Copyright � 2009 by the Genetics Society of AmericaDOI: 10.1534/genetics.109.101915

Retrograde Intraflagellar Transport Mutants Identify Complex A ProteinsWith Multiple Genetic Interactions in Chlamydomonas reinhardtii

Carlo Iomini,1 Linya Li, Jessica M. Esparza and Susan K. Dutcher2

Department of Genetics, Washington University School of Medicine, St. Louis, Missouri 63110

Manuscript received February 18, 2009Accepted for publication August 25, 2009

ABSTRACT

The intraflagellar transport machinery is required for the assembly of cilia. It has been investigated bybiochemical, genetic, and computational methods that have identified at least 21 proteins that assembleinto two subcomplexes. It has been hypothesized that complex A is required for retrograde transport.Temperature-sensitive mutations in FLA15 and FLA17 show defects in retrograde intraflagellar transport(IFT) in Chlamydomonas. We show that IFT144 and IFT139, two complex A proteins, are encoded byFLA15 and FLA17, respectively. The fla15 allele is a missense mutation in a conserved cysteine and thefla17 allele is an in-frame deletion of three exons. The flagellar assembly defect of each mutant is rescuedby the respective transgenes. In fla15 and fla17 mutants, bulges form in the distal one-third of the flagellaat the permissive temperature and this phenotype is also rescued by the transgenes. These bulges containthe complex B component IFT74/72, but not a-tubulin or p28, a component of an inner dynein arm,which suggests specificity with respect to the proteins that accumulate in these bulges. IFT144 and IFT139are likely to interact with each other and other proteins on the basis of three distinct genetic tests: (1)Double mutants display synthetic flagellar assembly defects at the permissive temperature, (2) het-erozygous diploid strains exhibit second-site noncomplemention, and (3) transgenes confer two-copysuppression. Since these tests show different levels of phenotypic sensitivity, we propose they illustratedifferent gradations of gene interaction between complex A proteins themselves and with a complex Bprotein (IFT172).

CILIA and flagella are microtubule-based organellesthat are found on most mammalian cells. They

provide motility to cells and participate in many sensoryprocesses. Defects in or loss of cilia/flagella cause avariety of human diseases that include polycystic kidneydisease, retinal degeneration, infertility, obesity, re-spiratory defects, left–right axis determination, andpolydactyly (Fliegauf et al. 2007). Mouse mutantsdemonstrate that cilia are essential for viability, neuraltube closure, and bone development (Eggenschwiler

and Anderson 2007; Fliegauf et al. 2007). Cilia andflagella are also present in protists, algae, moss, andsome fungi.

The assembly and maintenance of cilia and flagellarequire intraflagellar transport (IFT) (Kozminski et al.1995). IFT involves the movement of 100- to 200-nm-long protein particles from the basal body located in thecell body to the tip of the flagella using the heterotri-meric kinesin-2 (anterograde movement) (Kozminski

et al. 1995) and movement back to the cell body(retrograde movement) using the cytoplasmic dyneincomplex (Pazour et al. 1999; Porter et al. 1999). IFTparticles change their direction of movement as well astheir size, speed, and frequency at the ends of theflagella as they switch from anterograde to retrogrademovement (Iomini et al. 2001). Biochemical isolation ofIFT particles reveals that they are composed of at least16 proteins and that these particles can be dissociatedinto two complexes in vitro by changing the saltconcentration (Cole et al. 1998; Piperno et al. 1998).Recent genetic and bioinformatics analysis adds at least7 more proteins to the IFT particle (Follit et al. 2009)(Table 1). Complex A contains at least 6 polypeptidesand complex B contains at least 17 polypeptides.Analysis of mutations in Chlamydomonas, C. elegans,zebrafish, and mice demonstrates a requirement of IFTproteins and their motors for ciliary/flagellar assembly(Eggenschwiler and Anderson 2007).

A collection of temperature-sensitive mutant strainsthat fail to assemble flagella at the restrictive tempera-ture of 32� was isolated in Chlamydomonas (Huang et al.1977; Adams et al. 1982; Piperno et al. 1998; Iomini et al.2001). Analysis of the flagella at 21� permits themeasurement of the velocity and frequency of IFTparticles in the mutant strains. This analysis suggestedthat assembly has four phases: recruitment to the basal

Supporting information is available online at http://www.genetics.org/cgi/content/full/genetics.109.101915/DC1.

1Present address: Department of Developmental and RegenerativeBiology, Mt. Sinai School of Medicine, New York, NY 10023.

2Corresponding author: 660 S. Euclid Ave., Department of Genetics, Box8232, Washington University, St. Louis, MO 63110.E-mail: dutcher@genetics.wustl.edu

Genetics 183: 885–896 (November 2009)

body, anterograde movement (phases I and II), retro-grade movement, and return to the cytoplasm (phasesIII and IV) (Iomini et al. 2001). Different mutants wereclassified as defective in these four phases. However,because different alleles of FLA8 were classified asdefective in different phases (Iomini et al. 2001; Miller

et al. 2005), we combined mutants with IFT defects intojust two classes. The first group (phases I and II) includesmutant strains that show decreased anterograde veloc-ities, a decreased ratio of anterograde to retrogradeparticles, and an accumulation of complex A proteins atthe basal body. This group includes mutations in theFLA8 and FLA10 genes, which encode the two motorsubunits of kinesin-2 (Walther et al. 1994; Miller et al.2005), as well as mutations in three unknown genes(FLA18, FLA27, and FLA28). The second group includesmutant strains that show the reciprocal phenotype(phases III and IV); these phenotypes include decreasedretrograde velocities, an increased ratio of anterograde

to retrograde particles, and an accumulation of complexB proteins in the flagella. With the exception of theFLA11 gene, which encodes IFT172, a component ofcomplex B (Pedersen et al. 2005), the gene products inthis class are unknown (FLA2, FLA15, FLA16, FLA17, andFLA24). One might predict that mutations in this groupwould map to genes that encode complex A or retro-grade motor subunits. Interestingly, IFT particles iso-lated from fla11, fla15, fla16, and fla17-1 flagella showdepletion of complex A polypeptides (Piperno et al.1998; Iomini et al. 2001). The inclusion of IFT172 in thisclass is explained by the observations that IFT172 plays arole in remodeling the IFT particles at the flagellar tip totransition from anterograde to retrograde movement(Pedersen et al. 2005). The remaining mutant strains donot show obvious defects in velocities, ratios, or accu-mulation at 21� and may reflect a less severe phenotypeat the permissive temperature or a non-IFTrole for thesegenes.

TABLE 1

Proteins and gene names for the intraflagellar transport particles in Chlamydomonas, C. elegans, and mouse

Protein MotifChlamydomonas

geneC. elegans

gene Mouse geneReferences to worm

and mouse genes

Complex AIFT144 WD FLA15IFT140 WD — che-11 Qin et al. (2001)IFT139 TRP FLA17 dyf-2 THM1 Efimenko et al. (2006);

Tran et al. (2008)IFT122 WD — IFTA-1 Blacque et al. (2006)IFT121 WD — daf-10 Bell et al. (2006)IFT43 —

Complex BIFT172 WD FLA11 osm-1 Wimple Huangfu et al. (2003);

Pedersen et al. (2005);Bell et al. (2006)

IFT88 TRP IFT88 osm-5 Tg737/Polaris Pazour et al. (2000);Qin et al. (2001)

IFT81 Coil — ift-81 CDV1 Kobayashi et al. (2007)IFT80 WD — che-2 Wdr56 Fujiwara et al. (1999)IFT74/72 Coil — ift-74 Cmg1 Kobayashi et al. (2007)IFT57/55 Coil — che-13 Hippi Haycraft et al. (2003)IFT54 Microtubule binding

domain MIP-T3— dyf-11 Traf3IP1 Kunitomo and Iino

(2008); Li et al. (2008);Omori et al. (2008);Follit et al. (2009)

IFT52 ABC type BLD1 osm-6 Ngd2 Brazelton et al. (2001);Bell et al. (2006)

IFT46 IFT46 dyf-6 Bell et al. (2006);Hou et al. (2007)

IFT27 G protein — Not present Rabl4IFT25 Hsp20 — Not present HSP16.1 Follit et al. (2009)IFT22 G protein — IFTA-2 Rabl5 Schafer et al. (2006)IFT20 Coil — Follit et al. (2006)FAP22 Cluamp related protein — dyf-3 Cluamp1 Murayama et al. (2005);

Follit et al. (2009)DYF13 — dyf-13 Ttc26 Blacque et al. (2005)

—, no mutant found to date in Chlamydomonas.

