand for the LDL-teccptor
6.6 Chylomicrons, May inhibit hepatic uptake of VLDL, IDL, LDL chylomicron and VLDL
rernnants - - -
8.9 Chy lomimns, VLDL, DL, LDL
8.8 Ch y lornimns, VLDL, IDL, LDL
Inhibitor of LPL; may inhibit uptake of chylomimn and VLDt rcmnants
34 Chylomimns, Ligand for binding of several VLDL, IDL, HDL lipoprotcins to the LDL-
receptor and possibly to the LDL receptor-rclated rcccptor
(Adapted from Ginsberg. 1998)
Apolipoprotein BI00 is synthesizzd by the liver and is necessary for the
assembly and secretion of hepatic VLDL particles. ApoB is also important for
structurai integrity and catabolism of apoBcontaining lipoproteins such as LDL, IDL
and VLDL since apoB binds to the LDL-receptor and mediates clearance of plasma
lipids. ApoB48 represents the N-terminal domain of apoBlOO and is synthesized by
the intestine. ApoB48 is necessary for the assembly and secretion of chylomicrons.
ApoC-1. apoC-II and a@-III are synthesized by the liver. ApoC-1 is a minor
protein component of chylomicrons, VLDL, D L and HDL particles. ApoC-1 is
ôelieved to participate in the catabolism of chylomicrons and VLDL by the liver
through the binding of these particles to the LDL nceptor and the LDL receptor-
nlated protein. ApoC-II is an essential activator for the enzyme lipoprotein lipase.
ApoC-II is a protein component of chylornicron, VLDL, D L and HDL particles.
ApoC-iII constitutes 40% of the total protein content of VLDL particles. ApoC-Iü is
also a component of chylornicron, D L and HDL particles. The role of apoC-ID is to
inhibit lipoprotein lipase and to inhibit uptake of chylomicrons and VLDL rernnants
by the b e r (Ginsberg, 1998).
ApoE is a protein synthesized by the liver and is found on the major
lipoprieins including chylornicrons, VLDL, D L and HDL but is not found on LDL
particks. The central role of apoE is to mediate clearance of remnant lipopmteins
through the binding of apoE to the DL-receptor and ais0 potentially to the LDL-
receptor nlated receptor.
ApoA-1 is a protein sythesized by the liver and small intestine that constitutes
a major portion of the protein component of HDL. It is secreted by the intestine on
nascent chylomicrons which are subsequently converted to HDL after lipolysis.
ApoA-1 is an activator for the enzyme LCAT (lecithin cholesterol acyl transferase)
and plays a central role in reverse cholesterol transport. ApoA-n comprises 10-1596
of the protein component of HDL; its physiological role has not been elucidated.
ApoA-IV is a minor protein component of chylornicrons and HDL particles and its
role has also not been elucidated.
Triglyceride-rich chylomicrons and VLDL are hydrolyzed by lipoprotein
lipase, an enzyme that requires apoC-II and phospholipids as CO-factors for its
activity. This process rrleases free fatty acids and results in a depleted lipid core.
Hydrol ysis of ch ylomicrons occua rapidl y and produces a ch ylomicron-remnant
particle that is cleared from the plasma via chylomicron remnant receptors on the
liver which are also known as the LDL-receptor like protein (Kwiterovich, 2000).
Chylomicron-remnants may also be taken up via the apoB/E receptor pathway.
Hydrol ysis of VLDL results in VLDL-remnan ts and D L particles. VLDL-remnants
may be cleared from circulation via the apoBlE receptor mediated pathway or may
undergo further lipolysis by .lipoprotein lipase andlor hepatic lipase. IDL particles are
de-lipidated by hepatic lipase. The end nsult is the production of a cholesterol-rich
LDL particle that is cleand from plasma pnmarily by the liver but also by
extrahepatic tissues via apoB/E nceptor mediated endocytosis. .
Nascent HDL particles avidly accept cholesterol h m the plasma membranes
of cells which are not capable of metabolizing cholesterol. The HDL particles are
substrates for LCAT. an enzyme that converts surface phospholipids and cholesterol
to cholesterol ester and lysolecithin. Approximately 50% of these HDL particles may
be taken up by the liver via the HDL nceptor (Kwiterovich, 2000). The remaining
50% of HDL particles are metabolized via the activity of cholesterol ester transfer
pmtein (CETP) which transfers cholesterol ester to VLDL and chylomicron particles
that are subsequently cleared by the LDL-receptor pathway. Thus, HDL metabolism
provides a mechanism by which excess cholesterol is delivered to the liver where it
may be metabolized.
Maintaining lipid homeostasis in the body is dependent on the appropriate
interaction and catabolism of al1 major lipopmteins including the synthesis of the
apolipoproteins. Dyslipidemia is a consequence of de-regulated lipid metabolism.
For example, hepatic overproduction of VLDL particles results in a concomitant
increase in D L and LDL since these particles are metabolic by-products of VLDL.
Increased plasma levels of LDL and DL-apoB comlate positively with the
development of coronary artery disease and atherosclerosis (Bninzell, et al., 1984).
Atherosclerosis is a multifactorial disease characterized initidly by fatty streaks and
endothelial lesions within the artcrial wall. Oxidized lipoproteins are taken up by
macrophages which are convened to foarn cells. Foam cells and activated endothelial
cells induce the reiease of growth factors that stimulate smooth muscle ce11
proliferation and migration resulting in complex plaque formation. The pathogenesis
of atherosclerosis causes occlusion of artenal vessels, endothelial apoptosis and
plaque r u p m (Ross, 1995, Ross, 1999).
A well established nsk factor for coronary heatt disease is the predorninance
of small, dense LDL particles in plasma (Austin, 1994, Austin and Edwards, 19%.
Krauss RM, 1994, Lamarche, et al., 1999, Slyper, 1994). A nurnber of potential
atherogenic mechanisms have been proposed. These include the association of srnall,
dense LDL particles with an atherogenic lipoprotein phenotype (Austin, et al., 1990).
increased susceptibility of small, dense LDL particles to oxidation (Austin, 1994,
Tribble, et al., 1995), and conformational diffennces within the apoB protein moiety
of small, dense LDL particles which nsult in reduced affinity of these particles for
the LDL receptor (Chen. et al., 1994, Galeano, et al., 1994). In addition, small, dense
LDL may contribute to the progression of atherosclerosis as these particles readily
infiltrate artenal tissues and are more avidly bound by arterial wall proteoglycans
(Krauss, 1998).
The sole protein constituent of LDL-particles including srnall. dense LDL is
apolipoprotein B. In addition, the central pmtein involved in many aspects of
dyslipidemia is apolipoprotein B. For example, lipopmtein disorders such as familial
combined h yperli pidernia (FCH) and familial h ypercholesterolemia (FH) are
characterized by increased levels of small, dense LDL particles (Kwiterovich and
Sniderman, 1983). In addition, h ypcrapolipopmteinemia is a c o m n li poprotein
disorder also characterized by inmased levels of small, dense LDL (Juo, et al.,
1997). Increased levels of apoB are attributcd to both decreased clearance of apoB-
containing particles and overproâuction of VLDL apoB-containing panicles and
apoB synthesis (Kwiterovich, 1988). It is therefore of great interest to understand the
mechanisms by which apolipoprotein B is regulated. Thus the focus of the present
study was to investigate the regdatory mechanisms which govem apoB mRNA
translation.
Apolipoprotein B 100 (apoB) is an important protein synthesized by the liver
which facilitates the transport of plasma VLDL and LDL. ApoB is the sole protein
constituent of LDL and is the ligand for the LDL-reccptor, which mediates the uptake
and clearance of LDL from plasma (Knott, et al., 1986a). The assembly and secrction
of apoB containing particles is a complex process involving the concerted interaction
of several components including apoB synthesis, microsomal triglyceride transfer
protein and the availability of cellular lipids such as triglycerides, cholesterol and
phospholipids (Adeli, et al., 1995). Ce11 culture studies have show that most newly
synthesized apoB is degraded intracellulary and only a small fraction is secreted into
lipoprotein particles (Yao and McLeod, 1994). in Hep02 cells, lipidation of the apoB
polypeptide occurs CO-translationall y; transi ation of apoB is not completed until
assembly of the lipoprotcin concludes (Pariyarath, et al., 201). The= are two
circulating forms of apoB-containing lipopmteins. ApoBlOO is essential for hepatic
assembly of VLDL particles and apoB48, which rcpresents the N-terminal portion of
apoB100, is essential for the assembly of chylomicrons. ApoB48 and apoBlOO are
encoded by the same gene. In hurnan intestinal cells, the apoB mRNA is edited at
nucleotide position C-6666 and mates a premature stop translation codon which
results in the huncated protein product.
1.2.1 Stmcture of the Human A m B Gene
The apoBlOO gene is located on the short ann of chromosome 2 (Knott, et al.,
1985). The gene consists of 28 introns and 29 exons and spans approximately 43 kb
of the genome (Blackhart, et al., 1986). Most of the exons are within 'normal' size
lirnits (between 35-600 base pairs) for eukaryotic cells; however, two are unusually
long, spanning 1906 and 7572 base pairs. The latter is exon 26 and is one of the
largest eukaryotic exons identified to date (Blackhart, et al., 1986). The apoB
promoter region consists of a classical TATA box located 29 nucleotides upstream of
the transcription start site as well as a CAAT box which is located 31 nucleotides
upstream of the TATA box (Blackhart, et al., 1986). Expression of apoB is tissue-
spécific and is lirnited to hepatocytes and enterocytes (Knott, et al., 1985). However,
recent evidence has show that the apoB gene is also expressed in human heart tissue
and in heart tissue of human apoB transgenic mice (Veniant, et al., 1999a, Veniant, et
ai., 1999b).
Transcription of the apoB gene involves the complex interaction of multiple
trans-acting protein factors with a number of cis-regulatory elements located within
the 5' promoter and intron regions. ' Positive cis-regulatory elements important for
apoB promoter function were first identified within the sequence -128 and -70 with
respect to the transcription start site @as, et al., 1988). The distal elernent (-128 to
-86) appears to be liver specific as it exhibits positive activity in HepG2 cells and
negative activity in HeLa cells. A tram-acting factor identified as BW-2, with a
molecular mass of 120 kDa has been shown to bind to this distal element (Zhuang, et
al., 1992). The proximal element (-86 to -70) exhibits stmng and mild positive
activity in HepG2 and HeLa ce11 lines, respectively, and interacts with DNA-binding
proteins from HepG2 and mouse liver nuclear extracts (Das, et al., 1988). Two rat-
liver nuclear proteins identified as BRF-I and C/EBP have ken shown to bind to
overlapping sites (-84 to -60 and -70 to -50) within this proximal element (Zhuang, et
al., 1992). Other investigators have identified cell-specific positive and negative
regulatory elements between positions -11 1 to -33 and one positive element within
the non-translated sequence of exon 1 (Carlsson and Bjursell, 1989). Karàissis et al.
also identified promoter elements downstream of -150 that may be important for
hepatic and intestinal transcription (Kardassis, et al.. 1990a). The specific regions
identified include positions -124 to -100, -97 to -93, -86 to -33 and +33 to +52;
sequences h m -86 to -33 interacted with multiple protein factors whereas the
sequence from -88 to -61 bound to only one nuclear factor and the specific binding
site for this factor was locaüzed to residues -78 to -68 (Kardassis, et al., 1990a). This
group also determined that the sequence-specific transcription factor NF-BAI binds
nucleotides -79 to -63 of the apoB pmnoter region and is essential for activation of
hepatic and intestinal apoB gene transcription (Kardassis. et al., 1990b). The binding
of NF-BA1 to promoter regions of other apolipopmteins such as a--III, apoA-II
and apoA-1 has ken identified and may regulate their expression (Kardassis, et al.,
1990b). Funher studies by this group detennined that apoB gene expression is
mediated by five regulatory elements within the promoter region -150 to +124 to
which multiple protein factors bind (Kardassis, et al., 1992). Two hepatic nuclear
factors, AF-1 (apolipopmtein factor 1) and CEBP bind the apoB promoter region
from position -86 to -52 (Metzger, et al., 1990). AF-I binds specificall y to the -86 to
-61 sequence and has also been shown to bind to promoter sequences within the
apoC-ïII, apoA-1 and apoC-II genes. The sequence from -69 to -52 binds the heat
stable hepatic nuclear factor C/EBP. Transcriptional activity is regulated by the
binding of both these factors to overlapping regions within the promotet sequence -- A -
(Metzger, et al., 1990). Further studies by this group determined that HNF-4 binds to
the AF-1 site and activates transcription in both HepG2 and IieLa ceil lines (Metzger,
et al., 1993). A nuclear protein identified as LJT1 binds to the proximal promoter of
apoB from nucleotides -79 to -65 while LiT2, another nuclear protein, binds
immediatel y downstrearn of LIT 1 (Carlsson, et al., 1990). These regions overlap
wi th those described for the NF-BA 1, AF-1 and CIEBP factors.
Regulatory regions within the fint non-coding exon have been reportcd '
(Carlsson and Bjursell, 1989, Das, et al., 1988, Kardassis, et al., 1990a). A negative
element was àetermined at +20 to +40 and a strong positive element was determined
at +43 to +53 for Hep02 cells which was mildly positive in HeLa cells (Chuang, et
al., 1995). Further studies characterized the trans-acting factors, BRF-3 and BRF-4,
which bind to the negative and positive elements, rcspectively, as proteins which
differ from knom hepatic factors (Chuang and Das, 1996). BRF-3 has been
subsequently purified and was found to be homologous to DNA topoisornerase 1
(Chuang, et al., 1999).
Tissue specific enhancers have also been localized to the second intron (+621
to +1064) (Brooks, et al., 1991) and third intron (+Io64 to +2977) (Levy-Wilson, et
al., 1992) of the apoB gene. The sequence from +806 to +940 is essential for
enhancer activi ty and liver-specific transcription factors such as HNF- 1, HNF-3
(Brooks, et al., 1991) and CEBP (Broûks and Levy-Wilson, 1992) bind to sites
within this sequence. The third intron contains putative sites that may bind to liver
specific nuclear factors (Levy-Wilson, et al., 1992). A negative element that reduces
promoter activity in apoB expressing ce11 lines has been localized from position -639
to -129 (Carlsson and Bjursell, 1989). An additional negative ngulatory region from
position -1802 to -3211 nduces expression of the apoB gene; specifically the
sequences from -2738 to -2470 and -21 18 and -1802 are necessary for reducing apoB
gene expression and are also binding sites for HepG2 nuclear proteins (Paulweber, et
al., 1991).
Regulatory elements specific to intestinal expression of apoB gene have been
localized to an 8 kB region spanning h m -54 to -62 kb 5' of the apoB gene (Nielsen,
et al., 1998) and more ncently to a 3 kb rcgion spanning from -54 to -57 kb (Antes, et
al., 2000). This 3 kb sequence contained intestine-specific enhancer activity for the
expression of the human apoB transgene in mice and had putative binding sites for
HNF-343, HNF-4 and CEBP (Antes, et al., 2000). It was recently shown that optimal
activity of the intestinal enhancer is achieved h u g h the interaction of these t h e
hepatic nuclear factors with specific' sites within this 315 bp sequence (Antes and
Levy-Wilson, 2001).
1.2.2 A~oïino~rotein B mRNA
ApoB mRNA is 14121 base pairs long and it encodes a 4563 amino acid
protein with a molecular weight of approximately 512 kDa (Knott, et al., 1986b). The
half-life of apoB mRNA in Hep02 cells is about 16 hours (Pullinger, et ai., 1989).
The 5' and 3'UTR sequences of apoB rnRNA are 128 and 304 base pairs in length,
respectively (Knott, et al., 1986b). The S'UTR sequence is comprised of 76% G + C
nucleotides. Analysis of the SWi'R reveals the presence of two GC boxes with the
typical CCGCCC sequence similar to promoter sequences of sorne eukaryotic genes - -
(Blackhart, et al., 1986). These two GC boxes are located at position -20 and -81
upstream of the translational start site. The 3WïR sequence is AU-rich and contains
a number of A and U npeats.
1.23 A~ol iw~mte in B mRNA Editing
There are two endogenous foms of apoB in the body, apoBlûû and apoB48,
which are distinct protein products encoded by the same 14 kb apoB mRNA. Both
serve diverse functions in the body: apoBl0 is involved in the endogenous pathway
of lipid metabolism and apo848 is important in the exogenous pathway (Chan, et al.,
1997). ApoBlûû represents the full-length protein consisting. of 4536 amino acid
residues and is synthesized exclusively in the human liver. ApoB48 represents the N-
terminal portion (2152 residues) of apoBl0 and is synthesized in the small intestine
(Olofsson, et al., 1987). The mechanism responsible for the generation of the
mincated apoB48 is a result of C to U RNA editing at position 6666 of the apoB
mRNA sequence. This converts the glutamine codon (CAA) at residue 2153 into an
- in-fiame stop translation codon (UAA) (Chen, et al., 1987, Powell, et al., 1987). The
enzyme responsible for the apoB editing is APOBEC-1, an RNA-specific cytidine
deaminase. Components such as the mRNA substrate, the catalytic subunit of the
APOBEC-1 (apoB mRNA editing catal ytic component 1) and auxiiiary proteins are
essential for apoB mRNA editing (Chester, et al., 2000); the multicomponent enzyme
complex has ken called an 'editosome'.
Studies using rat apoB mRNA have detemined that editing predominantly
occurs in the nucleus after splicing and polyadenylation (Lau, et al., 1991). However
ment studies have shown that overexpression of APOBEC-1 results in the
localization of this protein in both the nucleus and cytoplasm, suggesting that apoB
mRNA editing may occur in the cytoplasm (Yang, et al., 2000). APOBEC-1 was
initially cloned h m rat intestinal cells (Teng, et al.. 1993) and subsequently h m
human (Hadjiagapiou, et al., 1994, Lau, et al., 1994). mouse (Nakamuta, et al., 1995).
rabbit (Yamanaka, et ai., 1994) and opossum (Fujino, et al., 1999) cells. Tissue *
distribution of the protein is diverse for al1 species. APOBEC-I is expressed in the
intestine of al1 marnais and is also expnssed in the liver of mamrnals such as rat,
mouse, dog and home (Gmve, et al., 1993).
APOBEC-1 is a 27 kDa homodimenc protein with several important
functional domains including a catal ytidac ti ve site (w hich contains zinc-binding
si tes), the apoB rnRNA binding domain, a putative biparti te nuclear localization
sequence, and a Ieucine-nch c h x y temiinus (Anant and Davidson, 200 1, Davidson
and Shelness, 2000). The apoB mRNA editing mechanism is sequence- and
structure-specific requiring the presence of certain elements such as 'enhancer',
'spacer' and 'mooring' sequences within an AU-rich content (Chester, et ai., 2000)
(Figure 1). Sequence alignment of the apoB mRNA eàiting site reveaied that it is
highly conserved arnong marnmals (Richadson, et al., 1998). The 26 nucleotide
sequence h m 66624687 of apoB mRNA is necessary and adequaie for in vitro
editing; however, a specific 11 nucleotide sequence located from position 667 1-6681
is essential for editing and is identified as the 'mwring' sequence (Shah, et al., 1991).
Figure 1. Spatial Organization of Sequence Elements Rcquired for ApoB mRNA ----- - -
Editing.
A schematic diagram is shown displaying the spatial arrangement of domains
surroundhg the apoB rnRNA editing site at C-6666. The 'spacer' element, 'mooring'
sequence and predicted binding site of APOBEC-1 are displayed. Sequence
alignment indicated that the apoB mRNA editing site is highly conserved among
mammals. (Adapted from Chester et al. 2000)
5' Efficiency Efficiency Mooring 3' Efficiency element sequence sequence elemen t
elernent Spacer elemen t
l
Figure 1.
17
-
Mutations in this 11 base pair region result in significantly diminished editing in vitro --- -- -
(Shah, et al., 1991). In addition, a 'spacer' sequence, 4 nucletides in length, located
between the edited cytidine at 6666 and 'moonng' sequence is also essential for
editing (Backus and Smith, 1992). A regulator element consisting of 4 nucleotides
located irnmediately upstream of the C-6666 is also involved in editing (Chan, et al.,
1997). There may also be efficiency elements located 5' and 3' to these regions which
participate in editing (Hersberger and Innerarity, 1998).
Using cornputer modelling, a highly conserved stem-lwp structure has ken
pndined for the apoB mRNA sequence with the edited cytidine nucleotide located
within the loop (Davies, et al., 1989, Navaramam, et al., 1993, Shah, et al., 1991).
The fonnation of the stem loop within the editing site has been demonstrated and it
has been suggested that the structure exposes the cytidine to the catalytic subunit of
APOBEC-1 for deamination (Richardson, et al., 1998). A ment study inâicates that
the active site of the APOBEC-1 catalytic subunit binds to a high affinity consensus
binding site located wi thin the AU-rich region of the 'moonng' sequence (Anant and
Davidson, 2000). Interestingly, the sarne study determined that overexpression of
- APOBEC-1 stabilizes c-myc mRNA as a result of the binding of APOBEC-I to the
same consensus site which is localized within the 3WïR of c-myc mRNA (Anant and
Davidson, 2000).
Although APOBEC- 1 is essential for editing, other auxiliary protein factors
are also necessary. Recently, an auxiliary factor identified as ACF (APOBEC-1
complementation factor) or ASP (APOBEC-i stirnulating protein), with a predicted
molecular mass of 64 kDa, has ken cloned by two independent groups (Lellek, et al.,
2000, Mehta, et al., 2000). Both factors appear to be identical with the exception of a
24 nucleotide insertion found in the cDNA denved from the liver ASP (Anant and
Davidson, 2001). It was demonstrated that APOBEC-1 and ACF physically interact
and that ACF binds to apoB mRNA; furthemore, it was suggested that both elements
fonn the minimal protein requinments for in vitro editing (Mehta, et al., 2000).
Another protein factor called GRY-RBP, which is a hornolog of ACF, was recently
identified to interact with APOBEC-1, ACF and the apoB rnRNA. GRY-RBP binds
to ACF and results in the inhibition of apoB mRNA editing, since ACF is no longer
available to bind apoB mRNA (Blanc, et ai., 2001). GRY-RBP was also recently
identified by Lau et al. &au, et al., 2001).
ApoB mRNA editing is influenced by dietary factors and hormones (reviewed
in (Chan. et al., 1997)) including thyroid hormone @avi&on, et al.. 1990), insulin
(Thomgate, et al.. 1994) and growth hormone (Linden, et ai. 2000). in addition,
editing is also affected by dexarnethasone (Lorentz, et al., 1996) and extracellular
calcium (Chen, et al., 2000).
1.2.4 Structural Domains of ADOB Protein
Apolipoprotein B is a very large polypeptide with a predicted molecular mass
of appmximately 512 kDa (Cladaras, et al., 1986). A 27-amino acid residue signal
peptide, directly preceding the 4536 amino acid residues of the mature protein, is
cleaved pnor to secretion (Knott, et al., 1986b). The apoB sequence contains several
structural featwes that facilitate the association of lipids with the polypeptide. Om
such feature includes short suetches of arnphipathic alpha helices located in two
clusters smunding residues 2103-2560 and 40614338 (Segrest, et al., 1994). These
amphipathic alpha helices are not thought to interact with the ER membrane as the
regions are belicved to be too short (Segnst, et al.. 1994).
Another structural feature noted ihroughout the apoB sequence is amphipathic
beta strands which contain altemating hydrophobic and hydrophilic surfaces (Knon,
et al., 1986a). Segrest et ai. proposed that the apoB sequence contains a pentapartite
structure comprised of altemating amphipathic aipha helices and beta strands (NH2-
al -p 1 s2-~2-d-COOH) with al npresenting the N-terminal globular domain of
apoB (Figure 2) (Sepst, et ai., 1994). The pl and 82 domains are thougbt to interact
with the triglyceride core of the lipoprotein through their hydmphobic surfaces
(Segrest, et ai., 1998).
In addition, stuâies have detennined that the four altemating lipid domains
(p 1 -aZ-j32-a3-COOH) are conserved structural features found in the apoB 1 O0
sequmces of 9 other vertebrate species (Segnst, et al., 1998). Funhennore, an N-
terminal portion of apoB (1000 residues comprised of the al domain and 200 residues
of the pl domain) was deterrnined to have amphipathic motif homology to the lipid
binding pocket of lamprey lipovitellin (Segrest, et al., 1998). The al domain of
apoB 100 was also shown to have sequence and amphipathic motif homology to
rnicrosomal triglyceride transfer pmtein (MTP) (Segrest, et al., 1998). Based on
structural similarity to lipovitellin, these findings suggest that the N-terminal portion
of apoB may also fom a lipid pocket and may potentially interact with hiTTP during
assembl y of apoli poprotein B-containing particles (Segrest, et al., 1998).
