phylogenetic analysis and expression of zebrafish …...phylogenetic analysis and expression of...

Phylogenetic Analysis and Expression of Zebrafish

Transient Receptor Potential Melastatin Family Genes

Authors, affiliations and grants:

Edda Kastenhuber1, Matthias Gesemann1, Michaela Mickoleit1,2, Stephan C. F.

Neuhauss1*

1Institute of Molecular Life Sciences, University of Zurich, Winterthurerstrasse 190,

8057 Zurich, Switzerland

2Present address: Max-Planck-Institute of Molecular Cell Biology and Genetics,

Pfotenhauerstrasse 108, 01307 Dresden, Germany

*Correspondence to: Stephan C. F. Neuhauss, Institute of Molecular Life Sciences,

University of Zurich, Winterthurerstrasse 190, 8057 Zurich, Switzerland. E-mail:

[email protected] Telephone: +41 (0)44 63 56040 Fax: +41 (0)44 635

6817

Grant sponsor: EMBO ALTF 326-2010, Swiss National Science Foundation

31003A_135598, EU FP7 RETICIRC

Running title:

Zebrafish TRPM family

Key words:

Danio rerio; TRPM ion channels; sensory neurons; pronephros

Key findings:

� The zebrafish TRPM family consists of 11 genes.

� Zebrafish trpm genes show dynamic expression pattern over embryonic and

larval stages observed.

� Expression was identified in both excitable and non-excitable cells, reflecting

the broad functional range of TRPM channels.

� Zebrafish trpm expression was found in cell clusters involved in sensory

information processing, ion homeostasis, and osmolarity as well as in the

developing brain.

Research Article Developmental DynamicsDOI 10.1002/dvdy.24020

Accepted Articles are accepted, unedited articles for future issues, temporarily published onlinein advance of the final edited version.© 2013 Wiley Periodicals, Inc.Received: Apr 24, 2013; Revised: Jul 02, 2013; Accepted: Jul 17, 2013

Dev

elop

men

tal D

ynam

ics

2

Abstract:

Background: The transient receptor potential melastatin (TRPM) gene family belongs to

the superfamily of non-selective TRP ion channels. TRP channels are cellular sensors,

detecting a multitude of inputs, including temperature, light, chemical and mechanical

stimuli. Recent studies revealed diverse roles during development, linking TRP

channels to differentiation, proliferation, cell motility, cell death and survival. A detailed

description of this gene family in the zebrafish is still missing.

Results: Phylogenetic analysis revealed 11 trpm genes in the zebrafish genome. The

zebrafish orthologs of mammalian TRPM1 and TRPM4 are duplicated and

quadruplicated, respectively, and TRPM8, a cold sensitive channel has been lost in

zebrafish. Whole-mount in situ hybridization experiments revealed dynamic expression

pattern of trpm genes in the developing embryo and early larva. Transcripts were

mainly found in neural cell clusters, but also in tissues involved in ion homeostasis.

Conclusions: Our results suggest a role of TRPM channels in sensory information

processing, including vision, olfaction, taste, and mechanosensation. An involvement in

developmental processes is likely, as some trpm genes were found to be expressed in

differentiating cells. Our data now provides a basis for functional analyses of this gene

family of ion channels in the vertebrate model organism Danio rerio.

of 36

John Wiley & Sons, Inc.

Developmental DynamicsD

evel

opm

enta

l Dyn

amic

s

3

Introduction:

The transient receptor potential (TRP) channel was first described in the fruit fly

Drosophila melanogaster after the identification of a mutant fly that showed a transient

instead of a sustained response to continuous light exposure (Montell and Rubin, 1989;

Hardie and Minke, 1992). Subsequent phylogenetic analysis led to the discovery of a

whole superfamily of ion channels that are conserved throughout the animal kingdom.

The human TRP family consists of 27 genes clustering into six subfamilies (TRPC,

TRPM, TRPV, TRPA, TRPP, and TRPL). Although single channels can differ strongly

in their physiological characteristics, they all share a common structure consisting of six

transmembrane domains, the pore forming region between S5 and S6 and intracellular

amino- and carboxy-termini. Functional channels are known to form homo- or

heterotetramers, displaying a large diversity of ion selectivity, activation mode, and

gating mechanisms (reviewed for example by Clapham et al., 2001; Montell, 2005;

Venkatachalam and Montell, 2007; Nilius and Owsianik, 2011).

Expression of individual members was found in many tissues, underscoring their

perceived role as multifunctional cellular sensor proteins. Indeed, functional analyses of

TRP ion channels revealed their participation in all kinds of sensory perception:

thermo-, mechano-, and chemosensation, as well as nociception and light perception

(summarized in Voets et al., 2005 and Damann et al., 2008). Another central role of

TRP channels is the maintenance of ion homeostasis and osmoregulation. Therefore

they have been associated with diverse medical conditions, among them polycystic

kidney disease, hypomagnesemia with secondary hypocalcemia, idiopathic

hypercalciuria, cardiac hypertrophy, and hypertension as just a few examples

(Woudenberg-Vrenken et al., 2009; Dietrich and Gudermann, 2011). Additionally, many

TRP channels are involved in diverse developmental processes such as cell death,

proliferation, axon outgrowth and guidance, as well as synaptic plasticity (Dadon and

Minke, 2010; Santoni et al., 2011; Vennekens et al., 2012).

of 36



evel

opm

enta

l Dyn

amic

s

4

The subfamily of TRP melastatin (TRPM) channels shows structural and functional

diversity to a similar extent as the whole superfamily. It comprises eight members in

mammals: TRPM1 to TRPM8. Of these TRPM2, TRPM6 and TRPM7 are unique

amongst the TRP channels in that they possess an enzymatically active protein domain

in their intracellular structure (Perraud et al., 2001; Runnels, 2011). TRPM4 and

TRPM5 channels do not show any permeability for Ca2+ in contrast to the other TRP

channels, although their activation is highly dependent on increases in intracellular

Ca2+ levels (reviewed by Guinamard et al., 2011). Currently little information is

available for the zebrafish TRPM family.

The teleost Danio rerio is one of the best established genetic and behavioral vertebrate

model organisms. In zebrafish TRP channel function in vivo can be studied using a

variety of tools, including morpholino knockdown, zinc finger nuclease, TALEN

(transcription activator-like effector nuclease), TILLING (targeted induced local lesion in

genomes) and transgenesis technologies (reviewed in Huang et al., 2012; Sugano and

Neuhauss, 2013). In this study, we identified and cloned cDNAs for 11 trpm genes and

studied their expression over development. We were able to identify excitable and non-

excitable tissues expressing trpm channels. Our findings suggest a variety of functional

implications for zebrafish TRPM channels and form the basis for further investigations.

Results and Discussion:

The zebrafish trpm family:

We used the verified Homo sapiens and Mus musculus sequences of TRPM channels

to search the ensemble databases in order to identify trpm genes of Danio rerio. While

mouse and human genomes contain eight TRPM members, we found 11 zebrafish

trpm genes (figure 1). We ascertained a single zebrafish ortholog for the following

mammalian TRPM channels: TRPM2, TRPM3, TRPM5, TRPM6, and TRPM7. Two

zebrafish trpm genes, namely trpm1 and trpm4, were found to have multiple paralogs.

The two trpm1 paralogs, trpm1a and trpm1b, were located to different chromosomes

of 36



evel

opm

enta

l Dyn

amic

s

5

and hence are likely to be the result of the teleost specific R3 whole genome

duplication. In addition to the three zebrafish trpm4 paralogs described in Saito and

Shingai, 2006, we identified a fourth trpm4 gene. Whereas trpm4a was found on

chromosome 3, the three other paralogs, trpm4b1, trpm4b2, and trpm4b3, are situated

on chromosome 12. Phylogenetic and synteny analyses indicate that trpm4a and one

of the trpm4bs originate from the R3 genome duplication; whereas the other two

paralogs seem to be the result of tandem gene duplications (figure 1A, C). Based on

their high sequence similarity, these tandem duplications likely happened very recently.