886 C. Iomini et al.

Direct interactions occur between components ofcomplex B. IFT81 and IFT74/72 interact to form ascaffold required for IFT complex B assembly (Lucker

et al. 2005). IFT57 and IFT20 also interact with each otherand kinesin-2 (Baker et al. 2003). While physical inter-actions are being used to define IFT particle architecture,genetic interactions among loci encoding IFT compo-nents should be instructive regarding their function aswell. To probe retrograde movement and its function, wehave identified the gene products encoded by tworetrograde defective mutant strains. They are FLA15and FLA17 and encode IFT144 and IFT139, respectively.The genetic interactions of these loci provide interestingclues about the assembly of the IFT particles and possiblephysical interactions in the IFT particles.

MATERIALS AND METHODS

Strains and culture media: Strains fla15-1, fla16-1, fla17-1,fla17-2, and fla24 (Piperno et al. 1998) and the fla2, fla8-2,fla10-14, and fla11 strains (Adams et al. 1982) were utilized.Each strain was backcrossed to a NIT2 ac17 strain to removeany unlinked modifiers and to introduce selectable markersfor diploid strain construction. On the basis of resultsobtained in this study, fla16 is renamed fla17-3, in agreementwith the current nomenclature for Chlamydomonas reinhardtii.Cells were grown as previously described (Holmes andDutcher 1989). Crosses, maturation of zygotes, and tetradanalysis were carried out as previously described (Dutcher

1995).Linkage analysis: To determine linkage between complex

A genes and fla15-1, fla16-1, and fla17-1, we designed

PCR-based markers for the genes Chlre2_kg.scaffold_2000196(FAP66), estExt_gwp_1H.C_30331 (FAP60), estExt_fgenesh2_pg.C_290033 (IFT140), estExt_fgenesh2_pg.C_70a0033(FAP118), and Chlre2_kg.scaffold_ 3000443. Primers were cho-sen using Primer3 software for the six complex A genes and areshown in Table 2 (Rozen and Skaletsky 2000). DNA was isolatedusing a Genisol maxiprep kit (ABgene, Epsom, UK). DNA fromprogeny that pelleted at 32� from tetrads of crosses of fla15,fla16-1, and fla17-1 3 CC-1952 was analyzed for segregation of themutant allele with respect to polymorphic alleles. Similar crosseswith fla2 and fla24 were performed.

Fifty-six progeny from a cross of a 137c-derived strain(NIT2 ac17) 3 CC-1952 were analyzed to map complex A genesto a linkage group (LG), using 44 markers previously described(Bowers et al. 2003) or new markers described in Table 2.

Sequencing: DNA was isolated using a Genisol maxiprep kit(ABgene) or as described previously (Johnson and Dutcher

1991). Primers were designed to amplify IFT144 exons aspredicted from the JGI web site (http://genome.jgi-psf.org/Chlre3/Chlre3.home.html). Sequences of the primers areavailable in supporting information, Table S1. PCR productsfrom fla15-1 obtained using REDTaq and 1 m betaine (Sigma,St. Louis) at the annealing temperature of 50� were clonedinto the pCR4-TOPO vector (TOPO TA cloning kit; Invitro-gen, Carlsbad, CA). Plasmid DNA was sequenced by theNucleic Acid Sequencing Laboratory (Washington University,St. Louis) or in the Department of Genetics using M13primers. DNA sequences were aligned to the predictedIFT144 gene using SeqMan II (DNASTAR, Madison, WI). Anucleotide substitution T to C was detected in the 823-bp PCRfragment amplified by primers IFT144-14 (Table S1). Thenucleotide substitution was confirmed by sequencing anindependent PCR product from wild-type and fla15 genomicDNA. A derived cleaved amplified polymorphic sequence(dCAPS) marker that distinguishes the wild-type and mutantalleles in the IFT144-14 PCR was used. MspAI cuts the 137cPCR product into three fragments (380, 299, and 144 bp),

TABLE 2

Mapping of the complex A IFT subunits to linkage groups and fla mutants

IFT geneLinkagegroup

Parental:recombinantprogeny for mapping to

linkage group (map units)

Parental:recombinantprogeny dCAP marker tofla mutant (map units)

IFT primers (59–39),enzyme

IFT43 VI Mating-type 36P:2R (2.6) fla2 38P:0R AGT GGT GTT TGC AGA ATG GTGTAT TGC CTG AGT GCC TGT CADdeI

fla24 75P:2R (1.3)

IFT121 XI cDNA19 34P:2R (5.0) fla5 15P:4R (21) GAA GGA CCA GGG ACT GGA CTTGG CTT TCC TTC CTC GAT TAAluI

IFT122 I AGK 25P:22R (46.5) pf4 44P:3R (6.3) TCT TCA TGC TGT TGT CCT CATC CCC ATT CAA CCA AAC CTAluI

S18 49P:1R (2.0)

IFT 139 VI Mating-type 235P:7R (1.4) fla17-1 216P:0R GGA GCT CAT GTT CCA CAA GGAAG TGG TAG ATG GCG GTG TCBBS5 75P:9R (5.35) fla17-2 62P:0R

fla16-1 43P:0RIFT140 VIII STK 31:10 (24) None CGT TTG TGG AGG AGG AGG T

GGA CAC AGG GTT CAA ATG CTMspI

IFT144 XIV CCS1 44:2 (4.3) fla15-1 243P:0R GGG AGG TGC AGA CCT TGA TAGGA CAC AGG GTT TCA ATG CTAciI

IGPS 36:7 (16.3)

Mapping with fla5 and pf4 was based on the flagellar phenotypes of the mutants and not PCR-based markers.

Complex A IFT Mutants 887

while the fla15 fragment is cut into two fragments (443 and380 bp). This polymorphism segregated with the flagellarphenotype in 59 progeny. This polymorphism was also usedfor the reversion analysis. True revertants or pseudorevertants ofT to G produce three fragments while suppressors or otherpseudorevertants will generate only two bands like the mutantstrain.

Because of the high level of GC content, genomic DNAamplification and sequencing were difficult for IFT139 inseveral regions. Consequently, five overlapping primers (avail-able in Table S1) were designed from the predicted cDNAsequence and RT–PCR was performed. RNA was extracted asdescribed (Witman et al. 1972) and single-strand cDNAsynthesized using SuperscriptII (Invitrogen) (Li et al. 2004).The RT–PCR fragments were sequenced as described above.IFT139-42 primers (Table S1) showed a size differencebetween wild type and fla16-1, fla17-1, and fla17-2 DNA.

Chlamydomonas transformation: Six micrograms of BACDNA from I7I9 and 4M13 clones (Dutcher et al. 2002)was introduced into fla17-1 cells, using electroporation(Shimogawara et al. 1998) as modified by Kovar and co-workers (Kovar et al. 2002). DNA from BAC 4M13 was cut withXhoI at 37� for 5 hr prior to transformation. BAC DNA from12K11 (7 mg) was cut with AatI and StuI and introduced intofla15-1 cells.

Analysis of swimming transformants: Each rescued trans-formant (n¼ 2 for fla17-1 and n¼ 4 for fla15-1) was crossed toCC-124 to determine if the rescue was extragenic. Thirty tetradswere analyzed for the appearance of the flagellar assemblydefect and the presence of the mutant and wild-type allele, usingthe dCAPS markers in Table S1. All transformants were extra-genic. Meiotic progeny from nonparental ditype tetrads thatwere swimming were retained for further experiments.