Figure 2. Spahi Organization of the S t~c tu ra i Domsins =--- -
Apolipoprotein B Sequence.
A diagram outlining the positions of the thm alpha helices
within the Human
and two beta sheet
domains located within the pnmary structure of apoB 100. The N- and C-temiinal
domains are indicated. (Adapted from Davidson & Sheiness, 2000)
Figure 2.
22
Chatterton et al. (Chatterton, et al., 1995) proposed a 'ribbon and bow' mode1
for the conformation of apoB on the lipoprotein surface. The first 89% of apoBlOO
foms a nbbon-like structure that wraps once around the LDL with the ribbon
structure capable of pcnetrating the LDL con. The C-tenninal 11% of the apoB
foms an elongated structure or 'bow' which stretches back and crosses the ribbon
near the binding site for the LDL receptor. This suggests that the C-terminal
sequences may interfere with LDL-receptor binding (Chatterton, et al.. 1995).
ApoB 100 contains 25 cysteine residues. Of these cysteines, 8 form disulfide
bonds and link together the hydrophobic regions of apoB. Fourteen cysteine residues
lie within the N-terminal region of apoB (Yang. et al., 1986). Structures formed by
disulphidc bonds an thought to be important for proper assembl y of lipoproteins
(Shelness and Thomburg, 1996). There are seven cysteines present in the C-temiinal
portion of the apoB sequence. One of these cysteine residues of apoB, Cys-4326, was
determined to form a covalent linkage to lipoprotein (a) in vivo (Callow and Rubin,
1995).
There m 20 putative N-linked gl ycos ylation sites distributed throughout the
apoB primary sequence with a cluster localized to resi'dues 3 197-3438 (Knott. et ai.,
1986b). Carbohydrate moieties have been linked to 16 of these sites (Yang, et al.,
1989). The molecular mass of apoB on an SDS-gel is 550 kDa; this is thought to be a
result of glycosylation since 840% of .apoBlOO mas consists of N-linked
oligosaccharides (Knott, et al., 1986b). Hephn binding sites have also been
characterized near the C-terminal ngion of apoB (Elirose, et al., 1987).
The LDL-nceptor binding domain is located in the C-terminal portion of
apoB, specifically from residues 3345-3381 (Yang, et al., 1986). A similar sequence
has been found in the LDL-receptor binding region of apoE (Knott, et ai.. 1986a).
ApoB-LDL binding to the LDL-receptor is thought to occur via the interaction of
negatively charged amino acids within its domain to positively charged residues
prcsent in the LDL-receptor (Brown and Goldstein, 1986). Recent studies have
identified nsidues 3359-3369 to be essential for the binding of apoB to the LDL
receptor (Bonn, et al., 1998).
1.23 Transcri~tionai Remilation of the AmB Gene
To date, acute ngulation of apoB expression appears to occur pst-
transcnptionally as levels of apoB mRNA remain stable under acute metabolic
stimuli (Yao and McLeod, 1994). For example, metabolic States, such as fasting and
carboh ydrate overloading, alter apoB secretion without altering apoB mRNA levels
(Lusis, et al., 1987). Similarly, oleate and butyrate treatment of HepG2 cells resuited
in increased apoB secretion with no change in apoB mRNA levels (Dashti, et al.,
1989, Kaptein, et al., 1991, Moberly, et al., 1990. Pullinger, et al., 1989). In addition.
an insulin-modulated decrease in the net accumulation of apoB appears to k a nsult
of a pst-transciptional mechanism since apoB mRNA levels were not altered by
hormone treatment (Dashti, et ai., 1989, Rillinger, et al., 1989). There are some
studies that suggest that steady state levels of apoB mRNA may be altered resulting in
a concomitant increase in hepatic apoB secretion. A recent study found that a
polymorphism at position -5 16 of the apoB promotor sequence increases transcription
of the apoB gene resulting in significantly higher levels of LDL paxticles in plasma
(van 't Hooft, et ai., 1999). In another study, transcription of the apoB gene was
silenced in Hep02 cells as a result of a single in vitro point mutation to nucleotide
+51 within the positive element (+43 to +53) located within the non-translated exon
(Chuang and Das, 1999).
Cell culture studies in HepG2 cells found that treatment with 25-
hydroxycholesterol (Dashti, 1992), exogenous VLDL (Wu, et al., 1994) and low
concentrations of arnino acids (Zhang, et al., 1993) nsulted in increased apoB
secretion and increased mRNA levels. However, in some of these cases the increase
in mRNA was modest and disproportionate to the apoB secreted. A study in McArdle
rat hepatoma cells stably transfected with human apoB53 and human apoBlOO
ckmonstrated that increased steady state levels of human apoB mRNA led to
incnased secretion of human apoBcontaining lipoproteins (Selby and Yao, 1995).
Sowden et al. detedned that McArdie cells stably transfected with BMHT cDNA
induced apoB M A abundance and apoB secretion (Sowden, et al., 1999). In
addition, studies of transgenic mice overcxpressing the human apoB gene found that
increased transgene copy numkr was correlated with increased plasma apoB and
LDL levels (Callow, et al., 1994, Linton, et al., 1993, McConnick, et al., 1996).
1.2.6.1 Tmnsloc~'ona1 Contml of AmB
The efficiency of translocation and transport rate of apoB out of the ER are
important factors which may play a role in detcrmining whether apoB will be secreted
or subject to intmcellular degradation. ApoB that fails to pmperly assemble into a .
lipoprotein becomes membrane bound and is only panially translocated (Boren, et al.,
1990). Early studies by Boschardt et al. in rat hepatocytes determined that
inefficientl y tnuislocated apoB was degraded intracel1 ulari y (Borc hardt and Davis,
1987). Important factors in the modulation of translocation include lipid availability
and conformation of the apoB (Macxi and Adeli, 1997). The coupling of translation
and translocation is thought to occur in a regulated manner due to the tight junction
fonmd between the ribosome and the Sec6lp translocon. Several studies have
suggested that apoB is not exposed to the cytosolic surface of the ER during
translocation (Pease, et al., 1991, Shelness, et ai., 1994). However, othet studies have
&temiincd that apoB may be exposed to the cytosol when translocation of apoB is
incomplete (Cartwright, et al., 1993, Davis, et al., 1990, Dixon, et al., 1992).
Studies by Chuck and Lingappa proposed that translocation of apoB is
determined by 'pause transfert scquences within the apoB sequence (Chuck, et al.,
1990). Further studies determined that pauses in translocation mediated by the pause
transfer sequences located dong the apoB nascent chah function independently and
separatel y from translation (Chuck and Lingappa, 1992, Chuck and Lingappa, 1993).
Studies by Pease et al. (Pease, et al.. 1995) suggested that the transmembrane
arrangement of apoB is due to translationai pausing caused by persistent tRNA
association with the growing apoB polypeptide chah. A study by Du et al. (Du, et al.,
1994) âetermined that an anest in translocation acurs after the first 85 kDa of apoB
is synthesized resulting in a transmembrane arrangement of apoB in which a large
portion of apoB is situated on the cytosolic side of the ER. The translocation amsted
apoB may undergo pmteol ytic cleavage and nsult in translocation and secretion of
the N-terminal85 kDa fragment o u , et al., 1994).
1.2.6.2 Assemblv & Secretion of ADoB-Containinn Livo~roteins
The assembly of VLDL appears to involve two independent but concurrent
steps. The first step involves the formation of two precursors including a partially
lipidated p r e - W L particle and a VLDL-sized lipid droplet which lacks apoB. The
second step involves the fusion of the two pncursors of the first step and will k
discussed later in this section (Olofsson, et al., 1999).
The first step in the assembly of VLDL occm in the rough ER and proàuces a
pre-VLDL particle. It involves the simultaneous lipidation of apoB as it is king
translated and translocated through the translocon (Olofsson, et al., 2000). The co-
translational lipidation of apoB is catalyzed by MTP. MTP consists of a heterodimer
of protein disulphide isomerase and a specific 98 kDa pmtein subunit. The function of
MTP is io transfer lipids such as phospholipids, cholesterol esters and triglycerides.
It is localized in the ER and is expressed in the liver and intestine (Wetterau and
Zilversrnit, 1986). The details involving the mechanism of MTP action are not fully
known. Gordon et al. (Gordon, et al., 1996) proposed that dunng the first step of
assembly, MTP transfers lipids in the ER to apoB during the pmcess of translation
and translocation.
Several studies have indicated that MTP activity is cntical for apoB assembly.
Abetalipoproteinernia is a disease caused by a defect in the gene for MTP and is
associated with negligible levels of plasma apoB and apoB-containing lipoproteins.
Studies by Du et al. (Du, et al., 19%) determined that translocation of apoB is
27
blocked in abetalipoproteinemia. A ncent study in HepGZ cells detennined that
matment with an MTP inhibitor resulted in an accumulation of apoB in the
translocon and that this accumulation led to reduced apoB synthesis (Pan, et al.,
2000). Other studies have shown that apoB and MTP physically interact through
specific binding sites which have been identified on both apoB (Hussain, et al., 1998)
and on MTP (Bradbury, et al., 1999). MTP binding sites on apoB are localized to
amino acids 430-570 which lie within the al domain (Hussain, et al., 1998). The
interaction of apoB and MTP appears to be essential for efficient VLDL assembl y as '
mutations in the binding sites of MTP have been show to block VLDL assembly
(Bradbury, et al., 1999).
The second component of the first step in VLDL assembly are VLDL-like
lipid droplets which lack apoB. This VLDL-liike droplet has been localized to the
smooth endoplosmic reticulum and fonns the lipid core of the mature VLDL particle.
The mechanism of production of this apoB-fne droplet is unknown (Olofsson, et al.,
2000). MTP activity is thought to participate in the assembly of these apoB-free
Qoplets; this was infemd h m studies using biockout mice which failed to produce
such particles (Raabe, et al., 1999). The fusion of the pre-VLDL particle with the
apoB-fm droplet occurs before secretion from the ER and is believed to occur within
the smooth tennini of the endoplasmic reticulum (Olofsson, et al., 1999). The
mechanism involved in this process has not been elucidated but is thought to k
independent of MTP activity and involves ADP-ribosylation factor 1 and
phospholipase D (Olofsson, et al., 2ûûû). VLDL assembly is also thought to involve
molecular chaperones such as BiP (binding protein), caireticulin. calcium binding
protein 2 (CaBP2), glucose reg ulatory protein 94 (GRP94) and pro tein disulphide
isomerase (PDI) (Olofsson, et al., 2000).
1.2.6.3 Intmcellulor D e m o n of AvoB
ApoB degradation was fint described by Boschardt and Davis (Borchardt and
Davis, 1987). Since then, numerous studies have provided abundant evidence
suggesting that a significant portion of newly synthesized apoB is rapidly degraded at
different stages of the secretory pathway (reviewed in (Davis, 1999, Yao, et al.,
1997).
Degradation primarily occurs in a pn-Golgi compment and is independent
from the lysosomal pathway (Adeli, 1994, Borchardt and Davis, 1957). Many studies
suggest that intracellular degradation of apoB is mediated by the cytosolic
proteosome and that nascent apoB chains an ubiquitinatcd, a process associated with
activity of the proteosome (Benoist. and Grand-Perret, 1997, Fisher, et al., 1997,
Yeung, et al., 1996, Zhou, et al., 1998). A recent study detennined that apoB remains
associated with the translocon during CO-translational Iipidation until it is sufficiently
lipidated (Pariyarath, et al., 2001). Thenfore, the nascent apoB chain may interact
with the cytosolic chaperone, Hsp70, kcome ubiquitinated and subsequently be
targe ted for proteosomal degradation (Benois t and Grand-Pem t, 1997, Fisher, et al ., 1997, Yeung, et al., 1996, Zhou, et ai., 1998) under conditions where assembly is not
favourable (ie. insufficient lipids). MTP activity also appears to play a role in
protection of apoB from proteasomal degradation. Studies by Benoist and Grand-
Perret found that in the presence of MTP inhibiton, CO-translational degradation of
apoB was enhanced (Benoist and Grand-Perret, 1997).
To date, saidies have suggested several possible mechanisms of apoB
degradation including cytosolic proteosomal degradation. ApoB appeam to be
degraded as it is ~ranslated/translocated via the original transiocon (Liang, et al.,
2000). Altematively, fully iranslocated apoB may be retro-translocated from the
lumen to the cytosol via the translocation channel (Davis, 1999). Apo B degradation
rnay also occur pst-translationally and after translocation into the ER via a non-
proteosomal system (reviewed in (Davis, 1999, Yao, et ai., 1997). Post-translational
degradation may result in the generation of distinct degradation intemediates (Adeli,
1994, Cavallo, et al., 1999, Du, et al., 1994, Sallach and Adeli, 1995). For example, a
prominent 70 Wla fragment âetected was determined to be N-terminal in nature
(Sallach and Adeli, 1995). Additional studies by Adeli et al. identified an ER60
protease that associates with apoB and may potentially be involved in its pst-
translational degradation (Adeli, et al., 1997).
1.2.7 Translational Remilation of AmB Svnthesis
hvious stuàies in our laboratory have examined translational control of apoB
- mRNA. Using a HepG2 ce1l-k translation system, we have shown that the
translational efficiency of apoB mRNA was decreased by 52.6% in nsponse to
insulin treatrnent (Adeli and Thenault, 1992). ApoB mRNA levels were unaffected
by insulin treatmmt which suggests that insulin inhibited translation of apoB mRNA.
Thyroid hormone treatment increased apoB synthesis in vitro by 50-6096 (Thenault.
et al., 1992b). nie incrase in apoB spthesis was partially attributed to
transcriptional effects since thyroid hormone treatment also increased apoB mRNA
levels by 25-368. This modest increase in apoB mRNA may not h l l y account for
the o b w e d incnase in protein - 5 - -
exen its effects at the level of
synthesis suggesting that thymid hormone may also
translational control. Other studies in primary rat
hepatocytes have shown that insulin suppresses apoB secretion in part by stimulating
degradation of freshly translated apoB and also by reducing apoB synthesis. It was
suggested that reduced apoB synthesis is a result of decreased translational eniciency
(Sparks and Sparks, 1990). Additional studies in streptozotwin-induced diabetic rats
have provided further evidence of apoB mRNA translational control. Demased
apoB synthesis observed in primary hepatocyte cultures derived h m these diabetic
nits wes believed to be due to reduced translational efficiency. This was found to be
a result of impaired or slowed translation rates as detedned by ribosome transit
studies (Sparks, et al., 1992). Comsponding apoB mRNA levels wen not
significantly altered suggesting a post-transcriptional mechanism was involved in the
reduced hepatic output of apoB in these rats. Another study in cultured human fetal
intestinal cells determined that insulin treatment resulted in a reduction of apoB48
and apoBlOO secretion but did not change apoB mRNA levels suggesting CO- or post-
translational modulation (Levy. et al.. 19%). A r emt study in Hep02 cells found
that apoB synthesis decnased in rcsponse to trcatment with CP-10447, an inhibitor of
microsomal triglycende transfer protein (MTP) (Pan, et al., 2000). The decrease was
attributcd to a translational effect as apoB mRNA levels remained unchanged in
nsponse to the MTP inhibitor. The authors postulated that the decrease in apoB
translation was due to delayed poiypeptide elongation rates as determined by
synchmnization studies with puromycin and by ribosome transit studies (Pan. et al..
2000).
Ovedl, these studies provide evidence indicating that apoB synthesis may be -
~gulated at the level of translation. However, the molecular mechanisms or factors
which mediate translational control of apoB mRNA have not ken elucidated.
1.3 Factors in Tmnslational Conirol
Important factors to consider in translational control include the initiation of
translation which involves the binding of eukaryotic initiation factors to the 5' cap and
subsequent scanning of the 40s ribosomal complex for the fint AUG codon.
Recognition of the AUG codon is dependent on the context and position of the AUG
codon and the presence of upstream AUG codons may modify the translation process.
Secondary structure and sequence elements within the UTRs are also factors that
modulate translational contml. Furthemore, interaction of RNA-binding proteins
with specific sequences or sûuctures within the UTR regions also influences
translational contml and mRNA stability.
1.3.1 Initiation
The most complex stage of eukaryotic translation is initiation; it involves the
interaction of several eukaryotic initiation factors (eIFs). Initiation of translation
begins with the binding of eF4E to the 7-methyl guanosine cap structure at the 5' end
of the mRNA. Another factor, eIF2 binds to the initiating methionyl-tRNA (Met-
RNA) and a GTP molecule in a temary complex and places this complex on the
smaller 40s ribosomal subunit. The capbinding protein eIF4E also binds to another
factor, eIF4G. which has binding sites for the additional factors, eIF3 and eIFA. The
function of eIF3 is to facilitate the binding of the temary complex to the 40s
ribosome subunits. Another complex, eIF4F. is a large protein complex consisting of
factors eIF'4E. eIF4G and eIF4A. Al1 of the key components, Met-tRNAf, 40s
ribosomal complex and mRNA are brought together by the bridging functions of
eIF4G and elF3 (Clemens and Bommer, 1999). Translation initiates when the QOS
subunit complex scans the S'UTR for the first AUG or start codon in a favourable
context. The optimal context for efficient translation is the localized presence of A or
G at -3 and G at +4 relative to the start codon where position +l is A of the AUG
codon (Kozak, 1989b, Kozak, 199 1).
13.2 Leakv Scanning
The scanning mode1 suggests that initiation of translation engages at the first
AUG codon encountered by the 40s ribosomal complex in a favourable context
(Kozak, 1989b). However, in some cases, leaky scanning occun when the first AUG
codon is in a poor context and is consequently by-passed by many 40s ribosomal
complexes. Initiation occurs downstnam at an AUG codon in a stronger context.
- This results in the translation of two different products if both AUGs are in different
reading € m e s and are not separated by a termination codon (Pain, 1996).
Altematively, two functional long and short foms of the encoded protein are
produced as a result of leaky scanning (Kozak, 1999).
1.33 U~stream AUG codons
The presence of upstnam AUG codons or open reading frames leads to
reinitiation of the nôosorna1 complex. An upstream AUG codon in a strong context
inhibits translation of the authentic protein as it intercepts the scanning 40s ribosomal ---- .&.
subunit. Upstream AUG codons are usually followed by in-frame termination
codons, the result of which is a short peptide (Pain, 19%). Reinitiation at the
authentic AUG codon occurs efficiently when the upstrearn open reading fiame
(uORF) terminates some distance before the start site of the authentic initiation
codon. A pa te r distance allows for the 40s ribosomal subunit to nacquire the
Met-tRNAeeiF2 such that the downstream AUG codon will be recognized (Kozak,
1999). Translation ngulation imparted by uORFs is important for regulatory proteins
such as proto-oncogenes whose averexpression would be deletenous to cells; such
exarnples include BCL-2, a protein that is involved in apoptosis and c-mos protein
which is involved in the control of meiotic ce11 cycle (Willis, 1999).
13.4 Intemal Ribosome Entw SItes
A mechanism by which rnRNAs having long and highly structured S'UTR
regions may be expressed are by the presence of intemal ribosome entry sites (IRES)
which are capable of initiating capindependent translation (Willis, 1999). This
mechanism of translation is cornmon to picomaviruses as their mRNAs are uncapped,
their S'UTRs are long and incluàe regions of stable secondary structure capable of
preventing the scanning of the 40s ribosome complcx (Pain, 19%). Intemal initiation
is thought to occur by two mechanisms: type 1 involves two steps, the first of which is
the binding of the 40s ribosomal subunit to the IRES followed by scanning of the
subunit to the AUG codon; type II IRES elements bind ribosomal subunits directly at
the start site AUG codon (Sachs, et al., 1997). A cornputer generated common RNA
structural motif for the intemal initiation of translation of cellular mRNAs has been
pioposed; structural analysis reveals a Y-type stem-loop structure with an additional
stem-loop present at the 3' end of the leader sequence (Le and Maizel, 1997).
Specific or common sequence elements for IRES have not been identified to date
(Kozak, 1999). Cornmon featms associated with rnRNAs that employ this method
of initiation include the presence of upstnarn AUG codons, highly structured UTR's
several hundred base pain in length and a polypyrimidine tract (Sachs, et al., 1997).
Several cellular rnRNA's which encode proto-oncogenes and other factors related to
ce11 proliferation such as FGF-2, PMiFUc-sis, VEGF and eIF4û are thought to be
translated by this rnechanism (Akiri, et al., 1998, Bernstein, et al., 1997, Sehgal, et al.,
2000, Vagner, et al., 1995). IRES elements were also identified in other cellular
rnRNAs such as human irnmunoglobulin heavy chah binding protein (BiP) and
insulin like growth factor-II (Akiri, et al., 1998). Trans-acting factors, such as the La
autoantigen i d PTP (poly-pyrimidine tract binding protein), have ken shown to
bind to various IRES elements enhancing the initiation of intemal ribosome entry and
translation (Sachs, et al., 1997). A recent nview questions the validity of such
pmtein factors since the stimulation noted was in nsponse to an unnaturally high
concentration of the protein factor (Kozak, 1999).
13.5 mRNA Stabilitv
Stability and degradation of rnRNAs are govemed by cis-acting regulatory
sequences within the mRNA and trans-acting proteins which bind to such sequences
(Brennan and Steitz, 2001). Stuctural components of an rnRNA involved in rnRNA
stability include the 5' cap structure, the S'UTR, the protein coding region, the 3'UTR
and the 3'-polyadenylate tail (poly(A) tail). Interaction of the highly expressed poly
(A) binding protein with the poly(A) tail confers stabililty to the mRNA (Gao, et al.,
2000).
One mechanism of mRNA decay is the deadenylation-dependent pathway
which involves deadenylation of the poly(A) tail. Deadenylation is mediated by
poly(A) ribonuclease activity (Brennan and Steia, 2001). In yeast, it has k e n shown
that deadenylation is usually followed by decapping; however, direct evidence
suggesting such an occurrence in marnrnalian cells has not been eluciâated
(Guhaniyogi and Brewer, 2001). Deadenylation leads to degradation of the mRNA in
a 3' to 5' direction and also in 5' to 3' direction should decapping activity occur.
Nonsense-mediated mRNA decay is a pathway in which aberrant mRNAs an
degraded. This process eliminates aberrant rnRNAs resulting from e m in
transcription, splicing or replication that would produce truncated protein products.
The molecular mechanism has not been elucihted however it was suggested that
decay initiates by decapping.of the mRNA at the 5' end (Czaplinski, et al., 1999).
Degradation may also occur independently from deadenylation through
endonucleolytic activity that cleaves the mRNA within the coding region and
produces two fragments. The 5' fragment may undergo 3' to 5' decay and the 3'
fragment may undergo 5' to 3' decay (Guhaniyogi and Brewer, 2001). Examples of
marnmalian mRNAs degracied by endonucleolytic activity include insulin-growth
factor 2 and the transferrin receptor (Guhani yogi and Bnwer, 200 1).
Sequence elements such as ARE (AU-nch element) regions located within the
3'UTR of a rnRNA are important regulators of mRNA decay. Such regions consist of
multiple stretches of poly(A) and poly(U) residues and are featured by variable
repeats of an AULTUA pentamer that are most often localized to an U-nch region
(Guhani yogi and Brewer, 2 0 1). ARE regions target the rnRNA for degradation and
thus are usually destabilizing elements. Many ARE-binding proteins have been
described and their interaction with ARE regions may alter stability of the mRNA
(Guhaniyogi and Brewer, 2001).
1.3.6 Secondarv Structure and Seauence Elements within UTR Seauences
Secondary structure within the S'UTR and sequence specific signais such as
upstrrarn AUG codons impact efficient translation by àisrupting the scanning of the
ribosome initiation complexes. Stable secondary structures located in close proxi mi ty
to the 5' cap interfere with the binding of the 40s ribosome complex, whereas
secondary structure located further downstream interferes with the scanning of the
40s ribosome complex (Kozak, 1989b). The presence of a stem-lwp structure with a
stability of -30 kcaVmol located in close proximity to the 5' cap (12 nt from the cap)
interferes with the binding of the 40s ribosome complex and impairs translation.
When this stem-loop was situated 52 nt away h m the 5' cap. the bound 40s
ribosome complex was able to pmetrate the secondary structure and did not inhibit
translation (Kozak. 1989a). However, the presmce of stable stem-loop structures
(AG = -61 kcallmol) located downstream of the 5' cap interferes with the scanning of
the 40s ribosome complex and impedes translation (Kozak, 1989a, Kozak, 1989b).
Initiation factor eF4A is activated by eIF4B and possesses ATP-dependent RNA
helicase ability. Thus, the repression imposed by highl y stnictured S'UTR's may be
reduced by the unwinding capabilities of eIF4A (van der Velden and Thomas, 1999).