In agreement with Saito and Shingai, 2006, we failed to identify a zebrafish trpm8

ortholog, supporting their conclusion that trpm8 is indeed absent from the zebrafish

genome. In mammalian species TRPM8 has been described as a menthol and cold

sensitive TRP channel involved in body and ambient temperature perception below

25°C (McKemy et al., 2002; Peier et al., 2002).

Using sequence information from our in silico analysis, we amplified and

subsequently cloned the open reading frames for the zebrafish trpm genes. Using

these cDNA templates, we performed whole mount in situ hybridization (WISH) to

analyze the expression pattern of trpm genes in the developing zebrafish ranging from

24 hours (hpf) to 5 days post fertilization (dpf). With the exception of trpm6 we were

able to detect distinct and dynamic expression pattern for all trpm genes. However, as

human TRPM6 expression was exclusively found in kidney and intestine (Schlingmann

et al., 2002; Walder et al., 2002), we assume that the expression level in these organs

at the stages analyzed is too low to be visualized. An overview of the zebrafish trpm

family expression pattern observed throughout development is given in table 1.

Expression of trpm1 genes:

The founding member of the TRPM family, TRPM1 (melastatin), was initially identified

in melanoma cell lines and its expression levels seem to be inversely correlated to

metastasis of these tumors (Duncan et al., 1998). Here we describe the expression

of 36



evel

opm

enta

l Dyn

amic

s

6

pattern of the two zebrafish paralogs, trpm1a and trpm1b. We observed trpm1a

expression predominantly in cells of the neural crest (NC) at 24 hpf (see figure 2 A-C).

These cells are most likely future melanophores, the zebrafish equivalents to

mammalian melanocytes, as they are dispersed all over the embryonic body including

the yolk sac. This is a typical distribution described for melanoblast and melanophore

markers like microphthalmia-associated transcription factor a (mitfa) (Lister et al., 1999)

and dopachrome tautomerase (dct) (Kelsh et al., 2000). The expression of trpm1a in

melanophores is sustained at 48 hpf (figure 2 D, E), and was also found in single cells

mainly on the ventral side of 3 and 5 dpf larvae (figure 2 H). Interestingly, we observed

a peculiar staining pattern of trpm1a in melanophores with mostly two dots per cell (see

tail NC cells in figure 2 C as an example), which is not seen in mitfa or dct expression

studies. If this pattern reflects subcellular localization of mRNA remains elusive. It has

been shown that TRPM1 expression is induced by MITF and transcripts of both genes

were found in human primary melanocytes (Miller et al., 2004). Moreover, TRPM1

regulates positively Ca2+ uptake in human epidermal cells, thereby influencing

melanocyte development and melanin accumulation (Devi et al., 2009). It might well be

that the zebrafish ortholog TRPM1a plays a similar role in melanophore growth and

differentiation. Additionally to the expression in epidermal pigment cells, trpm1a was

found to be expressed in different cell types of the retina. In zebrafish embryos at 24

and 48 hpf, numerous cells all over the eye and especially around the lens were

labeled by WISH (figure 2 F). The retinal region around the lens is called the ciliary

marginal zone (CMZ) and contains retinal stem cells. Expression in the ciliary margin is

maintained at least until 5 dpf (figure 2 G, H, and K) and shows the same dot like

distribution as observed in migrating NC and melanophores. Expression of a TRPM1

channel in retinal progenitors has not been described for any other species so far.

Recent studies on TRPC1, another TRP channel from the canonical family, showed its

involvement in proliferation of embryonic and adult neuronal stem cells, as well as

oligodendrocyte precursors. Its function as a store-operated Ca2+ channel is thought to

of 36



evel

opm

enta

l Dyn

amic

s

7

be crucial for maintaining intracellular Ca2+ levels required for proliferation (Fiorio Pla et

al., 2005; Paez et al., 2011; Li et al., 2012). Moreover, a role of TRPC5 in the transition

from proliferation to differentiation has been revealed in cultures of neural progenitors

(Shin et al., 2010). Although an involvement of TRPM1 channels in neural stem cell

development has not been reported before, it is conceivable that zebrafish TRPM1a

has a functional role in retinal development. The trpm1a expressing cells in the outer

retinal neuroepithelium of embryonic stages most likely represent future retinal pigment

epithelial (RPE) cells (figure 2 B-D). At 3 dpf, expression of trpm1a started in the inner

nuclear layer (INL) of the retina (figure 2 G), which contains bipolar cells amongst other

cell types. Larvae at 5 dpf still expressed the gene in the INL, as well as in the RPE

(figure 2 J, K).

Compared to trpm1a, the second zebrafish paralog, trpm1b, shows a more restricted

and less dynamic expression pattern over development. trpm1b is initially also

expressed in a subset of cells in the outer retinal neuroepithelium (figure 2 L-N),

presumably labeling RPE progenitor cells. A small band of trpm1b expressing cells is

additionally observed in the ventral eye transiently at 48 hpf (figure 2 M). These cells

are located in the choroid fissure that has not yet been closed at this stage. Similar to

trpm1a, expression of trpm1b starts in cells of the INL at 3 dpf and is also found in

differentiated RPE cells (figure 2 O-R). Retinal expression of both trpm1 paralogs

correlates well with TRPM1 expression in the human eye (Klooster et al., 2011).

Recently, TRPM1 became known for its function in the light perceiving signaling

pathway of the retina. It was found to be the long missing ion channel gated by the

metabotropic glutamate receptor mGluR6 in ON bipolar cells (Morgans et al., 2009;

Shen et al., 2009; Koike et al., 2010). A considerable proportion of human patients

suffering from complete congenital stationary night blindness show mutations in the

TRPM1 channel gene (Audo et al., 2009; Li et al., 2009; van Genderen et al., 2009).

Expression of trpm2:

of 36



evel

opm

enta

l Dyn

amic

s

8

Mammalian TRPM2 expression has been studied mainly by RT-PCR experiments.

Transcripts were found in a variety of tissues, such as brain, immune cells, vascular

endothelial cells, pancreas and other inner organs (summarized in Sumoza-Toledo and

Penner, 2011). WISH of zebrafish trpm2 showed a dynamic expression pattern over

the course of development. At 24 hpf the gene is expressed in lens tissue (figure 3 A).

Over time lens expression becomes more restricted leaving expression only in a

specific spot between the lens and RGC layer, close to the point where the optic nerve

exits the retina (optic nerve head (ONH), figure 3 E, G, K). Additionally, trpm2

transcripts were found in single cells close to the horizontal myoseptum and dorsal to it

(figure 3 B-C). The bilateral, segmented expression pattern suggests that these cells

represent motoneurons. It resembles the expression of familiar motoneuron markers

such as islet1 and islet2 at this anatomical location and developmental stage (Inoue et

al., 1994; Appel et al., 1995; Tokumoto et al., 1995). It is likely that trpm2 is expressed

in primary motoneurons only, as expression in these cells is lost after 24 hpf. 48 hpf

onwards expression appears in a subset of olfactory sensory neurons (figure 3 D, H, K,

N, P). We also detected trpm2 transcripts in bilateral clusters in the hindbrain. Past day

3 this expression becomes rather diffuse and diminishes more and more. At 48hpf

trpm2 expression was also observed in cells of the trigeminal and the posterior lateral

line ganglia (figure 3 F-H, L, N, O). This expression extends to all cranial sensory

ganglia by day 3 and 5 (figure 3 L, N, O). Little is known about the function of TRPM2

during development. Therefore, it is striking that we found trpm2 transcripts primarily in

sensory placodes of embryonic and larval zebrafish. The function of TRPM2 in the

developing embryo is an interesting subject for future studies. As TRPM2 belongs to

the thermosensitive TRP channels and is best known for its involvement in the

oxidative stress response and consequent cell death (Hara et al., 2002; Zhang, 2003;

Takahashi et al., 2011) as well as in synaptic plasticity of hippocampal neurons (Olah

et al., 2009; Xie et al., 2011) it will be interesting to analyze TRPM2 functions in the

described zebrafish expression domains.

of 36



evel

opm

enta

l Dyn

amic

s

9


Expression of human TRPM3 is known to be highly enriched in kidney compared to

lower expression in brain, spinal cord and testis (Grimm et al., 2003; Lee et al., 2003).