SHIRT analysis: The segregation of heterozygosity inrescued transformants (SHIRT) analysis provides a rapid

method to determine which regions of BAC DNA are in-tegrated nonhomologously into the genome and cosegregatewith the rescued phenotype (Esparza 2008). It obviates therequirement for subcloning to determine the causative DNAfor rescued transformants. It is rare in Chlamydomonas thatthe entire transforming DNA of a BAC or plasmid integratesinto the genome, and independent transformants generallyintegrate nonidentical segments of the BAC or plasmid DNA(Dutcher and Trabuco 1998; Myster et al. 1999). For thisanalysis, multiple independent transformants are mated to thepolymorphic strain, CC-1952 and meiotic tetrad progeny arerecovered. In general, nonparental ditype (NPD) tetrads areidentified that have two mutant progeny and two wild-typeprogeny. A dCAPS marker is made for each BAC gene to betested in the transformant (Figure 1). Markers predicted byRymarquis et al. (2005) are tested. If no predictions areavailable, 39-UTR sequences are amplified and tested with 3–10 restriction enzymes (Bowers et al. 2003). In these progeny,there are three alleles of each gene. One copy is from the CC-1952 parent, one from the inserted BAC, and one from themutant parent. Since the BAC library was made from the samestrain as the mutant parent, the alleles contributed by the BACand the mutant parent possess the same polymorphism whilethe allele contributed by the CC-1952 parent is different. PCRis performed for each marker of the progeny that shows anNPD segregation pattern for the flagellar phenotype and therescue. The two aflagellate progeny should have only a copy ofthe parental allele and the two swimming progeny have theBAC and CC-1952 alleles (Figure 1C, see diagram for gene 2),if the gene is responsible for rescue. If the gene from the BACis not integrated into the genome, then the PCR products willresemble the gene 3 example (Figure 1C). If the gene from theBAC does not rescue, the pattern may resemble gene 1 and notcosegregate (Figure 1C). DNA was isolated from four NPDtetrads for each transformant and PCR was used for various

Figure 1.—Schematic diagram ofsegregation of heterozygosity in rescuedtransformants (SHIRT). SHIRT usesmapping and PCR-based markers to de-termine which parts of a BAC are re-sponsible (cosegregate) for rescue of amutant phenotype following transfor-mation. (A) Diagram of three genespresent on a BAC that come from themutant parent (black), the polymor-phic mapping strain CC-1952 (red),and the BAC (blue). Primers for PCRare generally made to the 39-UTR ofgenes to be tested (arrows). (B) Bandsof digested PCR products (dCAPmarkers) for the three genes from thethree sources of DNA. The digestedPCR products from the black and bluealleles cannot be distinguished fromeach other. (C) Three possible out-comes among nonparental ditype(NPD) tetrads in which the mutant phe-notype is observed in two of the fourprogeny (fla and 1). The pattern withgene 1 suggests that the BAC DNA isnot responsible for rescue. The hybrid(black and blue) band indicates thatthe band is amplified from both the mu-tant and the BAC allele. The pattern

with gene 2 is consistent with the BAC DNA providing rescue. Further proof requires additional NPD tetrads with this pattern.The pattern with gene 3 suggests that it is not integrated into the genome and therefore not responsible for rescue.

888 C. Iomini et al.

dCAPS markers to determine if the IFT144 or IFT139 geneswere present. The primers are available in Table S1.

Reversion of fla15-1 and fla17-2: Cultures of fla15-1 andfla17-2 cells were plated onto Sager and Granick medium at adensity of�2000 colonies per plate and grown for 4 days at 21�.They were subjected to ultraviolet irradiation (70,000 J) andleft in the dark to prevent photoreactivation for 18 hr.Approximately 40 colonies were transferred to 20 ml of Sagerand Granick medium in 25 3 150-mm tubes. The 72 tubeswere placed at 32� for 3 days. Five milliliters of supernatant wastransferred to new tubes at 3 days and this was repeated fourtimes. Swimming cells from the supernatant were plated toisolate individual colonies and one colony from each of thetubes was retained and scored for flagellar assembly. For fla15-1,56 of the 72 cultures yielded cells that assembled flagella andswam at 32�. DNA was made from each of these 52 strains toexamine by PCR with the IFT144-14 primers (GCA TGC ATTCTT CGA TGA CC and GGA GTG TAC TCG TG CCC TA) anddigested with MspAI as described for the mutant allele. Forfla17-2, 24 of the 72 cultures yielded swimming cells. By tetradanalysis, all were extragenic suppressors, but had no phenotypebeyond suppression.

Flagellar isolation and immunoblots: Cells were prepared asdescribed previously for immunofluorescence (Iomini et al.2001). The antibodies against IFT74/72, which was previouslydesignated at p71, are described in Iomini et al. (2001, 2004),p28 is described in LeDizet and Piperno (1986), andantibody raised against complex A is described in Iomini

et al. (2001).Immunoblots are as described previously (LeDizet and

Piperno 1986; Iomini et al. 2001). Isolated flagella weretreated with nonionic detergent to extract them (Piperno

et al. 1998).Diploid construction: Diploid strains were obtained by

screening on minimal medium lacking acetate with 2 mm

KNO2 instead of ammonium in the medium. Eight indepen-dent diploid strains were picked and heterozygosity of themating-type locus was assessed by PCR to MID1 and to FUS1(Miller et al. 2005). The parent strains were ac17 NIT2 andAC17 nit2.

RESULTS

Mapping the retrograde mutant strains: Each of thetemperature-sensitive mutations in Chlamydomonaswith decreased retrograde velocities and reduced num-bers of retrograde particles was crossed to the poly-morphic strain, CC-1952 (Gross et al. 1988) to map themutant phenotypes with respect to a marker for each ofthe complex A subunits (IFT144, IFT140, IFT139,IFT122, IFT121, and IFT43), which were developedusing sequences kindly provided by D. Cole and H. Qin

(personal communication) (Table 2). In addition, if thegene was placed on a chromosome in the JGI assemblies(Merchant et al. 2007), the position was verified bymapping to known markers. If the chromosome was notknown, it was determined by crossing to markers oneach chromosome (Table 2).

IFT43 is tightly linked to the FLA2 locus, but nochanges in the sequence of the gene were foundbetween the mutant and the parental strain (data notshown). IFT122 and IFT121, the homolog of Caenorhab-ditis elegans daf-10, map to linkage group I near the PF4

locus and to linkage group XI near the FLA5 locus,respectively. They are both separable from these loci(Table 2). IFT140 maps to linkage group VIII, but noflagellar mutants map to this region. Complete linkagewas observed between fla15-1 and IFT144 (n¼ 243) andbetween fla16 (n ¼ 43), fla17-1 (n ¼ 216), and fla17-2(n ¼ 62) with IFT139. The respective genes were se-quenced from fla15-1 and fla17-1 and compared tosequences in the JGI database (http://genome.jgi-psf.org/Chlre3/Chlre3.home.html).

Temperature-sensitive mutation in IFT144: The fla15-1 allele has a T to C change that changes a C to an R atamino acid 1283 (EF592033). This cysteine is conservedin IFT144 homologs that range from Giardia toDrosophila to humans (Figure 2B). To further ascertainthat this change is responsible for the temperature-sensitive phenotype of the fla15-1 allele, we screened forrevertants of the temperature-sensitive flagellar assem-bly defect after mutagenesis of cells with ultraviolet light(see materials and methods). Fifty-six independentstrains that assemble functional flagella at 32� wereisolated. Tetrad analysis of 8 strains indicated that theevents were likely to be intragenic as they were tightlylinked to fla15-1; the flagellar assembly defect was notrecovered in at least 35 tetrads for each of the eightstrains. A dCAPS marker was developed that alloweddetection of the mutant vs. the wild-type or a pseudor-evertant allele in PCR products. Forty-six of the rever-tants were examined by PCR and the C was changed toeither a T or a G (see materials and methods). Eightof these strains were sequenced and all were truerevertants of C to T rather than to the pseudorevertantG. These reversion studies support the identification ofthe FLA15 gene.

The fla15-1 strain was transformed with an �80-kbBAC (12K11) that contains the IFT144 gene and fourindependent transformants were obtained. Each con-tained the wild-type and mutant IFT144 gene as moni-tored by PCR and the dCAPS marker (data not shown)and the suppression segregated independently from thefla15-1 mutation. The IFT144 transgene segregated ineight tetrads with the rescue of the flagellar assemblydefect, using the SHIRTanalysis method (Figure 2C; seematerials and methods). Although at least twoadditional predicted genes are present on the rescuingBAC (data not shown), these multiple lines of evidencestrongly suggest that IFT144 is the correct gene.