Furthemore, the stability of the secondary structure encountered modulates the
unwinding capability of eIF4A (Rogers, et al., 2001). Messenger RNA's containing
stable secondary structure in their UTR's with a Gibbs energy of formation in the
range of -50 kcaVmol resist melting and efficient translation is inhibited (Kozak,
1986). Leader sequences high in G+C content lead to secondary structure formation
which may attenuate scanning of the 40s ribosomal complex (Kozak, 1999). It is
well established that efficient translation of leader sequences having stable secondary
structure is sevenly impeded. Conversely, in some cases, the presence of secondary
structure facilitates initiation of translation. Secondary structure situated near the
beginning of the protein-coding sequence slows scanning and allows for recognition
of the AUG codon; this is especially important for AUG codons in a non-favourable
context (Kozak, 1990).
1.3.7 Evidence of Translational Contml Mediated bv UTR Seauences
Several snidies in literatun suggest that secondary st~~cture and sequmce
elements within the 5' and 3'UTR sqwnces rnediate translational control. These
structural features or elements may be potential binding sites for RNA-binding
proteins; the interaction of cisclements with trans-acting factors may modulate
translation or alter stability of the message (McCanhy and Kollmus, 1995).
Ornithine decarboxylase mRNA is translated inefficiently due to the presence
of a stable stem-loop structure and an upstream AUG codon located within its S'UTR
(Manzella and Blackshear, 1990). Similarly, translation of muscle ac ylphosphatase
mRNA is inhibited by the presence of stable secondary stnictun and an upstream
AUG codon (Fiaschi. et al., 1997). Funher studies detemiined that RNA binding
proteins interact with the S'UTR of muscle acylphosphatase (Fiaschi, et al., 2000). In
another study, the presence of an element within the SWïR of human heat shock
pmtein 70 mRNA enhanced translation and was found to be essential for efficient
translation of its rnRNA (Vivinus, et al., 2001).
A very recent study determined that proinsulin biosynthesis is determined by
the cooperative interaction of the 5' and 3'UTR sequences in glucose-stimulated
translation of preproinsulin mRNA in the pancmas (Wicksteed et al., 2001). The
S'UTR of the preproinsulin mRNA contains an element that foms a stem-loop that is
believed to be important for glucose-stimulated translation. The 3VTR contains a
conserved sequence WGAA that increases the stability of the pmproinsulin rnRNA
but is klieved to decnase glucose-stimulated translation (Wicksteed, et al., 2001).
The interaction of specific elements within UTR sequences and RNA-binding
pmteins may lead to the stabilization of moderatcly stable stem-loop structures
present within the UTRs. Such is the case with the iron-responsive element (IRE).
which forms a stem-loop structure, and is present within the S'UTR of femtin mRNA.
The IRE on its own does not inhibit translation of the mRNA; the binding of iron
regulatory protein (IRP) to the IRE results in stabilization of the stem-loop and
subsequentl y inhibits translational initiation of ferritin mRNA (Cazzola and Skoda,
2000). IRE elements are also present in the 3'UTR of transfemn receptor mRNA.
Binding of IRP to the IRE stabilizes the stem-lwp structure (McCarthy and Kollmus,
1995). This leads to increased stability of the transferrin receptor rnRNA which
nsults in increased translation of the message (Guhaniyogi and Bnwer. 2001). The
affinity of the IRP to the IRE elements present with the 52TTR of ferritin mRNA and
the 3'UTR of transferrin receptor mRNA is regulated by imn levels.
Other studies have identified elements within the 3'UTR sequences that are
important in translational control. For exarnple, the 3WïR of rabbit erythroid
lipoxygenase mRNA contains a repeated pyrimidine-rich domain to which a 48 kDa
prolein binds and rrsults in the inhibition of translation (Ostareck-Lederer, et al.,
1994). The fint 40 nucleotides of the 3'UTR of lipoprotein lipase mRNA binds to a
specific trans-acting factor which is produced in epinephrine-treated adipocytes and
results in the inhibition of translation of the lipoprotein lipase mRNA (Yukht, et al.,
1995). Further studies in a diabetic rat mode1 found that low levels of lipoprotein
lipase were due to decreased translation of the lipoprotein lipase mRNA
(Ranganathan, et al., 2ûûû). The decruise was amibuted to the interaction of an
unidentified RNA-binding protein t o a sequence within the 3'UTR of lipoprotein
lipase rnRNA; furthemore, this gmup detennined that the RNA binding motif was
distinct from that which bound to the epinephnne induced RNA-binding protein
(Ranganathan, et al., 2000). In addition, fibronectin mRNA translation is enhanced
by the binding of microtubule-associated protein 1 light chain 3 (LC3) to AU-rich
ekments present within the 3'üTR of fibronectin mRNA (Zhou. et al., 1997. Zhou
and Rabinovitch, 1998).
1.4 Ratconale for Studyinn AD& mRNA Tm~sCational Controt --
It is clear that RNA-protein interactions are important for several cellular
processes involving mRNA translation and stability. The focus of the present study
was to investigate the molecular mechanisms that govem translational control of
apoB rnRNA. Sequence and structural elements localized to the 5' and 3' untranslated
regions (Un) of M A ' S are believed to play a significant mle in translational
control and such regions may contain cis-regulatory elements. Suc h elements are
thought to regulate mRNA translational efficiency and stability and rnay be potential
binding sites for trans-acting cytoplasmic factors such as translation initiation factors
(McCarthy and Kollmus, 1995).
Investigation of the 5' and 3'UTR sequences of apoB mRNA revealed
elements with the potential to form stable secondary structure which in tum may
mediate translational control of apoB mRNA translation. ApoB mRNA is 14 12 1 base
pairs long and its 5' and 3'UTR sequences are 128 and 304 base pairs in length,
respectively (Knott, et al., 1986b). The 5'üTR sequence is comprised of 76% G + C
nucleotides. G + C-rich regions have a high potential for forming stable secondary
structure (Kozak, 1991). Studies have shown that highly stnictured S'UTR sequences
tend to inhibit efficient translation (Kozak, 1989a, Kozsk, 1991). Analysis of the
S'UTR reveals the presence of two OC boxes with the typical CCGCCC sequence
similar to promoter sequences of some eukaryotic genes (Blackhart, et al., 1986).
These two GC boxes are located ai position -20 and -81 upstream of the translational
start site; their rote in mRNA translation is unknown. Between these two GC boxes is
a GAGGCC doublet (Figure 3). The 3'UTR of apoB mRNA also has the potential to
Figure 3. Analysis of the Human ApoB S'UTR mRNA Sequenœ. ---- ---
The 128 base pair S'UTR sequence contains elements such as G + C-rich areas and .
pattemed sequences that are indicated in colour. Position of the transcriptional and
translational start sites are indicated. (Sequence obtained from GenBank Accession
X04506)
O 128 base pairs long two GC boxes are present at -20 and -81 presence of a gaggcc doublet between the GC boxes
Transcriptional start site (-1 28) + auucccaccgggaccugcggggcugagugcccuucucggu ugcugccgcugaggagcccgcccagccagc cagggccgc aaaaccaaaq ccaggccgcagcccaggagccgccc caccgcagcuggcg auggac.. .
t Translational start site (+1)
Figure 3.
Figure 4. Analysis of the Humna ApoB SUTR mRNA Sequence.
The 304 base pair sequence contains AU-rich areas and sequences eiements such as
one AUUUA and one AUUUUUA rhat are indicated in colour. (Sequence obtained
from GenBank Accession X04506)
304 base pairs long presence of one auuua and auuuuua and a large number of a and u repeats
uaauuuuuaaaagaaaucuucauuuauucü ucuuuuccag uugaacuuucacauagcacagaaaaaauucaaacugccua - uuugauaaaaccauacagugagccagccuugcaguaggca guagacuauaagcagaagcacauaugaacuggaccugcac caaagcuggcaccagggcucggaaggucucugaacucaga aggauggcauuuuuugcaaguuaaagaaaaucaggaucug aguuauuuugcuaaacuugggggaggaggaaaauaaagga gucuuuauug uguaucaua
Figure 4.
form secondary structure and includes sequence elements such as one AUUUA and -W....-. -
one AUUUCTUA sequence and a large number of U and A repeats (Figure 4).
1.4.1 Hvmthesis
We hypothesized that modulation of apoB mRNA translation is meâiated by
cis-regulatory elements within the S'UTR andlor the 3'UTR sequences and that these
elements may be potential binding sites for trans-acting cytoplasmic protein factors.
Aim 1 - Our pnmary objective was to detennine the biological function of these UTR
sequences in the translatability of apoB mRNA and to idemtify potential cis-
ngulatory elernents. We also wanted to assess the potential of the UTR sequences to
fom secondary smicture.
A D D ~ ~ c ~ 1
In order to analpe the function of the apoB 5' and 3VTR sequences we
. generated a set of consmicts containing the apoB S'UTR andor 3'UTR sequences
linked to a luciferase (LUC) reporter gene. To assess the biological activity of the
putative RNA motifs, we transfected Hem2 cells with the chimenc LUC constmcts
carrying the 5' andlor 3' UTR a p B sequences. We also analyzed the activity of the
chimeric UTR-LUC consmicts in vitro by RT-PCR and in an in vitro translation
system. We analyzed the potential of the UTR sequences to fom secondary structure
using M-fold, a cornputer based RNA secondary structure prediction prognun.
Aim 2 - Our secondary objective was to evaluate the metabolic influence of insulin
and thyroid horrnone treatment on translational control.
A~~rosch 2
We assessed the ability of insulin and thyroid hormone treatment to modulate
translation in our reporter system. We accomplished this by treating HepG2 cells
transfected with the UTR-LUC reporter constnicts with insulin and thyroid honnone
for various treatment periods.
Aim 3 - To assess the function of the apoB UTR sequences within the context of the
endogenous apoB protein sequence in both cell culture and in vitro. These studies
would supplement the ~ s u l t s obtained from Our UTR-LUC reporter expcriments.
Ap~roach 3
We created a set of constnicts carrying the apoB 5' and 3' UTR sequences
linked to a portion of the apoB gene sequence. Due to the large size of the apoB
protein, 15% of the N-terminal coding sequence (ApoB 15) was used to create the
constructs. The apoB 5' andlor 37JTR sequences were positioned appropriately
flanking the apoB 15 coding sequence.
MATERIALS & METHODS
2.1 Chernicals and Rea~ents
Bacto-tryptone and bacto-yeast exurict were from Becton Dickinson (Sparks,
MB). Sodium chlonde was from BDH Inc. (Toronto, ON). Granulated agar was
from Becton Dickinson (Cockeysville, MD). Chlorofonn and isopropyl alcohol were
obtained from Caledon Laboratones Inc. (Georgetown, ON). Anhydrous ethyl
alcohol was obtained from Commercial Alcohols Inc. (Brampton, ON). A11
restriction enzymes, ampicillin, agarose, insulin, DHSa competent cells,
deox ynucleotides, X-gal, and Tuq DNA pol ymerase were from GibcdLi fe
Technologies (Toronto, ON) unless otherwise stated in the text. T4 DNA ligase was
from GibcdLife Technologies floronto, ON) and from New England Biolabs Ltd.
(Mississauge, ON). AmpliTaq Goldm was from Perkin Elmer (Foster City, CA).
Calf intestinal phosphatase and shrimp alkaline phosphatase was from Boehringer
Mannheim/Roche (Laval, PQ). Ethidium bromide, trioduthreonine and DEPC was
from Sigma (Si. Louis, MO). Sybr Gold Nucleic Acid Stain was from Molecular
Robes Inc. (Eugene, OR) which is distributed through Cedarlane Laboratones
Limi ted (Homby, ON).
Maxi and mini prep plasmid purification kits were from Qiagen (Mississauga,
ON) and Roche (Laval, PQ). QiaexII and QIAquick gel extraction kits and Effectene
transfec tion reagent were from Qiagen (Mississauga, ON). The pGU-contml vec tor,
pRL-T?C vector, Luciferase Assay Kit, Dual Luciferase Reporter Assay Kit and
Flexi" Rabbit Reticulocyte in vitro translation kit were from Romega (distributed -AL- -
-
through VWR CanLab, Mississauga, ON). Tnzol reagent and the Superscript One-
Step RT-PCR kit werc obtained from Giùco/Life Technologies (Toronto, ON). The
Original TA Cloning Kit was purchased from Invitmgen (Carlsbad, CA). DNA
loading buffer, RNA loading buffer and buffers for electrophoresis of both agarose
and polyacrylamide gels were prepared using standard protocols.
2.2 DNA Svnthesis and Seaueneing
Al1 primers were synthesized commercially at the DNA synthesis facility at
the Hospital for Sick Childnn (Toronto, ON). Constructs were sequenced
commercially at the DNA Sequencing Facility at the Hospital for Sick Childm
(Toronto, ON).
2.3 Ce11 Culture and Tissue Culture Reanents
Human hepatoma ceIl line, HepG2, was obtained from Amencan Type
Culture Collection (ATCC HB 8065) (Manassas, VA). Alpha modification of
Eagle's minimum essential medium and sterile phosphate buffend saline (PBS) was
obtained h m the media facility at the Hospital for Sick Childm (Toronto. ON).
Media is prepared using powdered reagents from GibcolLi fe Technologies (Toronto,
ON) and is made by the University of Toronto media facility. Fetal bovine serum.
antibiotics/antimycotics were purchased from GibcdLife Technologies (Toronto.
ON). Trypsin-EDTA was from Gibcofife Technologies (Toronto, ON) and Wisent
Labs (Montreal, PQ). Trypan blue was h m GibcdLife Technologies (Toronto,
ON). Hemac ytometer (O. 1 mm) was from Hausser Scientif& (USA). Cells were
counted on a Leica DMIL microscope (Wetzlar, Germany).
2.4 hboratotv S u ~ ~ l é s and A~PPiratus
Petri dishes were from Fisher Scientific Ltd. (Nepean, ON). T-75 fiasks, 6-
well plates, sterile 10 ml pipettes, sterile 50 ml tubes, pipettes tips and 1.5 ml
eppendorf tubes were dl from Sarstedt (St-Leonard, PQ). Disposable syringes,
l8Gl.S needles and No. 1 1 surgical blaàes were from Becton Dickinson (distributed
VWR Canlab, Mississauga, ON).' PCR machine used was the PTC-150 MiniCycler
by MJ Research (Waterdown, MA). Electmphoresis units were from Bio-Rad
Laboratories Ltd (Mississauga, ON).
2.5 Isalrrlian of Phsrnid DNA
The 5Wïü and 3WTR transcripts were generated by the polymerase chah
reaction (PCR) using apoB 18 and apoB 1 0 cDNA, respectively, as templates (hndl y
provided by Dr. Zemin Yao. University of Ottawa Hem Institute). The cDNA clones
were provided as insrrts in the pCMV5 plasrnid vector. Plasmids were diluted to 2
ng/pl using sterile purified watec 4 ng and 8 ng of the apoBl8 and apoBlOO cDNA
plasmids, respectively. were transformed into DHSa competent cells (kfe
Technologies). Plasmid amplification and purification was accomplished by using
the Qiagen maxi prep kit for apoB18 cDNA and the PET System Manual for plasmid
purification of apoB 100 cDNA. Due to the large size of the apoB 100 plasmid+vector
(>19kb). the Qiagen Kit, which uses colurnns, did not efficiently elute high yields of
DNA, thus another plasmid purification method was necessary for the apoBlOO
cDNA. Identity of both plasmids was verified by digestion with EcoRI and SmaI
restriction enzymes. SmaI cleaves the vector once immediately downstnarn of the
apoB cDNA insert. Thus, the nstxiction map of the digestion with SmaI has one
band of approximately 8 kb for apoBI8 cDNA and 19 kb for apoBlûû cDNA. EcoRI
digestion cuts the vector twice (both sites are within 20 base pairs of each other)
immediately upsmam of the apoB cDNA insert. EcoRI. also cuts the apoBlOO
sequence at base pair 10681 which repnsents approximately 76% of the sequence.
For the plasmid containing the apoB18 cDNA insert, digestion with EcoRI yields one
band of approximately 8 kb. Digestion of this plasmid with Sac1 and EcoRI releases
the apoBl8 cDNA insert and produces two bands, one of 2.5 kb and the other of 5 kb.
For the plasmid canying the apoBlûû cDNA, digestion with EcoRI nsults in two
bands, one of approximately 10 kb (comsponding to 76% of apoB100) and the other
of 8.4 kb (cornsponding to the vector and the remaining 24% of apoB100).
Digestion of this plasmid with Sac1 and EcoRI yields thm products corresponding to
the molecular weights of 10 kb (N-terminal 76% of apoBlO), 5 kb (vector) and 3.4
kb (C-terminal 24% of apoB 100). Proàucts were visualizcd on an agarose gel stained
with ethidium bmmide.
2.6 h m m t i b n of the AmB UTR-LUC RewHer Consimets
The apoB18 and apoB1O cDNA templates were subsequently used as
templates to generate the 5' and 3'UTR sequences, respectively, by PCR. The UTR
sequences were subsequently cloned into an eukaryotic expression vector carrying a
reporter gene. The vector used was the pGL3-control vector (Promega) which
contains SV40 promoter and enhancer sequences and the entin sequence encoding
the firefly luciferase (LUC) reporter gene (Figure 5). PCR primen were designed
such that the 5' and 3' flanking regions contained sequences for their respective
restriction sites. The S'UTR and 3'UTR were cloned upstream and downstream of the
LUC coding sequence, respectively, using the Hindm and XbaI restriction sites.
2.6.1 Prenaration of the S'UTRnGL3 Construct
The first construct contained the apoB SZITR cloned upstream of the LUC
gene using the Hindm restriction site (S'UTRpGL3) which is positioned 35 base pairs
upstream of the LUC start codon. The forward and reverse primen were designed
such that they contained the Hindm restriction sequence plus four extra base pairs to
ensure efficient digestion of the ~ ~ ~ ' p r o d u c t . Spccial attention was necessary in
designing the forward S'UTR primer since the cDNA provided lacked the fint 20
base pairs of the apoB 5'UTR sequence. Thus, the rnissing base pairs (indicated in
ôold type) had to be generated within the fornard primer and nsulted in a primer
length of 45 base pairs. The calculated Tm values were 79 and 8S°C, nspectively, for
the forward and =verse primers:
S'UTR Fonvard Rimer:
5'-GCGCAAGCTTATTCCCACCGGGACCTGCGGGGCTGAGTWCmC-3'
S'UTR Reverse Primer:
5'-GCGCAAG~GCCA~GCGGTGGGGC~C~GGGCTGCGGC-3'
- -- Figure 5. Cirele Msp of the pGLSContro1 Vator.
The 5.25 kb pGL3-contml vector contains the firefl y luciferase reporter gene, SV40
promoter and enhancer sequences and the ampicillin antibiotic resistance gene. The
5'üTR transcript was cloned upstrearn of the LUC gene using the Hindm site
(located at position 245 within the pGU sequence) as indicated by the arrow. The
3'UTR transcnpt was cloned downstream of the LUC gene using the XbaI restriction
site (located at position 1934 within the pGU sequence). The NcoI restriction site is
located downstream of the HindIiI site at position 278 of the pGLJcontro1 vector
sequence (Promega).
SV40 En hancer
Synihelic poly[A) signai I
SV40 late poly( A) signal (for Iuc+ reporter)
Koa 1 2094
S'UTR
Figure 5.
The PCR enzyme used was Tuq DNA polymerase (5 Ulpl). PCR conditions were
optimized. Final concentrations of the following components were used for each
reaction: 10 ng of apoBl8 cDNA template, 0.5 mM each of fonvard and reverse
primers, 2.5 units of Taq DNA polymerase, 1X PCR buffer, 1.5 mM MgC12 and
0.2 rnM of each àNTP. The apoB 18 cDNA template was subjected to one cycle of
94OC for 3 min and 7S°C for 5 min (Taq added during this incubation); 35 cycles of
94OC for 1 min; 47OC for 30 sec and 72OC for 1 min 30 sec ; one cycle of 94OC for 1
min; 47OC for 30 sec and 72OC for 5 min followed by a soak cycle of less than 1S0C.
The length of the S'UTR is 128 base pairs, however due to the presence of the
restriction sites on both ends and the additional base pairs the PCR product generated
was approximately 148 base pairs in Iength. PCR products were run on an agarose
gel and were visualized by ethidium brorni& (EtBr) staining. The PCR proâuct was
then digested with HinàIII restriction enzyme to generate sticky en&. The ciigested
PCR product was nin on an agarose gel and the appropriate band was excised from
the gel and was purified using the Qiaex II gel extraction kit. The pGL3-control
vector was similarly digested with the HindiII restriction enzyme to linearize the
plasrnid, nm on an agarose gel and the appropnate band was gel purified. To prevent
recircularization dunng the ligation 'reaction, one pmole of the linearized vector was
treated with 1 unit of calf intestinal phosphatase and 1X ckphosphorylation buffer for
30 minutes in a 37OC water bath. The enzymatic reaction was inactivatcd by adding
1/10 final volume of 200 m M EGTA to the reaction mix fotlowed by a 10 minute
incubation in a 6S°C water bath. The 5'UTR and the vcctor Eragment were ligated
using a 3:l molar ratio (90 frnoles insert: 30 fmoles vector). The ligation enzyme
used was T4 DNA ligase (lu/@). .Ligation reactions wem performed using 1 U T4
DNA ligase per miction, 1X ligase buffer and purified water (to a final volume of 20
pl) at m m temperature for one hour. Five microlitres of the ligation reaction
(approximately 30 fmoles) was subsequently transformed into 50 of DHSa
competent cells and placed on ice for 30 minutes. The competent cells were then heat
shocked for 20 seconds at 37OC and place on ice for 2 minutes. For expression.
Luna-Bertani (LB) medium (950 pl) was added to the competent cells and the tubes
were placed into a shaking incubator (225 rpm) at 37OC for one hour. A 200 and 500
@ aliquot of the original bacterial suspension was plated on agar plates containing 50
pg/d of ampicillin and plates were leH ovemight in a 37'C incubator. individual
clones were selected and grown ovemight at 37OC in 3 ml of LB media with 50 pg/ml
of ampicillin in a bacterial shaker (225 rpm). Plasmid DNA was isolated from the
bacterial suspension using a rnini-prep kit. The clones were digested with Hindm to
nlease the S'UTR insert from the vector. Digestion pducts wen visualized on an
agarose gel. Positive clones contained two bands consisting of 128 base pairs and 5.2
kilobase pairs. Two positive clones werc noted (clone #5 and clone W). Botb of
these clones were squmced ta mfim both sequmce and orientation fidclity. The
forward sequencing primer used was RV primer3 (nomega) which covered base
pairs 5198-5217 (5'-3') on the pGU contml vector map. The reverse primer used for
sequencing was GL primer2 (Romega); this repfescntcd base pairs 303-28 1 (5'-3') of
the vector sequence. Clone IY9 was in the right orientation and did not have any errors
in its sequence. To generate a large stock of DNA, the original bacterial suspension
from rhis clone was streaked on an agar plate containing ampicillin (50 bg/ml) using
a bacterial bop. One clone was selected and grown in 3 ml LB medium at 37°C in a
bacterial shaker (225 rpm) for 8 hours. The contents of the culture tube were then
transfemd to a large flask containing 250 ml of LB media supplemented with 50
pg/d ampicillin. This flask was placed in the bacterial shaker ovemight and grown
for approximately 16 hours. Plasmid DNA was extracted using a Maxi-prep DNA
isolation kit. The amplified construct was then confirmed by restriction digest with
Hindm prior to use in subsequent experiments.
2.6.2 Pie~aration of the ~ ' W R D G L ~ Constmct
The second construct contained the apoB 3'UTR cloned downstream of the
LUC gene using the XbaI restriction site (3'UTRpGW). The forward and reverse
PCR pnmers were designed such that they contained the XbaI restriction sites plus
four additional base pairs to ensure efficient digestion. The forward and reverse
pnmers were 25 base pairs in length and had a Tm value of 52 and 5S°C respectively.
3'- Fonvarâ Primer:
5'-GCGCTCTAGATAAmAAAAGA-3'
3'UTR Reverse Primer:
5'-GCGCTCTAGATATGATACACAATAA-3'
The PCR enzyme used was T q DNA polymerase (5 U/@). PCR conditions were
optimized and final concentrations of the following components were used for each
reaction: 10 ng of cDNA template, 0.5 m k of forward and reverse primers. 2.5 units
of Tuq DNA polymerase, 1X PCR buffer. 1.5 m M MgC12 and 0.2 mM of each dNTP.