Surprisingly, RT-PCR and Northern blot analyses in mouse showed high expression in

various brain areas, such as the telencephalon, cerebellum, basal ganglia, choroid

plexus and hippocampus but comparatively low expression in kidney and other organs.

However, distinct mouse strains showed significant differences in their expression

levels of TRPM3 in the telencephalon (Oberwinkler et al., 2005; Kunert-Keil et al.,

2006). The zebrafish ortholog of the TRPM3 gene is found to be expressed by a subset

of neural crest cells at 24 hpf (figure 4 A-C). Compared to trpm1a expression, trpm3 is

expressed only by cranial NC cells and in a dorsal longitudinal stripe along the

embryonic trunk and tail (compare figure 2 A-B with 4 A-B). Additionally, expression is

also present in the habenula (Ha) and lens tissue (L; figure 4 A). Comparable to trpm1a

expression in NC and CMZ, a dotted staining was also observed in NC and lens cells

expressing trpm3, but with one single dot per cell (see cranial NC cells in figure 4 C).

Whereas NC cell expression ceases after 24 hpf, expression in the lens and habenula

is retained over all stages observed. From 48 hpf onwards, more and more neurons of

the central nervous system (CNS) start gene expression of this TRPM channel. We

observed expression in the epiphysis (E) and dorsal thalamus (DT), together with a

rather broad expression in the hindbrain (Hb) at 48 hpf (figure 4 D, E). Moreover, lens

expression of trpm3 becomes restricted to the lens epithelial (LEp) layer (figure 4 F).

CNS expression gets more pronounced over development. While expression in the

epiphysis seems to be lost after 3 dpf, we found additional trpm3 staining in the optic

tectum (TeO) and choroid plexus (CP; figure 4 G-L). Finally, larvae show expression in

a subset of ganglion cells of the retina at 5 dpf (GCL, figure 4 M). It is noteworthy that

the expression pattern of trpm3 partially overlaps with the expression pattern of

mglur6a, which was found in the retinal ganglion cell layer, habenula, optic tectum and

of 36



evel

opm

enta

l Dyn

amic

s

10

thalamus as well (Haug et al., 2013). This suggests the possibility that a similar

glutamate signaling pathway as described for ON bipolar cells may be active in these

neurons as well. Moreover, a recent study showed the localization of TRPM3 in

Purkinje cells of the neonatal rat cerebellar cortex and its capability to enhance

glutamatergic transmission (Zamudio-Bulcock et al., 2011). These findings suggest a

role of TRPM3 in synapse refinement during development.

Expression of trpm4 genes:

TRPM4 is one of the two TRP channels that is selective for monovalent cations and

activated by high intracellular Ca2+ levels. In humans the channel is predominantly

expressed in skeletal muscles and inner organs, including heart, kidney, liver and

pancreas (Launay et al., 2002). A similar distribution of trpm4 mRNA was observed in

mice (Kunert-Keil et al., 2006). The zebrafish ortholog trpm4a was found to be

expressed only in three distinct domains. WISH analysis of trpm4a revealed expression

to be restricted to the cloaca of the pronephros in embryos 24 hpf (figure 5 A, B). By 48

hpf, the pharyngeal ectoderm (PEc) starts to express trpm4a, but this expression is lost

again at larval stages analyzed. However, cloacal expression is sustained until at least

5 dpf (figure 5 D, F, H), with expression even expanding into the caudal part of the

pronephros (figure 5 H). Additionally, we located trpm4a transcripts in the intestinal

bulb from 3 dpf onwards (figure 5 E, G).

This comparatively restricted expression is in contrast to the other three trpm4

paralogs, which show a broader expression pattern. As every probe for trpm4bs gave

identical results it seems likely that our probes used for the trpm4b variants are unable

to discriminate between the three different transcripts. Since the 3’ untranslated regions

(UTRs) of trpm4b genes show very high conservation, we designed probes for the less

conserved 5’ UTRs. Unfortunately, these probes proved unable to detect expression,

probably due to their rather short length (see table 2). Therefore, we can not determine

whether transcripts of a particular trpm4b gene is present only in a subset of the

of 36



evel

opm

enta

l Dyn

amic

s

11

domains stained with the long trpm4b probes or is not expressed at all. Initial

expression at 24 hpf is visible in the olfactory, pronephric and lateral line systems.

More specifically, expression is detectable in olfactory sensory neurons (figure 5 J) and

the pronephric cloaca (figure 5 M). At 24 hpf weak expression is also seen in the lateral

line primordium (LLP), and stronger expression can be detected in the newly formed

neuromast cells (LLN; figure 5 K, L). Although expression in olfactory sensory neurons

and neuromasts seems to decrease after 3 dpf, we could observe WISH staining in

these cells at all stages analyzed (figure 5 N-V). From embryonic stage 48 hpf until at

least 4 dpf, transcripts for trpm4bs can be seen in cells of the pharyngeal ectoderm

(figure 5 O, P). The gill ectoderm (GEc) also shows expression as soon as gill

development started (figure 5 R, V). Last but not least, we observed yet another

expression domain in the intestinal bulb of 5 dpf larvae (IB; figure 5 W), comparable to

the expression of trpm4a at this stage.

Expression of trpm4s in cloaca, intestine, pharynx and gill ectoderm points to a role in

ion homeostasis or osmoregulation. Moreover, expression of TRPM4 in the murine

accessory olfactory system (AOS) has been described recently and seems to be at

least partially responsible for the sustained response of neurons (Shpak et al., 2012).

The mammalian and reptile accessory olfactory system is considered to be involved in

the fluid based chemosensation in contrast to the main olfactory system, which detects

volatile substances. Therefore it is reasonable to expect a conserved TRPM expression

pattern of teleost olfactory neurons and mammalian AOS neurons. In addition to a

possible role in chemosensation, TRPM4b channels in the lateral line system could

account for the transduction of mechanical stimuli as specialized hair cells in the lateral

line neuromasts are able to detect water movements and vibrations comparable to hair

cells in the mammalian inner ear.


of 36



evel

opm

enta

l Dyn

amic

s

12

The expression of zebrafish trpm5 in juvenile zebrafish aged approximately 2 months

has already been described by Yoshida et al., 2007. In this study they demonstrated

expression in taste bud cells located on the lips, barbels, and headskin as well as in the

mouth cavity, gill rakers, and pharynx. In contrast to their experiments, we analyzed

trpm5 expression in the whole animal at earlier developmental stages. However, no

transcripts of trpm5 were detected at 24 and 48 hpf, respectively. In accordance with

Yoshida et al., 2007, we could confirm expression of trpm5 in taste bud cells of the

pharynx and gills to be present already at larval stages 3 and 5 dpf (figure 6 A-F) but

not in any other tissue. TRPM5 expression in taste receptor cells as well as its function

in the transduction of different taste stimuli is well established. This channel is activated

upon ligand binding to G-protein coupled receptors of the taste receptor T1R and T2R

families and mediate perception of sweet, umami and bitter taste (Pérez et al., 2002;

Zhang et al., 2003; Damak et al., 2006). Their additional thermosensitivity is proposed

to modulate taste reception dependent on temperature (Talavera et al., 2005). Our

expression analysis together with the data of Yoshida et al., 2007, suggests a

conservation of TRPM5 in the transduction of taste stimuli among vertebrate species.


