Phylogenetic Analysis and Expression of Zebrafish
Transient Receptor Potential Melastatin Family Genes
Authors, affiliations and grants:
Edda Kastenhuber1, Matthias Gesemann1, Michaela Mickoleit1,2, Stephan C. F.
Neuhauss1*
1Institute of Molecular Life Sciences, University of Zurich, Winterthurerstrasse 190,
8057 Zurich, Switzerland
2Present address: Max-Planck-Institute of Molecular Cell Biology and Genetics,
Pfotenhauerstrasse 108, 01307 Dresden, Germany
*Correspondence to: Stephan C. F. Neuhauss, Institute of Molecular Life Sciences,
University of Zurich, Winterthurerstrasse 190, 8057 Zurich, Switzerland. E-mail:
[email protected] Telephone: +41 (0)44 63 56040 Fax: +41 (0)44 635
6817
Grant sponsor: EMBO ALTF 326-2010, Swiss National Science Foundation
31003A_135598, EU FP7 RETICIRC
Running title:
Zebrafish TRPM family
Key words:
Danio rerio; TRPM ion channels; sensory neurons; pronephros
Key findings:
� The zebrafish TRPM family consists of 11 genes.
� Zebrafish trpm genes show dynamic expression pattern over embryonic and
larval stages observed.
� Expression was identified in both excitable and non-excitable cells, reflecting
the broad functional range of TRPM channels.
� Zebrafish trpm expression was found in cell clusters involved in sensory
information processing, ion homeostasis, and osmolarity as well as in the
developing brain.
Research Article Developmental DynamicsDOI 10.1002/dvdy.24020
Accepted Articles are accepted, unedited articles for future issues, temporarily published onlinein advance of the final edited version.© 2013 Wiley Periodicals, Inc.Received: Apr 24, 2013; Revised: Jul 02, 2013; Accepted: Jul 17, 2013
Dev
elop
men
tal D
ynam
ics
2
Abstract:
Background: The transient receptor potential melastatin (TRPM) gene family belongs to
the superfamily of non-selective TRP ion channels. TRP channels are cellular sensors,
detecting a multitude of inputs, including temperature, light, chemical and mechanical
stimuli. Recent studies revealed diverse roles during development, linking TRP
channels to differentiation, proliferation, cell motility, cell death and survival. A detailed
description of this gene family in the zebrafish is still missing.
Results: Phylogenetic analysis revealed 11 trpm genes in the zebrafish genome. The
zebrafish orthologs of mammalian TRPM1 and TRPM4 are duplicated and
quadruplicated, respectively, and TRPM8, a cold sensitive channel has been lost in
zebrafish. Whole-mount in situ hybridization experiments revealed dynamic expression
pattern of trpm genes in the developing embryo and early larva. Transcripts were
mainly found in neural cell clusters, but also in tissues involved in ion homeostasis.
Conclusions: Our results suggest a role of TRPM channels in sensory information
processing, including vision, olfaction, taste, and mechanosensation. An involvement in
developmental processes is likely, as some trpm genes were found to be expressed in
differentiating cells. Our data now provides a basis for functional analyses of this gene
family of ion channels in the vertebrate model organism Danio rerio.
Page 2 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
3
Introduction:
The transient receptor potential (TRP) channel was first described in the fruit fly
Drosophila melanogaster after the identification of a mutant fly that showed a transient
instead of a sustained response to continuous light exposure (Montell and Rubin, 1989;
Hardie and Minke, 1992). Subsequent phylogenetic analysis led to the discovery of a
whole superfamily of ion channels that are conserved throughout the animal kingdom.
The human TRP family consists of 27 genes clustering into six subfamilies (TRPC,
TRPM, TRPV, TRPA, TRPP, and TRPL). Although single channels can differ strongly
in their physiological characteristics, they all share a common structure consisting of six
transmembrane domains, the pore forming region between S5 and S6 and intracellular
amino- and carboxy-termini. Functional channels are known to form homo- or
heterotetramers, displaying a large diversity of ion selectivity, activation mode, and
gating mechanisms (reviewed for example by Clapham et al., 2001; Montell, 2005;
Venkatachalam and Montell, 2007; Nilius and Owsianik, 2011).
Expression of individual members was found in many tissues, underscoring their
perceived role as multifunctional cellular sensor proteins. Indeed, functional analyses of
TRP ion channels revealed their participation in all kinds of sensory perception:
thermo-, mechano-, and chemosensation, as well as nociception and light perception
(summarized in Voets et al., 2005 and Damann et al., 2008). Another central role of
TRP channels is the maintenance of ion homeostasis and osmoregulation. Therefore
they have been associated with diverse medical conditions, among them polycystic
kidney disease, hypomagnesemia with secondary hypocalcemia, idiopathic
hypercalciuria, cardiac hypertrophy, and hypertension as just a few examples
(Woudenberg-Vrenken et al., 2009; Dietrich and Gudermann, 2011). Additionally, many
TRP channels are involved in diverse developmental processes such as cell death,
proliferation, axon outgrowth and guidance, as well as synaptic plasticity (Dadon and
Minke, 2010; Santoni et al., 2011; Vennekens et al., 2012).
Page 3 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
4
The subfamily of TRP melastatin (TRPM) channels shows structural and functional
diversity to a similar extent as the whole superfamily. It comprises eight members in
mammals: TRPM1 to TRPM8. Of these TRPM2, TRPM6 and TRPM7 are unique
amongst the TRP channels in that they possess an enzymatically active protein domain
in their intracellular structure (Perraud et al., 2001; Runnels, 2011). TRPM4 and
TRPM5 channels do not show any permeability for Ca2+ in contrast to the other TRP
channels, although their activation is highly dependent on increases in intracellular
Ca2+ levels (reviewed by Guinamard et al., 2011). Currently little information is
available for the zebrafish TRPM family.
The teleost Danio rerio is one of the best established genetic and behavioral vertebrate
model organisms. In zebrafish TRP channel function in vivo can be studied using a
variety of tools, including morpholino knockdown, zinc finger nuclease, TALEN
(transcription activator-like effector nuclease), TILLING (targeted induced local lesion in
genomes) and transgenesis technologies (reviewed in Huang et al., 2012; Sugano and
Neuhauss, 2013). In this study, we identified and cloned cDNAs for 11 trpm genes and
studied their expression over development. We were able to identify excitable and non-
excitable tissues expressing trpm channels. Our findings suggest a variety of functional
implications for zebrafish TRPM channels and form the basis for further investigations.