The apoBlûû cDNA template was subjected to one cycle of 94OC for 3 min and 7S°C
for 5 min (Taq added during this incubation); 35 cycles of 94OC for 1 min; 47OC for
30 sec and 72OC for 1 min 30 sec ; one cycle of 94OC for I min; 47OC for 30 sec and
72OC for 5 min followed by a soak cycle of less than 15OC. The 3'Uï'R is 304 base
pairs in length, however due to the presence of the restriction sites on both ends and
the additional base pairs the PCR product generated by the PCR reaction was
approximatel y 324 base pairs in length. PCR products were run on a 1 % agarose gel
and were visualized by EtBr staining. The PCR pmduct was then digested with XbaI
restriction enzyme. After digestion, the PCR product was run on an agarose gel and
the appropriate band was excised and was purified using the Qiaex II gel extraction
kit. The pGL3-control vector was similarly digested with the XbaI restriction
enzyme, run on an agarose gel and the appropriate band was excised and gel purified.
Rior to ligation, the vector was dephosphorylated with calf intestinal phosphatase
essentially as àescribed in Methods 2.6.1. The 3'UTR and the vector fragment were
ligated using a 6:l molar ratio (180 fmoles insert: 30 fmoles vector) using T4 DNA
ligase. The fragments wen ligated for 1 hour at room temperature and 5 pl of the
ligation naction (approximately 50 fmoles) was subsequently transfonned into DHSa
comptent cells. Clones were screened and plasmid DNA was isolated by mini-prep.
The clones were digested with XbaI to release the 3'UTR insert h m the vector.
Digestion pmducts were visualized on an agame gel. Positive clones contained two
bands consisting of 304 base pairs and 5.2 kilobase pairs. One positive clone was
noted (clone #17). This clone was sequenced to venfy both sequence and orientation
fidelity. Primers designed to sequence the constnict were synthesized.
The sequencing primer used for the forward reaction was
b
5'-AAGAAOGGAAAGATCGC-3' which cornsponded to base pairs 191 1-1925 of --- -
the LUC coding ngion. The sequencing primer used for the reverse reaction was
5'-TTATCATGTCTGCTCGAAGC-3' whic h comsponded to base pairs 1975- 1956
of the pGUcontro1 vector sequence. Clone #17 was in the nght orientation and did
not have any emrs in its sequence. The original bacterial suspension from this
construct was streaked on an agar plate containing 50 @nl ampicillin. One
individual clone was selected and grown in LB media to generate a large stock of the
plasmid. Plasmid DNA was isolated by Maxi-prep. The arnplified constmct was
then confirmed by restriction digest with XbaI pnor to use in subsequent experiments.
2.6.3 Pre~aration of the WYUTRDGL~ Construct
The third construct con tained both apoB UTR sequences (5'/3'UTRpGL3).
This constmct was generatcd by cloning the apoB S'UTR (generated by PCR with
Hindm and NcoI sequences at the 5' and 3' flanking ngions, nspectively) upstream
of the LUC gene into the verified 3WïRpGL3 consmict. We designed thc primers
such that two different restriction sites flanked the PCR product as this eliminated the
possibili ty of ligation of the insert in the reverse orientation. The fornard primer used
was the same as in the S'UTRpGU construct described in Methods 2.6.1. However,
another reverse primer containing the NcoI restriction site was synthesized. Both
primers were 45 base pain in length and the cdculated Tm values were 79 and 85*C,
respective1 y, for the forward and reverse primers.
S'UTR Forward Primer (2.6.1):
5'-GCGCAAGmATTCCCACCGGGACCTGCGGGGCTGAGTWCmC-3'
S'UTR Reverse Primer with NcoI site:
5@-GCGCCCATGGCGCCAG~GCGGTGGGGCGGCTCCTGGGCTGCGGC-3'
The PCR enzyme used was AmpliTaq Goldm. Components of the PCR reaction
were optirnized. Final concentrations of components used in each reaction were: 10
ng of apoB18 cDNA template, 0.5 rnM each of forward and reverse pnmers, 2.5 units
of AmpliTaq Goldm , 1X PCR buffer, 4 4 MMg2 and 0.2 rnM of each àNTP. The
PCR reaction was camied out as follows: the template was subjected to one cycle of
94OC for 10 minutes; 94OC for 1 minute; 66OC for 30 seconds and 72°C for 1 minute
followed by 39 cycles of 94OC for 1 minute; 66OC for 30 seconds and 72OC for 1
Mnute and a final extension at 72OC for 10 minutes and a soak pend at 4OC. The
PCR product obtained from this reaction was approximately 118 base pairs in length
(since both restriction sites and extra base pain were present). The PCR pducts
wcre run on a 12% poiyacrylarnide gel and bands were visudized with Sybr Gold
nucleic acid stain. The 5 WTR sequence was confimed by restriction digestion with
BanII, a restriction enzyme which cuts the SWïR sequence once at base pair 58 and
thus generates two bands of 58 and 70 base pairs in length. After digestion, the
products were run on a 18% polyacrylamide gel and bands were detected with Sybr
Gold. The confirmed S'UTR PCR product was then digested with Hindl'U and NcoI
and run on an agarose gel. The appropriate band was excised and gel purified. The
3'UTRpGU verified constnict, describecl in Methods 2.6.2, was also digested with
HindIII and NcoI mstriction enzymes. After digestion, the construct was run on an
agame gel, visualized by Sybr Gold staining and the appropriate band was excised
and gel purified. The S W ï R was then ligated with the 3'UTRpGW constnict using a
3: 1 molar ratio. Ninety - - ZL
room temperature for
fmoles of insert were ligated with 30 fmoles of the vector at
one hour using 1 U of T4 DNA ligase. A fraction
(approximately 30 fmoles) of the ligation mixture was transformed into DHSa
competent cells. Clones were screened and plasmid DNA was isolated using a mini
prep kit. DNA isolated from the clones was digested with Hindm and NcoI
restriction enzymes. Positive clones had two bands present, one of appmximately
128 bp and the other of 5.5 kb which corresponded to the insert and vector,
nspectively. One of the positive clones was sequenced. The sequencing primer used
annealed to base pairs 181-200 of the pGW-control vector sequence (5'-
CTCOOCCTCTGAGCTATTCC-3') which is located about 40 base pairs upstrearn of
the Hindm restriction site. The original bacterial suspension from the sequence-
verified clone was streaked on an agar plate containing 50 pdml ampicillin. To
generate a large stock of the plasrnid, one clone was selected and arnplified in LB
media. Plasmid DNA was isolated using a Maxi-prep kit. The arnplified consmict
was then confirmed by nstriction digest with HindiII and NcoI to nlease the S'UTR
insert. Digestion with H i n a , NcoI and XbaI nleased both the 5' and 3'U?'R inserts.
2.6.4 Premration of the Nenative Control Construct
in order to ensure that effects obsmed were due to the specific presence of
the apoB UTR sequencw, a fourth constnict containing a nul1 sequence appropnately
positioncd was created. This negative conml sequence was of equivalent length (128
base pairs) to the apoB S'UTR and was cloned upstream of the LUC gene into the
confirmed 3WTRpGL3 constnict using the HindIIi and NcoI restriction sites
(NCSpGL3). The sequence was denved from the LUC gene itself and cornsponded
to base pain 11584286 of the LUC coding region of the pGL3-control vector. The
sequence was examined to enswe that it did not contain any open reading frames or
stable secondary structure (AG = -29.5 kcaUmo1). The pnmers used to s ynthesize this
product were selected h m a cornputer primer design program (Genetics Computer
Gmup (GCG)) which was accessed through the bioinfonnatics website available
thtough the Hospital for Sick Children. Both primers contained four extra base pain
at the flanking region8 prior to the restriction site to ensure complete enzymatic
digestion. The forward primer contained the HindIII restriction site and 20 base pairs
of the LUC coding sequence (5'4 158 to 1177-3'). The reverse primer contained the
NcoI restriction site and 20 base pain of the LUC coding sequence (5-1285 to 1266-
3'). In total, the primers were 30 nucleotides in length and the optimal annealing
temperature detennind from the program was 52.6OC.
NCS fomsrù primer:
S ' - O C G C A A G ~ ~ C G C C A A A A G c A C T C - 3 '
NCS reverse primer: '
5'-GCGCCCATGGTACmGGCAGATGGAACrrr-3'
The PCR enzyme used was AmpliTaq Goldm and the conditions for PCR were
optirnized. The pGL3control vector DNA was used as the template for this reaction.
Final concentrations of the PCR rcaction components werc: 10 ng of template, 0.5
mM each of forward and reverse primers. 2.5 uni& of ArnpliTaq Goldm. 1X PCR
buffer, 3 mM MgC12 and 0.2 m . of each dNTP. The PCR reaction was canied out
as follows: the template was'subjected to one cycle of 940C for 10 minutes; 94OC for
1 minute; 53OC for 30 seconds and 72OC for 1 minute followed by -=-- - --
for 1 minute; 53OC for 30 seconds and 72OC for 1 minute and a
72OC for 10 minutes and a soak period at 4OC. The size of the PCR
39 cycles of 94OC
final extension at
pduc t generatcd
was approximately 148 base pairs. PCR products were mn on a 12% polyacrylarnide
gel and bands were visualized with Sybr Gold nucleic acid stain. The PCR product
was digested with Hindm and NcoI restriction enzymes, was run on an agarose gel
and stained with Sybr Gold. The band was excised and purified using a gel extraction
kit. The 3'UTRpOW verified constnict was similarly digested with both Hindm and
NcoI restriction enzymes. ~ f t e r ' digestion, the linearized consmict was mn on an
agarose gel, visualized by Sybr Gold and the appropriate band was excised and gel
purified. The digested and purified NC5 PCR product was then ligated with the
similarly digested and purified J'UTRpGL3 constnict using a 3: 1 molar ratio. Ninety
fmoles of NC5 were ligated with 30 fmoles of the vector at mOm temperature for one
hour using T4 DNA ligase (1 UAigation). A fraction (approximately 30 fmoles) of
the ligation mixture was transfonned into DH5a comptent cells. Clones were
scmned and plasmid DNA was isolated using a mini prep kit. DNA extracted from
the clones was digested with Hindm and NcoI restriction enzymes. Positive clones
had two bands present, one of approximately 128 bp and the other of 5.5 kb which
comsponded to the inseri and vector, nspectively. One of the positive constmcts
was selected and amplified in order to genehte a large stock of the plasmid. Plasrnid
DNA was isolated using a Maxi-prep kit. The amplified construct was then
confirmed by restriction digestion with Hindm and NcoI which released the nul1
sequence.
2.7 Ce11 Cultrrm
Human hepatoma ceIl line (HepG2) was obtained h m Arnerican Type
Culture Collection (ATCC HB 8065). HepG2 cells were maintained in alpha
modification of Eagle's minimum essential medium. Complete a M E M medium
contained 5% fetal bovine serum and a 1% antibiotic-antimycotic mix. Cells were
maintained in an Nuaire incubator at 37OC under 9S%air/5%C02. Cells were seeded
into T-75 flasks and media was replenished every 3 days. Cells were subcultured on
a weekly basis usually after reaching 90% confluency.
2,7.1 Subculturinn of HenG2 Cells
Complete media maintaining HepG2 cells was aspirated and approximately 8
mL of trypsin-EDTA was incubated with the cells for one minute at room
temperature. The trypsin-EDTA was removed and the flask was placed upright at
37°C for 5 minutes. The flask was returned to the tissue culture hood and cells were
resuspended with 10 ml of complete media that had been warmed to 37OC using a
stenle 10 ml pipette. The ce11 suspension was transfemd to a sterile 50 ml tube. The
cells were mixed by drawing the ce11 suspension up and down 6 times using a sterile
disposable syringe with an 1801.5 gauge needle. Cells stained with Trypan-Blue
were counted under a microscope using a hemacytometer. The cells were diluted to
the desirrd concentration and w m seeded in 35 mm 6-weil plates to a final volume
of 2 ml.
2.8 Tmnsient Tmnsfections of LUC RenoHer Constructs
HepG2 cells wen subcultured from T-75 flash and 0.4 x 106 cells were
seeded per dish into 6-well plates. Cells were allowed to attach ovemight and
transfection experiments were carried out at 70.80% confluency. Cells were washed
once with 2 ml of sterile phosphate buffered saline (PBS) and 1.6 ml of complete
media was added to each well. HepG2 cells were transfected using Effectene
transfection Ragent by Qiagen. The cells wen transfected with 0.4 pg/well of the
pGI3 control vector, the chimeric reporter DNA constmcts described in Methods 2.6
and were mock transfected with buffer only. Transfection efficiency was monitond
by CO-rnuisfecting cells with 0.4 pg of the pRL-TK vector (Pmmega). This vector
contains the renilla luciferase pne and the HSV-thymidine kinase promoter, which is
a weak promoter suitable to use as a control as it provides neutral constitutive
expression of the renilla luciferase control vector. Finfly LUC and renilla LUC have
dissirnilar enzyme smictures and substrate requirements. Thus, the bioluminescence
reactions catalyzed by the fjnfly LUC (or experimental reporter) and the renilla LUC
(control reporter) are quailtifiable and discriminate. Cells CO-transfected with the
various LUC constmcts and the pRL-TK constnict were harvested 48 houk post
transfection with 1X Passive Lysis Buffer (PLB). Media was aspirated from each
dish and cells were washed twice with 1 ml of PBS. A stock solution of 5X PLB was
diluted to a working solution of 1X PLB and 500 pl was added to each well. The 6-
well plates were shaken at 150 rpm on an orbit shaker for 15 minutes. Ce11 lysates
were pipetted into sterile 1.5 ml eppendorf tubes and stored at -70°C. Lysates were
diluted 10-fold with 1X PLB prior to performing reporter assays. Activities of each
reporter were detennined by using the Dual-Luciferase Reporter Assay System
(Promega). This systern allows for sequential memurement of both firefl y LUC and
renilla LUC activity h m the cell lysate of a single well. The reporter or firefiy LUC
is measured first by adding cell lysate to Luciferase Assay Reagent II (LAM) to
generate a luminescent signal which is quantified by a luminometer (Turner Designs
Model). A second reagent called Stop & Glow is then added; this reagent quenches
the first signal and provides the substmte requind to generate a signal from the renilla
LUC that is also quantified by the luminometer. The dual LUC assay was optimized
and final conditions were as follows: 5 pl of diluted lysate was pipetted into a
pol ystpne clear plastic tube containing 25 pl of LAM. The tube was placed in the
luminometer, after a 5 second incubation, the luminescence was quantified for 10
seconds. The tube was nmoved and 25 pl of LX Stop & Glow nagent was pipetted
into the tube. The tube was replaced and after 5 seconds the second luminescence
signal was quantified over a 10 second period. A ratio of firefly: renilla LUC activity
was calculated for each dish to normalize for differiences in ce11 number and
transfection efficiency. This value was detennined for each conshuct and allowed for
between-experiment cornparison. Unless othewise stated, cells were transfected in
triplicate in al1 expenments.
In order to determine whether observed effects were due to transcripitonal or
translational influences, a complement set of dishes was transfected for RNA
isolation. Total RNA was isolated h m triplicate dishes using 1 ml Trizol Reagent
for each 35 mm dish. Cells were collected using a ce11 scraper and the suspension
was üansferred to a stenle tube using a pipette. After 5 minutes at room temperature,
200 pl of chloroform was added and the tube was vortexed. The eppendorf tubes
were then centrifuged at 4OC for 15 minutes at 12000 x g in a Beckrnan GS-1SR
Desktop Centrifuge. The aqueous phase was transfemd to sterile tube and RNA was
precipitated by adding 500 pl of isopropyl alcohol. Samples were incubated for 10
minutes at rwm temperature and RNA was pelleted by centrifugation at 12000 x g
for 10 minutes at 4OC. The RNA pellet was washed once with 1 ml of 75% ethanol.
vortexed and centrifuged at 7500 x g for 5 minutes at 4OC. The RNA pellets were air-
Qied briefly and were resuspmded in 20 pl of DEPC water. The txiplicate dishes
were combined and the RNA concentration was determined using a
spectmphotometer to measure absorbante at 260 and 280 nm. RNA was aliquoted
and stored at -70°C. Integrity of isolated RNA was detennined by observing the 28s
and 18s ribosomal subunits after electrophoresis on an agarose gel. Five pl of DEPC
water was added to a 5 pl aliquot of RNA and 10 pl of 2X RNA dye was added to the
tube. RNA was àenatured by incubating the tube in a 6S°C water bath for 30
minutes. Aftcr this incubation, the tubes were i d a t d y pleced on ice and samples
were loaded into agarose gels. Gels were stained using Sybr Gold.
2.10 RT-PCR Andvsis of LUC Remrter Constructs
LUC rnRNA levels for each construct were monitored by perfonning RT-PCR
using the Superscript One-Step RT-PCR S ystem (LA fe Technologies). Gene spcci fic
prirners for the firefly LUC gene were designed; the pnmers selected had an optimal
annealing temperature of --
530 of the LUC coding
55.4OC. The fonuard primer repnsented base pair 509 to
sequence: 5'-TCGTCACATCTCATCTACCTCC-3'. The
reverse primer npresented base pair 1188 to 1169: 5'-
TCTCACACACAG~CGCCTC-3'. The reaction resulted in a 680 base pair product.
The RT-PCR protoc01 was perfonned essentially as descnbed by the manufacturer's
instructions. Final concentrations of components for each reaction included: 1 pg of
total RNA template, 1 pl of RTlTgq M x , 1X Reaction Mix (containing 0.2 rnM of
each WïP and 1.2 mM MgSO*) and 0.2 ph4 each of fonuard and reverse primers.
The RNA template was added to the reaction mixture and subjected to the following:
one cycle of 50°C for 30 min; 94OC for 2 Mn followed by 25 cycles of 94T for 15
sec; 5S°C for 30 sec and 72OC for 1 Mn and one cycle of 72OC for 10 min. Products
were run on 1% agarose gels and were visualized by staining with Sybr Gold. Gels
were scanned using the Kodak 1D Digital Science carnera and a net intensity
quantitation was determined for each pmduct.
2.1 1 In V h Translation of LUC Remrter Constnrcts
Total RNA species isolated from HepG2 cells tnmsfected with the various
consînicts were subjected to in vitro translation experiments using the Flexi@ Rabbit
Reticulocyte Lysate System (nomega). Since Our constructs contain finfly LUC as
the reporter, the pmtocol used was analogous to the conditions suggested for the non-
radioactive control LUC RNA translation. Translation reactions were performed at
30°C for 90 min after the assembly of al1 reaction components. Template RNA was
âenatured at 65OC for 3 minutes and was immcdiately cwled in an ice-water bath.
Reaction components included 17.5 pl of the FIexiQ Rabbit Reticulocyte Lysate;
Amino Acids mixture minus Methionine (0.01 mM each), Arnino Acids mixture
minus Leucine (0.01 rnM each); 70 mM potassium chloride; 40 units RNasin and 200
ng of RNA template. Translation reactions were stored at -70°C until the time of the
assay. LUC activity was determined using the Luciferase Assay System. Undilutcd
samples (5 pL) were pipetted into 25 of Luciferase Assay Reagent; luminescence
was quantified over a 2 minute period using a luminometer.
2.12.1 Insulin Hormone Treatment of Transientlv Transfected Cells
HepG2 cells were transfected with the various chimeric UTR-LUC consmicts
as described in Methods 2.8. In one series of experiments, cells were treated with
1 pg/rnL insulin at the time of transfection and the insulin was replenished 24 hours
pst-transfection. Control and treated cells were hmested after 48 hours and dual
LUC activity was assayed as Qscribcd in Methods 2.8. In another series of
expenments, HepG2 cells transiently transfected cells with the UTR-LUC constmcts
were treated with insulin supplemented media 48 hom pst-transfection. Cells were
incubateci for various time points and final concentrations of insulin including 12
hours at 10 pg/mL, 18 hours at 1 pg/mL and 6 hours at 1 pg/mL. Control and treated
cells were harvested and assayed for dual LUC activity (as described in Methods 2.8)
at the indicated time points.
2.12.2 Thvroid Hormone Treatment of Trrinsientlv Transfected Cells
Hep02 cells were transimtly traasfected with the various chimeric UTR-LUC ,
constructs as descnbed in Methods 2.8. Approximately 12 hours post ûansfection,
thymid honnone (T3), at a final concentration of 50 nM, was added to the existent
media of one set of cells and vehicle was added to control cells. Cells were harvested
48 hours after treatment with hormone or vehicle and were assayed for dual LUC
activity (Methods 2.8).
2.13 Secondant Structure Analvsis af the ADOB YUTR
The potential for the apoB 5 W R sequence to form secondary structures
such as stem-loops or hairpins was assessed by cornputer analysis using a program
called Mfold developed by Zuker (Zuker, 1989). This program has been used
successfully for analysis of other RNA sequences and predicts optimal and
suboptimal secondary stnictuns on the basis of free energy minimization (Jaeger, et
al., 1989, Jaeger, et al., 1990). This program was used with the assistance of the
Genetics Computer Group (GCG) available through the biouiformatics website at the
Hospital for Sick Childmi. The program was run using the default parameters set by
the program.
2.14 Stutisticul Analvsh
Statistical analysis was calculated by pafonning 2-tailed Student t-test analysis.
Differences were considered significant if P values were ', 0.05.
CHAPTER 3 - -- RESULTS
3.1 Constnrction of the UTR-Re~oHer Constrrrcts
The different chimeric UTR-LUC constructs used in the present analysis are
displayed in Figure 6. The pGL3-control vector (Romega) was selected as the
reporter vector. Each constmct contained SV40 promoter and enhancer sequences as
well as the firefly LUC coding sequence with the apoB 5' andor 3'UTR's positioned
upstream and downstrearn of the LUC gene as indicated. The negative control
construct (NCSpGL3) contained a nul1 sequence &nved h m the LUC coding
. sequence and was positioned upstream of the LUC gene (as in the 5'/3'UTRpGU
constnict).
3.1.1 Construction of the S'UTRnGL3 Constnict
The S'UTRpGU construct was generated by cloning the PCR-generated apoB
S'UTR sequence upstream of the LUC gene into the pGL3control vector using the
HindIII restriction site. The apoB S'UTR insert was generated by PCR using forward
and reverse primers designcd to contain the sequence for the Hindm restriction site.
The apoB 5'UTR PCR product was digested with Hindm and the 128 base pair
fragment was p l purified. The fragment was subsequently cloned into the similarly
digested, gel purified and dephosphorylated pGW-control vector. Positive clones
contained two fragments, one comsponding to the apoB S 'UTR (128 bp) and the
other comsponding to the linearized pGL3j.ontrol vector (5.2 kb). The orientation
Figure 6. Chimeric UTR-LUC constnicts carrying the 5' anaor 3'UTR of apoB
mRNA.
An illustrative schematic diagram displaying the UTR-LUC constructs generated.
The 5' and 3'UTR sequences of apoB mRNA were generated by PCR. The
S'UTRpGU consuuct was created by cloning the S'UTR upstrearn of the LUC gene
using the Hindm restriction site. The 3WTRpGL3 construct was created by cloning
the apoB 3'UTR downstrearn of the LUC gene using the XbaI restriction site. The
5'/3'UTRpGL3 construct was created by cloning the S'UTR upstnam of the LUC
coding region using the Hindm and NcoI restriction sites into the 3'UTRpGL3
construct. The pGL3-control constnict contained no apoB UTR sequences. The
negative control construct (NCSpGL3) camed a nul1 sequence derived from the LUC
gene itself and was equivalent in length to the apoB S'UTR. This was cloned
upstrearn of the LUC gene using the Hindm and NcoI restriction sites into the
3'UTRpGL3 consmct.
SqUTRpGL3
3'UTRpGL3
5@13'UTRpGL3
NCSpGL3
pGL3 control
Legend: 0 = SV40 pmmoter
= SV40 enhancer
S U T R LUC Gene
Xbal tbal LUC G e n ë 3'UTR
Hindlll Ncol
I ~ U T R LUC Gene 3'UTR
Hindll( Ncol Xba! Xbal
1 NC5 LUC Gene 3'UTR
LUC Gene
Figure 6.
73
and sequence fidelity of the S'UTR insert in the construct was confinned by DNA A
sequencing. A large stock of the StUTRpGL3 construct was generated and confinned
by restriction digestion with Hindm prior to use in experiments (Figure 7).
3.1.2 Construction of the ~ ' U T R D G L ~ Constmct
The 3'UTRpGW constnict was generated by cloning the apoB 3'UTR
sequence downstream of the LUC gene into the pGU-control
XbaI restriction site. The apoB 3'UTR insert was generated by
consrnict using the
PCR using forward
and reverse pnmers that were designed to contain the sequence for the XbaI
restriction site. The apoB 3'üTR PCR product was digested with Xbai and the 304
base pair fragment was gel purified. The fragment was subsequently cloned into the
similarly digested, gel purified and dephosphorylated pGL3-control vector. Positive
clones contained two fragments, one comsponding to the apoB 3WI'R (304 bp) and
the other comsponding to the linearized pGU-control vector (5.2 kb). The
orientation and sequence fidelity of the 3'UTR insert in the constnict was confirmed
by DNA sequencing. A large stock of 3VTRpGI.3 constnict was prepared and
confirmed by restriction digestion with XbaI prior to use in experiments (Figure 8).
