Primer Design

PCR has 3 steps:

Denaturation (95ᵒ) Annealing (58-62ᵒ)

Elongation (72ᵒ)

Primer Double Stranded DNA

Primers

• Anneal to complementary regions of single stranded DNA

• DNA polymerase attaches to the primer and elongates the DNA by adding nucleotides

CTACTTAGTATGAGGCCTATATTTACC TATGA

Primer design overview 1) Locate region of interest in genome browser 2) Paste sequence into Primer3 and set

parameters – Target region (define locations of SNPs) – Product size (400-800 bp) – Annealing Temp or TM (57-62ᵒ)

3) Check specificity by blasting primers against D. melanogaster in NCBI Blast

Locate region of interest in genome browser

1. Go to the UCSC Genome Browser page (https://genome.ucsc.edu/)

2. Click on “Genome Browser” (there are 2 links)

Locate region of interest in genome browser

3. Select “Fruitfly”

Locate region of interest in genome browser

4. Under “Position/Search Term”, enter your SNP information (e.g., “chr3R:29,462,204-29,462,314”)

SNP Locations

GluClα

chr3R:19,742,169

ChAT chr3R:18,725,183

tenectin

chr3R:24,985,209 chr3R:24,985,256 chr3R:24,985,299

Ptp99A

chr3R:29,462,204 chr3R:29,462,232 chr3R:29,462,270 chr3R:29,462,314

Example: region of interest in serrano, defined by location of SNPs

18,955,920 18,955,959 18,955,986

Serrano SNPs

Your primers should amplify this region

Right click and select “Get DNA for sano”

Obtain a 500 bp flank from the first and last SNP location

chr3R:29,462,204-29,462,314

Copy the entire sequence output

http://biotools.umassmed.edu/bioapps/primer3_www.cgi

Paste the sequence into the empty box

Set a target range that includes all of the SNPs for the gene

Targets: 500, 100 The program will pick primers that will amplify a PCR product including 100 bp after the first SNP, which is located at 500.

Adjust the product size Min: 600 Opt: 800 Max: 1000

Click Pick Primers

Select Min 600, Opt 800, Max 1000

Output Note the annealing temperatures & product size >>>> forward primer location <<<< reverse primer location **** target region (with SNPs) Additional primers are listed at the bottom

Blastn primer sequences in NCBI BLAST

against D. melanogaster

to check specificity

Go to https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch

• Make sure the blastn tab is selected. • Enter the primer sequence in the query box. • Click BLAST.

Your BLAST results should only match your gene. Sometimes only location is given, so make sure it’s on the correct chromosome

Make a word or powerpoint file that contains screenshots of each of your steps, your Primer3 output, and your

BLAST results.