Results and Discussion:
The zebrafish trpm family:
We used the verified Homo sapiens and Mus musculus sequences of TRPM channels
to search the ensemble databases in order to identify trpm genes of Danio rerio. While
mouse and human genomes contain eight TRPM members, we found 11 zebrafish
trpm genes (figure 1). We ascertained a single zebrafish ortholog for the following
mammalian TRPM channels: TRPM2, TRPM3, TRPM5, TRPM6, and TRPM7. Two
zebrafish trpm genes, namely trpm1 and trpm4, were found to have multiple paralogs.
The two trpm1 paralogs, trpm1a and trpm1b, were located to different chromosomes
Page 4 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
5
and hence are likely to be the result of the teleost specific R3 whole genome
duplication. In addition to the three zebrafish trpm4 paralogs described in Saito and
Shingai, 2006, we identified a fourth trpm4 gene. Whereas trpm4a was found on
chromosome 3, the three other paralogs, trpm4b1, trpm4b2, and trpm4b3, are situated
on chromosome 12. Phylogenetic and synteny analyses indicate that trpm4a and one
of the trpm4bs originate from the R3 genome duplication; whereas the other two
paralogs seem to be the result of tandem gene duplications (figure 1A, C). Based on
their high sequence similarity, these tandem duplications likely happened very recently.
In agreement with Saito and Shingai, 2006, we failed to identify a zebrafish trpm8
ortholog, supporting their conclusion that trpm8 is indeed absent from the zebrafish
genome. In mammalian species TRPM8 has been described as a menthol and cold
sensitive TRP channel involved in body and ambient temperature perception below
25°C (McKemy et al., 2002; Peier et al., 2002).
Using sequence information from our in silico analysis, we amplified and
subsequently cloned the open reading frames for the zebrafish trpm genes. Using
these cDNA templates, we performed whole mount in situ hybridization (WISH) to
analyze the expression pattern of trpm genes in the developing zebrafish ranging from
24 hours (hpf) to 5 days post fertilization (dpf). With the exception of trpm6 we were
able to detect distinct and dynamic expression pattern for all trpm genes. However, as
human TRPM6 expression was exclusively found in kidney and intestine (Schlingmann
et al., 2002; Walder et al., 2002), we assume that the expression level in these organs
at the stages analyzed is too low to be visualized. An overview of the zebrafish trpm
family expression pattern observed throughout development is given in table 1.
Expression of trpm1 genes:
The founding member of the TRPM family, TRPM1 (melastatin), was initially identified
in melanoma cell lines and its expression levels seem to be inversely correlated to
metastasis of these tumors (Duncan et al., 1998). Here we describe the expression
Page 5 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
6
pattern of the two zebrafish paralogs, trpm1a and trpm1b. We observed trpm1a
expression predominantly in cells of the neural crest (NC) at 24 hpf (see figure 2 A-C).
These cells are most likely future melanophores, the zebrafish equivalents to
mammalian melanocytes, as they are dispersed all over the embryonic body including
the yolk sac. This is a typical distribution described for melanoblast and melanophore
markers like microphthalmia-associated transcription factor a (mitfa) (Lister et al., 1999)
and dopachrome tautomerase (dct) (Kelsh et al., 2000). The expression of trpm1a in
melanophores is sustained at 48 hpf (figure 2 D, E), and was also found in single cells
mainly on the ventral side of 3 and 5 dpf larvae (figure 2 H). Interestingly, we observed
a peculiar staining pattern of trpm1a in melanophores with mostly two dots per cell (see
tail NC cells in figure 2 C as an example), which is not seen in mitfa or dct expression
studies. If this pattern reflects subcellular localization of mRNA remains elusive. It has
been shown that TRPM1 expression is induced by MITF and transcripts of both genes
were found in human primary melanocytes (Miller et al., 2004). Moreover, TRPM1
regulates positively Ca2+ uptake in human epidermal cells, thereby influencing
melanocyte development and melanin accumulation (Devi et al., 2009). It might well be
that the zebrafish ortholog TRPM1a plays a similar role in melanophore growth and
differentiation. Additionally to the expression in epidermal pigment cells, trpm1a was
found to be expressed in different cell types of the retina. In zebrafish embryos at 24
and 48 hpf, numerous cells all over the eye and especially around the lens were
labeled by WISH (figure 2 F). The retinal region around the lens is called the ciliary
marginal zone (CMZ) and contains retinal stem cells. Expression in the ciliary margin is
maintained at least until 5 dpf (figure 2 G, H, and K) and shows the same dot like
distribution as observed in migrating NC and melanophores. Expression of a TRPM1
channel in retinal progenitors has not been described for any other species so far.
Recent studies on TRPC1, another TRP channel from the canonical family, showed its
involvement in proliferation of embryonic and adult neuronal stem cells, as well as
oligodendrocyte precursors. Its function as a store-operated Ca2+ channel is thought to
Page 6 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
7
be crucial for maintaining intracellular Ca2+ levels required for proliferation (Fiorio Pla et
al., 2005; Paez et al., 2011; Li et al., 2012). Moreover, a role of TRPC5 in the transition
from proliferation to differentiation has been revealed in cultures of neural progenitors
(Shin et al., 2010). Although an involvement of TRPM1 channels in neural stem cell
development has not been reported before, it is conceivable that zebrafish TRPM1a
has a functional role in retinal development. The trpm1a expressing cells in the outer
retinal neuroepithelium of embryonic stages most likely represent future retinal pigment
epithelial (RPE) cells (figure 2 B-D). At 3 dpf, expression of trpm1a started in the inner
nuclear layer (INL) of the retina (figure 2 G), which contains bipolar cells amongst other
cell types. Larvae at 5 dpf still expressed the gene in the INL, as well as in the RPE
(figure 2 J, K).
Compared to trpm1a, the second zebrafish paralog, trpm1b, shows a more restricted
and less dynamic expression pattern over development. trpm1b is initially also
expressed in a subset of cells in the outer retinal neuroepithelium (figure 2 L-N),
presumably labeling RPE progenitor cells. A small band of trpm1b expressing cells is
additionally observed in the ventral eye transiently at 48 hpf (figure 2 M). These cells
are located in the choroid fissure that has not yet been closed at this stage. Similar to
trpm1a, expression of trpm1b starts in cells of the INL at 3 dpf and is also found in
differentiated RPE cells (figure 2 O-R). Retinal expression of both trpm1 paralogs
correlates well with TRPM1 expression in the human eye (Klooster et al., 2011).