3.1.3 Construction of the ~ '~ 'UTRDGL~ Construct
The S'/3'UTRpGL3 construct, which contained both apoB UTR sequences,
was generated by cloning the PCR generated apoB S ' U T R insert into the sequence-
verified 3'UTRpGU constnict. The S'UTR PCR product was generated using a
( t a continues on p. 79)
Figure 7. Digestion of the S'UTRpGW Constmct witb HindIlI Restriction - - -
Enzyme.
noducts of the 5'UTRpGU-constnict digestion with HindiII restriction enzyme were
analyzed by electrophoresis on a 1% Agarose Gel af'ter staining with Sybr Gold.
Digestion products consisted of two bands, a 5.2 kb band which comesponâed to the
pGL3-control vector and a 128 bp band which comsponded to the apoB 5WTR.
15.2 kb (pGL3 vector)
Figure 7.
76
Figure 8. Digestion of the 3'UTRpGL3 Construct with Xbai Restriction --- - -
Enzyme.
Products of the 3'UTRpGL3 construct digested with Xbai restriction enzyme wen
analyzed by electrophonsis on a 1% Agarose Gel after staining with Sybr Gold.
Products observed consisted of two bands comsponcüng to the apoB 3'UTR (304 bp)
and the pGL3-control vector (5.2 kb).
Figure 8.
78
5.2 kb (pGL3 vector)
fonvard primer containing the Hindm nstnction site and a reverse primer containing
the NcoI site. The apoB SWTR PCR product was digested with Hindm and NcoI and
the 128 base pair fragment was gel purifred. The fiagrnent was subsequently cloned
into the similarly digested and gel purified 3'UTRpGL3 constmct. After digestion
with Hindm, NcoI and XbaI, positive clones contained three fragments, one
comsponding to the apoB 5'UTR (128 bp), another comsponding to the apoB 3'UTR
(304 bp) and the third co~sponding to the pGL3-control vector fragment (3.6 kb).
Sequence fidelity of the insert in the construct was confinned by DNA
sequencing. A large stock of the plasmid was prepmd and confinned by restriction
digestion with HindII?, NcoI and XbaI pnor to use in experiments (Figure 9).
3.1.4 Construction of the NCSDGL~ Construct
The NCSpGU construct contained a nul1 sequence, of equivalent length to the
apoB S'UTR (128 bp), which was cloned upstream of the LUC gene into the
sequence-verified 3'UTRpGU constnrt. The NCS PCR product was generated using
a forward pnmer containing the Hindm =striction site and a reverse pnmer
containing the NcoI site. The NCS PCR product was digested with Hindm and NcoI
and the 128 base pair fragment was gel purified. The fragment was subsequently
cloned into the similarly digested and gel purified 3'UTRpOU construct. After
digestion with HindIII and NcoI positive clones contained two fragments, one
comsponding to the 3WïRpGU consmict (5.5 kb) and the other comsponding to
the nul1 sequence (128 bp). A large stock of the NCSpGL3 construct was generated
and confinned by restriction digestion (Figure 10).
-. - Fi y r e 9. Digestion of the S'IJ'UTRpGL3 Const~ct witb HiadIII, Ne01 and
Xbd Restriction Enzymes.
Digestion products of the 5'/3'UTRpGU-consrnict were analyzed by electrophoresis
on a 1% Agarose Gel after staining with Sybr Gold. Digestion with HindIII, NcoI
and XbaI resulted in four bands cornsponding io the pGL3 vector (3.6 kb), the LUC
gene (1.67 kb), the apoB 3WTR (304 bp) and the apoB S'UTR (128 bp).
3.6 kb (pGL3 vector)
1.67 kb (LUC gene)
Figure 10. Digestion of the NCSpGL3 Construct with HiadIII and NcoI - -- Restriction Enzymes.
Digestion products of the NC5pGL3 constmct were analyzed by electrophoresis on a
1% Agarose Gel after staining with Sybr Gold. Digestion with Hindm and NcoI
nleased the nul1 sequence and resulted in two bands comsponding to the nul1
sequence (128 bp) and the 3'UTRpGL3 consmct (5.5 kb).
Figure 10.
83
'5.5 kb (3UTRpGL3 construct)
NuIl sequence
3.2 Influence of the @OB 5' and 3'UTR on LUC Exmession in Cell Cuhre
By assaying for LUC activity expressed in each set of transfectants, we
evaluated the influence of apoB-UTR's on LUC expression of hybrid aanscripts
canying those sequences. In order to nomalize for transfection efficiency and ce11
viability after transfection experiments, we employed the Dual Luciferase Reporter
assay system (see Methods-2.8). As such, HepG2 cells wen CO-transfected with the
chimenc firefly LUC constructs carrying one or both apoB UTR's and also with a
control plasmid (pRL-TIC) encoding the renilla luciferase gene. Al1 experiments were
perfomed in triplicate; a mean was calculated for each construct and the fold
incnaseldecrease in LUC activity versus control was determined. The results
obtained are summarized in Figure 11. We observed a statistically significant 2.2-
fold increase (pe0.005; n=12) in LUC activity from the chimeric construct carrying
the apoB S'UTR cloned upstream of the LUC gene (S'üTRpGL3) in comparison to
the pGL3-conuol consiruct. We did not observe any significant difference in LUC
activity from the constnict canying the 3'UTR alone (3'UTRpGU) in comparison to
the conml. The constmct carrying both UTR's (5'/3'UTRpGW) exhibited a
significant 1.8-fold increase in LUC activity in comparison to control (p4.005;
n=12). This &ta suggests that while the apoB S'UTR sequence is required for its
optimal expression. the 3'UTR on its own does w t appcar to play a crucial role. The
presence of both the 5' and 3'üTR of apoB appeared to nsult in an increase in LUC
activity as compared to that observed with the S'UTR alone. However, the increase in
LUC activity observed with the SB/3'UTRpGL3 construct was 1.8-fold versus a 2.2-
(text continues on p.87)
Figure 11. Transient t d e c t i o n of HepG2 cells with the chimeric UTR-LUC
constnicts.
HepG2 cells wen transiently CO-transfected with the chimeric apoB UTR-LUC
constructs and the pRL-TK (renilla LUC) vector (sec Methods 2.8). Cells were
harvested 48 hours pst transfection and LUC activity was assessed using the dual
LUC assay system. Transfection ef'ficiency for each dish was nomalized by dividing
firefly LUC activity by renilla LUC activity. Mean f SEM luciferase values are h m
12 independent experiments perfomed in triplicate.
UTR-LUC Constructs
Figure 11.
86
fold incnase with the construct carrying the
comparing the LUC activity measured from the
S'UTR alone. Statistical analysis
S'UTRpGL3 and the St/3'UTRpGL3
constnrts (1.8-fold versus 2.2-fold) showed a significant difference (p=0.04). This
may suggest that the presence of the 3'UTR slightly attenuated the stimulatory effect
observed with the SWîRpûL3 constnict. The LUC activity results obtained from
cells transfected with the negative control (null) construct (NCSpGL3) wen
comparable to the LUC activity denved h m the pGU-control consrnict. This
suggests that the increased LUC activity observed in the SWïRpGL3 and
5'/3'UTRpGL3 constmcts was sequence specific and not simply due to the presence
of an additional sequence upsmam of the LUC gene.
3.3 Detemination of LUCmRNA Levels h m Tmnsfected CeUs
Total RNA isolated h m the Hep02 cells transfected with the various UTR-
LUC constmcts was w d for RT-PCR experiments in order to identify whether the
increase in LUC activity was due to transcriptional or CO- or pst-translational
conml. The RT-PCR reaction was canied out according to the instructions provided
with the Superscript One-Step RT-KR Kit by GibcoLife Technologies (Methods-
2.10). The cycle number was optimized to 25 cycles in order to ensure that the RT-
PCR reaction had not reached a plateau nsulting in consistent band intensities for
each constmct. At 20 cycles appreciable product formation did not occur for the
constructs, however, LUC rnRNA kvels were detected with the pGU-control vector.
The cycle number was subsequently changed to 25 cycles and this was selected as the
target cycle nurnber as it allowed sufficient time for âetection of LUC mRNA levels
for al1 experimental constnicts and the control vector. Statistical analysis indicates
that LUC mRNA levels did not significantly increase or ciecrease due to the presence
of the chimeric DNA constructs containing the LJTR sequences (Figure 12). These
results suggest that the increase in LUC activity was likely due to CO- or pst-
translational ngulation and not due to transcriptional upngulation of the apoB gene.
Total RNA from HepG2 cells transfected with each chimeric construct was
isolated and used for in vitro translation experiments using a rabbit reticulocyte lysate
system (Methods-2.11). The nsults obtained from these expriments are depicted in
Figure 13. The results paralleled the transfection data in that we observed an increase
in LUC activity with constructs containing the apoB S'UTR sequences. The consmct
containing the S'UTR alone exhibited a statistically sipificant 2.2-fold incrrase in
LUC activity over the control constmct (pc0.005; n=6). The LUC activity obtained
from the 3'UTRpGU construct was not significantly different in comparison to the
pGUtontro1 construct. Similar to the S'üTRpGL3 construct, the 5'/3'UTRpGL3
consmict (carrying both UTR's) exhibited a 2.2-fold incmase in LUC activity in
comparison to the pGL3-control construct (p8.005; n=6). These results suggest that
the presence of the apoB 5WTR stimulated an increase in in vitro translation of LUC
mRNA, suggesting a role in translational control.
(text continues on p. 93)
Figure 12. Assessrnent of LUC mRNA --- -
the chimeric UTR-LUC Comtructs.
levels following transient transfection of
LUC mRNA levels were assessed by RT-PCR (Methods 2.10). RNA products used
for RT-PCR reactions were isolated following transient transfection of HepG2 cells
with the various chimeric UTR-LUC constructs. RT-PCR products were run on
agarose gels, stained with Sybr Gold and wen scanned using the Kodak 1D Digital
Science camera; a net intensity quantitation was determined for each product. A
representative scan of one RT-PCR experiment is displayed. Mean f SEM luciferase
rnRNA values are from 7 independent RNA isolation experiments. RNA was isolated
h m 7 independent experiments in which each construct was uruisfected in tnplicate.
Am~lified RT-PCR ~roduct from Total RNA
Figure 12.
Figure 13. In vitro translation of RNA producîs derived from transient
transfertion of HepG2 cells with the chimeric UTR-LUC constmcts.
Isolated RNA products from transient transfection of HepG2 cells with the various
chimeric UTR-LUC constmcts were translated in vitro (Methods 2.1 1).
Translatability of RNA for each construct was assessed by measunng LUC activity of
the reticulocyte lysate. Mean I SEM luciferase values are from 6 independent RNA
samples in vitro translated in duplicate. RNA was isolated from 6 independent
. experiments in which each construct was transfected in ai plkate.
Figure 13.
3.5 Effect of Insulin Hormone Tmatment on Lacifemse Exl,ression
Transfected cells were treated with insulin at the time of transfection and 48
hours pst-transfection for various time points as described (Methoth-2.12). Data
obtained from experiments in which cells were treated with insulin at the time of
transfection did not exhibit statistically significant differences in LUC activity in
nsponse to insulin treatment for the constructs relative to control treatment (Figure
14);however. a trend was observed in the 3WïRpGL3 construct. Insulin treatment
appeared to decrease LUC activity slightly in transfected HepG2 cells carrying l e '
3'üTR of apoB. Incubation of transfected cells with insulin for 6 hom. 48 hours post
tmnsfection. showed a sirnilar trend for the 3'UTRpGL3 constnict. A decnase was
also observed for the 5WïRpGL3 constnict. However both of these changes did not
nach statistical signi ficance (Figure 15). When HepG2 cells tnnsfected with the
chimeric constnicts were incubated with insulin for 12 hours. 48 hours post-
transfection, the results obtained did not nveal any significant differences in LUC
activity in nsponse to insulin treatment (Figure 16). Transfected cells incubated with
insulin for 18 hours, 48 hours pst-transfection, also did not msult in any significant
differences in LUC activity in rcsponse to insulin matment (Figure 17); however we
did observe a sirnilar trend for the SWi'RpGL3 and the 3WïRpGL3 constmcts in that
LUC activity was slightly àecnased.
( t a continues on p. IO2)
-
Fi y r e 14. Efféct of inwlin hormone treatment (48 hours) on LUC activity in -- HepG2 cells transiently transfkcted with the cbimeric UTR-LUC construc@.
HepG2 cells were transiently CO-transfected with the chimeric UTR-LUC constructs
and the pRL-TK vector. One set of cells was treated at the time of transfection with
media supplemented with 1 ug/ml insulin. Insulin was replenished 24 hours p s t
transfection and cells were harvested at 48 hours post transfection and assayed for
dual LUC activity. Mean f SEM luciferase values are fmm 2 independent
experiments perfonned in triplicate and one expriment perfomed in duplicate.
O Control
1 lnsulin
Figure 14.
Figvre 15. Effect of insulin hormone treatment (6 hours) on LUC activity in
HepG2 cells traasiently transfected with the chimeric UTR-LUC construcLa
HepG2 ceils were transientiy CO-transfected with the chimeric UTR-LUC constructs
and the pRL-TK vector. One set of cells was treated with media supplemented with
1 pghl insulin for a pend of 6 h o u , 48 hours post tmnsfection. Control and
insulin treated cells were then harvested and assayed for dual LUC activity. Mean f
SEM luciferase values are from 3 independent experiments performed in triplicate.
Figure 16. Effkct of insuUn h o m e treatment (12 boum) on LUC activity in -----.-- .- - -
HepG2 ceils transientiy transfected with the chimric UTR-LUC constnicts.
Hep02 cells were transiently CO-tnuisfected with the chimeric UTR-LUC constnicts
and the p&TK vector. One set of cells was treated with media supplemented with
10 ug/rnl insulin for a period of 12 hours, 48 hours p s t transfection. Control and
treated cells were then harvested and assayed for dual LUC activity. Mean f SEM
luciferase values are from 2 independent experiments perfomed in triplicate.
B Control
i lnsulin
Figure 16.
-- a Figure 17, Effect of insulin hormone tmtment (18 boum) on LUC activity in
HepG2 cells transiently transfwted with the chimeric UTR-LUC eonstnicts.
HepG2 cells were transiently CO-transfected with the chimenc UTR-LUC constructs
and the pRL-TK vector. One set of cells was treated with media supplemented with
1 @ml insulin for a period of 18 hours, 48 hours pst transfection. Control and
treated cells were then harvested and assayed for dual LUC activity. Mean f SEM
luciferase values are from 3 independent experiments performed in triplicate.
H Control
i Insulin
Figure 17.
Thyroid hormone treatment of HepG2 cells transfected with each construct did
not result in any statistically significant differences in LUC activity in comparison to
that in control cells (Figure 18).
3.7 Secondm Strucîute Predictions of the StUTR
The computer p r o p M-fold generated 8 secondary structure predictions of
the apoB S'UTR sequence; these are depicted in Figures 19A to 19H. Gibbs free
energy of formation determined for each prediction was in the range of -50.5 to -52.8
kcal/mol. The calculated values suggest that the structures formed by the apoB
S W T R are stable. Structural analysis of each prediction revealed that four of the 8
predictions possess a Ythaped structure with each branch of the "Y" occumng fmm
base pair 47-66 and 69-90 (19A-19D). The stem of the Y varies slightly in each case;
in two of the cases a short hairpin from base pair 3-13 exists (19A and 19B). in the
third case there is a hairpin from 3-13 and a small stem-lwp from 22-33 (19C) and in
the last case the stem is not4ntempted by other stnicturcs (19D). Other predictions
possess a small stem lwp at 118-128 (Figure 19A) and possess a larger stem loop
from 108-127 (Figure 19C). T b of the rcmaining structure pmdictions (19E-19G)
have the eppearance of an elongated Y-shapc since one of the branches is longer than
the other. The first branch (5' end) occurs h m base pair 21-67 and the second
branch occurs h m 69-90 in al1 3 structwcs. Structure 19E has a short hairpin fmrn
3- 13 and a long bulged stem-loop from 100428. Structure 19F also possesses a short
hairpin from 3-13; however, it also has a short stem-loop structure h m 92-113.
(text continues on p. 108)
Figure 18. Effmt of thyrokl hormone trePtment on LUC actîvity in HepG2 cells
tmiently tmndiected with the chimcric UTR-LUC constniets.
Hep02 cells were transiently CO-transfected with the chimenc UTR-LUC constructs
and the pRL-TK vector. Twelve hours post transfection, one set of cells was treated
with 50 nM thyroid hormone (T3) and the control set was treated with vehicle. Cells
were harvested aftcr 48 hours of treatment and assayed for dual LUC activity.
Mean f SEM luciferase values are h m 3 independent experiments perfonned in
tripkate.
Figure 18.
Figure 19 A-H. Secondary Structure Rodictions of the apoB S'UTR Genemted
by M-fold.
The apoB 5'UTR sequence was analyzed for its potential to form secondary structure
using M-fold, an RNA secondary structure prediction program. Eight predictions '
were generated by the program. Four of these predictions are displayed on page 106
in (Figure 19 A-D) and the remaining four are displayed on page 107 (Figures 19 E-
H). Distinctive features of each prediction such as stem-loop structurrs are
highlighted.
Figure 19 A-D.
Figure 19 E-AD
107
Smicture 190 lacks the short hairpin but contains a short stem-loop structure from
108-127. The final smicture prediction (19H) does not possess a Y-shaped structure
and is thus different from the other structure predictions; it possesses a short hairpin
from 3-13, a long stem-loop from 17-70. another stem-loop from 73-103 and a final
short stem loop from 108-127.
CHAPTER 4
DISCUSSION
Molecular mechanisms involved in the replation of apoB translation have not
been extensive1 y studied. Sequence and structural elements within the apoB UTR's
suggest that these seqwnces rnay participate in modulation of apoB mRNA
translation. The focus of Our study was to address the role of the 5' and 3' UTR's in
translational control of apoB rnRNA. Results obtained h m our experiments indicate
that the S'UTR of apoB is essential for its efficient translation. Biological activity of
the UTR sequences was investigated by transiently transfecting HepG2 cells with
chimeric DNA consûucts containing the S ' U T R andlor 3'UTR linked to a finfly
luciferase (LUC) reporter gene. LUC activity significantly incnased 2.2-fold and
1.8-fold for the S'UTRpGU and the S1/3'UTRpGL3 construct, respectively, in
cornparison to the pGL31ontrol vector. The negative control constnict (NCSpûL3)
exhibited a LUC activity essentially' equivalent to that obtained from the pGW-
control consûuct. This provides evidence for the sequence or structural specificity of
the S'UTR in mediating expression of the apoB mRNA. These results indicate that
presence of the S'UTR is essential for optimal expression. The 3'UTR on its own did
not significantly affect LUC activity. The 5'13'UTRpGU construct appeared to
exhibit LUC activity lower than that obtained from the construct carrying the S'UTR
alone. This suggests that the presence of the 3'üTR rnay attenuate the stimulatory
response observed in the S'UTRpGL3 construct. This observation may or rnay not be
a tme translational effect since we did not observe a concomitant demase for the
-A-- - - L.
S'Ci'UTRpGL3 constnict
translation experiments.
in cornpaison to the 521TRpûL3 construct in our in vitro
However. there may be two possible reasons to explain the results obtained
from Our transient transfection experiments. First. the decrease in LUC activity
observed from the 5'/3'UTRpGL3 constnict may be due to the presence of de-
stabilizing AU-rich elements present in the apoB 3'UTR. Seqwnces such as AU-rich
elements present in the 3'UTR of mRNAs alter stability or translatability of the
message when they are bound to trans-acting factors such as adenosine-uridine
binding factors (AUBFs) (Malter, 1989). However, this explanation is unlikely since
the suggested decreased stability imposed by the 3'CPTn would likely decrease mRNA
levels for the 5'13'UTRpGW constnict, an observation we did. not find in out
expenments. Second, the 3WïR may interact with the S'UTR and interfere with
trans-acting protein factors that may modulate translation. An example in which the
S'UTR and 3'UTR interact at the level of translation occurs in the protein omithine
decarboxylase. Omithine decarboxylase mRNA is translated inefficiently due to its
highly structured S'UTR which contains a stable stem-loop structure and an upstream
AUG codon (Manzella and Blackshear, 1990). It was shown that the presence of the
omithine decarboxylase 3'üTR paitially mluces the inhibition imposed by the
omithine decarboxylase S'UTR (Grens and Scheffler, 1990) and it was suggested that
the nlease of inhibition is indirect and may be mediated by cellular factors (Lorenzini
and Scheffler, 1997). This mechanism is also unlikely to explain Our findings as we
did not observe a similar decrease for the 5'13'UTRpGU constnict in our in vitro
translation expenments.
The concentration and activity of expressed RNA were also assessed using
RT-PCR and in vitro translation experiments. LUC mRNA levels did not
significantly change from one construct to another, thus implying that the increase in
LUC activity was likely pst-transcriptional in nature. In vitro translation of RNA
products denved h m cells transfacted with the UTR-LUC constructs also provides
evidence for pst-transcriptional modulation, since an increase in translatable LUC
activity was observed fmm RNA derived from cells transfected with constmcts
containing the 5WIR sequence. In fact, results obtained patalleled our ce11 cultt~re '
data in that a 2.2 and 2.2-fold increase in LUC activity was observed for the
S'UTRpGL3 and 5'13 WïRpGL3 constructs, respective1 y, in cornparison to control .
Taken together, the rrsults obtained from ce11 culture and in vitro exwments
provides support for the notion that the S'UTR plays an important role in optimal
translation of apoB mRNA.
Results obtained from Our hormonal studies indicated that insulin and thyroid
treatment did not sipificantly modulate translation of our reporter consmicts cmying
one or both of the apoB UTR sequences linked to the LUC gene. However, there was
a trend obsmed in insulin treated cells transfected with the 3WïRpOL3 construct,
towards a decrease in LUC activity. Several reports in HepG2 cells (Adeli and
Thenault, 1992, Dashti, et ai., 1989, Pdlinger, et al., 1989, Thenault, et al., 1992a)
and rat hepatocytes (Sparks and Sparks, 1990, Sparks, et al., 1992) have suggested
that insulin treatment reduced apoB sekretion and attenuated apoB translational
efficiency. Thyroid hormone inmased apoB synthesis at both the transcriptional and
translational level in HepG2 cells (Theriault, et al., 1992b).
Hormonal influence on translation al
documented. For exarnple. lipoprotein lipase
the level of the UTR's kas been
mRNA synthesis is ngulated by an
epinephnne induced trans-acting factor which binds to its 3'UTR (Yukht, et al.,
1995). In another study, crosslinking experiments determimd that estrogen induces
the binding of hepatic proteins to the 3'UTR sequences of estrogen-regulated
rnRNA's such as apoB, vitellogenin and chicken apolipoprotein II mRNA (Margot
and Williams, 1996). Thus, we hypothesized that insulin or thyroid treatment may
potentially induce cellular factors that would bind to the 5' andlor 3' UTR sequences
and subsequently modulate translation. ' Studies by Sparks et al. in cultured
hepatocytes fmm streptozoticin rats inâicated that decreased apoB synthesis was due
to pmlonged transit time and elongation of the polypeptiàe chah as deterrnined by
ribosome transit studies (Sparks, et al., 1992). Under the conditions of the presmt
study, the results obtained suggest that insulin and thyroid modulation of apoB
synthesis does not seem to function'at the üTR level as we did not observe any
stati sticall y significant differences in LUC activity of our chimeric UTR-LUC
construcu. The trend observed for the 3'UTRpGL3 construct from some of the
insulin expenments may suggest that the 3'UTR may potentially be involved in either
âecteased translational efficiency or stability. Further studies may clarify this trend.
The S'UTR of apoB is a short 128 base pair sequence. The leader sequence is
GC-rich with 76% of its length consisting of G+C nsidues. The S'UTR of apoB does
not contain any upsmarn AUG codons. Its AU0 codon occurs at position 1 of the
protein coding sequence. The context surrounding the AUG codon is favourable
(ggcgAUGgac) as it has a O. present at position -3 and +4 (Kozak, 1991). Since the
authentic AUG codon is in a good. context we assume that recognition by the Met-
tRNA occurs efficiently.