TRPM7 is the best studied member of the zebrafish TRPM family so far. Its expression

has been described as rather ubiquitous with stronger expression in lens sensory

placodes, ionocytes, epiphysis, pharynx, pronephros, and Rohon-Beard neurons

between 24 – 55 hpf (Thisse, 2001; Hsiao et al., 2007; Low et al., 2011). Another study

described expression of this ion channel in liver, kidney tubules and corpuscules of

Stannis in metamorphic larvae 14 dpf (Elizondo et al., 2005). Our observations are in

line with these data (figure 7 A-F), although expression in the spinal cord is very weak.

We extended the expression analysis during development to early larval stages (figure

7 G-M). TRPM7 is a well established marker for the pronephric proximal straight tubule

(PST) in zebrafish embryos (Wingert et al., 2007); however larvae show an extension

of 36



evel

opm

enta

l Dyn

amic

s

13

of the expression into the proximal convoluted tubule (PCT) at 5 dpf (figure 7 K-L).

Additionally, we observed trpm7 transcripts above the heart (arrowhead in figure 7 E)

and in two bilateral spots caudal to the pharynx (arrowheads in figure 7 G-H).

Some zebrafish lines carrying different mutations of the gene have been isolated in

genetic screens for pigmentation, pancreas development or locomotion deficiencies

(Granato et al., 1996; Kelsh et al., 1996; Arduini and Henion, 2004; Low et al., 2011;

Yee et al., 2011). Loss of TRPM7 usually leads to lethality between 14 and 16 dpf.

Nevertheless, one semi-viable allele was identified enabling phenotypic description into

adulthood. These fish showed kidney stone formation accompanied by severe

dwarfism due to massive disruption of bone ossification, indicative of the important role

of TRPM7 in calcium and magnesium homeostasis (Cornell et al., 2004; Elizondo et al.,

2005; Elizondo et al., 2010). Larval trpm7 mutants show hypopigmentation due to a

failure in melanoblast development (Arduini and Henion, 2004; Cornell et al., 2004;

McNeill et al., 2007). Moreover, trpm7 mutants become unresponsive in escape

response tests assessing mobility at 39 hpf but recover completely after 72 hpf. The

transgenic expression of trpm7 in mechanosensitive Rohon-Beard cells of mutant

larvae could rescue this behavioral phenotype, but the transiently required role of the

cation channel in the sensory neurons is not yet clarified (Low et al., 2011). The

expression pattern of TRPM7 indicates the pivotal role of the channel in ion

homeostasis, and it seems possible that all observed phenotypes of trpm7 mutants rely

on this function.

Taken together our phylogenetic and expression analyses of the TRPM family of ion

channels in zebrafish open the way for further studies on their function. As expression

was found in diverse organs and tissues, including excitable and non-excitable cells,

we expect TRPM channels to be implicated in a multitude of processes. We

concentrated on expression during embryonic and larval stages and found transcripts

in variegated cell clusters of the central and peripheral nervous system. It will be

interesting to investigate trpm genes expressed in neural cells during development and

of 36



evel

opm

enta

l Dyn

amic

s

14

elucidate their role in neural differentiation and proliferation, axon guidance, or synaptic

plasticity. Another interesting aspect is expression of TRPM channels in cells involved

in metabolism and homeostasis, such as the kidney, intestine, and gills. The zebrafish

offers a broad variety of genetic and behavioral tools to assess the function of TRPM

channels in vivo. And a better understanding of their physiological functions may

provide further insight into disease mechanisms and support the development of

therapies.

Experimental Procedures:

Fish maintenance:

Zebrafish breeding and maintenance were carried out under standard conditions (26-

28°C, 14h light/10h dark) according to Westerfield, 2007. The wildtype WIK line was

used for all experiments described here. Pigmentation of embryos was avoided by

incubating them in 0.2 mM 1-phenyl-2 thiourea (Sigma).

Annotation of trpm cDNAs

As automated gene predictions within GenBank are subjected to putative annotation

errors, trpm cDNA sequences used in this study were annotated manually. Annotations

were done based on combined information obtained from expressed sequence tags

and genome databases (GeneBank, http://www.ncbi.nlm.nih.gov; Ensembl,

http://www.ensembl.org/index.html). Human and mouse sequences were used as initial

query (for more details on sequence annotation see Gesemann et al., 2010).

Phylogenetic and synteny analyses:

The phylogenetic analysis was performed on the Phylogeny.fr platform

(http://www.phylogeny.fr/) as described previously (Gesemann et al., 2010; Haug et al.,

2013). In brief, sequences alignment was done using MUSCLE. Input sequence length

varied between 1104 and 2028 amino acids. Ambiguous regions were removed using

Gblocks and 438 conserved amino acids were used to reconstruct a maximum

of 36



evel

opm

enta

l Dyn

amic

s

15

likelihood tree. Branch liability was assessed using the aLRT test and svg tree file were

imported into CoralDraw (version X5; Coral Corporation Ottawa, Canada) for final

editing.

Cloning and sequencing of trpm genes:

Total RNA was extracted from a pool of 5 dpf wild-type zebrafish embryos using the

Macherey-Nagel NucleoSpin® RNA II kit. cDNA was subsequently generated

according to the manual of the Invitrogen SuperScript™ II RT-PCR kit. Fragments of

the respective trpm genes were amplified by means of polymerase chain reaction,

cloned into the pCR®II-TOPO vector following the TOPO TA Cloning® instruction

manual and eventually sequenced. If necessary and possible 5’ rapid amplification of

cDNA ends was performed using the Invitrogen 5’ RACE System Version 2.0 in order

to obtain cDNA fragments comprising the start codon. The sequences of all 11 genes

were submitted to GenBank under the following accession numbers: trpm1a

KF305305, trpm1b KF305306, trpm2 KF305307, trpm3 KF305308, trpm4a KF305309,

trpm4b1 KF305310, trpm4b2 KF305311, trpm4b3 KF305312, trpm5 KF305313, trpm6

KF305314, and trpm7 KF305315. The oligonucleotides listed in table 2 were used for

amplification of cDNA fragments used for in situ hybridization analyses.

Probe synthesis and whole mount in situ hybridization:

Preparation of RNA probes and expression analyses with alkaline phosphatase-based

color reaction was performed as described previously (Hauptmann and Gerster, 2000)

with the following adaptations. The RNA probe was recovered by lithium chloride

precipitation. The duration of Proteinase K treatment was 60 min and 90 min for larvae

fixed 3 and 5 dpf, respectively. Hybridization was performed overnight at 65°C. The

anti-digoxigenin antibody (Roche #11093274910) was diluted at 1:5000 with 1% Roche

blocking reagent (Roche #11096176001) in TNT buffer (100mM Tris-HCL pH7.5, 150

mM NaCl, 0.5% Tween20). Washing steps after antibody incubation were also done

of 36



evel

opm

enta

l Dyn

amic

s

16

with TNT buffer. 2 mM levamisole hydrochloride (Sigma L9756) was added to the

staining buffer in order to prevent unspecific staining by endogenous alkaline

phosphatase.

Imaging:

Embryos were embedded in glycerol. Images were captured using a ColorView IIIu

camera and an Olympus BX61 widefield microscope. Levels of pictures were adjusted

and figures were assembled using Adobe Photoshop software.

Acknowledgments:

We thank Kara Dannenhauer for excellent technical assistance and zebrafish care, as

well as Andreas Stäuble for help in cloning trpm4 genes.

References:

Appel B, Korzh V, Glasgow E, Thor S, Edlund T, Dawid IB, Eisen JS. 1995. Motoneuron

fate specification revealed by patterned LIM homeobox gene expression in

embryonic zebrafish. Development 121:4117–4125.

Arduini BL, Henion PD. 2004. Melanophore sublineage-specific requirement for

zebrafish touchtone during neural crest development. Mech Dev 121:1353–1364.