Recently, TRPM1 became known for its function in the light perceiving signaling
pathway of the retina. It was found to be the long missing ion channel gated by the
metabotropic glutamate receptor mGluR6 in ON bipolar cells (Morgans et al., 2009;
Shen et al., 2009; Koike et al., 2010). A considerable proportion of human patients
suffering from complete congenital stationary night blindness show mutations in the
TRPM1 channel gene (Audo et al., 2009; Li et al., 2009; van Genderen et al., 2009).
Expression of trpm2:
Page 7 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
8
Mammalian TRPM2 expression has been studied mainly by RT-PCR experiments.
Transcripts were found in a variety of tissues, such as brain, immune cells, vascular
endothelial cells, pancreas and other inner organs (summarized in Sumoza-Toledo and
Penner, 2011). WISH of zebrafish trpm2 showed a dynamic expression pattern over
the course of development. At 24 hpf the gene is expressed in lens tissue (figure 3 A).
Over time lens expression becomes more restricted leaving expression only in a
specific spot between the lens and RGC layer, close to the point where the optic nerve
exits the retina (optic nerve head (ONH), figure 3 E, G, K). Additionally, trpm2
transcripts were found in single cells close to the horizontal myoseptum and dorsal to it
(figure 3 B-C). The bilateral, segmented expression pattern suggests that these cells
represent motoneurons. It resembles the expression of familiar motoneuron markers
such as islet1 and islet2 at this anatomical location and developmental stage (Inoue et
al., 1994; Appel et al., 1995; Tokumoto et al., 1995). It is likely that trpm2 is expressed
in primary motoneurons only, as expression in these cells is lost after 24 hpf. 48 hpf
onwards expression appears in a subset of olfactory sensory neurons (figure 3 D, H, K,
N, P). We also detected trpm2 transcripts in bilateral clusters in the hindbrain. Past day
3 this expression becomes rather diffuse and diminishes more and more. At 48hpf
trpm2 expression was also observed in cells of the trigeminal and the posterior lateral
line ganglia (figure 3 F-H, L, N, O). This expression extends to all cranial sensory
ganglia by day 3 and 5 (figure 3 L, N, O). Little is known about the function of TRPM2
during development. Therefore, it is striking that we found trpm2 transcripts primarily in
sensory placodes of embryonic and larval zebrafish. The function of TRPM2 in the
developing embryo is an interesting subject for future studies. As TRPM2 belongs to
the thermosensitive TRP channels and is best known for its involvement in the
oxidative stress response and consequent cell death (Hara et al., 2002; Zhang, 2003;
Takahashi et al., 2011) as well as in synaptic plasticity of hippocampal neurons (Olah
et al., 2009; Xie et al., 2011) it will be interesting to analyze TRPM2 functions in the
described zebrafish expression domains.
Page 8 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
9
Expression of trpm3:
Expression of human TRPM3 is known to be highly enriched in kidney compared to
lower expression in brain, spinal cord and testis (Grimm et al., 2003; Lee et al., 2003).
Surprisingly, RT-PCR and Northern blot analyses in mouse showed high expression in
various brain areas, such as the telencephalon, cerebellum, basal ganglia, choroid
plexus and hippocampus but comparatively low expression in kidney and other organs.
However, distinct mouse strains showed significant differences in their expression
levels of TRPM3 in the telencephalon (Oberwinkler et al., 2005; Kunert-Keil et al.,
2006). The zebrafish ortholog of the TRPM3 gene is found to be expressed by a subset
of neural crest cells at 24 hpf (figure 4 A-C). Compared to trpm1a expression, trpm3 is
expressed only by cranial NC cells and in a dorsal longitudinal stripe along the
embryonic trunk and tail (compare figure 2 A-B with 4 A-B). Additionally, expression is
also present in the habenula (Ha) and lens tissue (L; figure 4 A). Comparable to trpm1a
expression in NC and CMZ, a dotted staining was also observed in NC and lens cells
expressing trpm3, but with one single dot per cell (see cranial NC cells in figure 4 C).
Whereas NC cell expression ceases after 24 hpf, expression in the lens and habenula
is retained over all stages observed. From 48 hpf onwards, more and more neurons of
the central nervous system (CNS) start gene expression of this TRPM channel. We
observed expression in the epiphysis (E) and dorsal thalamus (DT), together with a
rather broad expression in the hindbrain (Hb) at 48 hpf (figure 4 D, E). Moreover, lens
expression of trpm3 becomes restricted to the lens epithelial (LEp) layer (figure 4 F).
CNS expression gets more pronounced over development. While expression in the
epiphysis seems to be lost after 3 dpf, we found additional trpm3 staining in the optic
tectum (TeO) and choroid plexus (CP; figure 4 G-L). Finally, larvae show expression in
a subset of ganglion cells of the retina at 5 dpf (GCL, figure 4 M). It is noteworthy that
the expression pattern of trpm3 partially overlaps with the expression pattern of
mglur6a, which was found in the retinal ganglion cell layer, habenula, optic tectum and
Page 9 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
10
thalamus as well (Haug et al., 2013). This suggests the possibility that a similar
glutamate signaling pathway as described for ON bipolar cells may be active in these
neurons as well. Moreover, a recent study showed the localization of TRPM3 in
Purkinje cells of the neonatal rat cerebellar cortex and its capability to enhance
glutamatergic transmission (Zamudio-Bulcock et al., 2011). These findings suggest a
role of TRPM3 in synapse refinement during development.
Expression of trpm4 genes:
TRPM4 is one of the two TRP channels that is selective for monovalent cations and
activated by high intracellular Ca2+ levels. In humans the channel is predominantly
expressed in skeletal muscles and inner organs, including heart, kidney, liver and
pancreas (Launay et al., 2002). A similar distribution of trpm4 mRNA was observed in
mice (Kunert-Keil et al., 2006). The zebrafish ortholog trpm4a was found to be
expressed only in three distinct domains. WISH analysis of trpm4a revealed expression
to be restricted to the cloaca of the pronephros in embryos 24 hpf (figure 5 A, B). By 48
hpf, the pharyngeal ectoderm (PEc) starts to express trpm4a, but this expression is lost
again at larval stages analyzed. However, cloacal expression is sustained until at least
5 dpf (figure 5 D, F, H), with expression even expanding into the caudal part of the
pronephros (figure 5 H). Additionally, we located trpm4a transcripts in the intestinal
bulb from 3 dpf onwards (figure 5 E, G).
