rnai-mediated inhibition of hiv-1 by targeting partially complementary viral sequences
TRANSCRIPT
![Page 1: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/1.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 1/14
RNAi-Mediated Inhibition Of HIV-1 By Targeting
Partially Complimentary Viral Sequences
Ying Poi Liu, Jens Groober, Joost Hasnoot, Pavlina Constantinova and Ben Berkhout
Presented By - : K.Rahul and P.Shamina
INTRODUCTION :
AIDS is one of the most prevalent and dangerous
diseases in the world caused by the Human
Immunodefiency Virus. This virus has foiledmany an attempt to inhibit either its genomic
function or its entry and infection due its ability
to mutate and give rise to new variants of HIV.
Inhibition of HIV replication post-infection can
lead to a possible permanent cure/temporary
suppression. This is achieved by RNA
interference.
AIM :
To produce significant inhibition of replication in
both the wild type and mutant escape viruses of
HIV-1 by utilizing an miRNA and shRNA
combinatorial approach.
MATERIALS AND METHODS :
�Construction of DNA constructs using HIV-1
pLAI plasmid.
�Inductionof mutations using Fusion PCR.
�Construction of luciferase reporter constructs
using pGL3-Nef vector.
�Culturing of Hek293T cells for transfection.
�Construction of respective miRNA¶s and
shRNA¶s.
�Luciferase reporter assay system and ELISA to
record results.
�miRanda algorithn to determine putative target
sites.
RESULTS :
Efficient inhibition of HIV-1 replication [60%] is
observed when a combinatorial approach of
miRNA¶s and shRNA¶s are used. Inhibition of
both wild type and mutant variants of HIV-1 is
observed along with prolonged inhibition of HIV-
1 replication which ensures the suppression ordelay of further mutant strains of HIV-1 from
being generated.
C : Inhibition of luciferase expression with pBS as control [100%]
D : Inhibition of virus replication with pBS as control [100%]
CONCLUSION:
�Durable HIV-1 inhibition is achieved using miRNA + shRNA.
�Targeting of conserved sequences ensures inhibition of even
mutant escape forms of HIV-1 virus.
� Usage of a combinatorial miRNA + shRNA approach results in
better inhibition of HIV-1 replication.
�Method of delivery and RNAi suppression are still important
aspects to consider.
�Hematopoeitic stem cell transplants can be engineered to
produce stem cells that express these specific miRNA¶s and
shRNA¶s. This can give rise to permanent immunity to HIV-1.
�Off target effects are also of concern and need to be minimized.
�Combinations of various approaches that results in a multi
pronged attack can result in efficient HIV-1 replication inhibition.
REFERENCES:
�Karin Jasmijn von Eije, Olivier ter Brake, and Ben Berkhout, HIV-1
Escape Is Restricted When Conserved Genome Sequences Are Targetedby RNA Interferenc,JOURNAL OF VIROLOGY, Mar. 2008, p. 2895±
2903 Vol. 82, No. 6
Liu,Y.P., Haasnoot,J., Ter Brake,O., Berkhout,B. and Konstantinova,P.
(2008) Inhibition of HIV-1 by multiple siRNAs expressed from a singlemicroRNApolycistron. NucleicAcids Res., 36, 2811±2824.
![Page 2: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/2.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 2/14
RNAiRNAi--mediated Inhibition Of HIVmediated Inhibition Of HIV--11
By Targeting Partially ComplementaryBy Targeting Partially Complementary
Viral SequencesViral Sequences
RNAiRNAi--mediated Inhibition Of HIVmediated Inhibition Of HIV--11
By
Targeting Partially ComplementaryBy Targeting Partially Complementary
Viral SequencesViral Sequences
Ying Ying PoiPoi Liu,Liu, JensJens Gruber,Gruber, JoostJoost HaasnootHaasnoot,, PavlinaPavlina
KonstantinovaKonstantinova andand BenBen BerkhoutBerkhout
[[61946194± ±62046204 NucleicNucleic AcidsAcids Research,Research, 20092009,, VolVol.. 3737,, NoNo.. 1818 oioi::1010..10931093/ /nar nar/gkp /gkp644644]]
Presented By Presented By ±± RahulRahul KuncheKunche
ShaminaShamina PathanPathan
![Page 3: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/3.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 3/14
RNA INTERFERENCE AND ITS MECHANISM
�� InherentInherent phenomenonphenomenon presentpresent inin almostalmost allall eukaryoticeukaryotic organisms,organisms, andand
humanhuman cellcell lineslines..
��AlsoAlso knownknown asas PostPost TranscriptionalTranscriptional GeneGene SilencingSilencing [PTGS][PTGS].. RNAiRNAi --
protectionprotection of of thethe genomegenome againstagainst invasioninvasion byby mobilemobile geneticgenetic elementselements suchsuch
asas virusesviruses andand transposontransposonss..