Temperature-sensitive mutation in IFT139: TheIFT139 gene was sequenced from the fla17-1 allele andcontains a deletion that precisely removes three pre-dicted exons (Figure 3A, highlighted exons). The fla17-1 allele and the fla16-1 allele contain the same deletionby PCR analysis (Figure 3B) as well as by sequencing ofthe fla17-2 allele. Given that FLA16 and FLA17 wereunlinked in a previous analysis (Iomini et al. 2001), it islikely that a stock-keeping error occurred at some timein the past before the strains were deposited at the

Complex A IFT Mutants 889

Chlamydomonas Genetics Center and the original fla16allele is lost. We refer to this locus as FLA17 and theextant fla16-1 allele is referred to as fla17-3. Thesequence in the three deleted exons is highlighted inbold in Figure 3C, and it deletes a TPR repeat.

The exon structure presented in Figure 3A does notagree with the GenBank sequence from Cole and co-workers (EF592032) for exon 10 (Figure 3C). Wesequenced four independent RT–PCR reactions fromwild-type cells. One of them agreed with the GenBankentry (EF592032) to produce an exon that encodes 58amino acids (Figure 3C, blue protein sequence) andthree of them used internal splice sites to produce anexon with only 28 amino acids (Figure 3C, purpleprotein sequence). Thus, the IFT139 gene shows alter-native splicing in this exon.

The fla17-1 strain was transformed with the BACs 17I9and 4M13, which contain the IFT139 gene, and twoindependent transformants were obtained. Each one

contained the IFT139 gene and the transgene segre-gated independently from the fla17-1 mutation in 35tetrads. By SHIRT analysis, in one of the transformantsthe only gene integrated into the genome from the BACis the IFT139 gene (data not shown). Intragenicrevertants of the fla17-1 allele were sought using thesame methodology described for the fla15-1 allele, andonly unlinked suppressors were identified (n ¼ 24) asmight be expected for a deletion allele.

As further evidence that FLA17 encodes IFT139, weexamined flagellar extracts from wild-type, mutant, andtransgenic strains at 21� by immunoblot, using an anti-body to IFT139 (Piperno et al. 1998). A deletion ofexons 17, 18, and 19 from FLA17 predicts an �13-kDadecrease in the molecular weight of IFT139. In agree-ment with previously published electrophoretograms of17S complexes (Piperno et al. 1998), we found that thepolypeptide recognized by the anti-IFT139 antibody infla17-1 flagella was smaller than the polypeptides

Figure 2.—Identification of IFT144 as the gene product of the FLA15 locus. (A) Diagram of the structure of the gene. IFT144is a WD repeat protein (Cole 2003). It also has a clathrin domain, which has been implicated in vesicle transport in the testis(Oyhenart et al. 2003), as well as an uncharacterized domain (PD303210). (B) The region of IFT144 from mouse (Mm), human(Hs), Chlamydomonas (Cr), Drosophila (Dm), C. elegans (Ce), and Giardia (Gl) that contains the cysteine that is mutated in fla15-1.This cysteine is invariant (shaded). (C) SHIRT analysis of the transgene. PCR products from a nonparental ditype are shown. Theparents (fla15 1 rescue; CC-1952) are in lanes 1 and 2. The four progeny are in lanes 3–6. Lanes 3 and 6 are from cells aflagellate at 32�and the band is consistent with the mutant alleles. Lanes 4 and 5 are from flagellated cells and the bands are consistent with the wild-type FLA15 allele from the CC-1952 parent and the BAC contributed transgene.

890 C. Iomini et al.

detected by the same antibody in flagella from wild-typeor other strains. In the fla17-1TIFT139 transgenicstrain, only the wild-type polypeptide is detected (Figure4A), which suggests that the wild-type band is incorpo-rated more effectively. Immunoblots also show a re-duction of IFT139 in flagellar extracts from fla17 andfla15 (Figure 4A) (Piperno et al. 1998). The smallerpolypeptide is also detected in isolated cell bodies (datanot shown). This evidence supports the molecular datathat FLA17 encodes IFT139.

Accumulation of flagellar bulges: In fla15 and fla17mutants, bulges form in the distal one-third of theflagella (Piperno et al. 1998). The flagella of a fla15strain have bulges (arrowhead in Figure 5A) and thisphenotype is rescued by the transgene (Figure 5B). Byimmunofluorescence, these bulges contain the com-plex B component IFT74/72 (Figure 5, E and H)(Iomini et al. 2001, 2004), but not a-tubulin (Figure 5,D and G) or p28, a component of the inner arm (Figure5, C and F).

Synthetic interactions of fla15 and fla17: Syntheticphenotypes have been used to build networks ofinteractions in many cellular processes (Ooi et al.

2006). Many double-mutant combinations of hypomor-phic alleles for genes that act in the same pathway showsynthetic phenotypes, but mutants in two independentpathways can also underlie synthetic phenotypes. Wehave investigated if temperature-sensitive mutations inflagellar assembly show synthetic phenotypes in double-mutant combinations. Haploid strains with any combi-nation of fla11, fla15, and fla17 alleles lack flagella at 21�and 32�, but are not aflagellate in combination withmutant alleles in the subunits of the heterotrimerickinesin-2 (fla10-14 and fla8-2) at 21�. Double mutants offla2 and fla24 with fla15 or fla17 were also aflagellate atboth temperatures (Table 3). Since there are no knowntemperature-sensitive complex B mutations other thanIFT172, we could not examine this class of double-mutant combinations. These genetic interactions sup-port the biochemical phenotypes that the complex Agenes act together for assembly and with IFT172 incomplex B.

We also examined the ability of these mutations tocomplement one another in doubly heterozygous dip-loid strains. The phenomenon of second-site noncom-plementation, also known as dominant enhancers

Figure 3.—Identification of IFT139 as the gene product of the FLA17 locus. (A) Diagram of the structure of the gene. IFT139contain multiple TRP domains that are thought to mediate short-term protein interactions and two half A TPR (HAT) domains.Shaded exons represent the three exons deleted in the fla17 alleles. (B) PCR amplification of IFT139 with primers in exons 16 and20 (59-ATC CGC GAG ACG CCT CTG TAC and CTG TGC GCC GCC GCG GGC GT). The wild-type product is �700 bp while themutant product of fla17-1 and fla17-3 (also known as fla16-1) is �325 bp. (C) Alignment of protein around and including thedeletion in human, mouse, Chlamydomonas, and C. elegans. The deleted region is shown in boldface type. (D) Exon 10 inthe IF139 gene shows alternative splicing. In black are the shared introns before and after exon 10. Exonic sequence that is presentin both splicing variants is shown in red. In green is the exon that is present in only one splice variant. The four splice donor andacceptor sites are underlined and in uppercase. The 58 amino acids encoded by the longer splice variant are shown in blue and the28 amino acids encoded by the short splice variant are shown in purple.

Complex A IFT Mutants 891

(Hawley and Gilliland 2006), is defined as the lack ofcomplementation between two recessive mutations intwo different loci. It can arise via a number of mecha-nisms, which include the creation of a poisonousinteraction complex or the reduction in the dose of acomplex formed by the two mutant gene products.Diploid strains heterozygous for fla2, fla11-1, fla15-1,fla17-1, or fla24-1 alleles with the wild-type allele are ableto swim at 21� and 32�; all of these mutations arerecessive to the wild-type allele. However, diploid strainsthat are heterozygous for all pairwise combinations ofthe fla11-1, fla15-1, and fla17-1 mutations are unable toassemble flagella at 21� or 32� (Table 4). Surprisingly,the double heterozygous diploids show a more extremephenotype than the homozygous diploid strains, whichsuggests that the heterozygous diploid has multipledefects in the pathway. For example, homozygous fla17-1 diploid strains have functional flagella at 21� and lackflagella only at 32�, while the double heterozygousdiploid strain (FLA15/fla15-1; FLA17/fla17-1, for exam-ple) fails to assemble flagella at either temperature.Double heterozygous diploids with mutations in the

heterotrimeric kinesin-2 subunits assemble flagella atboth temperatures, which is consistent with the haploidstrains. The double heterozygous strain with the fla24mutation and either fla15 or fla17 becomes aflagellateat 32� but remains flagellated with the fla11 mutant(Table 4). Although mutations in FLA2 show retrogradedefects, it fails to show this type of genetic interaction.This mutant allele may be less severe or the loss hasfewer effects on complex A particles.