This comparatively restricted expression is in contrast to the other three trpm4
paralogs, which show a broader expression pattern. As every probe for trpm4bs gave
identical results it seems likely that our probes used for the trpm4b variants are unable
to discriminate between the three different transcripts. Since the 3’ untranslated regions
(UTRs) of trpm4b genes show very high conservation, we designed probes for the less
conserved 5’ UTRs. Unfortunately, these probes proved unable to detect expression,
probably due to their rather short length (see table 2). Therefore, we can not determine
whether transcripts of a particular trpm4b gene is present only in a subset of the
Page 10 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
11
domains stained with the long trpm4b probes or is not expressed at all. Initial
expression at 24 hpf is visible in the olfactory, pronephric and lateral line systems.
More specifically, expression is detectable in olfactory sensory neurons (figure 5 J) and
the pronephric cloaca (figure 5 M). At 24 hpf weak expression is also seen in the lateral
line primordium (LLP), and stronger expression can be detected in the newly formed
neuromast cells (LLN; figure 5 K, L). Although expression in olfactory sensory neurons
and neuromasts seems to decrease after 3 dpf, we could observe WISH staining in
these cells at all stages analyzed (figure 5 N-V). From embryonic stage 48 hpf until at
least 4 dpf, transcripts for trpm4bs can be seen in cells of the pharyngeal ectoderm
(figure 5 O, P). The gill ectoderm (GEc) also shows expression as soon as gill
development started (figure 5 R, V). Last but not least, we observed yet another
expression domain in the intestinal bulb of 5 dpf larvae (IB; figure 5 W), comparable to
the expression of trpm4a at this stage.
Expression of trpm4s in cloaca, intestine, pharynx and gill ectoderm points to a role in
ion homeostasis or osmoregulation. Moreover, expression of TRPM4 in the murine
accessory olfactory system (AOS) has been described recently and seems to be at
least partially responsible for the sustained response of neurons (Shpak et al., 2012).
The mammalian and reptile accessory olfactory system is considered to be involved in
the fluid based chemosensation in contrast to the main olfactory system, which detects
volatile substances. Therefore it is reasonable to expect a conserved TRPM expression
pattern of teleost olfactory neurons and mammalian AOS neurons. In addition to a
possible role in chemosensation, TRPM4b channels in the lateral line system could
account for the transduction of mechanical stimuli as specialized hair cells in the lateral
line neuromasts are able to detect water movements and vibrations comparable to hair
cells in the mammalian inner ear.
Expression of trpm5:
Page 11 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
12
The expression of zebrafish trpm5 in juvenile zebrafish aged approximately 2 months
has already been described by Yoshida et al., 2007. In this study they demonstrated
expression in taste bud cells located on the lips, barbels, and headskin as well as in the
mouth cavity, gill rakers, and pharynx. In contrast to their experiments, we analyzed
trpm5 expression in the whole animal at earlier developmental stages. However, no
transcripts of trpm5 were detected at 24 and 48 hpf, respectively. In accordance with
Yoshida et al., 2007, we could confirm expression of trpm5 in taste bud cells of the
pharynx and gills to be present already at larval stages 3 and 5 dpf (figure 6 A-F) but
not in any other tissue. TRPM5 expression in taste receptor cells as well as its function
in the transduction of different taste stimuli is well established. This channel is activated
upon ligand binding to G-protein coupled receptors of the taste receptor T1R and T2R
families and mediate perception of sweet, umami and bitter taste (Pérez et al., 2002;
Zhang et al., 2003; Damak et al., 2006). Their additional thermosensitivity is proposed
to modulate taste reception dependent on temperature (Talavera et al., 2005). Our
expression analysis together with the data of Yoshida et al., 2007, suggests a
conservation of TRPM5 in the transduction of taste stimuli among vertebrate species.
Expression of trpm7:
TRPM7 is the best studied member of the zebrafish TRPM family so far. Its expression
has been described as rather ubiquitous with stronger expression in lens sensory
placodes, ionocytes, epiphysis, pharynx, pronephros, and Rohon-Beard neurons
between 24 – 55 hpf (Thisse, 2001; Hsiao et al., 2007; Low et al., 2011). Another study
described expression of this ion channel in liver, kidney tubules and corpuscules of
Stannis in metamorphic larvae 14 dpf (Elizondo et al., 2005). Our observations are in
line with these data (figure 7 A-F), although expression in the spinal cord is very weak.
We extended the expression analysis during development to early larval stages (figure
7 G-M). TRPM7 is a well established marker for the pronephric proximal straight tubule
(PST) in zebrafish embryos (Wingert et al., 2007); however larvae show an extension
Page 12 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
13
of the expression into the proximal convoluted tubule (PCT) at 5 dpf (figure 7 K-L).
Additionally, we observed trpm7 transcripts above the heart (arrowhead in figure 7 E)
and in two bilateral spots caudal to the pharynx (arrowheads in figure 7 G-H).
Some zebrafish lines carrying different mutations of the gene have been isolated in
genetic screens for pigmentation, pancreas development or locomotion deficiencies
(Granato et al., 1996; Kelsh et al., 1996; Arduini and Henion, 2004; Low et al., 2011;
Yee et al., 2011). Loss of TRPM7 usually leads to lethality between 14 and 16 dpf.
Nevertheless, one semi-viable allele was identified enabling phenotypic description into
adulthood. These fish showed kidney stone formation accompanied by severe
dwarfism due to massive disruption of bone ossification, indicative of the important role
of TRPM7 in calcium and magnesium homeostasis (Cornell et al., 2004; Elizondo et al.,
2005; Elizondo et al., 2010). Larval trpm7 mutants show hypopigmentation due to a
failure in melanoblast development (Arduini and Henion, 2004; Cornell et al., 2004;
McNeill et al., 2007). Moreover, trpm7 mutants become unresponsive in escape
response tests assessing mobility at 39 hpf but recover completely after 72 hpf. The
transgenic expression of trpm7 in mechanosensitive Rohon-Beard cells of mutant
larvae could rescue this behavioral phenotype, but the transiently required role of the
cation channel in the sensory neurons is not yet clarified (Low et al., 2011). The
expression pattern of TRPM7 indicates the pivotal role of the channel in ion
homeostasis, and it seems possible that all observed phenotypes of trpm7 mutants rely
on this function.
Taken together our phylogenetic and expression analyses of the TRPM family of ion
channels in zebrafish open the way for further studies on their function. As expression
was found in diverse organs and tissues, including excitable and non-excitable cells,
we expect TRPM channels to be implicated in a multitude of processes. We
concentrated on expression during embryonic and larval stages and found transcripts
in variegated cell clusters of the central and peripheral nervous system. It will be
interesting to investigate trpm genes expressed in neural cells during development and
Page 13 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
14
elucidate their role in neural differentiation and proliferation, axon guidance, or synaptic
plasticity. Another interesting aspect is expression of TRPM channels in cells involved
in metabolism and homeostasis, such as the kidney, intestine, and gills. The zebrafish
offers a broad variety of genetic and behavioral tools to assess the function of TRPM
channels in vivo. And a better understanding of their physiological functions may
provide further insight into disease mechanisms and support the development of
therapies.