��NobelNobel prizeprize awardedawarded toto AndrewAndrew FireFire andand CraigCraig MelloMello inin 20062006 forfor theirtheir
discoverydiscovery of of RNARNA interferenceinterference inin thethe nematodenematode wormworm CaenorhabditisCaenorhabditiseleganselegans..
��ExperimentExperiment involvedinvolved injectioninjection of of dsds--RNARNA intointo CC..elegans¶selegans¶s bodybody cavitycavity..
TheThe wormsworms injectedinjected withwith thethe RNARNA exhibitedexhibited aberrantaberrant twitchingtwitching
movementsmovements duedue toto thethe silencingsilencing of of uncunc2222 genegene codingcoding forfor thethe myofilamentmyofilament
proteinprotein ..
��ExogenousExogenous dsds--RNARNA DicerDicer cleavagecleavage siRNA¶ssiRNA¶s siRNsiRNA+RISCA+RISC GuideGuide
ssRNA+RISCssRNA+RISC BindBind toto mRNAmRNA CleavageCleavage PTGSPTGS..
��MicroRNA¶sMicroRNA¶s ((miRNAsmiRNAs)) areare genomicallygenomically encodedencoded nonnon--codingcoding RNAsRNAs andand
shRNA¶sshRNA¶s areare RNA¶sRNA¶s withwith tighttight hairpinhairpin turnsturns ..
�� InherentInherent phenomenonphenomenon presentpresent inin almostalmost allall eukaryoticeukaryotic organisms,organisms, andand
humanhuman cellcell lineslines..
��AlsoAlso knownknown asas PostPost TranscriptionalTranscriptional GeneGene SilencingSilencing [PTGS][PTGS].. RNAiRNAi --
protectionprotection of of thethe genomegenome againstagainst invasioninvasion byby mobilemobile geneticgenetic elementselements suchsuch
asas virusesviruses andand transposontransposonss..
��NobelNobel prizeprize awardedawarded toto AndrewAndrew FireFire andand CraigCraig MelloMello inin 20062006 forfor theirtheir
discoverydiscovery of of RNARNA interferenceinterference inin thethe nematodenematode wormworm CaenorhabditisCaenorhabditiseleganselegans..
��ExperimentExperiment involvedinvolved injectioninjection of of dsds--RNARNA intointo CC..elegans¶selegans¶s bodybody cavitycavity..
TheThe wormsworms injectedinjected withwith thethe RNARNA exhibitedexhibited aberrantaberrant twitchingtwitching
movementsmovements duedue toto thethe silencingsilencing of of uncunc2222 genegene codingcoding forfor thethe myofilamentmyofilament
proteinprotein ..
��ExogenousExogenous dsds--RNARNA DicerDicer cleavagecleavage siRNA¶ssiRNA¶s siRNsiRNA+RISCA+RISC GuideGuide
ssRNA+RISCssRNA+RISC BindBind toto mRNAmRNA CleavageCleavage PTGSPTGS..
��MicroRNA¶sMicroRNA¶s ((miRNAsmiRNAs)) areare genomicallygenomically encodedencoded nonnon--codingcoding RNAsRNAs andand
shRNA¶sshRNA¶s areare RNA¶sRNA¶s withwith tighttight hairpinhairpin turnsturns ..
![Page 4: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/4.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 4/14
�Pri-miRNA Pre-miRNA Mature miRNA PTGS�shRNA Exported to cytoplasm siRNA PTGS
�Since the discovery of RNAi scientists have tried to implement this method to
produce different silencing effects in various organisms and also to cure
diseases.
�In this research by Ying Poi Liu et. al, HIV is the targeted disease for PTGS.
�Pri-miRNA Pre-miRNA Mature miRNA PTGS�shRNA Exported to cytoplasm siRNA PTGS
�Since the discovery of RNAi scientists have tried to implement this method to
produce different silencing effects in various organisms and also to cure
diseases.
�In this research by Ying Poi Liu et. al, HIV is the targeted disease for PTGS.
![Page 5: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/5.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 5/14
HIVHIV--1 THE ELUSIVE VIRUS1 THE ELUSIVE VIRUS
��HIVHIV--1 is a retro1 is a retro--virus belonging to Family :virus belonging to Family : retroviridaeretroviridae,,
Genus :Genus : LentivirusLentivirus..
��Attacks cells of the host immune systemAttacks cells of the host immune system ± ± TThh cells andcells and
macrophages.macrophages.
��Replicates via Reverse Transcription and by utilizing hostReplicates via Reverse Transcription and by utilizing host
chromosome machinery .chromosome machinery .
