recerca de selenoproteïnes en el genoma d’organimes eucariotes bioinformàtica, upf

79
Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF.

Upload: alexander-cole

Post on 31-Dec-2015

215 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Recerca de selenoproteïnes en el genoma d’organimes

eucariotesBioinformàtica, UPF.

Page 2: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

what are selenoproteins?

Selenoproteins are proteins that incorporate selenocysteine, the 21st aminoacid

Page 3: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

selenocysteine

Page 4: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Role of selenium

• Selenium is an essential nutrient for animals, microorganisms and some other eukaryotes.• Selenium deficiency may lead to disease

– Keshan disease (the primary symptom is myocardial necrosis, which leads to weakening of the heart)

• Named after a province in Keshan in China with low levels of Selenium. Studies in the Jiangsu province have indicated a reduction in the prevalence of this disease by taking selenium supplements.

• Excess selenium can be toxic– General Custer and the “Little Big Horn” massacre

Page 5: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 6: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Selenium is found in cells mostly in selenoproteins

• Mostly redox enzimes– Possible antioxidant protection capability

• Distributed in the three domains of life• About 25 known selenoproteins in mammals, but the number varies for different taxa

– 3 selenoproteins in Drosophila melanogaster– 1 selenoprotein in Caenorhabditis elegansSelenoproteins though to be essential for Metazoan life

• Sometimes the orthologue of a selenoprotein has Cys instead of Sec.

Page 7: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

SelU is a selenoprotein in fishes, but it is not in humans

Page 8: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

the selenocysteine codon?

Page 9: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

the selenocysteine codon:UGA

Page 10: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

recoding of UGA

Page 11: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Selenoprotein Biosynthesis

Page 12: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Selenoprotein biosynthesis• Synthesis of Selenocysteine (Sec)

– SPS1– SPS2– SLA/LP– Sec43p

• Incorporation of Sec into selenoproteins– SBP2– Efsec– tRNAsec

• SECIS

Page 13: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Aren’t selenoproteins annotated?

selenoproteins are usually incorrectly annotated

Selenocysteine Glycine Real STOP NO SECIS!Selenocysteine Glycine Real STOP NO SECIS!

Page 14: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Selenoprotein identification

Page 15: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

selenoprotein search: SECIS search

SECIS came in a variety of sequences

Page 16: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

SECIS search: PatScan

Page 17: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

SECIS search in the Drosophila genome

• 35,876 potential SECIS elements• 1,220 termodynamically stable

Page 18: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

selenoprotein search: codon bias across TGA

Page 19: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

selenoprotein search: SECIS + exon prediction

1.Predict SECIS with PatScan 2.Gene prediction with geneid (allowing TGA-interrupted exons)

Geneid uses dynamic programming to chain input exons into gene structures maximizing a log-likelihood function. SECIS predictions and TGA-interrupted exons are now among the input exons. Chaining rules state that SECIS elements can only be chained if they terminate genes containing TGA exons, and that genes containing TGA exon can only be terminated by SECIS predictions.

Page 20: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

5’ 3’

selenoprotein search:

Page 21: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

5’ 3’

selenoprotein search:

Page 22: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

5’ 3’

selenoprotein search:

Page 23: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Independent but coordinated TGA in-frame gene

and SECIS prediction

Putativeselenoprotein

5’ 3’

selenoprotein search:

Page 24: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 25: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

selenoprotein search in Drosophila

(Castellano et al. EMBO Reports 2:697-702, 2001)

SECIS predicted 35876

SECIS thermo assessment

1220

Genes predicted 12194

Predicted Selenoproteins

(4)

RealSelenoproteins

3

Page 26: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 27: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

dSelK

Page 28: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

dSelH

Page 29: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

dSelK and dSelH are ubiquitous selenoproteins

Page 30: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 31: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

selenoprotein search in mammalian genomes

• Larger genome. Much more room for false positive SECIS predictions

• Poorer gene predicitons.

Page 32: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 33: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

conserved SECIS between human and mouse

Page 34: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

characterization of mammalian selenoproteins(Kryukov et al., Science 300:1439-1443, 2003)

Page 35: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 36: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 37: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

selenoprotein search in other vertebrate genomes.