Sequences which are GC-rich have a tendency to fonn stable secondary
s&tures. Results obtained from analysis of the S'UTR using the cornputer program
M-fold predict a free energy of formation in the range of -50.5 to -52.8 kcal/mol. A
AG value in this range is indicative of the potential to form very stable secondary
structures and would likely result in4nefficient translation due to inability of the
ribosomal complex to unwind the secondary structure and nach the AUG codon
(Kozak, 1989a). An important consideration is the site at which the secondary
structure occurs. The stem-loop smictuns predicted by M-fold indicrite that rnost
stem-loops occur within the central ngion of the apoB 5'UTR. However, a short
hairpin structure was noted near the S'cap (at nt 3-13) in six of the eight predicted
structures; this sequence on its own hm a AG in the range of -5 kcal/mol. The fne
energy of such a stn~cture is not stable enough to inhibit the binding of the eIF4E
initiation factor to the 5' cap. Thus, the hairpin will likely not interfere with the
binding and initial scanning of the 40s ribosomal subunit.
M-fold resulis indicated that the p d c t e d stem-lwps occurred from
nucleotides 47-66 and 69-90; which are sites that lie within the centrai region of the
apoB S'UTR sequence. Stem-loops present within the central region may interfere
with the scanning of the bound 40s ribosomal complex for the first AUG codon
(Kozak, 1989b). This suggests that the SWïR should confer an inhibition of
translation; however this is not what we observed in our ce11 culture and in vitro
experiments. Our findings challenge some of the literature published which suggests
that most proteins containing
translation. However, a recent
highly stnictured S'UTR's lead to an inhibition of
paper by Vivinus et aï. [Vivinus, et ai., 2001) on the
human heat shock protein 70 (Hsp70) describes the fint nport of a S'UTR with a high
d e p of secondary structure to confer imreased translational efficiency of Hsp70
rnRNA translation. The 213 nt S ' U T R of human Hsp7O rnRNA is GC-rich and has a
preàicted AG of - -70 kcal/mol, a value which is indicative of stable secondary
structure. The presence of the human Hsp7O S'UTR in reporter constructs did not
modify M A levels in transfected cells suggesting that the increase in expression '
was due to enhanced translation and not increased transcription or mRNA stability.
It is possible that the secondary stmcture present in the S'UTR of apoB mRNA
is capable of king unwound by the presence of initiation factor, eIF4A. Initiation
factor eIF4A. upon activation by eIF4B, may unwind highly structured S'UTR's
through its ATP-dependent RNA helicase activity and thus decrease the repression
imposed by secondary stnicture (van der Velden and Thomas, 1999). In addition,
overexpression of the initiation factor eIF4E has been shown to pmmote translation of
ODC mRNA as well as other proteins such as ornithine aminotransferase and the
growth related protein P23 which also have highly structmd S'üTR's (Pain, 1996).
Thus, it is possible that the apoB message may be translateci according to the
scanning mode1 as is suggested for human Hsp70 mRNA translation (Vivinus, et al.,
2001).
We postulate that the stem-loop structures noted from the secondary structure
predictions may be potential binding sites for eukaryotic initiation factors or other
RNA-binding proteins whose function is to alleviate or relax the secondary stnicture
present in the S'üTR. These protein factors may ncruit translational machinery,
miwind secondary structure or incrcase mRNA stability thus contributing to efficient
translation of the apoB message. Such an occurrence is observed in translation of p27
mRNA. The 5'UTR of p27 mRNA contains a U-rich element that is essential for
efficient translation. The U-rich region foms secondary structure which has k n
shown to bind the protein factor HuR, a protein that has ken implicated in mRNA
stability and translation (Millard, et al., 2000). This finding presents an interesting
possibility that merits further investigation in our system.
Secondary structure analysis of the apoB S ' U T R nsulted in a Y-shaped
structure for 7 of the 8 predictions generated by the program. This presents the
possibility that apoB translation may occur via intemal ribosome entry sites (IRES).
Cornputer analysis of cellular mRNA's that direct their translation via IRES has
revealed a Y-shaped structural motif including the presence of a 3' lwp near the end
of the 1eader~'sequence (Le and Maizel, 1997). However, specific IRES consensus
sequence elements have not k e n elucidated (Kozak, 1999). Proteins which use IRES
for translation are also featured by long, highly structured UTR sequences, upstrearn
AUG codons and a polypyrirnidine tract (Sachs, et al., 1997). The S'UTR of apoB is
highly structurecl. hos a stable Y-fhPped seoondary structure with the pmence of a
small stem bop (in 5 of the 7 Y-shaped predictions) at the 3' end of the leader. Thus
some of the structurai featuns exhibited in the apoB mRNA are consistent witb other
cellular mRNAs ihat use this mechanism for translation. The features or cnteria that
are not consistent with other cellular rnRNAs are that the S'UTR of apoB is relatively
short and does not possess upstrearn AUG codons. Since Our results indicate that the
presmce of the highly stmctwed S'UTR nsults in increased LUC expression.
translation of apoB mRNA by intemal ribosomeenüy is one potential moehanisrn by
which the apoB mRNA may be translated efficiently. Further studies are necessary to
elucidate such mechanisms.
Exnression of arroBI5-UTR Constructs
An important next step in confinning the present studies will be to assess the
biological activity of the apoB UTR sbquences within the context of the endogenous
apoB protein coding sequence using the apoB1S constnicts generated. Four
constructs containing the apoB 5' andlor 3'UTR sequences upstream and downstream
of 15% of the N-terminal endogenous
Detailed descriptions of the generation
appendix in this thesis. Expression of the
apoB coding sequence were generated.
of these constmcts an provided in an
apoB15 constructs may k assessed in cell
culture experiments, by transient transfection of the apoB1S constructs into HepG2
cells. and ako in vitro by RT-PCR and in in vitro translation of RNA products
àerived fmm transfected cells. ApoBl5 synthesis may be detected using the
monoclonal antibodies (ID1 and 2D8) that spccifically bind to the N-teminal domain
of apoB. These studies would supplement the data obtained from the CiTR-LUC
reporter experiments, and may serve to support or dispute these findings.
IdentiSkrrtion of mtentiol cis-hwis intemetions
Gel-shift assays may be conducted to investigate the potential of cytoplasmic
protein factors to bind to the 5' and 3'UTR sequences of the apoB rnRNA.
Identification of gel-shifts may lead to cross-linking stuàies. If such experiments
allow for the detection of trans-acting cytoplasmic proteins, subsequent studies would
involve the characterization of such factors.
AssessinP the Unmtct of nautations on the S'UTR semence
It wouId be important ta identify potentiat sites of mutagenesis based m the
pndictions from M-fold results. Mutations to the predicted stem-lmps m y disrupt
the secondary structure and alter the biological activity of the putative RNA motifs
within the UTR sequence. Once sites are identified a set of LUC constructs
containing mutated S'UTR sequences +/- the 3'UTR may be generated. Biological
activity may be assessed by transfection into HepG2 cells and also in vitro by RT-
PCR and in vitro translation. niese studies wili help to funher tluciâate the specific
function of the cis-elements within the UTR sequences.
Adeli, K. 1994. Regulated infnicellular degradation of apolipoprotein B in semipermeable HepG2 cells. J Bi01 Chem. 269:9166-75.
Adeli, K., J. Macri, A. Mohammadi, M. Kito, R. ürade, and D. Cavallo. 1997. Apolipoprotein B is intracellularly associated with an ER40 protease homologue in HepG2 cells. J Biol Chem. 272:22489-94.
Aàeli, K,, A. Mohmadi , and J. Macri. 1995. Regulation of apolipoprotein B biogenesis in human hepatocytes: posttranscriptional control mechanisms that determine the hepatic production of apolipoprotein B-containing lipoproteins. Clin Biochem. 28: 123-30.
Adeli, K., and A. Theriault. 1992. Insulin modulation of human apolipoprotein B mRNA translation: studies in an in vitro cell-free system from HepG2 cells. Biochem Ce11 Biol. 70:1301-12.
Akiri, G., D. Nahari, Y. Finkelstein, S.Y. Le, O. Elroy-Stein, and B.Z. Levi. 1998. Regulation of vascular endothelial growth factor (VEGF) expression is mediated by interna1 initiation of translation and alternative initiation of transcription. Oncogene. 17:227-36.
Anant, S., and N.O. Davidson. 2000. An AU-rich sequence element (ULTUN[mU) downstream of the edited C in apolipoprotein B mRNA is a high-affinity binding site for Apoôec-1 : binding of Apoboc-1 to this motif in the 3' untranslated region of c- myc increases rnRNA stability . Mol Cet1 Biol. 20: 1982-92.
Anant, S., and N.O. Davidson. 2001. Molecular mechanisms of apolipoprotein B mRNA editing. Curr Opin LJpidol. 12: 159-65.
Antes, T.J., S.A. Goodart, C. Huynh, M. Sullivan, S.G. Young, and B. Levy-Wilson. 2 0 . Identification and characterization of a 315-base pair enhancer, located more than 55 kilobases 5' of the apolipoprotein B gene, that confers expression in the intestine. J Biol Chem. 275:26637-48.
Antes, T.J., and B. Levy-Wilson. 2001. HNF-3 kta, ClEBP beta, and HW-4 act in synergy to enhance transcription of the human apolipoprotein B gene in intestinal cells. DNA Ce11 Biol. 20:67-74.
Austin, M.A. 1994. Small, dense low-density lipopmtcin as a risk factor for coronary heart disease. Int J Clin h b Res, 24: 187-92.
Austin, M.A., and K.L. Edwards. 19%. Small, dense low density lipoproteins, the insulin rrsistance syndrome y d noninsulin-àependcnt diaôetes. Curr Opin Lipidul. 7 : 167-71.
Austin, M.A., M.C. King, K.M. Vranizan, and ROM. Ktauss. 1990. Atherogenic li poprotein phenot ype. A proposed genetic marker for coronary' heart disease nsk [see comments] . Circulati'on. 82:495-SM.
Backus, LW., and H.C. Smith. 1992. n i n e distinct RNA sequence elements are required for efficient apolipoprotein B (apoB) RNA editing in vitro. Nucleic Acids Res. 20:6007-14.
Benoist, F., and T. Grand-Perret. 1997. Co-translational degradation of apolipoprotein B 100 by the proteasorne is pnvented by microsomal triglyceride transfer protein. Synchronized translation stuâies on HepGZ cells treated with an inhibitor of microsomal triglycende transfer protein. J Bi01 Chem. 272:20435-42.
Bernstein, J., O, Sella, S.Y. Le, and 0. Elroy-Stein. 1997. PDGWc-sis mRNA leader contains a di fferen dation-linked intemal ribosomal enûy si te @-IRES). J Bi01 Chem. 272:9356-62.
Blackhart, B.D., E M Ludwig, V.R. Pierotti, L. Caiati, M.A. Onasch, S.C. Wallis, L. Powell, R. Pease, T.J. Knott, M.L. Chu, and et al. 1986. Structure of the human apolipoprotein B gene. J Biol Chem. 261 : 15364-7.
Blanc, V., N. Navaratnarn, J.O. Henâerson, S. Anant, S. Kennedy, A. Jannuz, J. Scott, and N.O. Davidson. 2001. Identification of GRY-RBP as an apolipoprotein B RNA-binding protein that interacts with both apobec-1 and apobec-1 complementation factor to modulate C to U editing. JBiol Chem. 276:10272-83.
Borchardt, R.A., and R.A. Davis. 1987. Intrahepatic assembly of very low density lipoproteins. Rate of transport out of the endoplssmic reticulum detemiines rate of secretion. J Biol Chem. 262: l 6 3 W 2 .
Boren, J., K. Olin, 1. Lee, A. Chait, T.N. Wight, and T.L. Innerarity. 1998. Identification of the principal proteoglycan-binding site in LDL. A single-point mutation in apo-BI00 severcly affects proteoglycan interaction without affecting LDL receptor binding. I Clin Invest. 101 :2658-64.
Boren, J., M. Wettesten, A. Sjokg, T. Thortin, G. Bondjers, O. Wikfund, and S.O. Olofsson. 1990. The assembly and secretion of apoB 100 containing lipoproteins in Hep 0 2 cells. Eviàence for diffemnt sites for protein synthesis and lipoprotein assembly. J Bi01 Chem. 265: 10556-64.
Bradbury, P., C.J. Mann, S. Kochl, T.A. Anderson, S.A. Chester, J.M. Hancock, P.J. Ritchie, J. Amy, G.B. Harrison, D.G. Levitt, L.J. Banaszak, J. Scott, and C.C. Shoulders. 1999. A cornmon binding site on the microsomal triglycende transfer protein for apoüpoprotein B and protein disulfide isomerase. J Bi01 Chem. 274:3 159- 64.
Brennan, C.M., and J.A. Steitz. 2001. HuR and mRNA stability. Ce11 Mol Life Sci. 58:266-77.
Brooks, A.R., B.D. Blackhart, K. Haubold, and B. Levy-Wilson. 1991. Chamterkation of tissue-specific enhancer elements in the second intron of the human apolipoprotein B gene. J Biol Chem. 266:7848-59.
Bmks, A.R., and B. Levy-Wilson. 1992. Hepatocyte nuclear factor 1 and C/EBP are essential for the activity of the human apolipoprotein B gene second-intron enhancer. Mol Ce11 Biol, 12: 1 134-48.
Brown, M.S., and J.L. Goldstein. 1986. A receptor-mediated pathway for cholesterol homeostasis. Science. 232:3447.
Bninzell, J.D., A.D. Snideman, J.J. Albers, and P.O. Kwiterovich, Jr. 1984. Apoproteins B. and A4 and coronary artery disease in humans. Arteriusclerosis. 4:79- 83.
Callow, MJ., and E.M. Rubin. 1995. Site-specific mutagenesis demonstrates that c ysteine 4326 of apolipoprotein B is required for covalent linkage wi th apolipoprotein (a) in vivo. J Biul Chem. 270:23914-7.
Callow, M.J., L.J. Stoltzfus, R.M. Lawn, and E.M. Rubin. 1994. Expression of human apolipoprotein B and assembly of lipoprotein(a) in üansgenic mice. Proc Nat1 Acad Sci tf S A. 91:2130-4.
Carlsson, P., and 0. Bjursell. 1989. Negative and positive promoter elements contribute to tissue specificity of apolipoprotein B expression. Gene. 77: 113-21.
Carlsson, P., P. Eriksson, and 0. Bjursell. 1990. Two nuclear proteins bind to the major positive element of the apolipoprotein B gene promoter. Gene. 94:295-301.
Cartwright, I.J., A.M. Hebbachi, and J.A. Higgins. 1993. Transit and sorting of apolipoprotein B within the endoplasmic rcticulum and Golgi compartments of isolated hepatocytes from nonnal and orotic acid-fed rats. J Bi01 Chem. 268:20937- 52.
Cavallo, D., D. Rudy, A. Moharnmadi, J. Macri, and K. Adeli. 1999. Studies on degraciatin mcchanisms mcdiating post-tmslationd fragmentation of apolipoprotein B and the generation of the 70-kDa fragment. J Bid Chem. 274:23135-43.
Cauola, M., and R.C. Skoda. 2000. Translational pathophysiology: a novel molecular mechanism of human disease. Bluod. 953280-8.
Chan, L., B.EL Chang, M. Nakamuta, W.H. Li, and L.C. Smith. 1997. Apobec-1 and apolipoprotein B mRNA editing. Biochim Biophys Acta. 1345: 1 1-26.
Chatterton, J.E., M.L. Phillips, L.K. Curtiss, R. Milne, J.C. Fruchart, and V.N. Schumaker. 1995. Immunoelectron rnicroscopy of low density lipoproteins yields a ribbon and bow mode1 for the conformation of apolipoprotein B on the lipoprotein surface. J Lipid Res. 36:2027-37.
Chen, G.C., W. Liu, P. Duchateau, J. Allaart, R.L. Hamilton, C.M. Mendel, K. Lau, D.A. Hardrnan. P.& Frost, M.& MaJloy, and et al. 1994. Conformational differences in human apolipoprotein B-100 arnong subspecies of low density lipoproteins (LDL). Association of altered proteolytic accessibility with decreased receptor binding of LDL subspecies from hypemiglycendemic subjects. J Biol Chem. 269:29121-8.
Chen, S.H., O. Habib, C.Y. Yang, Z.W. Gu, B.R. Lee, S.A. Weng, S.R. Silberman, S.J. Cai, J.P. Deslypen, M. Rosseneu, and et al. 1987. Apolipoprotein B-48 is the ptoduct of a messenger RNA with an organ-specific in-frame stop codon. Science. 238 :363-6.
Chen, Z., T.L. Eggennan, D. Potosky, M. Arborati, and A.P. Patterson. 2ûO. Calcium increases apolipoprotein B mRNA editing. Biochem Biophys Res Commun. 277:2S 1-7,
Chester, A., J. Scott, S. .Anarit, and N. Navaratnam. 2000. RNA editing: cytiâine to uridine conversion in apoli popmtein B rnRNA. Biochim Biophys Acta. 1494: 1 - 1 3.
Chuang, S.S., D. Banejee, and H.K. Das. 1999. Punfied apolipoprotein B gene regulatory factor-3 is DNA topoisornerase 1. Eur J Biochen? .263: 773-8 1.
Chuang, S.S., and H.K. Das. 19%. Identification of trans-acting factors that inieract with cis-acting elements present in the first nontranslated exon of the human apoli poprotein B gene. Biochem Biophys Res Commun. 220553-62.
Chuang, S.S., and H.K. Das. 1999. A single in vitro point mutation in the first non- translated exon silences transcription of the human apolipoprotein B gene in HepG2 cells. Biochim Biophys Acta. 1436:600-5.
Chuang, S.S., H. Zhuang, S.R. Reisher, S.I. Feinstein, and H.K. Das. 1995. Transcriptional regulation of the apolipoprotein B-100 gene: identification of cis- acting elements in the first nontranslated exon of the hurnan apolipoprotein B-100 gene. Biochem Biophys Res Commun. 2 15:394-404.
Chuck, S.L., and V.R. Lingappa. 1992. Pause transfer: a topogenic sequence in apolipoprotein B mediates stopping and nstarting of translocation. CetI. 68~9-2 1.
Chuck, S.L., and V.R. Lingappa 1993. Analysis of a pause transfer sequence from apolipoprotein B. J Bi01 C h . 268: 22794-80 1.
Chuck, S.L., Z. Yao, B.D. Bleckhart, BJ. McCrnthy. and V.R. Lingappa. 1990. New variation on the translocation of proteins during early biogenesis of apolipopmtein B. N a r e . 346:382-5.
Cladanis, C., M. Ha&opoulou-Cladaras, R. Avila, A.L. Nussbaurn, R. Nicolosi, and V.I. Zannis. 1986. Complementary DNA âerived structure of the amina-terminai domain of human apolipop&in B and s i x of its messenger RNA transcript. Biochemistry. 25:S3S 1-7.
Clemens, M.J., and U.A. Borner. 1999. Translational control: the cancer conneciion, ht J Biochem Cell B b L 3 1: 1-23,
Czaplinski, K., MJ. Ruiz-Echevmia, C.I. Gonzalez, and S.W. Peltz. 1999. Should we kill the messenger? The role of the surveillance complex in translation termination and mRNA turnover. Bioessays. 2 1 :685-96.
Das, HK., T. Leff, and J.L. Bnslow. 1988. Ce11 type-specific expression of the hurnan apoB gene is controlled by two cis-acting regulatory ngions. J Bi01 Chem. 263: 11452-8.
Dashti, N. 1992. The effect of low density lipoproteins, cholesterol, and 25- h ydrox ycholesterol on apoli poprotein B gene expression in HepG2 cells. J Bi01 Chem. 267:7160-9.
~ i h t i , N., D.L. Williams, and P. Alaupovic. 1989. Effects of oleate and insulin on the production rates and cellular mRNA concentrations of apolipoproteins in HepG2 cells. J Lipid Res. 30: 1365-73.
Davidson, N.O., R.C. Carlos, and A.M. Lukaszewicz. 1990. Apolipoprotein B mRNA editing is modulated by thyroid honnone analogs but not growth hormone administration in the rat. Mol Endocrinol. 4:779-85.
Davidson, N.O., and O.S. Shelness. 2000. APûLlPOPROTEIN B: mRNA editing, lipoprotein assembly, and presecretory degradation. Annu Rcv Nutr. 20: 169-93.
Davies, M.S., S.C. Wallis, D.M. Driscoll, J.K. Wynne, G.W. Williams, L.M. Powell, and J. Scott. 1989. Sequence requiiements for apolipoprotein B RNA cditing in msfected rat hepatoma cells. J Bi01 Chan. 264: 13395-8.
Davis, R.A. 1999. Cell and molecular biology of the assembly and secretion of apolipoprotein Btontaining lipoproteins by the liver. Biochim Biophys Acta. 1440: 1- 3 1.
Davis, R.A., R.N. Thrift, C.C. Wu, and KE. Howell. 1990. Apolipoprotein B is both integrated into and translocated across the endopiasmic reticulum membrane. Evidence for two functionall y distinct pools. J Bi01 Chem. 265: 1005-1 1.
Dixon, J.L., R. Chattapaàhyay, T. Huima, C.M. Redrnan, and D. Banerjee. 1992. Biosynthesis of lipoprotein: location of nascent apoAI and apoB in the rough endoplasmic reticulum of chicken hepatocytes. J Ce11 Biol. 117: 1 161-9.
Du, EZ., J. Ku*, S.L. Wang, P. Humiston, and R.A. Davis. 1994. Pmteolysis- coupled secretion of the N terminus of apolipoprotein B. Chanictenzation of a transient, translocation msted intermediate. J Bi01 Chem. 269:24I69-76.
Du. HZ., S.L. Wang, H.J. Kay&n, R. Sokol, L.K. Curtiss, and R.A. Davis. 19%. Ttans1ocation of apolipoprotùn R acrass the endoplasmic nticulum is blocked in abetalipoproteinemia. J Lipid Res. 37: 130% 15.
Fiaschi, T., P. Chiarugi, D. Veggi, G. Raugei, and 0. Ramponi. 2000. The inhibitory effect of the 5' untranslated region of muscle acylphosphatase mRNA on protein expression is relieved during ce11 di fferentiation. FEBS Lerr. 473:42-6.
Fiaschi, T., R. Manocchini, O. Raugei, D. Veggi, P. Chiarugi, and G. Ramponi. 1997. The 5'-untranslated region of the human muscle ac ylphosphatase mRNA has an inhibitory effect on protein expression. FEBS Lett. 4 17: 130-4.
Fisher, E.A., M. Zhou, D.M. Mitchell. X. Wu, S. Omura, H. Wang, A.L. Goldkrg, and H.N. Ginsberg. 1997. The degradation of apolipoprotein Blûû is mediated by the ubiquitin-proteasorne pathway and involves heat shock protein 70. J Biol Chem. 272:20427-34.
Fujino, T., N. Navaratnam. A. Jarmuz, A. von Haeseler, and J. Scott. 1999. C->U editing of apolipoprotein B mRNA in marsupials: identification and characterisation of APOBEC-1 from the Amencan opossum Monodelphus domestica. Nucleic Acids Res. 2732662-73.
Galeano, NF;, R. Milne, Y.L. Marcel, M.T. Walsh, E. Levy, T.D. Ngu'yen, A. Gleeson, Y. Arad L. Witte, M. al-Haiden. and et al. 1994. Apoprotein B structure and receptor recognition of trigl yceride-ric h low &nsi t y lipoprotein (LDL) is modified in small LDL but not in trigl ycende-rich LDL of nonnal size. J Biol Chem. 269:s 1 1-9.
Gao, M., D.T. Fritz, L.P. Ford, and J. Wilusz. 2000. Interaction between a poly(A)- specific ribonuclease and the 5' cap influences mRNA deadenylation rates in vitro. Mol Cell. 5:479-88.
Ginsberg, H.N. 1998. Lipopmtein physiology. Endocnnol Metab Clin North Ant. 27:503-19.
Gordon, D.A., H. Jamil, R.E. Gngg, S.O. Olofsson, and J. Boren. 1996. Inhibition of the Mcrosomal triglyceride transfer protein blocks the first step of apolipoprotein B lipoprotein assembly but not the addition of bulk core lipids in the second step. J Bi01 Chem. 271:33047-53.
Gncve, J., 1. Altkemper, J.H. Dicterich, H. Greten, and E. Windler. 1993. Apolipoprotein B M A editing in 12 different marnmaiian species: hepatic expression is nflected in low concentrations of apoB-containing plasma lipoproteins. J Lipid Res. 34: 1367-83.
Grens, A., and LE. Scheffler. 1990. The 5'- and 3'-untranslated regions of ornithine decarboxylase rnRNA affect the üanslational efficiency. J Biol Chem. 265: 11810-6.
Guhaniyogi, J., and 0. Brewer. 2001. Regulation of mRNA stability in mammalian ---- - a celk &ne. 265: 11-23.