��Sometimes HIVSometimes HIV--1 replicates1 replicates
with errors that get stabilized.with errors that get stabilized.
��HIVHIV--1 is a retro1 is a retro--virus belonging to Family :virus belonging to Family : retroviridaeretroviridae,,
Genus :Genus : LentivirusLentivirus..
��Attacks cells of the host immune systemAttacks cells of the host immune system ± ± TThh cells andcells and
macrophages.macrophages.
��Replicates via Reverse Transcription and by utilizing hostReplicates via Reverse Transcription and by utilizing host
chromosome machinery .chromosome machinery .
��Sometimes HIVSometimes HIV--1 replicates1 replicates
with errors that get stabilized.with errors that get stabilized.
![Page 6: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/6.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 6/14
HIVHIV--1 INFECTION MECHANISM1 INFECTION MECHANISM
![Page 7: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/7.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 7/14
InhibitionInhibition Of Of HIVHIV--11 ByBy RNAiRNAi MediatedMediated TargetingTargeting Of Of
PartiallyPartially ComplementaryComplementary SequencesSequences
��ThoughThough siRNA¶ssiRNA¶s cancan efficientlyefficiently inhibitinhibit translation,translation, errorerror proneprone HIVHIV--11
escapesescapes thisthis byby targettarget mutationmutation..
��TheThe aimaim of of thisthis researchresearch waswas toto targettarget errorerror proneprone HIVHIV--11 escapeescape
mutantsmutants byby usingusing miRNA¶smiRNA¶s andand shRNA¶sshRNA¶s insteadinstead of of siRNA¶ssiRNA¶s..
��YingYing PoiPoi LuiLui etet.. alal utilizedutilized thisthis abilityability of of miRNA¶smiRNA¶s toto partiallypartially pairpair withwith
targettarget sequencessequences resultingresulting inin inhibitioninhibition of of HIVHIV--11 escapeescape mutantsmutants..
��TheThe pLAIpLAI plasmidplasmid encodingencoding thethe HIVHIV--11 isolateisolate LAILAI isis usedused toto produceproduce
virusvirus..
��MutationsMutations introducedintroduced byby FusionFusion PCR PCR usingusing oligonucleotideoligonucleotide withwith thethe
mutationsmutations..
��AA mutantmutant ± ± SingleSingle oror DoubleDouble mutationmutation inin pLAIpLAI [[88A/A/1515A]A]
��DD mutantmutant ± ± SingleSingle mutationmutation inin 66//1111 andand DoubleDouble mutationmutation inin 88//1111 andand
1313//1515
��
FireflyFirefly luciferaseluciferase expressionexpression vectorvector pGLpGL33--Nef Nef constructconstruct usedused totoconstructconstruct luciferaseluciferase reporterreporter constructsconstructs..
![Page 8: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/8.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 8/14
��HivHiv--11 fragmentfragment of of 600600,,10001000 andand 16001600 bpbp isis PCR PCR amplifiedamplified usingusing fullfull
lengthlength molecularmolecular cloneclone pLAIpLAI asas templatetemplate..
��PrimersPrimers usedused ± ±
LucLuc--II f f:: GGAATTCATTATCGTTTCAGACCCACCTCGGAATTCATTATCGTTTCAGACCCACCTCLucLuc--II rr:: AACTGCAGGCTGCCTTGTAAGTCATTGGTCAACTGCAGGCTGCCTTGTAAGTCATTGGTC
LucLuc--IIII f f:: GGAATTCCACACCTCAGGTACCTTTAAGACGGAATTCCACACCTCAGGTACCTTTAAGAC
LucLuc--IIII rr:: AACTGCAGTCACCAGCGTTTCTGGGTGAGCAACTGCAGTCACCAGCGTTTCTGGGTGAGC
LucLuc--II f f andand LucLuc--IIIIII rr..
��PurifiedPurified PCR PCR fragmentsfragments digesteddigested byby EcoR EcoR11 andand PstPst11 areare insertedinserted
intointo pGLpGL33--Nef Nef vectorvector..
��TheThe luciferaseluciferase reporterreporter constructsconstructs encodingencoding ACDEACDE wildwild--typetype targetstargets
ACDEACDEwtwt andand thethe mutatedmutated targetstargets ACDEACDEmm11 andand ACDEACDEmm22 areare
constructedconstructed..
��LuciferaseLuciferase reporterreporter ACDEACDEmm11 targettarget alteredaltered byby introductionintroduction of of
observedobserved viralviral escapeescape mutationsmutations ::
GG88AA inin targettarget AA andand D,D,
AA66GG inin targettarget C,C, GG66AA inin targettarget EE..
