Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside

the cell to direct the production of new molecules?

• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production

• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds

• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil

• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices

• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA

• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited

• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons

• Steps of Translation (Protein Synthesis)

DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

Flow of Genetic Information

Figure 8.2

DNA is a Double-Stranded Chain of Nucleotides

DNA

Figure 8.4

Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside

the cell to direct the production of new molecules?

• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production

• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds

• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil

• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices

• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA

• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited

• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons

DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

DNA Replication is Semiconservative

Figure 8.3

• DNA replication is semiconservative

DNA

Figure 8.7

DNA Replication Involves Several Enzymes

Figure 8.6

Central Dogma of Biology: How Shape and Form Are Dictated By DNA Genes

A segment of DNA (gene)

carries specific coded

instructions for the making

of a single proteins.

Genotype:The genes carried in a cell for a particular trait

Phenotype: The physical expression of genes for a particular trait

QuickTime™ and a decompressor

are needed to see this picture.

DNA Genes are Instructions for Making Specific Polypeptides

Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside

the cell to direct the production of new molecules?

• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production

• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds

• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil

• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices

• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA

• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited

• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons

DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

Transcription is Performed by RNA Polymerase

Translation or Protein Synthesis

Figure 8.2

Figure 10.17

Anatomy of a Messenger RNA

Leader

Trailer

mRNA is a Chain of Nucleotides

Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside

the cell to direct the production of new molecules?

• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production

• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds

• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil

• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices

• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA

• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited

• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons

DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.

=

3 Types of RNA – Each With a Different Job

Messenger RNA (mRNA)

Carries copy of gene informationto the ribosome to make protein

anticodon

Ribosomal RNA (rRNA)

Part of the structure ofthe ribosome; key component in aminoacid linking machinery

CUGC U G

Transfer RNA (tRNA)

Carries amino acids to the ribosome for linking; identified by anticodon “sign”

How Gene Instructions are Communicated

mRNA Codon Dictionary of the Genetic Code

DNA template strand:

CGTTTACGACCGGCCTTAGATCCTGACG

Central Dogma: DNARNAProtein

mRNA: GCAAAUGCUGGCCGGAAUCUAGGACUGC

Transcription by RNA polymerase

Translation by ribosome

Protein: Met -

Leu -Ala -

Gly -Ile

Translation in Prokaryotes Can Occur Simultaneously With Transcription

Figure 8.11

A Ribosome Has Two Subunits and Three tRNA Binding Sites

Translation: Initiation, Elongation, Termination

Termination

Initiation

Elongation (3-4 steps)

Steps of Translation

Protein Synthesis Movie