Experimental Procedures:
Fish maintenance:
Zebrafish breeding and maintenance were carried out under standard conditions (26-
28°C, 14h light/10h dark) according to Westerfield, 2007. The wildtype WIK line was
used for all experiments described here. Pigmentation of embryos was avoided by
incubating them in 0.2 mM 1-phenyl-2 thiourea (Sigma).
Annotation of trpm cDNAs
As automated gene predictions within GenBank are subjected to putative annotation
errors, trpm cDNA sequences used in this study were annotated manually. Annotations
were done based on combined information obtained from expressed sequence tags
and genome databases (GeneBank, http://www.ncbi.nlm.nih.gov; Ensembl,
http://www.ensembl.org/index.html). Human and mouse sequences were used as initial
query (for more details on sequence annotation see Gesemann et al., 2010).
Phylogenetic and synteny analyses:
The phylogenetic analysis was performed on the Phylogeny.fr platform
(http://www.phylogeny.fr/) as described previously (Gesemann et al., 2010; Haug et al.,
2013). In brief, sequences alignment was done using MUSCLE. Input sequence length
varied between 1104 and 2028 amino acids. Ambiguous regions were removed using
Gblocks and 438 conserved amino acids were used to reconstruct a maximum
Page 14 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
15
likelihood tree. Branch liability was assessed using the aLRT test and svg tree file were
imported into CoralDraw (version X5; Coral Corporation Ottawa, Canada) for final
editing.
Cloning and sequencing of trpm genes:
Total RNA was extracted from a pool of 5 dpf wild-type zebrafish embryos using the
Macherey-Nagel NucleoSpin® RNA II kit. cDNA was subsequently generated
according to the manual of the Invitrogen SuperScript™ II RT-PCR kit. Fragments of
the respective trpm genes were amplified by means of polymerase chain reaction,
cloned into the pCR®II-TOPO vector following the TOPO TA Cloning® instruction
manual and eventually sequenced. If necessary and possible 5’ rapid amplification of
cDNA ends was performed using the Invitrogen 5’ RACE System Version 2.0 in order
to obtain cDNA fragments comprising the start codon. The sequences of all 11 genes
were submitted to GenBank under the following accession numbers: trpm1a
KF305305, trpm1b KF305306, trpm2 KF305307, trpm3 KF305308, trpm4a KF305309,
trpm4b1 KF305310, trpm4b2 KF305311, trpm4b3 KF305312, trpm5 KF305313, trpm6
KF305314, and trpm7 KF305315. The oligonucleotides listed in table 2 were used for
amplification of cDNA fragments used for in situ hybridization analyses.
Probe synthesis and whole mount in situ hybridization:
Preparation of RNA probes and expression analyses with alkaline phosphatase-based
color reaction was performed as described previously (Hauptmann and Gerster, 2000)
with the following adaptations. The RNA probe was recovered by lithium chloride
precipitation. The duration of Proteinase K treatment was 60 min and 90 min for larvae
fixed 3 and 5 dpf, respectively. Hybridization was performed overnight at 65°C. The
anti-digoxigenin antibody (Roche #11093274910) was diluted at 1:5000 with 1% Roche
blocking reagent (Roche #11096176001) in TNT buffer (100mM Tris-HCL pH7.5, 150
mM NaCl, 0.5% Tween20). Washing steps after antibody incubation were also done
Page 15 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
16
with TNT buffer. 2 mM levamisole hydrochloride (Sigma L9756) was added to the
staining buffer in order to prevent unspecific staining by endogenous alkaline
phosphatase.
Imaging:
Embryos were embedded in glycerol. Images were captured using a ColorView IIIu
camera and an Olympus BX61 widefield microscope. Levels of pictures were adjusted
and figures were assembled using Adobe Photoshop software.
Acknowledgments:
We thank Kara Dannenhauer for excellent technical assistance and zebrafish care, as
well as Andreas Stäuble for help in cloning trpm4 genes.
References:
Appel B, Korzh V, Glasgow E, Thor S, Edlund T, Dawid IB, Eisen JS. 1995. Motoneuron
fate specification revealed by patterned LIM homeobox gene expression in
embryonic zebrafish. Development 121:4117–4125.
Arduini BL, Henion PD. 2004. Melanophore sublineage-specific requirement for
zebrafish touchtone during neural crest development. Mech Dev 121:1353–1364.
Audo I, Kohl S, Leroy BP, Munier FL, Guillonneau X, Mohand-Saïd S, Bujakowska K,
Nandrot EF, Lorenz B, Preising M et al. 2009. TRPM1 Is Mutated in Patients with
Autosomal-Recessive Complete Congenital Stationary Night Blindness. The
American Journal of Human Genetics 85:720–729.
Clapham DE, Runnels LW, Strubing C. 2001. The TRP ion channel family. Nat Rev
Neurosci 2:387–396.
Cornell RA, Yemm E, Bonde G, Li W, d'Alencon C, Wegman L, Eisen J, Zahs A. 2004.
Touchtone promotes survival of embryonic melanophores in zebrafish. Mech Dev
121:1365–1376.
Page 16 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
17
Dadon D, Minke B. 2010. Cellular functions of Transient Receptor Potential channels.
The International Journal of Biochemistry & Cell Biology 42:1430–1445.
Damak S, Rong M, Yasumatsu K, Kokrashvili Z, Perez CA, Shigemura N, Yoshida R,
Mosinger B, JR, Glendinning JI, Ninomiya Y et al. 2006. Trpm5 null mice respond to
bitter, sweet, and umami compounds. Chem Senses 31:253–264.
Damann N, Voets T, Nilius B. 2008. TRPs in our senses. Curr Biol 18:R880-9.
Devi S, Kedlaya R, Maddodi N, Bhat KMR, Weber CS, Valdivia H, Setaluri V. 2009.
Calcium homeostasis in human melanocytes: role of transient receptor potential
melastatin 1 (TRPM1) and its regulation by ultraviolet light. AJP: Cell Physiology
297:C679.
Dietrich A, Gudermann T. 2011. TRP channels in the cardiopulmonary vasculature. Adv
Exp Med Biol 704:781–810.
Duncan LM, Deeds J, Hunter J, Shao J, Holmgren LM, Woolf EA, Tepper RI, Shyjan
AW. 1998. Down-regulation of the novel gene melastatin correlates with potential
for melanoma metastasis. Cancer Res 58:1515–1520.