��LuciferaseLuciferase reporterreporter ACDEACDEmm22 encodesencodes thethe ACDEACDE targettarget withwith aa pointpoint
mutationmutation atat positionposition 1515 inin eacheach targettarget..
![Page 9: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/9.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 9/14
��Hek Hek293293TT cellscells culturedcultured inin DMEMDMEM.. ForFor luciferaseluciferase andand HIVHIV--11
inhibitioninhibition assays,assays, HEK HEK 293293TT cellscells seededseeded inin 2424--wellwell withoutwithout
antibioticsantibiotics.. TransfectionsTransfections werewere performedperformed usingusing LipofectamineLipofectamine 20002000
reagentreagent..
��HEK HEK 293293TT cellscells werewere coco--transfectedtransfected withwith 100100 ngng of of fireflyfirefly luciferaseluciferase
reporterreporter plasmidsplasmids (pGL(pGL33),), 11 ngng of of renillarenilla luciferaseluciferase expressionexpression
plasmidplasmid ((pRLpRL--CMV)CMV) andand differentdifferent amountsamounts of of hairpinhairpin RNARNA
expressionexpression constructsconstructs..
��TwoTwo daysdays postpost--transfectiontransfection,, luciferaseluciferase andand renillarenilla expressionexpression werewere
measuredmeasured withwith thethe DualDual--LuciferaseLuciferase ReporterReporter AssayAssay SystemSystem andand
relativerelative luciferaseluciferase activityactivity waswas calculatedcalculated..
��InhibitionInhibition of of virusvirus productionproduction waswas determineddetermined byby coco--transfectiontransfection of of
250250 ngng HIVHIV pLAIpLAI,, 11 ngng pRLpRL--CMVCMV andand differentdifferent amountsamounts of of hairpinhairpin
RNARNA constructsconstructs intointo HEK HEK 293293TT cellscells..
��Two days postTwo days post--transfectiontransfection, the CA, the CA--p24 levels in the culturep24 levels in the culture
supernatant was determined by ELISA.supernatant was determined by ELISA. RenillaRenilla luciferaseluciferase expressionexpression
of of transfectedtransfected cells and relative virus production was calculated.cells and relative virus production was calculated.
��Putative target sites forPutative target sites for miRNAsmiRNAs in the 3in the 3dd UTR of the HIVUTR of the HIV--1 RNA1 RNA
genome are determined using thegenome are determined using the miRandamiRanda algorithm.algorithm.
![Page 10: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/10.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 10/14
Results And DiscussionResults And Discussion
![Page 11: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/11.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 11/14
![Page 12: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/12.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 12/14
![Page 13: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/13.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 13/14
CricticalCrictical Analysis And ConclusionAnalysis And ConclusionCricticalCrictical Analysis And ConclusionAnalysis And Conclusion
�For durable HIV inhibition prevention of viral escape is important.
�
siRNA
perfectly complimentary sequences. Combinatorial miRNA+ shRNA approach targeting partially complenetary sequences.
�miRNA Partial complimentarity [Only downregulates]
�shRNA Complete complimentarity + Inherited Through vector
[Interferon response]
�Targeted conserved sequences. HIV replication inhibited irrespective
of mutant form.
�First tested against luciferase reporter constructs. Low amount of
inhibition constructs High inhibition [60%]
�Off-target effects, RNAi suppression by Tat protein and Delivery
method are a few of the concerns.
�Can genetically alter stem cells and Target HIV-1 target cells instead.
�Though much progress is seen in usage of RNAi for HIV inhibition a
lot more research is required prior to actual clinical application.
�For durable HIV inhibition prevention of viral escape is important.
�
siRNA
perfectly complimentary sequences. Combinatorial miRNA+ shRNA approach targeting partially complenetary sequences.
�miRNA Partial complimentarity [Only downregulates]
�shRNA Complete complimentarity + Inherited Through vector
[Interferon response]
�Targeted conserved sequences. HIV replication inhibited irrespective
of mutant form.
�First tested against luciferase reporter constructs. Low amount of
inhibition constructs High inhibition [60%]
�Off-target effects, RNAi suppression by Tat protein and Delivery
method are a few of the concerns.
�Can genetically alter stem cells and Target HIV-1 target cells instead.
�Though much progress is seen in usage of RNAi for HIV inhibition a
lot more research is required prior to actual clinical application.
![Page 14: RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences](https://reader031.vdocuments.us/reader031/viewer/2022021214/577d2baa1a28ab4e1eab0c1f/html5/thumbnails/14.jpg)
8/7/2019 RNAi-mediated Inhibition Of HIV-1 By Targeting Partially Complementary Viral Sequences
http://slidepdf.com/reader/full/rnai-mediated-inhibition-of-hiv-1-by-targeting-partially-complementary-viral 14/14