supplemental data revision final - journal of biological ... · pdf fileprimers were selected...

Horst/Gu et al., 2010

1

SUPPLEMENTAL MATERIALS

Supplemental Figure 1. Immunostaining specificity for Spdef and lack of expression in Spdef‐/‐

mice. (A) Spdef is not expressed in the gastric forestomach, as shown by absence of nuclear

immunostaining. (B) Quantitative real‐time RT‐PCR with primers spanning Spdef exons 2 and 3

confirms absence of the deleted exons in Spdef‐/‐ (KO) animals. (C‐E) Spdef protein is absent in

Spdef‐/‐ mice, as shown by lack of nuclear immunostaining in mutant (KO) samples compared to

the wild‐type (WT) gastric corpus (C), antrum (D), and Brunner’s glands (E). Scale bars, 50 µm

(A‐D), 100 µm (E).


2

Supplemental Figure 2. Antral hyperplasia in Spdef‐/‐ mice. The spectrum of hyperplastic

changes in Spdef‐/‐ antra includes focal cyst formation (A, arrow) and tubular to cribriform

growth patterns (B), with broad extension of the epithelial proliferative zone, as indicated by

Ki67 immunostaining (C). Inset in C shows a higher magnification of the boxed area.

Immunostaining for the intestinal marker Cdx2 (D), the chief cell product gastric intrinsic factor

(E), and the parietal cell marker Atp4b (F) demonstrate absence of heterotopia or metaplasia in

the mutant hyperplastic antrum. Insets show positive staining controls. Scale bars, 250 µm.


3

Supplemental Figure 3. Phenotypic changes in Spdef‐/‐ gastric corpus and Helicobacter testing.

(A) Histologically intact corpus mucosa in Spdef‐/‐ mice when hyperplastic changes of the gastric

antrum are absent. (B) Inflammatory infiltrates appeared beneath the mucosa of the corpus‐

antrum junction (arrows) coincident with antral hyplerplasia. (C) Warthin‐Starry staining

displays absence of Helicobacter in inflammation and hyperplasia affected antrum mucosa of


4

Spdef‐/‐ (KO) mice (mid panel shows magnification of boxed area); right panel shows a positive

staining control (Ctrl) of Helicobacter (arrows) infected antrum mucosa. (D) PCR testing for

Helicobacter species (HP spp) was negative in wild‐type (WT) as well as in Spdef‐/‐ stomachs

with inflammation (KOinf) and hyperplasia (KOhyp). Helicobacter infected antrum mucosa (Ctrl)

and Helicobacter pylori DNA extracts (H) were used as positive controls. Suitable quality of

template DNA for PCR was confirmed by amplification of genomic Cdx1. Size marker (M). Scale

bars, 100 µm (A, B), 50 µm (C).


5

Supplemental Figure 4. Specificity of Spdef effects on antral cell lineages. Before onset of

inflammation or hyplerplasia, Spdef‐/‐ (KO) and wild‐type (WT) mice showed no differences in

(A) proliferation, as quantified from Ki67 immunostaining; (B) maturation of Muc5ac‐expressing

foveolar pit cells; or (C) distribution and localization of gastrin‐expressing antral G cells. Scale

bars, 100 µm.


6

Supplemental Figure 5. Gene expression analysis in

stomach and intestine. Heat map showing the

overlapping down‐ and up‐regulated Spdef‐regulated

transcripts in the gastric antrum and colon of Spdef‐/‐

(KO) mice compared to WT and Spdef+/‐ (HET) mice.

Columns represent samples and rows represent genes.

Gene expression is shown with a pseudocolor scale (‐2

to 2), with red denoting high and green denoting low

relative expression levels.


7

Suppl. Table 1. PCR primers used in this study

Primers were selected from the Universal Probe Library (Roche) or designed using Primer3

software S1.

Gene Expression (real‐time RT‐PCR)

Gene Forward Primer Reverse Primer

Spdef (exon 2/3) ttggatgagcactcgctaga agccggtactggtgttctgt

Spdef (5’ UTR) gtggccctgagcttctgac ggtcactgctgggtctcagt

Spdef (3’UTR) ggtatcccagaacccaaggt actgtccggtgagctgactt

Gapdh accacagtccatgccatcac tccaccaccctgttgctgta

Muc6 ctcctcaccttctaccccagt tctggtgctcttcctcctgt

Tff2 ccagtgagcagtgctttgat tgacacactgctccgattct

Pthrp caagtccatccaagacttgc cgtgtccttggaagatcttc

Dmbt1 caagtccatccaagacttgc agaccgcccacctgcc

Thrsp catgctcaagagcatctgtgtagaagtg agggctttggattccgtgtttgcttttag

Cfd atgacgactctgtgcaggtg ctcgtattgcaagggtaggg

Adipoq aaggacaaggcccttctct cgcacgatttccctctcagctg

Mlph cggcctcagaagtccagcaggca agctttgcagacgaagaggg

Creb3l4 gtggactgccctccgattcg cgtgtccttggaagatcttc

Mouse genotyping (genomic PCR)