Audo I, Kohl S, Leroy BP, Munier FL, Guillonneau X, Mohand-Saïd S, Bujakowska K,

Nandrot EF, Lorenz B, Preising M et al. 2009. TRPM1 Is Mutated in Patients with

Autosomal-Recessive Complete Congenital Stationary Night Blindness. The

American Journal of Human Genetics 85:720–729.

Clapham DE, Runnels LW, Strubing C. 2001. The TRP ion channel family. Nat Rev

Neurosci 2:387–396.

Cornell RA, Yemm E, Bonde G, Li W, d'Alencon C, Wegman L, Eisen J, Zahs A. 2004.

Touchtone promotes survival of embryonic melanophores in zebrafish. Mech Dev

121:1365–1376.

of 36



evel

opm

enta

l Dyn

amic

s

17

Dadon D, Minke B. 2010. Cellular functions of Transient Receptor Potential channels.

The International Journal of Biochemistry & Cell Biology 42:1430–1445.

Damak S, Rong M, Yasumatsu K, Kokrashvili Z, Perez CA, Shigemura N, Yoshida R,

Mosinger B, JR, Glendinning JI, Ninomiya Y et al. 2006. Trpm5 null mice respond to

bitter, sweet, and umami compounds. Chem Senses 31:253–264.

Damann N, Voets T, Nilius B. 2008. TRPs in our senses. Curr Biol 18:R880-9.

Devi S, Kedlaya R, Maddodi N, Bhat KMR, Weber CS, Valdivia H, Setaluri V. 2009.

Calcium homeostasis in human melanocytes: role of transient receptor potential

melastatin 1 (TRPM1) and its regulation by ultraviolet light. AJP: Cell Physiology

297:C679.

Dietrich A, Gudermann T. 2011. TRP channels in the cardiopulmonary vasculature. Adv

Exp Med Biol 704:781–810.

Duncan LM, Deeds J, Hunter J, Shao J, Holmgren LM, Woolf EA, Tepper RI, Shyjan

AW. 1998. Down-regulation of the novel gene melastatin correlates with potential

for melanoma metastasis. Cancer Res 58:1515–1520.

Elizondo MR, Arduini BL, Paulsen J, MacDonald EL, Sabel JL, Henion PD, Cornell RA,

Parichy DM. 2005. Defective skeletogenesis with kidney stone formation in dwarf

zebrafish mutant for trpm7. Curr Biol 15:667–671.

Elizondo MR, Budi EH, Parichy DM. 2010. trpm7 regulation of in vivo cation

homeostasis and kidney function involves stanniocalcin 1 and fgf23. Endocrinology

151:5700–5709.

Fiorio Pla A, Maric D, Brazer S, Giacobini P, Liu X, Chang YH, Ambudkar IS, Barker JL.

2005. Canonical transient receptor potential 1 plays a role in basic fibroblast growth

factor (bFGF)/FGF receptor-1-induced Ca2+ entry and embryonic rat neural stem

cell proliferation. J Neurosci 25:2687–2701.

Gesemann M, Lesslauer A, Maurer CM, Schönthaler HB, Neuhauss SCF. 2010.

Phylogenetic analysis of the vertebrate Excitatory/Neutral Amino Acid Transporter

(SLC1/EAAT) family reveals lineage specific subfamilies. BMC Evol Biol 10:117.

of 36



evel

opm

enta

l Dyn

amic

s

18

Granato M, van Eeden FJ, Schach U, Trowe T, Brand M, Furutani-Seiki M, Haffter P,

Hammerschmidt M, Heisenberg CP, Jiang YJ et al. 1996. Genes controlling and

mediating locomotion behavior of the zebrafish embryo and larva. Development

123:399–413.

Grimm C, Kraft R, Sauerbruch S, Schultz G, Harteneck C. 2003. Molecular and

Functional Characterization of the Melastatin-related Cation Channel TRPM3.

Journal of Biological Chemistry 278:21493–21501.

Guinamard R, Salle L, Simard C. 2011. The non-selective monovalent cationic

channels TRPM4 and TRPM5. Adv Exp Med Biol 704:147–171.

Hara Y, Wakamori M, Ishii M, Maeno E, Nishida M, Yoshida T, Yamada H, Shimizu S,

Mori E, Kudoh J et al. 2002. LTRPC2 Ca2+-permeable channel activated by

changes in redox status confers susceptibility to cell death. Mol Cell 9:163–173.

Hardie RC, Minke B. 1992. The trp gene is essential for a light-activated Ca2+ channel

in Drosophila photoreceptors. Neuron 8:643–651.

Haug MF, Gesemann M, Mueller T, Neuhauss SC. 2013. Phylogeny and expression

divergence of metabotropic glutamate receptor genes in the brain of zebrafish

(Danio rerio ). J. Comp. Neurol. 521:1533–1560.

Hauptmann G, Gerster T. 2000. Multicolor whole-mount in situ hybridization. Methods

Mol Biol 137:139–148.

Hsiao C, You M, Guh Y, Ma M, Jiang Y, Hwang P. 2007. A positive regulatory loop

between foxi3a and foxi3b is essential for specification and differentiation of

zebrafish epidermal ionocytes. PLoS One 2:e302.

Huang P, Zhu Z, Lin S, Zhang B. 2012. Reverse genetic approaches in zebrafish. J

Genet Genomics 39:421–433.

Inoue A, Takahashi M, Hatta K, Hotta Y, Okamoto H. 1994. Developmental regulation of

islet-1 mRNA expression during neuronal differentiation in embryonic zebrafish. Dev

Dyn 199:1–11.

of 36



evel

opm

enta

l Dyn

amic

s

19

Kelsh RN, Brand M, Jiang YJ, Heisenberg CP, Lin S, Haffter P, Odenthal J, Mullins MC,

van Eeden FJ, Furutani-Seiki M et al. 1996. Zebrafish pigmentation mutations and

the processes of neural crest development. Development 123:369–389.

Kelsh RN, Schmid B, Eisen JS. 2000. Genetic analysis of melanophore development in

zebrafish embryos. Dev Biol 225:277–293.

Klooster J, Blokker J, Brink JB ten, Unmehopa U, Fluiter K, Bergen AAB, Kamermans

M. 2011. Ultrastructural Localization and Expression of TRPM1 in the Human

Retina. Investigative Ophthalmology & Visual Science 52:8356–8362.

Koike C, Obara T, Uriu Y, Numata T, Sanuki R, Miyata K, Koyasu T, Ueno S, Funabiki

K, Tani A et al. 2010. TRPM1 is a component of the retinal ON bipolar cell

transduction channel in the mGluR6 cascade. Proceedings of the National

Academy of Sciences 107:332–337.

Kunert-Keil C, Bisping F, Krüger J, Brinkmeier H. 2006. Tissue-specific expression of

TRP channel genes in the mouse and its variation in three different mouse strains.

BMC Genomics 7:159.

Launay P, Fleig A, Perraud AL, Scharenberg AM, Penner R, Kinet JP. 2002. TRPM4 is

a Ca2+-activated nonselective cation channel mediating cell membrane

depolarization. Cell 109:397–407.

Lee N, Chen J, Sun L, Wu S, Gray KR, Rich A, Huang M, Lin J, Feder JN, Janovitz E et

al. 2003. Expression and Characterization of Human Transient Receptor Potential

Melastatin 3 (hTRPM3). Journal of Biological Chemistry 278:20890–20897.

Li M, Chen C, Zhou Z, Xu S, Yu Z. 2012. A TRPC1-mediated increase in store-operated

Ca2+ entry is required for the proliferation of adult hippocampal neural progenitor

cells. Cell Calcium 51:486–496.