Two-copy suppression: The presence of multiplecopies of a gene or overexpression of a gene cansuppress the phenotype of mutations in a noncognate

Figure 4.—Immunoblots for IFT components with flagel-lar extracts of wild-type and mutant strains grown at 21�.(A) Coomassie blue-stained gels of wild type, fla15, fla17,and rescued strains fla15-1TIFT144 and fla17-1TIFT139.(B) Immunoblots of the region around 145–130 kDa reactedwith antibodies to complex A, IFT74/72, and a-tubulin. Thecomplex A antiserum has been shown previously to recognizethe IFT139 polypeptide (Iomini et al. 2001) and IFT74/72 isdescribed in Iomini et al. (2004).

Figure 5.—Retrograde mutant bulges contain some butnot all flagellar proteins. (A and B) Phase contrast of bulges(arrowheads) on fla15-1 cells (A) and their absence in the res-cued fla15-1TIFT144 strain (B). In the mutant strain, .80%of the cells have bulges (n ¼ 200) and no bulges were ob-served in the rescued strains. (C–E) Phase images of cells withbulges. (F–H) Immunofluorescence of cells with bulges. (F)p28 antibody. (G) IFT74/72 antibody. (H) a-Tubulin anti-body. IFT74/72 is present in the bulges, but a-tubulin andp28 are not.

TABLE 3

Synthetic phenotypes of double mutants of anterogradeand retrograde defective mutants at 21�

Locus Defect Protein fla15-1 fla17-1

fla2-1 R Unknown � �fla8-2 A Kinesin-2 motor subunit 1 1

fla10-14 A Kinesin-2 motor subunit 1 1

fla11-1 R IFT172 � �fla17-3a R IFT139 � NAfla24-1 R Unknown � �

R, retrograde defect based on previous results (Iomini

et al. 2001); A, anterograde defect based on previous results(Iomini et al. 2001); �, aflagellate cells (.97% of cells haveno flagella); 1, flagellate cells (.80% of cells have flagella);NA, not applicable.

a Formerly fla16-1.

892 C. Iomini et al.

gene in Saccharomyces cerevisiae and Schizosaccharomycespombe. This observation has been termed multicopysuppression and has been used extensively to find genesthat act in the same pathway (Forsburg 2001). Dosagesuppressors may occur because the protein at theincreased dosage helps to stabilize the mutant proteinor the increased dosage protein may act downstream tobypass the requirement for the mutant protein. We findthat two copies of the wild-type IFT144 gene (FLA15)can rescue the fla17-1 mutant phenotype at 32� (Table5). Meiotic crosses and allele-specific PCR verified thegenotypes; the presence of two copies and rescue wereobserved in six independent progeny (Figure 2D). Twocopies of the IFT144 gene partially rescue the pheno-type of fla11-1 cells (Table 5), and the genotypes wereverified for three independent meiotic progeny. Twocopies of the IFT144 gene do not rescue the mutantphenotypes of the fla2, fla8, fla10, or fla24 strains (Table5). We also find that two copies of the wild-type IFT139gene (FLA17) rescue the fla15-1 mutant phenotype. Thepresence of two copies as well as the mutant fla15-1allele was verified in eight independent progeny. Asingle wild-type copy of IFT139 or IFT144 rescues theaflagellate phenotype of the fla15; fla17 double mutantat 21�, but not at 32� (Table 5). This demonstrates thatthe rescue requires two wild-type copies of the non-cognate gene. Two copies of the IFT139 gene do notrescue the fla2, fla8, fla10, fla11, or fla24 mutantphenotypes (Table 5).

DISCUSSION

IFT is required to assemble cilia and flagella. Muta-tions in complex B genes have been identified in avariety of organisms (Table 1). Nonconditional muta-tions in Chlamydomonas IFT172, IFT88, and IFT52result in aflagellate cells, while mutations in IFT46 resultin cells with short, paralyzed flagella. A reduction in thelevel of IFT27 protein by RNA interference also causes

aflagellate cells as well as defects in cytokinesis (Qin et al.2007). These mutants demonstrate that anterogradeIFT is essential for ciliary/flagellar assembly. Mutationsin the genes that encode complex A proteins inChlamydomonas have not been previously identified(Table 1). However, mutations in the motor subunitDYNC2H1 of cytoplasmic dynein 2 complex (previouslycalled cytoplasmic dynein 1b) (Pfister et al. 2005) inChlamydomonas lead to cessation of the retrograde IFTmovement and result in cells with short (1–2 mm)flagella stumps that contain even shorter axonemalmicrotubules (Pazour et al. 1999; Porter et al. 1999).The dynein light chain LC8 is encoded by the FLA14locus and the fla14 mutant strain assembles shortflagella filled with unassembled flagellar precursors(Pazour et al. 1998). A dynein light intermediate chain,DYNC2LI1, has been isolated and is also required forretrograde transport (Hou et al. 2004). We report thatIFT144 and IFT139 are encoded by FLA15 and FLA17,respectively. Unlike the motor mutants, the complex Amutants are aflagellated, which suggests a slightlydifferent requirement for the retrograde motors andcomplex A.

Complex B, which has been studied extensively bybiochemical techniques, has a set of core proteins(IFT88, -81, -74/72, -52, -46, and -27) that do not requirethe other complex B components (IFT172, -80, -57, and-20) to remain associated (Lucker et al. 2005). In fact,fla11 (IFT172) mutant strains have phenotypes that moreclosely resemble the retrograde mutants (Pedersen et al.2005). However, these relationships are not maintainedthrough evolution in other organisms. IFT88 in C. elegansis encoded by the osm-5 gene and acts as if it were aperipheral component rather than a core component ofthe B complex (Haycraft et al. 2003). In Physcomitrellapatens, a moss with motile sperm, several of the corecomplex B IFT genes in Chlamydomonas (IFT81, -72/74,and -20) cannot be found in the genome by bioinfor-matics tools (Rensing et al. 2008).

TABLE 4

Phenotype of double-heterozygous strains at 21� and 32�

Dominance test:mut1 11 mut2

FLA1 fla11-1 fla15-1 fla17-1

fla2 1 1 1 1

fla8-2 1 1 1 1

fla10-14 1 1 1 1

fla11-1 1 121� � ��32�

fla17-1 1 � � 121��32�

fla24-1 1 1 121� 121��32� �32�

�, aflagellate cells (.97% of cells have no flagella); 1, fla-gellate cells (.90% of the cells have flagella, n ¼ 200).

TABLE 5

Two-copy suppression: flagellar number at 32�

FLA15transgene

FLA17transgene

Notransgene

fla2 100:0:0 100:0:0 100:0:0fla8-1 100:0:0 100:0:0 100:0:0fla10-14 100:0:0 100:0:0 100:0:0fla11-1 38:1:61 92:0:8 89:0:11fla15-1 7:1:92 9:2:89 100:0:0fla17-1 5:1:94 6:0:94 100:0:0fla24 100:0:0 100:0:0 100:0:0fla15, fla17, 21� 11:2:87 8:3:89 100:0:0fla15, fla17, 32� 100:0:0 100:0:0 100:0:0

Numbers represent percentage of cells with zero, one, ortwo flagella (n ¼ 250 cells) in logarithmically growing culture(�1 3 106/ml) shifted to 32� for 8 hr.

Complex A IFT Mutants 893

Our genetic interaction studies suggest that IFT144and IFT139 interact intimately and IFT144 may interactwith IFT172 (Figure 6). All pairwise combinations ofthese three mutations show a synthetic aflagellatephenotype and also have an aflagellate phenotype indoubly heterozygous diploid strains. The FLA15 trans-gene (IFT144) suppresses the phenotypes of fla15 andfla17 strains and partially suppresses the phenotype ofthe fla11 strain. In contrast, the FLA17 transgene(IFT139) suppresses the phenotypes of the fla15 andfla17 strains, but not the phenotype of the fla11 strain.Because there are no null alleles for these genes, wecannot ask if these interactions occur by a bypassmechanism. However, it seems likely that the suppressioncould result from stabilization of the mutant geneproduct in the presence of an excess of the noncognatetransgene product together with the endogenous copy ofthe gene. This hypothesis is supported by the observa-tions that the double mutant (fla15; fla17) is not rescuedby either of the transgenes when there is only one copy ofthe wild-type gene. We suggest that IFT144 may interactwith both IFT139 and IFT172 while IFT139 is less likely tointeract with IFT172 (Figure 6). This model might alsosuggest that there is more than one copy of IFT144 perIFT particle. Biochemical experiments will be needed inthe future to address these hypotheses.