Elizondo MR, Arduini BL, Paulsen J, MacDonald EL, Sabel JL, Henion PD, Cornell RA,
Parichy DM. 2005. Defective skeletogenesis with kidney stone formation in dwarf
zebrafish mutant for trpm7. Curr Biol 15:667–671.
Elizondo MR, Budi EH, Parichy DM. 2010. trpm7 regulation of in vivo cation
homeostasis and kidney function involves stanniocalcin 1 and fgf23. Endocrinology
151:5700–5709.
Fiorio Pla A, Maric D, Brazer S, Giacobini P, Liu X, Chang YH, Ambudkar IS, Barker JL.
2005. Canonical transient receptor potential 1 plays a role in basic fibroblast growth
factor (bFGF)/FGF receptor-1-induced Ca2+ entry and embryonic rat neural stem
cell proliferation. J Neurosci 25:2687–2701.
Gesemann M, Lesslauer A, Maurer CM, Schönthaler HB, Neuhauss SCF. 2010.
Phylogenetic analysis of the vertebrate Excitatory/Neutral Amino Acid Transporter
(SLC1/EAAT) family reveals lineage specific subfamilies. BMC Evol Biol 10:117.
Page 17 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
18
Granato M, van Eeden FJ, Schach U, Trowe T, Brand M, Furutani-Seiki M, Haffter P,
Hammerschmidt M, Heisenberg CP, Jiang YJ et al. 1996. Genes controlling and
mediating locomotion behavior of the zebrafish embryo and larva. Development
123:399–413.
Grimm C, Kraft R, Sauerbruch S, Schultz G, Harteneck C. 2003. Molecular and
Functional Characterization of the Melastatin-related Cation Channel TRPM3.
Journal of Biological Chemistry 278:21493–21501.
Guinamard R, Salle L, Simard C. 2011. The non-selective monovalent cationic
channels TRPM4 and TRPM5. Adv Exp Med Biol 704:147–171.
Hara Y, Wakamori M, Ishii M, Maeno E, Nishida M, Yoshida T, Yamada H, Shimizu S,
Mori E, Kudoh J et al. 2002. LTRPC2 Ca2+-permeable channel activated by
changes in redox status confers susceptibility to cell death. Mol Cell 9:163–173.
Hardie RC, Minke B. 1992. The trp gene is essential for a light-activated Ca2+ channel
in Drosophila photoreceptors. Neuron 8:643–651.
Haug MF, Gesemann M, Mueller T, Neuhauss SC. 2013. Phylogeny and expression
divergence of metabotropic glutamate receptor genes in the brain of zebrafish
(Danio rerio ). J. Comp. Neurol. 521:1533–1560.
Hauptmann G, Gerster T. 2000. Multicolor whole-mount in situ hybridization. Methods
Mol Biol 137:139–148.
Hsiao C, You M, Guh Y, Ma M, Jiang Y, Hwang P. 2007. A positive regulatory loop
between foxi3a and foxi3b is essential for specification and differentiation of
zebrafish epidermal ionocytes. PLoS One 2:e302.
Huang P, Zhu Z, Lin S, Zhang B. 2012. Reverse genetic approaches in zebrafish. J
Genet Genomics 39:421–433.
Inoue A, Takahashi M, Hatta K, Hotta Y, Okamoto H. 1994. Developmental regulation of
islet-1 mRNA expression during neuronal differentiation in embryonic zebrafish. Dev
Dyn 199:1–11.
Page 18 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
19
Kelsh RN, Brand M, Jiang YJ, Heisenberg CP, Lin S, Haffter P, Odenthal J, Mullins MC,
van Eeden FJ, Furutani-Seiki M et al. 1996. Zebrafish pigmentation mutations and
the processes of neural crest development. Development 123:369–389.
Kelsh RN, Schmid B, Eisen JS. 2000. Genetic analysis of melanophore development in
zebrafish embryos. Dev Biol 225:277–293.
Klooster J, Blokker J, Brink JB ten, Unmehopa U, Fluiter K, Bergen AAB, Kamermans
M. 2011. Ultrastructural Localization and Expression of TRPM1 in the Human
Retina. Investigative Ophthalmology & Visual Science 52:8356–8362.
Koike C, Obara T, Uriu Y, Numata T, Sanuki R, Miyata K, Koyasu T, Ueno S, Funabiki
K, Tani A et al. 2010. TRPM1 is a component of the retinal ON bipolar cell
transduction channel in the mGluR6 cascade. Proceedings of the National
Academy of Sciences 107:332–337.
Kunert-Keil C, Bisping F, Krüger J, Brinkmeier H. 2006. Tissue-specific expression of
TRP channel genes in the mouse and its variation in three different mouse strains.
BMC Genomics 7:159.
Launay P, Fleig A, Perraud AL, Scharenberg AM, Penner R, Kinet JP. 2002. TRPM4 is
a Ca2+-activated nonselective cation channel mediating cell membrane
depolarization. Cell 109:397–407.
Lee N, Chen J, Sun L, Wu S, Gray KR, Rich A, Huang M, Lin J, Feder JN, Janovitz E et
al. 2003. Expression and Characterization of Human Transient Receptor Potential
Melastatin 3 (hTRPM3). Journal of Biological Chemistry 278:20890–20897.
Li M, Chen C, Zhou Z, Xu S, Yu Z. 2012. A TRPC1-mediated increase in store-operated
Ca2+ entry is required for the proliferation of adult hippocampal neural progenitor
cells. Cell Calcium 51:486–496.
Lister JA, Robertson CP, Lepage T, Johnson SL, Raible DW. 1999. nacre encodes a
zebrafish microphthalmia-related protein that regulates neural-crest-derived
pigment cell fate. Development 126:3757–3767.
Page 19 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
20
Li Z, Sergouniotis PI, Michaelides M, Mackay DS, Wright GA, Devery S, Moore AT,
Holder GE, Robson AG, Webster AR. 2009. Recessive Mutations of the Gene
TRPM1 Abrogate ON Bipolar Cell Function and Cause Complete Congenital
Stationary Night Blindness in Humans. The American Journal of Human Genetics
85:711–719.
Low SE, Amburgey K, Horstick E, Linsley J, Sprague SM, Cui WW, Zhou W, Hirata H,
Saint-Amant L, Hume RI et al. 2011. TRPM7 is required within zebrafish sensory
neurons for the activation of touch-evoked escape behaviors. J Neurosci 31:11633–
11644.
McKemy DD, Neuhausser WM, Julius D. 2002. Identification of a cold receptor reveals
a general role for TRP channels in thermosensation. Nature 416:52–58.