Lister JA, Robertson CP, Lepage T, Johnson SL, Raible DW. 1999. nacre encodes a

zebrafish microphthalmia-related protein that regulates neural-crest-derived

pigment cell fate. Development 126:3757–3767.

of 36



evel

opm

enta

l Dyn

amic

s

20

Li Z, Sergouniotis PI, Michaelides M, Mackay DS, Wright GA, Devery S, Moore AT,

Holder GE, Robson AG, Webster AR. 2009. Recessive Mutations of the Gene

TRPM1 Abrogate ON Bipolar Cell Function and Cause Complete Congenital

Stationary Night Blindness in Humans. The American Journal of Human Genetics

85:711–719.

Low SE, Amburgey K, Horstick E, Linsley J, Sprague SM, Cui WW, Zhou W, Hirata H,

Saint-Amant L, Hume RI et al. 2011. TRPM7 is required within zebrafish sensory

neurons for the activation of touch-evoked escape behaviors. J Neurosci 31:11633–

11644.

McKemy DD, Neuhausser WM, Julius D. 2002. Identification of a cold receptor reveals

a general role for TRP channels in thermosensation. Nature 416:52–58.

McNeill MS, Paulsen J, Bonde G, Burnight E, Hsu M, Cornell RA. 2007. Cell death of

melanophores in zebrafish trpm7 mutant embryos depends on melanin synthesis. J

Invest Dermatol 127:2020–2030.

Miller AJ, Du J, Rowan S, Hershey CL, Widlund HR, Fisher DE. 2004. Transcriptional

regulation of the melanoma prognostic marker melastatin (TRPM1) by MITF in

melanocytes and melanoma. Cancer Res 64:509–516.

Montell C. 2005. The TRP superfamily of cation channels. Sci STKE 2005:re3.

Montell C, Rubin GM. 1989. Molecular characterization of the drosophila trp locus: A

putative integral membrane protein required for phototransduction. Neuron 2:1313–

1323.

Morgans CW, Zhang J, Jeffrey BG, Nelson SM, Burke NS, Duvoisin RM, Brown RL.

2009. TRPM1 is required for the depolarizing light response in retinal ON-bipolar

cells. Proc Natl Acad Sci U S A 106:19174–19178.

Nilius B, Owsianik G. 2011. The transient receptor potential family of ion channels.

Genome Biol 12:218.

of 36



evel

opm

enta

l Dyn

amic

s

21

Oberwinkler J, Lis A, Giehl KM, Flockerzi V, Philipp SE. 2005. Alternative splicing

switches the divalent cation selectivity of TRPM3 channels. J Biol Chem

280:22540–22548.

Olah ME, Jackson MF, Li H, Perez Y, Sun H, Kiyonaka S, Mori Y, Tymianski M,

MacDonald JF. 2009. Ca2+-dependent induction of TRPM2 currents in hippocampal

neurons. The Journal of Physiology 587:965–979.

Paez PM, Fulton D, Spreuer V, Handley V, Campagnoni AT. 2011. Modulation of

Canonical Transient Receptor Potential Channel 1 in the Proliferation of

Oligodendrocyte Precursor Cells by the Golli Products of the Myelin Basic Protein

Gene. Journal of Neuroscience 31:3625–3637.

Peier AM, Moqrich A, Hergarden AC, Reeve AJ, Andersson DA, Story GM, Earley TJ,

Dragoni I, McIntyre P, Bevan S. 2002. A TRP Channel that Senses Cold Stimuli and

Menthol. Cell 108:705–715.

Pérez CA, Huang L, Rong M, Kozak JA, Preuss AK, Zhang H, Max M, Margolskee RF.

2002. A transient receptor potential channel expressed in taste receptor cells. Nat

Neurosci 5:1169–1176.

Perraud AL, Fleig A, Dunn CA, Bagley LA, Launay P, Schmitz C, Stokes AJ, Zhu Q,

Bessman MJ, Penner R et al. 2001. ADP-ribose gating of the calcium-permeable

LTRPC2 channel revealed by Nudix motif homology. Nature 411:595–599.

Runnels LW. 2011. TRPM6 and TRPM7: A Mul-TRP-PLIK-cation of channel functions.

Curr Pharm Biotechnol 12:42–53.

Saito S, Shingai R. 2006. Evolution of thermoTRP ion channel homologs in

vertebrates. Physiol Genomics 27:219–230.

Santoni G, Farfariello V, Amantini C. 2011. TRPV channels in tumor growth and

progression. Adv Exp Med Biol 704:947–967.

Schlingmann KP, Weber S, Peters M, Niemann Nejsum L, Vitzthum H, Klingel K, Kratz

M, Haddad E, Ristoff E, Dinour D et al. 2002. Hypomagnesemia with secondary

of 36



evel

opm

enta

l Dyn

amic

s

22

hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene

family. Nat Genet 31:166–170.

Shen Y, Heimel JA, Kamermans M, Peachey NS, Gregg RG, Nawy S. 2009. A transient

receptor potential-like channel mediates synaptic transmission in rod bipolar cells. J

Neurosci 29:6088–6093.

Shin HY, Hong YH, Jang SS, Chae HG, Paek SL, Moon HE, Kim DG, Kim J, Paek SH,

Kim SJ et al. 2010. A Role of Canonical Transient Receptor Potential 5 Channel in

Neuronal Differentiation from A2B5 Neural Progenitor Cells. PLoS ONE 5:e10359.

Shpak G, Zylbertal A, Yarom Y, Wagner S. 2012. Calcium-Activated Sustained Firing

Responses Distinguish Accessory from Main Olfactory Bulb Mitral Cells. Journal of

Neuroscience 32:6251–6262.

Sugano Y, Neuhauss SCF. 2013. Reverse genetics tools in zebrafish: A forward dive

into endocrinology. Gen Comp Endocrinol.

Sumoza-Toledo A, Penner R. 2011. TRPM2: a multifunctional ion channel for calcium

signalling. The Journal of Physiology 589:1515–1525.

Takahashi N, Kozai D, Kobayashi R, Ebert M, Mori Y. 2011. Roles of TRPM2 in

oxidative stress. Cell Calcium 50:279–287.

Talavera K, Yasumatsu K, Voets T, Droogmans G, Shigemura N, Ninomiya Y,

Margolskee RF, Nilius B. 2005. Heat activation of TRPM5 underlies thermal

sensitivity of sweet taste. Nature 438:1022–1025.

Thisse, B., Pflumio, S., Furthauer, M., Loppin, B., Heyer, V., Degrave, A., Woehl, R.,

Lux, A., Steffan, T., Charbonnier, X.Q. and Thisse, C. 2001. Expression of the

zebrafish genome during embryogenesis (NIH R01 RR15402). ZFIN Direct Data

Submission (http://zfin.org).

Tokumoto M, Gong Z, Tsubokawa T, Hew CL, Uyemura K, Hotta Y, Okamoto H. 1995.

Molecular heterogeneity among primary motoneurons and within myotomes

revealed by the differential mRNA expression of novel islet-1 homologs in

embryonic zebrafish. Dev Biol 171:578–589.

of 36



evel

opm

enta

l Dyn

amic

s

23

van Genderen MM, Bijveld MM, Claassen YB, Florijn RJ, Pearring JN, Meire FM,

McCall MA, Riemslag FC, Gregg RG, Bergen AA et al. 2009. Mutations in TRPM1

Are a Common Cause of Complete Congenital Stationary Night Blindness. The

American Journal of Human Genetics 85:730–736.

Venkatachalam K, Montell C. 2007. TRP channels. Annu Rev Biochem 76:387–417.

Vennekens R, Menigoz A, Nilius B. 2012. TRPs in the Brain. Rev Physiol Biochem

Pharmacol 163:27–64.

Voets T, Talavera K, Owsianik G, Nilius B. 2005. Sensing with TRP channels. Nat Chem

Biol 1:85–92.

Walder RY, Landau D, Meyer P, Shalev H, Tsolia M, Borochowitz Z, Boettger MB, Beck

GE, Englehardt RK, Carmi R et al. 2002. Mutation of TRPM6 causes familial

hypomagnesemia with secondary hypocalcemia. Nat Genet 31:171–174.