The analysis of double mutants suggests that thisgenetic test is the most permissive for finding mutantphenotypes (Figure 6). Synthetic phenotypes are ob-served in all combinations of mutants with retrogradedefects to produce an aflagellate phenotype at 21�, butnot with the anterograde motor mutants. This analysissuggests that FLA24 and FLA2 may identify genes notidentified by biochemical isolation of IFT particles.Second-site noncomplementation is observed in allcombinations of fla11, fla15, and fla17 alleles at 21�and 32�. Aflagellate phenotypes are observed in hetero-zygous diploid strains for fla24 with either fla15 or fla17,but not with fla11. No phenotype is observed in diploidstrains with the fla2 allele or with the anterograde motor

mutants. The lack of phenotype in heterozygotes withfla24 and fla11 suggests that there is a more directinteraction of FLA24 with complex A components(IFT144 and IFT130) than with IFT172 from complex B.

FLA15 is a homolog of dyf-2 in C. elegans (Efimenko

et al. 2006). Efimenko and co-workers suggested that thisWD (tryptophan aspartic acid) repeat protein, which isan ortholog of the human WDR19 protein (Lin et al.2003), associates with complex B proteins, but inter-feres with function of complex A proteins. WDR19 hasbeen associated with prostrate cancer as well (Lin et al.2008) and localizes to cilia (Efimenko et al. 2006). TheChlamydomonas biochemical and phenotypic datareported previously (Piperno et al. 1998; Iomini et al.2001) show that FLA15 is a component of the Acomplex. Our genetic data suggest that IFT144 interactswith IFT172, which may mediate between the twocomplexes.

The Sonic hedgehog (Shh) pathway is uniquelyimpaired in mice carrying the aln null mutation in theTtc21b gene that encodes THM1, the mouse ortholog ofIFT139 (Tran et al. 2008). Mutant aln embryos show aninappropriate activation of the Shh pathway, whichcontrasts with anterograde ciliary mutant mice thatshow a disruption in the activation of the Shh pathway(Eggenschwiler and Anderson 2007). This set ofphenotypes suggests that retrograde IFT may modulateShh signaling. Ciliary signaling is needed for mating inChlamydomonas (Lux and Dutcher 1991; Piperno

et al. 1996; Pan and Snell 2002; Wang et al. 2006). Weattempted to ask if retrograde IFT is needed for mating,but both fla15 and fla17 cells retain some retrogradeIFT movement after 4 hr at the restrictive temperature.We were unable to find a time in which IFT stopped andthe cells retained flagella (data not shown). The role ofretrograde IFT may be to recycle components or to helpin retention of various proteins. Screens for newmutants that give synthetic phenotypes in a fla15 orfla17 haploid strain or fail to complement in heterozy-gous diploid strains may be useful to ask about the role

Figure 6.—Diagramofpos-sible interactions in the IFTparticle. (A) IFT complexesA and B with kinesin-2 (ingreen) and cytoplasmic dy-nein (in red). (B) Syntheticphenotypes suggest inter-actions between all of themutants with retrograde de-fects. (C) Noncomplementa-tion phenotypes show morelimited interactions. The fla2mutant no longer interacts.(D) Two-copy suppressionshows interactions of IFT139and IFT144 while IFT172shows a weak interaction withIFT144.

894 C. Iomini et al.

IFT in the signaling for mating and to find newregulators and possibly novel pathways.

This work was made possible by the kindness of Doug Cole (Universityof Idaho). He provided the amino acid sequences for the complex A IFTproteins. We thank Kat Lyle, Camille Starback, and Brett Havranek forhelp with various experiments; Laura Kyro for help with Figure 6; andAlison Albee for critical reading of the manuscript. This work wassupported by a grant to S.K.D. from the National Institutes of Health(NIH) (GM-03842). J.M.E. was supported by a fellowship from the FordFoundation and an NIH supplement. Camille Starback was supportedby the Washington University Summer Scholars Program.

LITERATURE CITED

Adams, G. M., B. Huang and D. J. Luck, 1982 Temperature-sensi-tive, assembly-defective flagella mutants of Chlamydomonas rein-hardtii. Genetics 100: 579–586.

Baker, S. A., K. Freeman, K. Luby-Phelps, G. J. Pazour and J. C.Besharse, 2003 IFT20 links kinesin II with a mammalian intra-flagellar transport complex that is conserved in motile flagellaand sensory cilia. J. Biol. Chem. 278: 34211–34218.

Bell, L. R., S. Stone, J. Yochem, J. E. Shaw and R. K. Herman,2006 The molecular identities of the Caenorhabditis elegansintraflagellar transport genes dyf-6, daf-10 and osm-1. Genetics106: 1275–1286.

Blacque, O. E., E. A. Perens, K. A. Boroevich, P. N. Inglis, C. Li

et al., 2005 Functional genomics of the cilium, a sensory organ-elle. Curr. Biol. 15: 935–941.

Blacque, O. E., C. Li, P. N. Inglis, M. A. Esmail, G. Ou et al.,2006 The WD repeat-containing protein IFTA-1 is requiredfor retrograde intraflagellar transport. Mol. Biol. Cell 17:5053–5062.

Bowers, A. K., J. A. Keller and S. K. Dutcher, 2003 Molecularmarkers for rapidly identifying candidate genes in Chlamydomo-nas reinhardtii. ery1 and ery2 encode chloroplast ribosomalproteins. Genetics 164: 1345–1353.

Brazelton, W. J., C. D. Amundsen, C. D. Silflow and P. A. Lefebvre,2001 The bld1 mutation identifies the Chlamydomonas osm-6homolog as a gene required for flagellar assembly. Curr. Biol.11: 1591–1594.

Cole, D. G., D. R. Diener, A. L. Himelblau, P. L. Beech, J. C. Fuster

et al., 1998 Chlamydomonas kinesin-II-dependent intraflagellartransport (IFT): IFT particles contain proteins required for cili-ary assembly in Caenorhabditis elegans sensory neurons. J. CellBiol. 141: 993–1008.

Cole, D. G., 2003 The intraflagellar transport machinery in Chlamy-domonas reinhardtii. Traffic 4: 435–442.

Dutcher, S. K., 1995 Mating and tetrad analysis in Chlamydomonasreinhardtii. Methods Cell Biol. 47: 531–540.

Dutcher, S. K., and E. C. Trabuco, 1998 The UNI3 gene isrequired for assembly of basal bodies of Chlamydomonas andencodes delta-tubulin, a new member of the tubulin superfamily.Mol. Biol. Cell 9: 1293–1308.

Dutcher, S. K., N. S. Morrissette, A. M. Preble, C. Rackley and J.Stanga, 2002 Epsilon-tubulin is an essential component of thecentriole. Mol. Biol. Cell 13: 3859–3869.

Efimenko, E., O. E. Blacque, G. Ou, C. J. Haycraft, B. K. Yoder

et al., 2006 Caenorhabditis elegans DYF-2, an orthologue of hu-man WDR19, is a component of the intraflagellar transport ma-chinery in sensory cilia. Mol. Biol. Cell 17: 4801–4811.

Eggenschwiler, J. T., and K. V. Anderson, 2007 Cilia and develop-mental signaling. Annu. Rev. Cell Dev. Biol. 23: 345–373.

Esparza, J. M., 2008 Epsilon tubulin mutants affect basal body in-tegrity, disrupt katanin localization, and increase microtubulestability. Ph.D. Thesis, Washington University, St. Louis.

Fliegauf, M., T. Benzing and H. Omran, 2007 When cilia go bad:cilia defects and ciliopathies. Nat. Rev. Mol. Cell. Biol. 8: 880–893.

Follit, J. A., R. A. Tuft, K. E. Fogarty and G. J. Pazour, 2006 Theintraflagellar transport protein IFT20 is associated with the Golgicomplex and is required for cilia assembly. Mol. Biol. Cell 17:3781–3792.

Follit, J. A., F. Xu, B. T. Keady and G. J. Pazour, 2009 Charac-terization of mouse IFT complex B. Cell Motil. Cytoskeleton 66:447–468.

Forsburg, S., 2001 The art and design of genetic screens: yeast. Nat.Rev. Genet. 2: 659–668.