SelH alignment

Page 38: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

human vs. fugu

Page 39: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

SelU

Page 40: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

SelU: a novel selenoprotein family

Page 41: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

SelU: scattered phylogenetic distribution

Page 42: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 43: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Copyright ©2005 by the National Academy of Sciences

Page 44: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Copyright ©2005 by the National Academy of Sciences

Fig. 3. Subcellular localization of SelJFig. 2. 75Se labeling

Page 45: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

SelJ and crystallins

Page 46: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Copyright ©2005 by the National Academy of Sciences

Castellano, Sergi et al. (2005) Proc. Natl. Acad. Sci. USA 102, 16188-16193

Fig. 4. Expression pattern of the SelJ gene during development in zebrafish embryos

Page 47: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

the eukaryotic selenoproteome

Page 48: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 49: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Sergi Castellanos

- Doctorat l’any 2007

- PostDoc- Marla Berry, Universitat de Hawaii- Andrew G. Clark, Cornell University- Sean Eddy, Janelia Farm

-Group LeaderMax Plank Institute for Evolutioary Antropology, Leipzig

Page 50: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 51: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

SelH alignment across fly genomes

Page 52: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

SelH:alignment at the DNA level

Page 53: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

SelH:alignment at the DNA level

3-period conservation pattern

Page 54: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

increasing the sequences, increases the signal

actgtgacattgactcccatgcaggacttgacaaccgtgacattcactcccatgcaggacttgaca

** ******** *********************

Page 55: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

increasing the sequences, increases the signal

actgtgacattgactcccatgcaggacttgacaaccgtgacattcactcccatgcaggacttgacaacagtgacattgacacccatgcaggacttgacaactgtgacatttactccaatacaggacttcaca

** ******** ** ***** ******** ***

Page 56: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

increasing the sequences, increases the signal

actgtgacattgactcccatgcaggacttgacaaccgtgacattcactcccatgcaggacttgacaacagtgacattgacacccatgcaggacttgacaactgtgacatttactccaatacaggacttcacaactgtaacattgactcccatgcacgacttgaca

** ** ***** ** ***** ** ***** ***

Page 57: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

increasing the sequences,increases the signal

actgtgacattgactcccatgcaggacttgacaaccgtgacattcactcccatgcaggacttgacaacagtgacattgacacccatgcaggacttgacaactgtgacatttactccaatacaggacttcacaactgtaacattgactcccatgcacgacttgacaactgtgacattgactcccatgcacgacttgact

** ** ***** ** ***** ** ***** **

Page 58: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

increasing the sequences, increases the signal

actgtgacattgactcccatgcaggacttgacaaccgtgacattcactcccatgcaggacttgacaacagtgacattgacacccatgcaggacttgacaactgtgacatttactccaatacaggacttcacaactgtaacattgactcccatgcacgacttgacaactgtgacattgactcccatgcacgacttgactactgtaactttgactcccatacaggacttgaca

** ** ** ** ** ***** ** ***** **

Page 59: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

increasing the sequences, increases the signal

actgtgacattgactcccatgcaggacttgacaaccgtgacattcactcccatgcaggacttgacaacagtgacattgacacccatgcaggacttgacaactgtgacatttactccaatacaggacttcacaactgtaacattgactcccatgcacgacttgacaactgtgacattgactcccatgcacgacttgactactgtaactttgactcccatacaggacttgacaaccgtgacattgactcccatccaggacttgact

** ** ** ** ** ***** ** ***** **

Page 60: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

increasing the sequences, increases the signal

actgtgacattgactcccatgcaggacttgacaaccgtgacattcactcccatgcaggacttgacaacagtgacattgacacccatgcaggacttgacaactgtgacatttactccaatacaggacttcacaactgtaacattgactcccatgcacgacttgacaactgtgacattgactcccatgcacgacttgactactgtaactttgactcccatacaggacttgacaaccgtgacattgactcccatccaggacttgactactgtgacgttgactccgatgcaggacttgaca** ** ** ** ** ** ** ** ***** **

Page 61: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

scanning the fly mutiple-alingments for the 3-period conservation pattern across conserved TGA codons

Page 62: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

glucose dehydrogenase (gld)proposed as a selenoprotein by Perlaky, S., Merritt, K., and Cavener (1998)