Westerfield M. 2007. The zebrafish book: A guide for the laboratory use of zebrafish

(Danio rerio). 5th ed. Eugene: University of Oregon Press.

Wingert RA, Selleck R, Yu J, Song H, Chen Z, Song A, Zhou Y, Thisse B, Thisse C,

McMahon AP et al. 2007. The cdx genes and retinoic acid control the positioning

and segmentation of the zebrafish pronephros. PLoS Genet 3:1922–1938.

Woods IG, Wilson C, Friedlander B, Chang P, Reyes DK, Nix R, Kelly PD, Chu F,

Postlethwait JH, Talbot WS. 2005. The zebrafish gene map defines ancestral

vertebrate chromosomes. Genome Res 15:1307–1314.

Woudenberg-Vrenken TE, Bindels RJM, Hoenderop JGJ. 2009. The role of transient

receptor potential channels in kidney disease. Nat Rev Nephrol 5:441–449.

Xie Y, Belrose JC, Lei G, Tymianski M, Mori Y, MacDonald JF, Jackson MF. 2011.

Dependence of NMDA/GSK-3β Mediated Metaplasticity on TRPM2 Channels at

Hippocampal CA3-CA1 Synapses. Mol Brain 4:44.

Yee NS, Zhou W, Liang I. 2011. Transient receptor potential ion channel Trpm7

regulates exocrine pancreatic epithelial proliferation by Mg2+-sensitive Socs3a

signaling in development and cancer. Dis Model Mech 4:240–254.

of 36



evel

opm

enta

l Dyn

amic

s

24

Yoshida Y, Saitoh K, Aihara Y, Okada S, Misaka T, Abe K. 2007. Transient receptor

potential channel M5 and phospholipaseC-beta2 colocalizing in zebrafish taste

receptor cells. Neuroreport 18:1517–1520.

Zamudio-Bulcock PA, Everett J, Harteneck C, Valenzuela CF. 2011. Activation of

steroid-sensitive TRPM3 channels potentiates glutamatergic transmission at

cerebellar Purkinje neurons from developing rats. J Neurochem 119:474–485.

Zhang W. 2003. A Novel TRPM2 Isoform Inhibits Calcium Influx and Susceptibility to

Cell Death. Journal of Biological Chemistry 278:16222–16229.

Zhang Y, Hoon MA, Chandrashekar J, Mueller KL, Cook B, Wu D, Zuker CS, Ryba

NJP. 2003. Coding of Sweet, Bitter, and Umami Tastes: Different Receptor Cells

Sharing Similar Signaling Pathways. Cell 112:293–301.

Figure Legends:

Figure 1:

Origin, conservation and phylogenetic relation of zebrafish TRPM channels. (A)

Phylogenetic relations between TRPM channels from human, mouse and zebrafish.

Zebrafish (dr) TRPMs are shown in red, human (hs) TRPMs are depicted in dark gray

and mouse (mm) TRPMs are given in light gray. The tree was rooted using the

zebrafish TRPN1 channel as an outgroup. (B) Identity and conservation within the

trpm4 subgroup. The four zebrafish TRPM4 sequences were compared with each other

and with the corresponding orthologs of mouse and human. The first line represents

the amino acid comparison (bold = identical, in parentheses = conserved), whereas the

second line gives identities on nucleotide level. While zebrafish TRPM4s resulting from

tandem duplication events are highlighted in dark red, homologies between human and

mouse TRPM4s are pointed out in orange. (C) Synteny of the zebrafish trpm4 genes.

Genes flanking the trpm4 genes on the zebrafish chromosomes 3 and 12 are shown in

the central part of the figure. Zebrafish chromosomes 3 and 12, harboring the trpm4

of 36



evel

opm

enta

l Dyn

amic

s

25

genes, have been previously reported to derive from a common protochromosome

(Woods et al., 2005). Note that the genes depicted here have their counterparts on

human chromosomes 10 (q23.33), 16 (p11.2, p12.3 and p13.3) 17, and 19 (q13.42)

and that several genes found in close proximity to the human trpm4 gene (e.g. PRR12

or BRSK1) have corresponding representatives on both zebrafish chromosomes. The

additional zebrafish trpm4 genes on chromosome 12 most likely originated by tandem

duplication and partial chromosome inversions of the original trpm4 duplicate leading to

two additional trpm4 genes in zebrafish.

Figure 2:

Expression of trpm1 channel genes, trpm1a and trpm1b, shown in whole-mount during

zebrafish development. A-K: trpm1a expression with A-C: lateral (A, C) and dorsal (B)

views of embryos 24 hpf, of which C shows dorsal and lateral NC cells of the tail in

higher magnification; D-F: dorsal (D-E) and lateral (F) views of embryos staged 48 hpf;

G-H: 3 dpf larvae shown from the ventral side; J-K: ventral (J) and lateral (K) views of

larvae staged 5 dpf. L-R: trpm1b expression with L: dorsal view of embryos 24 hpf; M-

N: embryos staged 48 hpf shown from the dorsal side; O-P: ventral (O) and lateral (P)

views of larvae 3 dpf; Q-R: ventral (Q) and lateral (R) views of larvae 5dpf. Zebrafish

are orientated with anterior to the left in all pictures but G, J, O, and Q, where anterior

is to the top. Scale bars of 100 µm are indicated in the first picture of a series until

changed. Scale bar in C refers to 25 µm. Abbreviations: NC = neural crest; Mel =

melanoblast / -cyte; CMZ = ciliary marginal zone; INL = inner nuclear layer; RPE =

retinal pigment epithelium.

Figure 3:

Dynamic expression pattern of trpm2 during zebrafish development, shown in whole-

mount views. A-C: dorsal (A-B) and lateral (C) views of embryos 24 hpf; D-H: ventral

(D-F) and lateral (G-H) views of embryos staged 48 hpf; J-M: 3 dpf larvae shown from

the dorsal (J), ventral (K) and lateral (L-M) side, respectively; N-P: ventral (N), lateral

of 36



evel

opm

enta

l Dyn

amic

s

26

(O), and frontal (P) views of larvae staged 5 dpf. Orientation of zebrafish is with anterior

to the left in all pictures but P showing a frontal view. Scale bars of 100 µm are

indicated in the first picture of a series until changed. Abbreviations: L = lens; Mn =

motoneurons; OSN = olfactory sensory neurons; TG = trigeminal ganglia; PLG =

posterior lateral line ganglia; Hb = hindbrain; ONH = optic nerve head; CSG = cranial

sensory ganglia.

Figure 4:

Expression of trpm3 in whole-mount zebrafish during embryonic and larval stages. A-

C: lateral (A, A’, C) and dorsal (B) views of embryos 24 hpf with (A’) showing staining in

NC cells of the tail and (C) providing a higher magnification of trpm3 expression in

cranial NC cells; D-F: lateral (D, F) and dorsal (E) views of embryos staged 48 hpf; G-

J: 3 dpf larvae shown from the dorsal (G-H) and lateral (J) side, respectively; K-M:

lateral (K), dorsal (L), and ventral (M) views of larvae staged 5 dpf. Zebrafish are

orientated with anterior to the left in all pictures but M, where anterior is to the top.

Scale bars of 100 µm are indicated in the first picture of a series until changed. Scale

bar in C refers to 25 µm. Abbreviations: NC = neural crest; Ha = habenula; E =

epiphysis; DT = dorsal thalamus; Nhp = neurohypophysis; Hb = hindbrain; LEp = lens

epithelium; TeO = optic tectum; CP = choroid plexus; GCL = ganglion cell layer.