Fujiwara, M., T. Ishihara and I. Katsura, 1999 A novel WD40 pro-tein, CHE-2, acts cell-autonomously in the formation of C. ele-gans sensory cilia. Development 126: 4839–4848.

Gross, C. H., L. P. Ranum and P. A. Lefebvre, 1988 Extensiverestriction fragment length polymorphisms in a new isolate ofChlamydomonas reinhardtii. Curr. Genet. 13: 503–508.

Hawley, R. S., and W. D. Gilliland, 2006 Sometimes the result isnot the answer: the truths and the lies that come from using thecomplementation test. Genetics 174: 5–15.

Haycraft, C. J., J. C. Schafer, Q. Zhang, P. D. Taulman and B. K.Yoder, 2003 Identification of CHE-13, a novel intraflagellartransport protein required for cilia formation. Exp. Cell Res.284: 251–263.

Holmes, J. A., and S. K. Dutcher, 1989 Cellular asymmetry in Chla-mydomonas reinhardtii. J. Cell Sci. 94: 273–285.

Hou, Y., G. J. Pazour and G. B. Witman, 2004 A dynein light inter-mediate chain, D1bLIC, is required for retrograde intraflagellartransport. Mol. Biol. Cell 15: 4382–4394.

Hou, Y., H. Qin, J. A. Follit, G. J. Pazour, J. L. Rosenbaum et al.,2007 Functional analysis of an individual IFT protein: IFT46is required for transport of outer dynein arms into flagella. J. CellBiol. 176: 653–665.

Huang, B., M. R. Rifkin and D. J. Luck, 1977 Temperature-sensitivemutations affecting flagellar assembly and function in Chlamydo-monas reinhardtii. J. Cell Biol. 72: 67–85.

Huangfu, D., A. Liu, A. S. Rakeman, N. S. Murcia, L. Niswander

et al., 2003 Hedgehog signalling in the mouse requires intrafla-gellar transport proteins. Nature 426: 83–87.

Iomini, C., V. Babaev-Khaimov, M. Sassaroli and G. Piperno,2001 Protein particles in Chlamydomonas flagella undergo atransport cycle consisting of four phases. J. Cell Biol. 153: 13–24.

Iomini, C., K. Tejada, W. Mo, H. Vaananen and G. Piperno,2004 Primary cilia of human endothelial cells disassemble un-der laminar shear stress. J. Cell Biol. 164: 811–817.

Johnson, D. E., and S. K. Dutcher, 1991 Molecular studies of link-age group XIX of Chlamydomonas reinhardtii: evidence againsta basal body location. J. Cell Biol. 113: 339–346.

Kobayashi, T., K. Gengyo-Ando, T. Ishihara, I. Katsura andS. Mitani, 2007 IFT-81 and IFT-74 are required for intraflagel-lar transport in C. elegans. Genes Cells 12: 593–602.

Kovar, J. L., J. Zhang, R. P. Funke and D. P. Weeks, 2002 Molecularanalysis of the acetolactate synthase gene of Chlamydomonasreinhardtii and development of a genetically engineered geneas a dominant selectable marker for genetic transformation.Plant J. 29: 109–117.

Kozminski, K. G., P. L. Beech and J. L. Rosenbaum, 1995 TheChlamydomonas kinesin-like protein FLA10 is involved in mo-tility associated with the flagellar membrane. J. Cell Biol. 131:1517–1527.

Kunitomo, H., and Y. Iino, 2008 Caenorhabditis elegans DYF-11, anorthologue of mammalian Traf3ip1/MIP-T3, is required for sen-sory cilia formation. Genes Cells 13: 13–25.

LeDizet, M., and G. Piperno, 1986 Cytoplasmic microtubules con-taining acetylated alpha-tubulin in Chlamydomonas reinhardtii: spa-tial arrangement and properties. J. Cell Biol. 103: 13–22.

Li, C., P. N. Inglis, C. C. Leitch, E. Efimenko, N. A. Zaghloul et al.,2008 An essential role for DYF-11/MIP-T3 in assemblingfunctional intraflagellar transport complexes. PLoS Genet. 28:e1000044.

Li, J. B., J. M. Gerdes, C. J. Haycraft, Y. Fan, T. M. Teslovich et al.,2004 Comparative genomics identifies a flagellar and basalbody proteome that includes the BBS5 human disease gene. Cell117: 541–552.

Lin, B., J. T. White, A. G. Utleg, S. Wang, C. Ferguson et al.,2003 Isolation and characterization of human and mouseWDR19,a novelWD-repeatprotein exhibiting androgen-regulatedexpression in prostate epithelium. Genomics 82: 331–342.

Lin, B., A. G. Utleg, K. Gravdal, J. T. White, O. J. Halvorsen et al.,2008 WDR19 expression is increased in prostate cancer com-pared with normal cells, but low-intensity expression in cancers

Complex A IFT Mutants 895

is associated with shorter time to biochemical failures and localrecurrence. Clin. Cancer Res. 14: 1397–1406.

Lucker, B. F., R. H. Behal, H. Qin, L. C. Siron, W. D. Taggart et al.,2005 Characterization of the intraflagellar transport complex Bcore: direct interaction of the IFT81 and IFT74/72 subunits.J. Biol. Chem. 280: 27688–27696.

Lux, III, F. G., and S. K. Dutcher, 1991 Genetic interactions at theFLA10 locus: suppressors and synthetic phenotypes that affectthe cell cycle and flagellar function in Chlamydomonas reinhardtii.Genetics 128: 549–561.

Merchant, S. S., S. E. Prochnik, O. Vallon, E. H. Harris, S. J.Karpowicz et al., 2007 The Chlamydomonas genome revealsthe evolution of key animal and plant functions. Science 318:245–250.

Miller, M. S., J. M. Esparza, A. M. Lippa, F. G. Lux, III, D. G. Cole

et al., 2005 Mutant kinesin-2 motor subunits increase chromo-some loss. Mol. Biol. Cell 16: 3810–3820.

Murayama, T., Y. Toh, Y. Ohshima and M. Koga, 2005 The dyf-3gene encodes a novel protein required for sensory cilium forma-tion in Caenorhabditis elegans. J. Mol. Biol. 346: 677–687.

Myster, S. H., J. A. Knott, K. M. Wysocki, E. O’Toole and M. E.Porter, 1999 Domains in the 1alpha dynein heavy chain re-quired for inner arm assembly and flagellar motility in Chlamy-domonas. J. Cell Biol. 146: 801–818.

Omori, Y., C. Zhao, A. Saras, S. Mukhopadhyay, W. Kim et al.,2008 Elipsa is an early determinant of ciliogenesis that linksthe IFT particle to membrane-associated small GTPase Rab8.Nat. Genet. 10: 437–444.

Ooi, S. L., X. Pan, B. D. Peyser, P. Ye, P. B. Meluh et al., 2006 Globalsynthetic-lethality analysis and yeast functional profiling. TrendsGenet. 22: 56–63.

Oyhenart, J., R. Le Goffic, M. Samson, B. Jegou and N. Raich,2003 Phtf1 is an integral membrane protein localized in an en-doplasmic reticulum domain in maturing male germ cells. Biol.Reprod. 68: 1044–1053.

Pan, J., and W. J. Snell, 2002 Kinesin-II is required for flagellar sen-sory transduction during fertilization in Chlamydomonas. Mol.Biol. Cell 13: 1417–1426.

Pazour, G. J., C. G. Wilkerson and G. B. Witman, 1998 A dyneinlight chain is essential for the retrograde particle movement ofintraflagellar transport (IFT). J. Cell Biol. 141: 979–992.

Pazour, G. J., B. L. Dickert and G. B. Witman, 1999 The DHC1b(DHC2) isoform of cytoplasmic dynein is required for flagellarassembly. J. Cell Biol. 144: 473–481.

Pazour, G. J., B. L. Dickert, Y. Vucica, E. S. Seeley, J. L. Rosenbaum

et al., 2000 Chlamydomonas IFT88 and its mouse homologue,polycystic kidney disease gene tg737, are required for assembly ofcilia and flagella. J. Cell Biol. 151: 709–718.

Pedersen, L. B., M. S. Miller, S. Geimer, J. M. Leitch, J. L. Rosenbaum

et al., 2005 Chlamydomonas IFT172 is encoded by FLA11, inter-acts with CrEB1, and regulates IFTat the flagellar tip. Curr. Biol. 15:262–266.