Hadjiagapiou, Ce, F. Giannoni, T. Funahashi, S.F. Skarosi, and N.O. Davidson. 1994. Molecular cloning of a human small intestinal apolipoprotein B &A editing protein. Nucleic Acids Res. 22: 1874-9.
Hersberger, M., and T.L. Innemity. 1998. Two efficiency elements flanking the editing site of cytidine 6666 in the apolipoprotein B mRNA support mooring- dependent editing. J Biol Chem. 2739435-42.
Hirose, N., D.T. Blankenship, M.A. Knvanek, R.L. Jackson, and A.D. Cardin. 1987. Isolation and characterization of four heptuin-binding cyanogen bromide peptides of human plasma apolipoprotein B. Biochemistry. 26:SSOS- 12.
Hussain, M.M., A. Bakillah, N. Nayak, and G.S. Shelness. 1998. Amino acids 430- 570 in apolipoprotein B an cntical for its binding to Mcrosomal triglyceride transfer protein. J Bi01 C h . 273:ZS6 12-5.
Jaeger, J.A., D.H. Turner, and M. Zuker. 1989. Improved predictions of secondary structures for RNA. Proc Nat1 Acad Sci U S A. 86:77O6- 10.
Jaeger, LA., D.H. Turner, and M. Zuker. 1990. Predicting optimal and suboptimal secondary structure for RNA. Merhoth EntymoL 1 83: 28 1 -306.
Juo, S.H., T.H. Beaty, and P.O. Kwiterovich, Jr. 1997. Etiologic heterogmeity of h ypempobetalipopmteinemia (hyperapoB). Resul ts from segregation anal ysis in families with premature coronary artery âisease. Aflerioscler nironib Vasc Biol. 17:2729-36.
Kaptein, A., L. Roodenburg, and H.M. Rincen. 1991. Butyrate stimulates the secretion of apolipoprotein (apo) A-1 and apo Blûû by the human hepatoma ceIl line Hep 02 . Induction of apo A 4 mRNA with no change of apo BlOO mRNA. Biochenr J. 278557064.
Kardassis, D., M. Ha&opoulou-Cladaras, D.P. Rarnji, R. Cortese, V.I. Zannis, and C. Cladaras. 1990a. Characterization of the pmmotcr elements required for hepatic and intestinal transcription of the human apoB gene: definition of the DNA-binding site of a tissue-speci fic transcnptional factor. Mol Cell Biol. 10:2653-9.
Kaniassis, D., V.I. Zannis, and C. Cladaras. 1990b. Purification and characterization of the nuclear factor BAI. A transcriptional activator of the hurnan apoB gene. J Bi01 Chem. 265:21733-40.
Kardassis, D., V.I. Zannis, and C. Claâaras. 1992. Organization of the regdatory elcments and nuclear activities participating in the transcription of the human apolipoprotein B gene. J Bid Chem. 267:2622-32.
Knott, T.J., R.J. Pease, L.M. Powell, S.C. Wallis, S.C. Rall, Jr., T.L. Innerarity, B. B l a c w \K.EL Taylor, Y, Marcelt R Müae, Md et ai, 1986a Complete protein sequence and identification of structural domains of human apolipoprotein B. Nature. 323:734-8.
Knott, T.J., S.C. Rall, Jr., T.L. Innerarity, S.F. Jacobsen, M.S. Urdea, B. Levy- Wilson, L.M. Powell, R.J. Pease, R. Eddy, H. Nakai, and et ai. 1985. Human apolipoprotein B: structure of carboxyl-temiinal domains, sites of gene expression, and chromosomal localization. Science. 230:3743.
Knott, T.J., S.C. Wallis, L.M. Powell, R.J. Pease, A.J. Lusis, B. Blackhart, B.J. McCarthy, R.W. Mahley, B. Levy-Wilson, and J. Scott. 1986b. Complete cDNA and derived protein sequence of human apolipoprotein B- 100. Nucleic Acids Res. 14:7501-3.
Kozak, M. 1986. Influences of mRNA secondary structure on initiation by eukaryotic ribosomes. Proc Natl Acad Sci U S A. 83:28504.
Kozak, M. 1989a. Circumstances. and mechanisms of inhibition of translation by secondary structure in eucaryotic mRNAs. Mol Cell Biol. 9 5 134-42.
Kozak, M. 1989b. The scanning mode1 for translation: an update. J Cet2 Biol. lO8:229-41 . Kozak, M. 1990. Downsmarn secondary structure faciütates recognition of initiator codons by eukaryotic ribosomes. Proc Natl Acad Sci US A. 87:8301-5.
Kozak, M. 1991. Structural featms in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem. 266: 19867-70.
Kozak, M. 1999. Initiation of translation in prokaryotes and eukaryotes. Gene. 234: 187-208.
Krauss, R.M. 1998. Athemgenicity of triglyceride-rich lipoproteins. Am I Cardiol. 81:13B-17B.
Krauss RM, S.M., Blance PJ, Holl LG, Ma J, Hennekens CH. 1994. A prospective study of particle diameter and risk of rnyocardial infarction. Circulation. 90: 1460.
Kwiterovic h, P.O., Jr. 1988. HyperapoB: a pleiotmpic phenot ype chanicterized by &nse low-âensity lipoproteins and associated with coronary mery disease. C h Chem. 34:B71-7.
Kwitemvich, P.O., Jr. 2000. The metabolic pathways of high-density lipoprotein, Iow-density lipoptein, and triglycerides: a cumnt review. Am J Cardiol. 86:SL- 10L.
Kwiterovich, P.O., Jr., and A D . Snideman. 1983. Athemsclerosis and apoproteins B andA-h. PmvMcd, &2:8fS---
Lamarche, B., 1. Lemieux, and J.P. Despres. 1999. The small, dense LDL phenotype and the nsk of coronary heart disease: epiderniology, patho-physiology and therapeutic aspects. Diabetes Metab. 25: 199-21 1 .
Lau, P.P., B.& Chang, and L. Chan. 201. Two-Hybrid Cloning Identifies an RNA- Binding Rotein. GRY-RBP, as a Component of apobec- 1 Edi tosorne. Biochem Biuphys Res Commun. 282:977-83.
Lau, P.P., W.J. Xiong, H.J. Zhu, S.H. Chen, and L. Chan. 1991. Apoiipoprotein B mRNA editing is an intranuclear event that occurs posttranscriptionally coincident with splicing and polyadenylation. J Biol Chem. 266:20550-4.
Lau, P.P., H.J. Zhu, A. Baldini, C. Chamsangavej, and L. Chan. 1994. Dimeric structure of a human apolipoprotein B rnRNA editing protein and cloning atid chromosomal locaiization of its gene. Proc Nat1 Acad Sci U S A. 91:8522-6.
Le, S.Y., and J.V. Maizel, Jr. 1997. A common RNA stnictural motif involved in the interna1 initiation of translation of cellular mRNAs. Nucleic Acirls Res. 25362-69.
Lellek, H., R. Kirsten, 1. Diehl, F. Apostel, Fe Buck, and J. Grecve. 2000. Purification and molecular cloning of a novel essentiai component of the apolipopmtein B mRNA editing enzymecornplex. J Bi01 Chem. 275: 19848-56.
Levy, E.. D. Sinnett, L. Thibault, T.D. Nguyen, E. Delvin, and D. Menard. 19%. Insulin modulation of newly synthesized apolipoproteins B-100 and B-48 in human fetal intestine: gene expression and mRNA editing are not involved. FEBS Let?. 393:253-8.
Levy-Wilson, B., B. Paulweber, B.P. Nagy. E.H. Ludwig, and A.R. Brooks. 1992. Nuclease-hypersensitive sites define a region with enhancer activity in the third intron
-. of the human apolipoprotein B gene. J Biol Chem. 267: 18735-43.
Liang, S., X. Wu, E.A. Fisher, and H.N. Ginsberg. 2000. The amino-terminal domain of apolipoprotein B does not undergo retrograde translocation from the endoplasmic reticulum to the cytosol. Roteasorna1 degradation of nascent apolipoprotein B begins at the carboxyl terminus of the protein, while apolipoprotein B is still in its original translocon. J Bi01 Chem. 275:32003-10.
Linden, D., A. Sjokrg, L. Asp, L. Carlsson, and J. Oscarsson. 2000. Direct effects of growth hormone on production and secretion of apolipoprotein B from rat hepatoc ytes. Am J Physiol Endocrinol Metab.' 279:E 133 546.
Linton, M.F., R.V. Farese, Jr., G. Chiesa, D.S. Grass, P. Chin, R.E. Hamrner, H.H. Hobbs, and S.G. Young. 1993. Transgenic mice expressing high plasma
concentrations of human apoli poprotein B 1 ûû and li poprotein(a). J Clin Invest. 92: 3O2%37.
Lorentz, A., D. Plonne, H.P. Schulze, and R. Dargel. 1996. Dexamethasone enhanced by insulin, but not by thyroid hormones stimulates apolipoprotein B &A editing in cultured rat hepatocytes depending on the developmental stage. FEBS Lett. 391:57- 60.
Lorenzini, E.C., and LE. Scheffler. 1997. Cwpcration of the 5' and 3' untranslated regions of omithine decarboxylase mRNA and inhibitory role of its 3' untranslated region in regulating the translational efficiency of hybrid RNA species via cellular factor. Biochem J. 326:361-7.
Lusis, A.J., B.A. Taylor, D. Quon, S. Zollman, and R.C. LeBoeuf. 1987. Genetic factors controlling structure and expression of apolipoproteins B and E in mice. J Bi02 . Chern. 262:7594-604.
Macn, J., and K. Adeli. 1997. Studies on intracellular translocation of apolipoprotein B in a pem~abilized HepG2 system. J Bi01 Chem. 272:7328-37.
Malter, J.S. 1989. Identification of an AULTUA-specific messenger RNA binding protein. Science. 246:664-6.
Manzella, J.M., and P.J. Blackshear. 1990. Regulation of rat omithine decarboxylase mRNA translation by its 5'- untranslated ngion. J Biol Chem. 2621 1817-22.
Margot, J.B., and D.L. Williams. 19%. Estrogen induces the assembly of a multiprotein messenger ribonucleopmtein complex on the 3'-untranslated region of chicken apolipoprotein II mRNA. J Bi01 Chem. 271:445260.
McCarthy, LE., and H. Kollmus. 1995. Cytoplasmic rnRNA-protein interactions in eukaryotic gene expression. Trends Biochem Sci. 20: 191-7.
McCormick, S.P., J.K. Ng, M. Veniant, J. Boren, V. Pierotti, L.M. Flynn, D.S. Grass, ConnollyA, and S.G. Young. 1996. Transgenic mice that overexpress mouse apolipoprotein B. Evidence that the DNA sequcnces controlling intestinal expression of the apolipoprotein B gene are distant from the structural gene. J Biol Chem. 27 1: 1 1963-70,
Mehta, A., M.T. Kinter, N.E. Sherman, and D.M. Dnscoll. 2000. Molecular cloning of apobec-1 complementation factor, a novel RNA-binding protein involved in the editing of apolipoprotein B mRNA. Md Cc11 Biol. 20: 1846-54.
Metzger, S., J.L. Halaas, J.L. Breslow, and F.M. Sladek. 1993. Orphan receptor HNF- 4 and bZip protein CEBP alpha bind to overlapping regions of the apolipoprotein B gene promoter and synergistically activate transcription. J Bi01 Chem. 268: 1683 1-8.
Metzger, S., T. Leff, and J.L. Breslow . 1990. Nuclear factors AF-1 and CEBP bind --=- - ta the human ApoB gem promoter a d mociulate ita trsnscnptional activity in hepatic
cells. J Biol Chem. 265:9978-83.
Millard, S.S., A, Vidal, M. Markus, and A. Koff. 2000. A U-rich element in the 5' untranslated region is necessary for the translation of p27 -A. Mol Ce11 Biol. 205947-59.
Moberly, J.B., T.G. Cole, D.H Alpers, and G. Schonfeld. 1990. Oleic acid stimulation of apolipoprotein B secretion from HepG2 and Caco-2 cells occurs post- transcriptiondl y. Biochim Biophys Acta. 1042:70-80.
Nakamuta, M., K. Oka, J. Kmshkal, K. Kobayashi, M. Yamamoto, W.H. Li, and L. Chan. 1995. Alternative mRNA splicing and differential promoter utilization determine tissue-specific expression of the apolipoprotein B mRNA-editing protein (Apobecl) gene in mice. Structure and evolution of Apobecl and related nucleoside/nucleotide deaminases. J Biol Chem. 270: 1 3042-56.
Navaratnarn, N., R. Shah, D. Patel, V. Fay, and J. Scott. 1993. Apolipoprotein B mRNA editing is associated with W crosslinking of proteins to the editing site. Proc Nat1 Acad Sci U S A. 90:222-6.
Nielsen, L.B., D. Kahn, T. Duell, H.U. Weier, S. Taylor, and S.G. Young. 1998. Apolipoprotein B gene expression in a series of human apolipoprotein B transgenic mice generated with =CA-assisted rrstriction endonuclease cleavage-modified bacterial aitificial chromosomes. An intestine-specific cnhancer element is located between 54 and 62 kilobases 5' to the stmctwa) gene. J Bi01 Chem. 273:21800-7.
Olofsson, S., P. Stillemark-Billton, and L. Asp. 2000. Intracellular assembly of vldl. two major s teps in separate ce11 cornpartmen ts. Trends Cardiovasc Med. 10:338-45.
Olofsson, S.O., L. Asp, and J. Boren. 1999. The assembly and secretion of apolipoprotein 8-containing lipoproteins. Curr Opin Lipidol; lO:M 1-6.
Olofssqn, S.O., K. Bostrom, P. Carlsson, J. Boxen, M. Wettesten, O. Bjursell, O. Wiklund, and 0. Bondjers. 1987. Structure and biosynthesis of apolipoprotein B. Am Hean J. 113:446-52.
Ostareck-Lederer, A., D.H. Ostarcck, N. Standart, and B.J. Thiele. 1994. Translation of 1Elipoxygenase mRNA is inhibited by a protein that binds to a repeated sequence in the 3' untranslated region. Embo J. 13: 1476.8 1.
Pain, V.M. 19%. Initiation of protein synthesis in eukaryotic cells. Eur J Biochem. 236:747-7 1.
Pan, M., J. Liang, E.A. Fisher, and H.N. Ginsberg. 2000. Inhibition of translocation of nascent apolipoprotein B across the endoplasmic reticulum membrane is associated
with selective inhibition of the synthesis of apolipoprotein B. J Bi01 Chem. 2 3 5 2 7 3 M 5 .
Pariyarath, R., H. Wang, J D . Aitchison, H.N. Ginsberg, W.J. Welch, A.E. Johnson, and E.A. Fisher. 2001. Co-translational interactions of apoprotein B with the ribosome and tmnslocon during lipoprotein assembl y or targeting to the proteasorne. J Biol Chem. 276:54 1-50.
Paulwebcr, B., A.R. Brooks, B.P. Nagy, and B. Levy-Wilson. 1991. Identification of a negative regulatory region 5' of the human apolipoprotein B promoter. J Bi01 Chem. 266:2 1956-6 1.
Pease, R.J., G.B. Hamison, and J. Scott. 1991. Cotranslocational insertion of apolipoprotein B into the inner leafiet of the endoplasmic reticulum. Nature. 353:448- 50.
Pease, R.J., J.M. Leiper, G.B. Hanison, and J. Scott. 1995. Studies on the translocation of the amino terminus of apoli poprotein B into the endoplasmic reticulum. J Bi01 Chem. 27037261-71 . Powell, L.M., S.C. Wallis, R.J. Pease, Y.H. Edwards, T.J. Knott, and J, Scott. 1987. A novel form of tissue-specific RNA processing produces apolipoprotein-B48 in intestine. Cell. 50:83 1-40,
Pullinger, CR., J.D. North, B.B. Teng, V.A. Rifici, A.E. Ronhild de Brito, and J. Scott. 1989. The apolipoprotein B gcne is constitutivcly expressed in HepG2 cells: regulation of secretion by oleic acid, albumin, and insulin, and measurement of the mRNA hai f-li fe. J Lipid Res. 30: 1065-77.
Raabe, M., M.M. Veniant, M.A. Sullivan, C.H. Pot, J. Bjorkegren, L.B. Nielsen, J.S. Wong, R.L. Hamilton, and S.G. Young. 1999. Analysis of the role of microsomal trigl ycende tram fer protein in the Liver of tissue-speci fic knockout mice. J Clin Invest. 103: 1287-98.
Ranganathan, G., C. Li, and P.A. Kem. 2000. The translational regulation of lipoprotein lipase in diabetic rats involves the Puntranslated region of the lipoprotein lipase mRNA. J Biol Chem. 27540986-91.
Richardson, N., N. Navaratnam, and J. Scott. 1998. Secondary structure for the apolipoprotein B mRNA editing site. Au- binding proteins interact with a stem lwp. J Bi01 Chem. 273:31707-17.
Rogers, G.W., Jr., W.F. Lima. and W.C. Memck. 2001. Further characterizaiion of the helicase activity of eIF4A. Substrate specificity. J Biol Chem. 276: 12598608.
Ross, R. 1995. Cell biology of atherosclerosis. Annu RN Physiol. 57:791-804.
Ross, R. 1999. Atherosclerosis--an infiammatory âisease. N Engl J Med. 340: 1 15-26.
Sachs, A.B., P. Samow, and M.W. Hentze. 1997. Stariing at the beginning. middle, endend: trmsletio1) initiation ineuka~yotes. Ce#. 89831-8.
Sallach, S.M., and K. Adeli. 1995. Intracellular degradation of apolipoprotein B generates an N-terminal 70 kDa fragment in the cndoplasmic n ticul um. Biochim Biophys Acta. 1265:29-32.
Segrest, J.P., M.K. Jones, V.K. Mishm, G.M. Anantharamaiah, and D.W. Garber. 1994. apoB-100 has a pentapattite structure composed of three arnphipathic alpha- helical domains altemating with two arnphipathic beta-strand domains. Detection by the computer program LOCATE. Arterioscler niromb. 14: 1674-85.
Segrest, J.P., M.K. Jones, V.K. Mishra, V. Pierotti, S.H. Young, J. Boren, T.L. Innerarity, and N. Dashti. 1998. Apolipoprotein B- 100: conservation of lipid- associating arnphipathic secondary structural motifs in nine species of vertebrates. J Lipid Res. 39:85-102.
Sehgal, A., J. Briggs, J. Rinehart-Kim, J. Basso, and T.J. Bos. 2000. The chicken c- Jun 5' untranslated ngion directs translation by intemal initiation. Oncogene. 19:283645.
Selby, S.L.. and 2. Yao. 1995. Level of apolipopmtein B rnRNA has an important effect of the synthesis and secntion of apolipoprotein Btontaining lipoproteins. Studies on transfected hepatoma ceIl lines expressing recombinant human apolipoprotein B. Arterioscler Thromb Vasc Biol. 15: 1900-10.
Shah, R.R., T L Knott. J.E. Legros. N. Navaratnarn, J.C. Greeve, and J. Scott. 1991. Sequence requinments for the editing of apolipoprotein B rnRNA. J Bi01 Chem. 266: 1630 1-4.
Shelness, G.S., K.C. Morris-Rogers, and M.F. Ingram. 1994. Apolipoprotein B48- membrane interactions. Absence of transmembrane localization in nonhepatic ceils. J Bi01 Chem. 269:93 10-8.
Shelness, G.S., and J.T. Thomburg. 1996. Rok of intramolecular disulfide bond formation in the assembly and sec~tion of apolipoprotein B-100tontaining lipoproteins. J Lipid Res. 37:408-19.
Slyper, A.& 1994. Low-density lipoprotein density and atherosclerosis. Unraveling the connection [see comrnents]. Jama. 272:305-8.
Sowden, M.P., H.L. Collins, &C. Smith, T.A. Garrow, J.D. Sparks, and C.E. Sparks. 1999. Apolipoprotein B rnRNA and lipoprotein secretion are increased in McArdle RH-7777 cells by expression of ktaine-homocysteine S-methyltransferase. Biochem J. 341:639-45.
Sparks, J.D., and C.E. Sparks. 1990. Insulin modulation of hepatic synthesis and qzretion of apolipoprotein B b y rat hepatocytes. J Bi01 Chent. 2658854-62.
Sparks, J.D., R. Zolfaghari, C.E. Sparh, H.C. Smith. and E.A. Fisher. 1992. Irnpaired hepatic epdipoprocein B d-E translation in streptozotocin diabeiic rpta J C h Invest. 89: 14 18-30.
Teng, B., C.F. Burant, and N.O.. Davidson. 1993. Molecular cloning of an apolipoprotein B messenger RNA editing protein. Science. 260: 18 16-9.
Theriault, A., R. Cheung, and K. Adeli. 1992a. Expression of apolipoprotein B in vitro in cell-fm lysates of Hep02 cells: evidence that insulin modulates ApoB synthesis at the translational level. Clin Biochem. 25% 1-3.
Theriault, A., G. Ogbonna, and K. Adeli. 1992b. Thyroid hormone modulates apolipoprotein B gene expression in Hep02 cells. Biodiem Biophys Res Commun. 186:617-23,
Thomgate, F.E., R. Raghow, H.G. Wilcox, C.S. Werner, M. Heimberg, and M.B. Elam. 1994. Insulin promotes the biosynthesis and secretion of apolipoprotein B-48 by altering apolipoprotein B mRNA editing. Proc Nat1 A c d Sci U SA. 915392-6.
Tribble, D.L., R.M. Krauss, M.G. Lansberg. P.M. Thiel, and J. J. van den Berg. 1995. Greater oxidative susceptibility of the surface monolayer in small dense LDL may contribute to differences in copper-induced oxidation among LDL density subfrac tions. J Lipid Res. 36:662-7 1 .
Vagmr, S., M.C. Gensac, A. M a t , F. Bayard, F. Amalric, H. Rats, and A.C. Prats. 1995. Alternative translation of human fibroblast p w t h factor 2 mRNA occua by intemal entry.uf ribosomes. Mol Ce11 Biol. 15:35-44.
van der Velden, A.W., and A.A. Thomas. 1999. The role of the 5' untranslated ngion of an mRNA in translation regulation during development. Int J Biochem Ce11 Biol. 31:87-106.
van 't Hooft, F.M., S. Jormsjo, B. Lundahl, P. Tomvall, P. Eriksson, and A. Hamsten. 1999, A functional polymorphism in the apolipoprotein B promoter that influences the level of plasma low density Iipoprotein. J Lipid Res. 40: 1686-94.
Veniant, MM., E. Kim, S. McCormick, J. Born, L.B. Nielsen, M. Raabe, and S.G. Young. 1999a. Insights into apolipoprotein B biology h m transgenic and gene- iargcted rnice. J Nutr. lS45SS.
Veniant, MM., L.B. Nielsen, J. Bonn, and S.G. Young. 1999b. Lipoproteins containing apolipoprotein B-100 are secreted by the hem. Trends Cardiovmc Med. 9: 103-7.
Vivinus, S., S. Baulande, M. Van Zenten, F. Campbell, P. Topley, J.H. Ellis, P. Dessen, and H. Coste. 2001. An element within the 5' untranslated ngion of human Hsp70 mRNA which acts as a general enhancer of mRNA translation. Eur J Biochem. 268: 1908-17.
Wetterau, J.R., and D.B. Zilversmit. 1986. Localization of intracellular tiacylglycerol end-ehdesteryk ester tiaw fer aetivity in rat (issues. Biockim Biopkys Acta. $75610-7.
Wicksteed, B., T.P. Herbert, C. Alarcon, M.K. Lingohr, L.G. Moss, and C.J. Rhodes. 201 . Co-operativity between the preproinsulin mRNA UTRs is necessary for glucose stimulated translation. J Bi01 Chem. 10: 10.
Willis, A.E. 1999. Translational control of growth factor and proto-oncogene expression. Int J Biochem Ce22 Biol. 3 1:73-86.
Wu, X., N. Sakata, J. Dixon, and H.N. Ginsberg. 1994. Exogenous VLDL stimulates apolipoprotein B secretion from HepG2 cells by both pre- and pst-translational mechanisms. J Lipid Res. 35: 1200- 10.
Yamanaka, S., K.S. Poksay, M.E. Balestra, G.Q. Zeng, and T.L. Innerarity. 1994. Cloning and mutagenesis of the rabbit ApoB mRNA editing protein. A zinc motif is essential for catal ytic activity, and noncatalytic awtiliary factor(s) of the editing complex are widel y distxibuted. J Bi01 Chem. 269:2 1725-34.
Yang, C.Y., S.H. Chen, S.H. Gianturco, W.A. Bradley, J.T. S p m w , M. Tanimuni, W.H. Li, D.A. Sparrow, H. DeLoof, M. Rosseneu, and et al. 1986. Sequence, structure, receptor-binding domains and intemal repeats of human apolipoprotein B- 100. Nature. 323:738-42.