Figure 5:

Expression of trpm4 channel genes, trpm4a and trpm4b1, shown in whole-mount

during zebrafish development. Expression pattern of both, trpm4b2 and trpm4b3 are

identical to trpm4b1. A-K: trpm4a expression with A-B: lateral (A) and ventral (B) views

of embryos 24 hpf; C-D: lateral views of embryos staged 48 hpf; E-F: 3 dpf larvae

shown laterally; G-H: lateral views of larvae staged 5 dpf. J-W: Expression of trpm4bs

with J-M: dorsal (J-K) and lateral (L-M) views of embryos 24 hpf; N-P: embryos staged

48 hpf shown from the lateral (N, P) and ventral (O) side; Q-T: lateral (Q, S-T) and

of 36



evel

opm

enta

l Dyn

amic

s

27

ventral (R) views of larvae 3 dpf; U-W: lateral (U) and ventral (V-W)) views of larvae

5dpf. Zebrafish are orientated with anterior to the left. Scale bars of 100 µm are

indicated in the first picture of a series until changed. Abbreviations: Cl = cloaca; PEc

= pharynx ectoderm; IB = intestinal bulb; OSN = olfactory sensory neurons; LLN =

lateral line neuromast; LLP = lateral line primordium; GEc = gill ectoderm.

Figure 6:

Expression of trpm5 in taste bud cells during zebrafish development. A-C: lateral (A)

and ventral (B-C) whole-mount views of larvae 3 dpf; D-F: lateral (D) and ventral (E-F)

whole-mount views of larvae staged 5 dpf, with anterior to the left in all pictures. Scale

bars of 100 µm are indicated in A for all pictures shown. Abbreviations: PTB =

pharynx taste bud; GTB = gill taste bud.

Figure 7:

Expression of trpm7 in whole-mount zebrafish during embryonic and larval stages. A-

C: dorsal (A), lateral (B), and ventral (C) views of embryos 24 hpf; D-F: lateral views of

embryos staged 48 hpf; G-J: 3 dpf larvae shown from lateral (G) and ventral (H-J)

sides, respectively; K-M: lateral (K) and ventral (L-M) views of larvae staged 5 dpf.

Zebrafish are orientated with anterior to the left. Arrowheads in E, G, and H mark

expression domains in unknown anatomical structures. Scale bars of 100 µm are

indicated in the first picture of a series until changed, but scale bar in H refers to 50 µm.

Abbreviations: L = lens; PST = proximal straight tubule; Ic = ionocyte; PCT = proximal

convoluted tubule.

of 36



evel

opm

enta

l Dyn

amic

s

28

Table 1: Overview of zebrafish trpm expression during development

24 hpf 48 hpf 3 dpf 5 dpf

trpm1a

melanoblasts (mel) melanophores (mel), retina: ciliary

marginal zone (CMZ)

melanophores, retina: ciliary marginal

zone, retinal pigment epithelium

(RPE), inner nuclear layer (INL)

melanophores, retina: ciliary marginal

zone, retinal pigment epithelium, inner

nuclear layer

trpm1b future RPE cells future RPE cells, choroid fissure (CF) retina: retinal pigment epithelium,

inner nuclear layer

retina: retinal pigment epithelium,

inner nuclear layer

trpm2

Lens (L), motoneurons (Mn) lens, olfactory sensory neurons

(OSN), hindbrain (Hb), trigeminal

ganglia (TG), posterior lateral line

ganglia (PLG)

optic nerve head (ONH), olfactory

sensory neurons, hindbrain, cranial

sensory ganglia

optic nerve head, olfactory sensory

neurons, hindbrain, cranial sensory

ganglia

trpm3

lens, neural crest cells (NC), habenula

(Ha)

lens, habenula, epiphysis (E), dorsal

thalamus (DT), hindbrain, choroid

plexus (CP), neurohypophysis (Nhp)

lens, habenula, epiphysis, dorsal

thalamus, hindbrain, choroid plexus,

optic tectum (TeO)

Lens, retinal ganglion cells (RGC),

habenula, dorsal thalamus, optic

tectum

trpm4a cloaca (C) pharyngeal ectoderm (PEc), cloaca intestinal bulb (IB), cloaca intestinal bulb (IB), posterior part of

the pronephros

trpm4bs

olfactory sensory neurons, lateral line

promordium (LLP) and lateral line

neuromasts (LLN), cloaca

olfactory sensory neurons, pharyngeal

ectoderm, lateral line neuromasts,

cloaca


and gill ectoderm (GEc), lateral line

neuromasts, cloaca


and gill ectoderm, intestinal bulb,

cloaca

trpm5 no detectable expression no detectable expression taste bud cells in pharynx and gills taste bud cells in pharynx and gills

trpm6 no detectable expression no detectable expression no detectable expression no detectable expression

trpm7 lens, ionocytes (IC), pronephros:

proximal straight tubules (PST)

lens, ionocytes, pronephros: proximal

straight tubules

pronephros: proximal straight tubules pronephros: proximal convoluted

tubules and proximal straight tubules

of 36


Developmental Dynamics

5051525354555657585960

Dev

elop

men

tal D

ynam

ics

29

Table 2: Oligonucleotides used for WISH probes

Gene Forward primer 5’-3’ Reverse primer 5’-3’ Length

trpm1a_dr GCAGGAGAAATGGTCGGT GGGCGAAGGAAATGATGT 764 nt

trpm1b_dr AGAGGGCATGGATTGAAAGG GGTTTGGTAGGGTCGTGT 632 nt

trpm2_dr TGTCTCCCTCTTTCCAGC CGAAGGAAGAAGCAGGAG 1439 nt

trpm3_dr GTAAGCACCAAAGACCACCA GAATGATGAAGAGATGCTGGG 1006 nt

trpm4a_dr GGGGGAGGAGAGAGAAAA GCACACACAAAACAGGAA 826 nt

trpm4b1_dr TTTCGACCTACTTGACTTACAA GCCTCTCGAATCTCCTCG 1099 nt

trpm4b2_dr GAAGTTTCCTCAGACGTTGA CATAATCCACTGTAGAGAGGAAT 986 nt

trpm4b2_dr UTR CCGAGTTTCCTGCTCSTCTC GATGAAAAGCAGAACATGGG 118 nt

trpm4b2_dr UTR CCGAGTTTCCTGCTCSTCTC GCTAGGATTAGGGATGTAGAAG 409 nt

trpm4b3_dr TTCCTCTTCCTGTTTCTGTAC GCGTTTGAGCCTCTGG 1026 nt

trpm4b3_dr UTR GTGTTCATCTTCTGTCTTCATTC CTAGTTTAAAGATGGAAAGCG 111 nt

trpm4b3_dr UTR GTGTTCATCTTCTGTCTTCATTC GGATTAGGGATGTAAAATATGATC 388 nt

trpm5_dr CGTAAGGGTGACCAGCTC CCTGACATTCGTTTTCTGG 1212 nt

trpm6_dr CTCCTCACATCATTTCCTTC CTTTTTCTGCCCCTTCTT 914 nt

trpm7_dr CACAGAGTTGGACAGAAACC GAGGGACGCAGTTCTTTAG 1122 nt

of 36



evel

opm

enta

l Dyn

amic

s

1

144x181mm (300 x 300 DPI)

of 36



evel

opm

enta

l Dyn

amic

s

2

191x210mm (300 x 300 DPI)

of 36



evel

opm

enta

l Dyn

amic

s

3

152x132mm (300 x 300 DPI)

of 36



evel

opm

enta

l Dyn

amic

s

4

180x185mm (300 x 300 DPI)

of 36



evel

opm

enta

l Dyn

amic

s

5

213x259mm (300 x 300 DPI)

of 36



evel

opm

enta

l Dyn

amic

s

6

92x48mm (300 x 300 DPI)

of 36



evel

opm

enta

l Dyn

amic

s

7

178x277mm (300 x 300 DPI)

of 36



evel

opm

enta

l Dyn

amic

s

phylogenetic analysis and expression of zebrafish …...phylogenetic analysis and expression of...

Documents