Pfister, K. K., E. M. Fisher, I. R. Gibbons, T. S. Hays, E. L. Holzbaur

et al., 2005 Cytoplasmic dynein nomenclature. J. Cell Biol. 171:411–413.

Piperno, G., K. Mead and S. Henderson, 1996 Inner dynein armsbut not outer dynein arms require the activity of kinesin homo-logue protein KHP1(FLA10) to reach the distal part of flagella inChlamydomonas. J. Cell Biol. 133: 371–379.

Piperno, G., E. Siuda, S. Henderson, M. Segil, H. Vaananen et al.,1998 Distinct mutants of retrograde intraflagellar transport(IFT) share similar morphological and molecular defects. J. CellBiol. 143: 1591–1601.

Porter, M. E., R. Bower, J. A. Knott, P. Byrd and W. Dentler,1999 Cytoplasmic dynein heavy chain 1b is required for flagel-lar assembly in Chlamydomonas. Mol Biol Cell 10: 693–712.

Qin, H., J. L. Rosenbaum and M. Barr, 2001 An autosomal reces-sive polycystic kidney disease gene homolog is involved in intra-flagellar transport in C. elegans ciliated sensory neurons. Curr.Biol. 11: 457–461.

Qin, H., Z. Wang, D. Diener and J. Rosenbaum, 2007 Intraflagellartransport protein 27 is a small G protein involved in cell-cyclecontrol. Curr. Biol. 17: 193–202.

Rensing, S. A., D. Lang, A. D. Zimmer, A. Terry, A. Salamov et al.,2008 The Physcomitrella genome reveals evolutionary insightsinto the conquest of land by plants. Science 319: 64–69.

Rozen, S., and H. Skaletsky, 2000 Primer3 on the WWW for gen-eral users and for biologist programmers. Methods Mol. Biol.132: 365–386.

Rymarquis, L. A., J. M. Handley, M. Thomas and D. B. Stern,2005 Beyond complementation. Map-based cloning in Chlamy-domonas reinhardtii. Plant Physiol. 137: 557–566.

Schafer, J. C., M. E. Winkelbauer, C. L. Williams, C. J. Haycraft,R. A. Desmond et al., 2006 IFTA-2 is a conserved cilia proteininvolved in pathways regulating longevity and dauer formationin Caenorhabditis elegans. J. Cell Sci. 119: 4088–4100.

Shimogawara, K., S. Fujiwara, A. Grossman and H. Usuda,1998 High-efficiency transformation of Chlamydomonas reinhard-tii by electroporation. Genetics 148: 1821–1828.

Tran, P. V., C. J. Haycraft, T. Y. Besschetnova, A. Turbe-Doan, R.W. Stottmann et al., 2008 THM1 negatively modulates mousesonic hedgehog signal transduction and affects retrograde intra-flagellar transport in cilia. Nat. Genet. 40: 403–410.

Walther, Z., M. Vashishtha and J. L. Hall, 1994 The Chlamydo-monas FLA10 gene encodes a novel kinesin-homologous pro-tein. J. Cell Biol. 126: 175–188.

Wang, Q., J. Pan and W. J. Snell, 2006 Intraflagellar transport par-ticles participate directly in cilium-generated signaling in Chla-mydomonas. Cell 125: 549–562.

Witman, G. B., K. Carlson, J. Berliner and J. L. Rosenbaum,1972 Chlamydomonas flagella. I. Isolation and electrophoreticanalysis of microtubules, matrix, membranes, and mastigonemes.J. Cell Biol. 54: 507–539.

Communicating editor: O. Cohen-Fix

896 C. Iomini et al.

Supporting Information http://www.genetics.org/cgi/content/full/genetics.109.101915/DC1

Retrograde Intraflagellar Transport Mutants Identify Complex A Proteins With Multiple Genetic Interactions in

Chlamydomonas reinhardtii

Carlo Iomini, Linya Li, Jessica M. Esparza and Susan K. Dutcher

Copyright © 2009 by the Genetics Society of America DOI: 10.1534/genetics.109.101915

C. Iomini et al. 2 SI

TABLE S1

Primers for sequencing IFT144 and IFT139

Primers for IFT144 Primers for IFT139 Sequening

ift144s-1F gcagcaacaccaatgaagaa ift139-1F cacctggcctcctcctacct

ift144s-1R aatgtgagtgctccgctctt ift139-1R tccattgcttcctgatttcc

ift144s-2F gaccccacctactcgcttg ift139-2F ggaggcctgaacattttgc

ift144s-2R aacatcccctccctccact ift139-2R gttgccctcctggacacta

ift144s-3F aggcgcaagtgctaggatac ift139-3F gcctatggactgctcatgga

ift144s-3R acctgcctctgtcatctgct ift139-3R gatgatccagcccagaagaa

ift144s-4F gcgttaacatccaccacgta ift139-4F acgtgctgacggagatcaac

ift144s-4R atttcccaccgtgtgttgg ift139-4R ccgtgcaacaacttcgttct

ift144s-5F acttcccctccgaaatcct ift139-5F taacccgccttcacttcttg

ift144s-5R gcacgctctctttctcacct ift139-5R caggacagcaaacggatct

ift144s-7F atccgcatttcgcatcttac ift139-6F cgagacgcctctgtaccac

ift144s-7R gcaaggcaacatgaacgag ift139-6R cacccacacacaacccatc

ift144s-8F cgagcacataaccatgtcgt ift139c-7F cacagcacgccctgcagctg

ift144s-8R accgtacatggaccctcatt ift139c-7R gtgcttgagcagcgtcac

ift144s-9F gcgcttaacacagaagcaca ift139c-8F ctccatgctggccgtggccaag

ift144s-9R tactgctagcgagccctgtt ift139c-8R gttgtcggggttgaggtaga

ift144s-10F aacagggctcgctagcagta ift139c-9F gaacctggcgcgcaaggacac

ift144s-10R ggagaggacagggaggaaac ift139c-9R gccctgtatgtggatgtcag

ift144s-11F tccctgtcctctccaatcac ift139c-10F cagtacaagcccgacgaggc

ift144s-11R ccagcgtgtctccattttct ift139c-10R tcagggcttgaggcccatgcg

ift144s-12F ggtagccgcatacccaac ift139-17F acttcgccctccacacaat

ift144s-12R caacacgccagtgccatc ift139-17R gaatcacagcaagccaacag

ift144s-13F ttaagtggccttgtcgttcc ift139-21F tcgcctcttcctcttaatcg

ift144s-13R aacccaaaaagccttcaggt ift139-21R aggctgcccattgattgtaa

ift144s-14F tgctcaagccgttgatgtaa ift139-23F ggtgccgtgtttacaatcaa

ift144s-14R cgcttagaggaggtcacagc ift139-23R gcgggttgttgatgtacctg

ift139-24F ccctccctcaggtacatcaa

ift139-24R acggtcacgcacacacac

ift139-28F cctgtgtcagaagtgcctca

ift139-28R gtgcgtgtcacaccagtca

ift139-29F cactcgtgcaaccacatttc

ift139-29R taccgtatcccaacccaaaa

ift139-30F ttcctcctccctcctcactt

ift139-30R ctccatgatctgacccatga

ift139-31F tgggagatcatgggtcagat

ift139-31R tgcgtgtcacaccagtcac

C. Iomini et al. 3 SI

ift139-32R gcggggacagtgatgatatg

ift139-33F ccgggttaccacagtctcag

ift139-33R acgttgatctccgtcagcac

ift139-34F ggacctgttcagctcaatgaa

ift139-34R gtggtctcgtccatcatcag

ift139-35F tgctcagaagctgatgatgg

ift139-35R ccagcagacccttgaggtag

ift139-36F gacgacgaccccgatatg

ift139-37F gtcgtgcgttggttgtattg

ift139-37R caggcgtgttgagacgaata

ift139-38F cacagtagcagtggggtgtg

ift139-38R gcttcgccactaccaagtgt

ift139-39F acgtaccataaccccaacca

ift139-39R ttcctggaggcaggattaaa

ift139-40F tgggttgggatacggtacat

ift139-40R acgcactcaacaccacacac

Primers used for sequencing the genomic and cDNA sequences.