Common reverse primer: ctgtgtcagagtttgcagttttag

Forward primer for the wild type allele (300‐bp product): gaactgacgttgattcctggagg

Forward primer for the targeted mutant allele (720‐bp product): gacatagcgttggctacccgtg

Helicobacter testing (genomic PCR)

Gene Forward Primer Reverse Primer

HP spp tatgacgggtatccggc attccacctacctctccca

Cdx1 gtttactttgcgctccttgg ggggaggaaagaggtttcag


8

Suppl. Table 2. Antibodies (Ab) used for immunohistochemistry

Antigen (Ab species) Ab source Dilution

Spdef (guinea pig) Dr. J. Whitsett, Cincinnati Children's Hospital 1:5000

H/K‐ATPase (mouse) MBL International, Woburn, MA 1:1000

Muc5ac (mouse) Vision Biosystems, Norwell, MA (NCL‐HGM‐45M1) 1:200

Cdx2 (mouse) Bio Genex, San Ramon, CA (clone CDX2‐88) 1:50

α‐smooth muscle actin (mouse) Bio Genex, San Ramon, CA (clone 1A4) 1:1000

Tff2 (mouse) Prof. Sir N. Wright, London School of Medicine, UK 1:100

Ki67 (mouse) Vector Laboratories (clone MM1) 1:500

B220 (mouse) B‐D Pharmingen, San Jose, CA (clone RA3‐6B2) 1:200

Intrinsic factor (rabbit) Dr. D. Alpers, Washington University, St. Louis 1:10,000

CD3 (rabbit) Cell Marquee, Rocklin, CA (CMC363) 1:1000

Gastrin (rabbit) Vision Biosystems, Norwell, MA (NCL‐GASp) 1:1000

Metalloperoxidase (rabbit) Dako, Carpinteria, CA (A0398) 1:2000


9

Suppl. Table 3. Yield of mice by genotype from Spdef heterozygote crosses

Spdef+/+ (%) Spdef+/‐ (%) Spdef‐/‐ (%)

Male 28 (17) 36 (22) 12 (7)

Female 30 (19) 38 (24) 18 (11)

Total 58 (36) 74 (46) 30 (18)

Expected (Mendelian) ratios 40.5 (25) 81 (50) 40.5 (25)


10

Suppl. Table 4. Overlap of dysregulated genes in Spdef‐/‐ small intestine and antrum with the

25‐gene list reported as downregulated in the small intestine of an independent knockout

mouse strain 19.

Small intestine

Probe Gene symbol WT1 WT2 WT3 KO1 KO2 KO3

Fold change in KO

1417735_at 1810030J14Rik 2324.57 2501.44 2073.25 484.19 540.17 1071.21 ‐3.29

1417266_at Ccl6 2755.19 2239.85 2358.54 909.64 432.91 335.74 ‐4.38

1420249_s_at Ccl6 975.4 847.24 826.51 220.38 154.02 92.12 ‐5.68

1417936_at Ccl9 264.37 165.44 201.33 42.26 53.54 36.95 ‐4.75

1448898_at Ccl9 135.03 82.31 101.13 23.74 17.44 22.46 ‐5

1424218_a_at Creb3l4 43.1 44 36.72 16.96 18.85 20.26 ‐2.21

1416913_at Es1 122.59 129.3 146.78 54.46 59.55 55.03 ‐2.36

1431900_a_at Foxa3 65.04 93.33 91.71 33.4 47.18 39.36 ‐2.08

1418405_at Hgfac 106.78 132.24 115.66 62.64 67.2 57.28 ‐1.9

1449478_at Mmp7 780.97 558.11 747.23 495.2 296.63 197.48 ‐2.11

1428443_a_at Rap1gap 62.94 64.06 75.44 40.01 40.15 40.59 ‐1.68

1427119_at Spink4 4323.71 3930.33 4613.75 2702.01 2715.63 2050.3 ‐1.72

1449564_at Tpsg1 82.05 102.21 63.08 32.43 29.68 36.59 ‐2.51

Antrum

Probe Gene symbol WT1 WT2 KO1 KO2 HET1 HET2

Fold change in KO

1417266_at Ccl6 72.19 95.46 40.69 56.46 56.01 83.76 ‐1.73

1448898_at Ccl9 37.08 39.93 29.9 25.19 27 49.79 ‐1.4

1424218_a_at Creb3l4 121.24 137.28 13.24 18.42 130.41 125.86 ‐8.16

1416913_at Es1 78.85 21.04 15.49 13.41 31.02 15.49 ‐3.46

1418405_at Hgfac 76.9 81.28 43.11 44.18 66.35 85.69 ‐1.81

1428443_a_at Rap1gap 467.36 513.22 372.82 377 429.07 455.37 ‐1.31


11

Suppl. References S1. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press 2000; Totowa, NJ, pp 365‐386

supplemental data revision final - journal of biological ... · pdf fileprimers were selected...

Documents