Yang, C.Y., Z.W. Gu, S.A. Weng, T.W. Kim, S.& Chen, H.J. Pownall, P.M. Sharp, S.W. Liu, W.H. Li, A.M. Gotto, Jr., and et al. 1989. Structure of apolipopmtein B- 100 of human low density lipoproteins. ArteMlerosis. 9:%-108.
Yang, Y., M.P. Sowden, and H.C. Smith. 2000. Induction of cytidine to uridine editing on cytoplasmic apolipoprotein B mRNA by ovenxpnssing APOBEC-1. J Bi01 Chem. 275:22663-9.
Yao, Z., and R.S. McLeod. 1994. S ynthesis and secretion of hepatic apolipoprotein B-containing lipoproteins. Biochim Biophys Acta. 1212: 152-66.
Yao, Z., K. Tm, and R.S. McLeod 1997. Intracellular degradation of newly synthesized apolipoprotein B. J Lipid Res. 38: 1937-53.
Yeung, S.J., S.H. Chen, and Le Chan. 1996. Ubiquitin-prottasome pathway mediates intracellular degradation of apolipoprotein B. Biockmistry. 35: 13843-8.
Yukht, A., R.C. Davis, LM. h g , G. Ranganathan, and P.A. Kem. 1995. Regulation of lipoprotein lipase translation by epinephrine in 3T3-LI cells. Importance of the 3' untranslated region. J Clin Znvest. %:2438-44.
Zhang, Z., A.D. Sniderman, D. Kalant, H. Vu. J.C. Monge, Y. Tao, and K. Cianflone. 1993. The role of amino acids h ApoB 100 synthesis and catabolism in human HepG2 cells. J Bi01 Chem. 268: 26920-6.
Zhou, B., N. Boudreau, C. Coulber, J. Hammarback, and M. Rabinovitch. 1997. Mcmtubult-associate& proteitr t iight chah 3 is s f i h & r r -A- binding protein linked to mRNA translation in lamb vascular smwth muscle cells. J Clin Invest. 100:3070-82.
Zhou, B., and M. Rabinovitch. 1998. Microtubule involvement in translational regulation of fibronectin expression by light chah 3 of microtubule-associated protein 1 in vascular smooth muscle cells. Circ Res. 83:481-9.
Zhou, M., E.A. Fisher, and RN. Ginsberg. 1998. Regulated Co-translational ubiquitination of apolipoprotein Blûû. A new paradigrn for proteasomal degradation of a secntory protein. J Biol Chem. 273:24649-53.
Zhuang, H., S.S. Chuang, and BK. Das. 1992. Transcriptional regulation of the apolipoprotein BlOO gene: purification and characterization of trans-acting factor BRF-2. Mol Cell Biol. 12:s 183-91.
Zuker, M. 1989. Cornputer predi&on of RNA structure. Methods Enzymol. l80:262- 88.
APPENDIX
A 1.1 PreDIUILhoon of the AmBlJ Constnrcts
Another approach used to study the role of the UTR sequenccs involved the
creation of constructs containing the UTR sequences linked to the protein of intenst.
As apoBlOO mRNA translates into a large pmtein (550 kDa), we decided to use a
uuncated forrn of the sequence in our constructs. We chose apoB1S which repnsents
15% of the N-terminal portion of t k apoBlOO sequence. Translation of this
tnincated protein should yield an apoB fagrnent of approximatel y 80 kDa. We used
the pGL3control vector to cnate the BIS consmicts as we wanted the vector
backbone to be analogous to the reporter constructs. We nmoved the LUC gene
using the HindIii and XbaI restriction sites and inserted the apoB1S coding sequence
in its place. The S W T R andor 3'UTR apoB sequences wen upstream and
downstream of the apoBlS coding sequence, respectively. Four apoB1S constructs
were generated: a control constmct containing the apoB1S sequence alone, a second
constnict containing the S'UTR upsûeam of the apoB15, a third containing the 3'UTR
downsveam of the apoBl5 and the fouith consmict containing both UTR sequences
appropriately positioned (Figure 20). Al1 primers used to mate these constructs were
obtained from the DNA synthesis facility at the Hospital for Sick Children.
A 1.1.1 Remration of the Ad315 Control Constmct
The control apoBlS sequence lacked both the 5' and 3WïR sequences and
was generated by PCR using the apoB 18 cDNA as a template. The forward primer
Figure 20. ApoBlS Constructs Carying the 5' andlor IUTR sequences of apoB
mRNA.
An illustrative schematic diagram displaying the apoB 15 constnicts generated. The
apoB15 coding sequence represents 15% of the N-terminal domain of apoB 100. The
apoB1S sequence was generated by PCR and primers were desiped to carry the
Hindm and XbaI restriction sites. The S'UTRapoBlS construct was also generated
by PCR using primers carrying the HindIII and XbaI restriction sites. These products
were subsequently cloned into the vector fragment of the pGL3tontrol vector (with
the LUC gene removed). The apoB1SJZTTR construct was generated by cloning the
apoB 3'UTR sequence into the apolS control constnict. The 5'üTRapoB lS-WTR
construct was generated by cloning the apoB 3'UTR into the S'UTRapoB15 construct.
Hindlll I
Xbal I
Hindlll Xbal
S'UTRapoB15 S'UTR apoB15
Xba( Xbal I
X bal Xbal
5@l3'UTRapoB15 I SUTR apoBl5 3'UTR
Legend: 0 = SV40 promoter
= SV40 enhancer
Figure 20.
contained four extra base pairs, the HindIII restriction site and was designed to anneal
h m base pair 129 (fimt nucleotide of che coding sequence) to 163 of the apoB
mRNA sequence. The reverse primer contained four extra base pairs, the XbaI
restriction site and was designed to anneal to base pairs 2181-2210 which represents
the 15% mark of the apoB mRNA sequence. This primer aiso contained a stop codon
positioned immediately after nucleotide 2210 of the apoB sequence and before the
restriction site sequence. The primers wen 45 base pairs in length and Tm values
were 78 and 70°C, respectively, for the forward and reverse primer.
F'omard Primer @Pl) for the ApoB 15 Contmi Construct:
S-GCGCAAGC7'7'ATGGACCCGCCGAGGCCCGCGCTGCTGGCGCTGCT-3'
Reverse Primer (RP1) for the ApoB 15 Control Construct:
5'-GCGCGCTCTAGATTATCCITCCAAGCCAATCTCGATGAGC-3'
The K R enzyme used was AmpliTaq Goldw. The components of the PCR reaction
were optimited. Final concentrations used in the reaction wen: 10 ng of apoBl8
cDNA tempiate, 0.5 mM each of forward and reverse primers, 2.5 units of AmpliTaq
Goldm, 1X PCR buffer, 4 mM MgCI2, 0.2 mM of each dNTP and 0.05% DMSO.
The addition of DMSO to the PCR reaction relaxed the secondary structure pnsent in
the 5' end of the apoB sequence. The PCR reaction was carried out as follows: 10 ng
of template was subjected to one cycle of 94OC for 10 minutes; 94OC for 1 minute;
66OC for 30 seconds and 72OC for 1 minute followed by 39 cycles of 94OC for 1
minute; 66OC for 30 seconds and 72°C for 1 minute and a final extension at 72°C for
10 minutes and a soak period at 4OC. The PCR product generated from this naction
is 2.072 kb. Products wen run on a 1% agarose gel and visualized by staining with
Sybr Gold. The PCR product was confirmed by restriction digestion with Sad
enzyme. Sac1 cuts apoB15 at base pair 520, thus the restriction map reveals two
DNA bands of 1.55 kb and 392 base pairs (since this lacks the 5'üTR). Prior to
ligating the apoBlS PCR product into the pGL3 vector, we subcloned the apoBl5
PCR product into the p ~ ~ @ 2 . 1 vector which is provided in the Original TA Cloning
Kit by Invitrogen. This linearized vector contains a single 3' deoxythymidine residue.
Thermostable polymerases such as AmpliTaq Goldm add 3' A-overhangs in each
PCR product; thus the PCR product is efficiently ligated with the p ~ ~ @ 2 . 1 vector.
The advantage of using the TA cloning is that modification of PCR products from
enzymatic reactions is eliminated. The protocol followed was provided in the
instruction manual for the TA cloning kit. We ligated 2 pl of fresh apoB15 PCR
product with 50 ng of ~ ~ ~ 2 . 1 vector, 4.0 Weiss units of T4 DNA ligase, 1X ligation
buffer and sterile water (to a final volume of 10 pi) ovemight at 14°C. The next &y,
the ligation was transfonned into competent cells. Two 1 pl and 9 pl aliquots of the
ligation mixture were transfemd into two diffennt vials containing 25 pl of INVoF
competent cells. After a 30 minute incubation on ice, the vials were heat shocked for
30 seconds in a 42T water bath and placed on ice again. At this point, 250 pi of
SOC medium was added to each vial; the vials were shaken at 37°C for 1 hour at 225
rpm in a shaking incubator. A g plates containing 100 pg/rnl ampicillin were
equilibrated at 37T for 30 minutes, spread with 40 pl of 40 m g h l X-Ga1 (to perform
bludwhite screening) and were used after the X-Gal had soaked into the plates. After
the 1 hour expression period, 50 )iI and 225 pl of the bacterial suspension were plated
ont0 the prepared agar plates and they wen subsequently placed in a 37°C incubator
ovemight. White colonies wen selected for screening since the presence of the insert - ---
inte+ the lacZ reading frarne nsulting in white colonies. Selected colonies were
grown overnight in LB Medium containing 100 pg/ml ampicillin; plasmid DNA was
isolated by mini-prep. DNA was anal yzed by restriction digest with Hindm and XbaI
(New England Biolabs). Digestion pducts were run on a 1% agarose gel; positive
clones contained two fragments, 3.9 kb (vector) and 2.072 kb (apoB1S insert). To
ensure that the 2.072 kb fragment detected was indeed the apoB1S insert. the clones
were digested with Sacl. Sac1 cuts apoBlS at base pair 520 and cuts the vector ohce '
at base pair 2 M which is situated appmximately 40 base pairs upstream of the
ligation site. Ligation of apoBlS insert in the correct orientation resulted in a
restriction map containing a 5.6 kb and 433 base pair fragment whe~as those inserted
in the reverse orientation resulted in 4.33 and 1.7 kb fragments. Plasrnid DNA from
the positive clone was digested with HindIIï and XbaI (New England Biolabs)
restriction enzymes ovemight in a 370C water bath. The digested DNA was nin on a
1% agarose gel and was visuaiized with EtBr staining. The appropriate band was
excised and gel purified using the QIAquick Gel Extraction kit. An aliquot of the gel
purified insert was run on an agarose gel and stained with Sybr Gold.
The pGL3-control vector was digested ovemight in a 37T water bath with
Hindm and XbaI (NEB) restriction enzymes to remove the LUC gene. The âigested
vector was run on an agarose gel and stained with EtBr. The 3.6 kb band
comsponding to the vector fragment wai excised and gel purified. The gel purified
product was run on an agame gel and stained with Sybr Gold. The gel purified
vector fragment and apoB 15 insert were ligated using a 1: 1 ratio based on intensity of
staining with Sybr Gold. Final ligation reaction components included 400 units of T4
DNA ligase (New England Biolabs). 1X ligase buffer and purified water (up to a final
volume of 10 pl) and the ligation was performed ovemight at 14°C. Ligation
nactions (10 pl) were transfonned in 50 pl of DHSa competent cells. After a 1 hour
incubation in the bacterial shaker, the bacterial suspension was centnfuged and 900 pl
of the media was removed.
100 pl of LB media) and
Clones were selected and
The bacterial pellet was resuspended (with the nmaining
plated on agar plates containing 100 p@ml ampicillin.
p w n ovemight in LB medium containing 100 Mm1
ampicillin. Plasmid DNA was isolated using a mini prep kit (Roche). DNA
exüacted from the clones was digested with Hindm and Xbd restriction enzymes
(NEB). Positive clones had two bands present, 2.072 and 3.6 kb which corresponded
to the insert and vector, respectively. Digestion pioducts were run on an agarose gel
and visualized by Sybr Gold staining. To confirm the positive clones detemiined by
the Hindm and XbaI digestion, the clones were also digested with Sacl. As
previously mentioned, S a d cuts the apoB15 insert at base pair 520. Sac1 also cuts the
pGU vector sequence once at base pair 1 1. as such the restriction map of the apoB1S
control constnict has two fragments of approximately 650 base pairs and 5 kb.
Digestion products were run on an agarose gel and were visualized with Sybr Gold
staining. One positive clone [P1(17)#1] was selected and was sequenced. The
foward sequencing primer annealed to a sequence upstrearn of the Hindm restriction
site and is descrikd in Methods 2.6.3. The sequencing primer used for the reverse
reaction annealed to a sequence downstream of the XbaI site and is described in
Methods 2.6.2. After confirmation of the constmct by sequencing results, a large
stock of the plasmid was generated. Plasmid DNA was isolated by rnini-prep (Roche --.-
kit) and the amplified constnict was confinned by restriction digestion with HindIIi
and XbaI (Figure 2 1).
A 1.1.2 Pre~aration of the S'UTRAmBlS Construct
The apoBlS sequence was generated by PCR using the apoBI8 cDNA as a
template. This sequence contained the 128 base pair S'UTR and 15% of the apoB
mRNA coding sequence. The forward primer used to generate this PCR product was
the same as the SWïR forward primer described in Methods 2.6.1. The reverse
primer used in this reaction was the same as in Appendix 1.1.1 for the apoB1S control
construct. In addition, the PCR conditions used to generate this product were
anaiogous to those described in Appendix 1.1.1. However, the PCR product of this
reaction was 2.210 kb since it contains the S'UTR sequence. PCR products were mn
on a 1% agarose gel and were visualized by staining with Sybr Gold. The PCR
products were confirmed by digestion with the nstriction enzyme, SacI, which
produces two DNA fragments of 1.55 kb and 520 base pairs. The S'UTRapoBlS
PCR product was also subcloned into the TA cloning vector using the exact
procedure described in Appendix 1.1.1. Positive clones contained two fragments of
2.2 kb (S'UTRapoBlS insert) and 3.9 kb ( p C ~ ~ 2 . 1 vector) after digestion with
Hindm and XbaI (NEB). To ensure that the 2.2 kb fragment was in fact the apoB
sequence, positive clones were also digested with SacI. S'UTRApoBIS inserts ligated
in the comct orientation resulted in a restriction map containing 5.6 kb and 533 base
pair fragments whereas those insezted in the reverse orientation resulted in 4.33 and
Figure 21. Digestion of the ApoBlS Control Construct with HhdIII and XbaI
Restriction En ymes.
Digestion products of the apoB 15 control construct were analyzed by electrophoresis
on a 1% Agarose Gel after staining with Sybr Gold. This construct contained 15% of
the N-terminal coding sequence of apoBlOO (excluding the S'UTR sequence) in the
place of the LUC gene. The LUC gene was removed fiom the pGL3-control vector
by digestion with Hindm and XbaI. The 3.6 kb vector fiagment was gel 'purified
pnor to ligation. The apoB1S hgment was generated by PCR using primers
containing Hindm and XbaI sites on the 5' and 3' flanking regions respectively. The
apoB 15 PCR product was subcloned into a TA clonhg vector (Invitrogen). M e r
idmtifying positive clones the apoBl5 fiagrnent wes removed from the TA cloning
vector by restriction digestion with Hindm and Xbd. The fiagment was gel purified
and was subsequently ligated with the pGL3-control vector fragment. Positive clones
contained two fkagments, one corresponding to apoBlS (2.072 kb) and the other
comsponding to the pGL3-control vector f iapent (3.6 kb). Sequence fidelity of the
apoB 15 PCR generated insert in the constmct was c o n h e d by DNA sequencing.
3.6 kb (pGL3 vector)
2.07 kb (apoBlg
1.7 kb fragments. Plasmid DNA h m the positive clone was digested with Hindm
and XbaI restriction enzymes ovemight in a 37OC water bath. The digested DNA was
mn on a 1% agarose gel and was visualized with EtBr staining. The appropriate band
was excised and gel punfied. An aliquot of the gel purified insert was nin on an
agarose gel and stained with Sybr Gold. The S'UTRapoBlS and pGL3 control vector
gel purified fragments were ligated and transfonned using the same procedures
described for the apoBl5 control consinict in Appendix 1.1.1. Positive clones
contained two bands of 3.6 and 2.2 kb which correspondcd to the vector and insert
fragments, respectively. Positive clones were also digested with Sac1 restriction
enzyme; the restriction map generated included two bands of approximately 5 kb and
800 base pairs. One selected positive clone [PZ(ll)lt8)] was sequenced using the
same primen dcscribed in Appendix 1.1.1. After sequencing nsults confimed the
construct, a large scde plasmid prep was generated from the original bacterial
suspension of'the clone. Isolated DNA was confirmed by restriction digestion with
Hindm and XbaI restriction enzymes. Digestion products were run on an agarose gel
and were visualized by Sybr Gold staining (Figure 22).
A 1.1.3 Pre~aration of the ADOBIS-~~UTR Constmct
This construct was created by ligating the apoB 3'UTR into the confimed
apoBl5 constnict from Appendix 1.1.1. A 30 JAI aliquot of the apoB 15 constnict
DNA was digested with XbaI restriction enzyme (NEB) ovemight in a 37OC water
bath. The digestion mixture was placed in a 6S°C water bath for 10 minutes to
Figurc 22. Digestion of the S'UTRApoBlJ Construct witb HiadIII and XbaI
Restriction Enzymes.
Digestion products of the 5'UTRapoB 1 5 construct were and yzed b y electrophoresi s
on a 1% Agarose Gel after staining with Sybr Gold. This consûuct contained the
apoB S'UTR and 15% of the N-terminal coding sequence of apoBlûû in the place of
the LUC gene. The LUC gene was removed from the pGL3tontrol vector by
digestion with HincüiI and Xbai. The 3.6 kb vector fragment was gel purified prior to
liption. The SWïRapoB15 fragment was generated by PCR using primers
containing HindIII and XbaI sites on the 5' and 3' flanking regi,ons respectively. The
S'UTRapoB15 PCR product was subcloned into a TA cloning vector (Invitmgen).
After identifying positive clones, the S'UTRapoB15 fragment was removed from the
TA cloning vector by restriction digestion with Hincüïi and XbaI. The fragment was
gel purified and was subsequently ligated with the pGL3-contml vector fragment.
Positive clones contained two ftagments, one comsponding to the S'UTRapoB15 (2.2
kb) and the other comqmmiing to the pGW-conuol vector fragment (3.6 kb).
Sequence fidelity of the S'UTRapoB15 PCR generated insert in the construct was
confinned by DNA sequencing.
kb (pGL3 vector)
kb (SUTRapoB15)
-
inactivate the XbaI enzyme. The IineMzed vector was then dephosphorylated using - -, . . -. . -
Shrimp Alkaline Phosphatase (SAP). A 4 pl aliquot of the linearized vector was
treated with 0.5 units of SAP and 1X buffer for 10 minutes in a 37OC water bath
followed by a 15 minute incubation in a 6S°C water bath to inactivate the SAP. The
linearized apoB15 construct was t k n ready for ligation with the apoB 3'üTR.
The 3WïR was generated by PCR using the same primers described in
Methods 2.6.2 which contained XbaI sites in each flanking region. The PCR enzyme
used to generate this product was ArnpliTaq Goldm. Final PCR components used in
each reaction were: 10 ng of apoEilO0 cDNA template, 0.5 mM each of forward and
reverse primers, 2.5 units of AmpliTaq Goldm, 1X PCR buffer, 4 m M MgCls and
0.2 mM of each dNTP. The PCR maction was camied out as follows: the template
was subjected to one cycle of 94OC for 10 minutes; 94OC for L minute; 52OC for 45
seconds and 72OC for 1 minute followed by 34 cycles of 940~'for 1 minute; 52OC for
45 seconds and 72°C for 1 minute and a final extension at 72°C for 10 minutes and a
soak period at 4OC. The PCR product was approximately 324 base pairs long and a 5
pl aliquot was run on an agarose gel stained with Sybr Gold to verify its size. The
3'UTR PCR product (45 pi) was run on an agarose gei, stained with EtBr and the
band of interest was excised and gel purified. The gel piirified 3'UTR was digested
ovemight with XbaI restriction enzyme (NEB) in a 37OC water bath. The digestion
mixture was then transferred to a 65°C water bath for 15 minutes to inactivate the
enzyme.
The linearized and àephosphorylated apoBl5 constmct was ligated with the
similarly digested 3'UTR using a 1:1 and 1:4 ratio and 2 0 units of T4 DNA ligase,
1X ligase buffer and punfied water (to a final volume of 10 pl) at 14OC. As a
negative control, the linearized and dephosphorylated apoB1S conml constnict alone
was also ligated with no insert present. After 4 hours, another 200 units of the T4
DNA ligase was added to each ligation reaction and was left ovemight at 14OC. The
next &y the ligation reaction was transfomicd into DHSa comptent cells. The
bacterial suspension was plated ont0 agar plate containing 100 pg/ml ampicillin.
Clones selected were grown ovemight in LB media containing 100 pg/ml ampicillin;
plasmkls were isolated by mini prep. Plasmid DNA was analyzed by restriction
digest with Xbai. Positive clones contained two fragments of 5.67 kb and 304 base
pairs which comsponded to the apoBl5 constmct and J'UTR, rrspectively.
Digestion products were run on an agarose gel and were stained with Sybr Gold
(Figure 23). Positive constructs were verified for sequence fidelity and orientation by
DNA sequencing. The primer used was the reverse primer descnbed in Methods
2.6.2. Sequencing nsults confirmed the construct apoB1Sœ3'UTR(#3) as the. 3'üTR
was ligated in the comct orientation into the apoB 15 control construct.
A lblb4 Pre~aration of the S'UTR-AmBlS-3'UTR Construct
To generate this constmct, the apoB 3'UTR was ligated into the confirmed
S'UTRapoBlS construct from Appendix 1.1.2. The S'UTRapoB consmct was
digested and dephoshorylated exactly as describcd for the apoB15-3WïR construct in
Appendix 1.1.3. The 3'UTR purified fragment used in this ligation reaction was
analogous to that described in Appendix 1.1.3. In addition, ligation, transformation
procedure and screening of clones were perfomed as descnbed in Appendix 1.1.3.
Figure 23. Digestion of the ApoB15-3'UTR Construct with XbaI Restriction
Enzyme*
Digestion products of the apoB1S-3'UTR construct were detected by electrophoresis
on a 1% Agarose Gel after staining with Sybr Gold. This construct contained the
3'UTR cloned downstnarn of the apoBt5 coding sequence. This constnict was
created by cloning the PCR generated apoB 3'UTR sequence (with XbaI on both the
5' and 3' flanking regions) into the apoBl5 conml construct. The apoBlS constnict
was linearized with XbaI. gel purifkd and dephosphorylated prior to Iigation with the
similarly digested 3'UTR. Positive clones contained two fragments, one
comsponding to the apoBlS control construct (5.67kb) and the other cornsponding
to the apoB 3'UTR fragment (304 bp). Sequence and orientation fidelity of the
3'UTR inserted into the construct was confinned by DNA sequencing.
304 bp (apoB YUTR)
Figure 23.
15 1
Figure 24. Digestion of the S'UTR-ApoBlS-3'UTR Constniet with XbaI
Restriction Enzyme.
Digestion pmducts of the S'UTRapoB15-3'UTR construct were detected by
electmphoresis on a 1% Agarose Gel after staining with Sybr Gold. This consmict
contained the 3'UTR cloned downstrearn of the S'üTRapoBlS construct. This
constnict was created by cloning the PCR generated apoB 3WTR sequence (with
XbaI on both the 5' and 3' flanking regions) into the S'UTRapoB15 constnict. The
S'UTRapoB15 construct was linearized with XbaI, gel purified and dephosphorylated
prior to ligation with the similarly digested 3'UTR. Positive clones contained two
fragments. one comsponding to the S'UTRapoB15 construct (5.8 kb) and the other
comsponding to the apoB 3'UTR fragment (304 bp). Sequence and orientation
fideiity of the 3'UTR inserted into the construct was confirmed by DNA sequencing.
Figure 24.
153
Positive clones for this construct contained two bands of 5.8 kb and 304 base pairs --.... -
after digestion with Xbd. Digestion poducts were run on an agame gel and were
visualized with Sybr Gold staining (Figure 24). Positive clones were sequenced using
the reverse primer described in Methods 2.6.2. A positive clone (S'UTR-apoB1S-
3'UTR#13) containing the 3'UTR ligated in the comct orientation into the S'UTR-
apoB 15 construct was accomplished.