McNeill MS, Paulsen J, Bonde G, Burnight E, Hsu M, Cornell RA. 2007. Cell death of
melanophores in zebrafish trpm7 mutant embryos depends on melanin synthesis. J
Invest Dermatol 127:2020–2030.
Miller AJ, Du J, Rowan S, Hershey CL, Widlund HR, Fisher DE. 2004. Transcriptional
regulation of the melanoma prognostic marker melastatin (TRPM1) by MITF in
melanocytes and melanoma. Cancer Res 64:509–516.
Montell C. 2005. The TRP superfamily of cation channels. Sci STKE 2005:re3.
Montell C, Rubin GM. 1989. Molecular characterization of the drosophila trp locus: A
putative integral membrane protein required for phototransduction. Neuron 2:1313–
1323.
Morgans CW, Zhang J, Jeffrey BG, Nelson SM, Burke NS, Duvoisin RM, Brown RL.
2009. TRPM1 is required for the depolarizing light response in retinal ON-bipolar
cells. Proc Natl Acad Sci U S A 106:19174–19178.
Nilius B, Owsianik G. 2011. The transient receptor potential family of ion channels.
Genome Biol 12:218.
Page 20 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
21
Oberwinkler J, Lis A, Giehl KM, Flockerzi V, Philipp SE. 2005. Alternative splicing
switches the divalent cation selectivity of TRPM3 channels. J Biol Chem
280:22540–22548.
Olah ME, Jackson MF, Li H, Perez Y, Sun H, Kiyonaka S, Mori Y, Tymianski M,
MacDonald JF. 2009. Ca2+-dependent induction of TRPM2 currents in hippocampal
neurons. The Journal of Physiology 587:965–979.
Paez PM, Fulton D, Spreuer V, Handley V, Campagnoni AT. 2011. Modulation of
Canonical Transient Receptor Potential Channel 1 in the Proliferation of
Oligodendrocyte Precursor Cells by the Golli Products of the Myelin Basic Protein
Gene. Journal of Neuroscience 31:3625–3637.
Peier AM, Moqrich A, Hergarden AC, Reeve AJ, Andersson DA, Story GM, Earley TJ,
Dragoni I, McIntyre P, Bevan S. 2002. A TRP Channel that Senses Cold Stimuli and
Menthol. Cell 108:705–715.
Pérez CA, Huang L, Rong M, Kozak JA, Preuss AK, Zhang H, Max M, Margolskee RF.
2002. A transient receptor potential channel expressed in taste receptor cells. Nat
Neurosci 5:1169–1176.
Perraud AL, Fleig A, Dunn CA, Bagley LA, Launay P, Schmitz C, Stokes AJ, Zhu Q,
Bessman MJ, Penner R et al. 2001. ADP-ribose gating of the calcium-permeable
LTRPC2 channel revealed by Nudix motif homology. Nature 411:595–599.
Runnels LW. 2011. TRPM6 and TRPM7: A Mul-TRP-PLIK-cation of channel functions.
Curr Pharm Biotechnol 12:42–53.
Saito S, Shingai R. 2006. Evolution of thermoTRP ion channel homologs in
vertebrates. Physiol Genomics 27:219–230.
Santoni G, Farfariello V, Amantini C. 2011. TRPV channels in tumor growth and
progression. Adv Exp Med Biol 704:947–967.
Schlingmann KP, Weber S, Peters M, Niemann Nejsum L, Vitzthum H, Klingel K, Kratz
M, Haddad E, Ristoff E, Dinour D et al. 2002. Hypomagnesemia with secondary
Page 21 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
22
hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene
family. Nat Genet 31:166–170.
Shen Y, Heimel JA, Kamermans M, Peachey NS, Gregg RG, Nawy S. 2009. A transient
receptor potential-like channel mediates synaptic transmission in rod bipolar cells. J
Neurosci 29:6088–6093.
Shin HY, Hong YH, Jang SS, Chae HG, Paek SL, Moon HE, Kim DG, Kim J, Paek SH,
Kim SJ et al. 2010. A Role of Canonical Transient Receptor Potential 5 Channel in
Neuronal Differentiation from A2B5 Neural Progenitor Cells. PLoS ONE 5:e10359.
Shpak G, Zylbertal A, Yarom Y, Wagner S. 2012. Calcium-Activated Sustained Firing
Responses Distinguish Accessory from Main Olfactory Bulb Mitral Cells. Journal of
Neuroscience 32:6251–6262.
Sugano Y, Neuhauss SCF. 2013. Reverse genetics tools in zebrafish: A forward dive
into endocrinology. Gen Comp Endocrinol.
Sumoza-Toledo A, Penner R. 2011. TRPM2: a multifunctional ion channel for calcium
signalling. The Journal of Physiology 589:1515–1525.
Takahashi N, Kozai D, Kobayashi R, Ebert M, Mori Y. 2011. Roles of TRPM2 in
oxidative stress. Cell Calcium 50:279–287.
Talavera K, Yasumatsu K, Voets T, Droogmans G, Shigemura N, Ninomiya Y,
Margolskee RF, Nilius B. 2005. Heat activation of TRPM5 underlies thermal
sensitivity of sweet taste. Nature 438:1022–1025.
Thisse, B., Pflumio, S., Furthauer, M., Loppin, B., Heyer, V., Degrave, A., Woehl, R.,
Lux, A., Steffan, T., Charbonnier, X.Q. and Thisse, C. 2001. Expression of the
zebrafish genome during embryogenesis (NIH R01 RR15402). ZFIN Direct Data
Submission (http://zfin.org).
Tokumoto M, Gong Z, Tsubokawa T, Hew CL, Uyemura K, Hotta Y, Okamoto H. 1995.
Molecular heterogeneity among primary motoneurons and within myotomes
revealed by the differential mRNA expression of novel islet-1 homologs in
embryonic zebrafish. Dev Biol 171:578–589.
Page 22 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
23
van Genderen MM, Bijveld MM, Claassen YB, Florijn RJ, Pearring JN, Meire FM,
McCall MA, Riemslag FC, Gregg RG, Bergen AA et al. 2009. Mutations in TRPM1
Are a Common Cause of Complete Congenital Stationary Night Blindness. The
American Journal of Human Genetics 85:730–736.
Venkatachalam K, Montell C. 2007. TRP channels. Annu Rev Biochem 76:387–417.
Vennekens R, Menigoz A, Nilius B. 2012. TRPs in the Brain. Rev Physiol Biochem
Pharmacol 163:27–64.