Page 63: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

SelH alignment across fly genomes

Page 64: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

willistoni lacks all known fly selenoproteins

SPS2 does not exist

SelK is a Cys homologue

Page 65: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

willistoni lacks some of the genes involved in selenoprotein

metabolism in addition to SPS2,• tRNA-Sec• EF-Sec• SLA/LP

The first animal known to lack selenoproteins

Page 66: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

NHGRI, Press Release“Scientists Compare Twelve Fruit Fly

Genomes”

“In a surprising finding, researchers found that the genes that produce selenoproteins appear to be absent in the D. willistoni genome. Selenoproteins are responsible for reducing excess amounts of the mineral selenium, an antioxidant found in a variety of food sources. Selenoproteins are present in all animals, including humans. D. willistoni appears to be the first animal known to lack these proteins. However, researchers suggest that D. willistoni may possibly encode selenoproteins in a different way, opening a new avenue for further research.”

Page 67: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Surprisingly willistoni maintains some others

• Secp43 is highly conserved• SPS1 is highly conservedWhich implies that these proteins

are involved in functions other than selenoprotein biosynthesis

Page 68: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Alignment of SPS1 across Drosophilas (including willistoni)

Page 69: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Questions

• What are the functional consequences of the loss of selenoproteins (if any)?

• What is the evolutionary path leading to selenoprotein extinction?– Loss of selenoproteins Loss of selenoprotein

factors– Loss of selenoprotein factors Loss of

selenoproteins

Page 70: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Control medium

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

0 3rd 6th 9th 12th 15th 18th 21st 24th 27th 30th 33rd

day

% survival

D. melanogaster

D. willistoni

Life Span at 20ºC (5mM paraquat)

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

0 1st 2nd 3rd 4th 5th 6th 7th 8th 9th 10th 11th

Day

Survival

D. melanogaster

D. willistoni Survival under oxidative stressC. PallaresM.Corominas, F.Serras Genetics, U. Barcelona

Life Span at 20ºC (3% H2O2)

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

0 1st 2nd 3rd 4th 5th 6th 7th 8th 9th 10th

Day

Survival

D. melanogaster

D. willistoni

Page 71: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Survival under selenium toxicity, A. Punset, M. Corominas, F. Serras, Genetics, UB

D. Melanogaster

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

0 5th 10th 14th 19th 23rd 28th 33rd 38th 42nd 47th 52nd 56th 61st 66th 70th 75th 80th 84th

Days

Survival

Control medium

10-4 M Selenium

10-5 M Selenium

10-6 M Selenium

10-7 M Selenium

10-8 M Selenium

No Selenium

D. Willistoni

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

0 5th 10th 14th 19th 23rd 28th 33rd 38th 42nd 47th 52nd 56th 61st 66th 70th 75th 80th 84th

Days

Survival

Control medium

10-4 M Selenium

10-5 M Selenium

10-6 M Selenium

10-7 M Selenium

10-8 M Selenium

No Selenium

Page 72: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Evolutionary path leading to selenoprotein extinction

Page 73: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Search for selenoproteins in other arthropoda

Page 74: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 75: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF
Page 76: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Evolutionary path leading to selenoprotein extinction• It can not be attributed to a single evolutionary

event• A consequence of the relaxation of the

selective constraints acting to maintain selenoproteins in other metazoans

• Dispensability of selenoproteins in insects, maybe related to the fundamental differences in the antioxidant defense systems between these animals and other metazoan.

Page 77: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

Charles Chapple

-Doctorat l’any 2009

-PostDoc-Christine BruneINSERM, Marseille

Page 78: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

UPF Biologia. Curs 2010-11 selenoproteins in protists

Page 79: Recerca de selenoproteïnes en el genoma d’organimes eucariotes Bioinformàtica, UPF

CRG/IMIM/UPF, BarcelonaCharles ChappleTyler AliotoEnrique BlancoMarco Mariotti

Universitat de BarcelonaMarta MoreyMontserrat CorominasFlorenci Serras

Harvard Unversity, BostonUniversity of HawaiiNadia MorozovaMarla J. Berry

University of NebraskaGregory V. KryukovSergey V. NovoselovVadim N. Gladyshev

IBMC, StrasbourgAlain LescureAlain Krol

MPI for Informatics, Saarbrucken

Mario AlbrechtThomas Lengauer

Barcelona/Hawaii/Cornell/Janelia,

Sergi Castellano

ACKNOWLEDGEMENTS