Voets T, Talavera K, Owsianik G, Nilius B. 2005. Sensing with TRP channels. Nat Chem
Biol 1:85–92.
Walder RY, Landau D, Meyer P, Shalev H, Tsolia M, Borochowitz Z, Boettger MB, Beck
GE, Englehardt RK, Carmi R et al. 2002. Mutation of TRPM6 causes familial
hypomagnesemia with secondary hypocalcemia. Nat Genet 31:171–174.
Westerfield M. 2007. The zebrafish book: A guide for the laboratory use of zebrafish
(Danio rerio). 5th ed. Eugene: University of Oregon Press.
Wingert RA, Selleck R, Yu J, Song H, Chen Z, Song A, Zhou Y, Thisse B, Thisse C,
McMahon AP et al. 2007. The cdx genes and retinoic acid control the positioning
and segmentation of the zebrafish pronephros. PLoS Genet 3:1922–1938.
Woods IG, Wilson C, Friedlander B, Chang P, Reyes DK, Nix R, Kelly PD, Chu F,
Postlethwait JH, Talbot WS. 2005. The zebrafish gene map defines ancestral
vertebrate chromosomes. Genome Res 15:1307–1314.
Woudenberg-Vrenken TE, Bindels RJM, Hoenderop JGJ. 2009. The role of transient
receptor potential channels in kidney disease. Nat Rev Nephrol 5:441–449.
Xie Y, Belrose JC, Lei G, Tymianski M, Mori Y, MacDonald JF, Jackson MF. 2011.
Dependence of NMDA/GSK-3β Mediated Metaplasticity on TRPM2 Channels at
Hippocampal CA3-CA1 Synapses. Mol Brain 4:44.
Yee NS, Zhou W, Liang I. 2011. Transient receptor potential ion channel Trpm7
regulates exocrine pancreatic epithelial proliferation by Mg2+-sensitive Socs3a
signaling in development and cancer. Dis Model Mech 4:240–254.
Page 23 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
24
Yoshida Y, Saitoh K, Aihara Y, Okada S, Misaka T, Abe K. 2007. Transient receptor
potential channel M5 and phospholipaseC-beta2 colocalizing in zebrafish taste
receptor cells. Neuroreport 18:1517–1520.
Zamudio-Bulcock PA, Everett J, Harteneck C, Valenzuela CF. 2011. Activation of
steroid-sensitive TRPM3 channels potentiates glutamatergic transmission at
cerebellar Purkinje neurons from developing rats. J Neurochem 119:474–485.
Zhang W. 2003. A Novel TRPM2 Isoform Inhibits Calcium Influx and Susceptibility to
Cell Death. Journal of Biological Chemistry 278:16222–16229.
Zhang Y, Hoon MA, Chandrashekar J, Mueller KL, Cook B, Wu D, Zuker CS, Ryba
NJP. 2003. Coding of Sweet, Bitter, and Umami Tastes: Different Receptor Cells
Sharing Similar Signaling Pathways. Cell 112:293–301.
Figure Legends:
Figure 1:
Origin, conservation and phylogenetic relation of zebrafish TRPM channels. (A)
Phylogenetic relations between TRPM channels from human, mouse and zebrafish.
Zebrafish (dr) TRPMs are shown in red, human (hs) TRPMs are depicted in dark gray
and mouse (mm) TRPMs are given in light gray. The tree was rooted using the
zebrafish TRPN1 channel as an outgroup. (B) Identity and conservation within the
trpm4 subgroup. The four zebrafish TRPM4 sequences were compared with each other
and with the corresponding orthologs of mouse and human. The first line represents
the amino acid comparison (bold = identical, in parentheses = conserved), whereas the
second line gives identities on nucleotide level. While zebrafish TRPM4s resulting from
tandem duplication events are highlighted in dark red, homologies between human and
mouse TRPM4s are pointed out in orange. (C) Synteny of the zebrafish trpm4 genes.
Genes flanking the trpm4 genes on the zebrafish chromosomes 3 and 12 are shown in
the central part of the figure. Zebrafish chromosomes 3 and 12, harboring the trpm4
Page 24 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
25
genes, have been previously reported to derive from a common protochromosome
(Woods et al., 2005). Note that the genes depicted here have their counterparts on
human chromosomes 10 (q23.33), 16 (p11.2, p12.3 and p13.3) 17, and 19 (q13.42)
and that several genes found in close proximity to the human trpm4 gene (e.g. PRR12
or BRSK1) have corresponding representatives on both zebrafish chromosomes. The
additional zebrafish trpm4 genes on chromosome 12 most likely originated by tandem
duplication and partial chromosome inversions of the original trpm4 duplicate leading to
two additional trpm4 genes in zebrafish.
Figure 2:
Expression of trpm1 channel genes, trpm1a and trpm1b, shown in whole-mount during
zebrafish development. A-K: trpm1a expression with A-C: lateral (A, C) and dorsal (B)
views of embryos 24 hpf, of which C shows dorsal and lateral NC cells of the tail in
higher magnification; D-F: dorsal (D-E) and lateral (F) views of embryos staged 48 hpf;
G-H: 3 dpf larvae shown from the ventral side; J-K: ventral (J) and lateral (K) views of
larvae staged 5 dpf. L-R: trpm1b expression with L: dorsal view of embryos 24 hpf; M-
N: embryos staged 48 hpf shown from the dorsal side; O-P: ventral (O) and lateral (P)
views of larvae 3 dpf; Q-R: ventral (Q) and lateral (R) views of larvae 5dpf. Zebrafish
are orientated with anterior to the left in all pictures but G, J, O, and Q, where anterior
is to the top. Scale bars of 100 µm are indicated in the first picture of a series until
changed. Scale bar in C refers to 25 µm. Abbreviations: NC = neural crest; Mel =
melanoblast / -cyte; CMZ = ciliary marginal zone; INL = inner nuclear layer; RPE =
retinal pigment epithelium.
Figure 3:
Dynamic expression pattern of trpm2 during zebrafish development, shown in whole-
mount views. A-C: dorsal (A-B) and lateral (C) views of embryos 24 hpf; D-H: ventral
(D-F) and lateral (G-H) views of embryos staged 48 hpf; J-M: 3 dpf larvae shown from
the dorsal (J), ventral (K) and lateral (L-M) side, respectively; N-P: ventral (N), lateral
Page 25 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
26
(O), and frontal (P) views of larvae staged 5 dpf. Orientation of zebrafish is with anterior
to the left in all pictures but P showing a frontal view. Scale bars of 100 µm are
indicated in the first picture of a series until changed. Abbreviations: L = lens; Mn =
motoneurons; OSN = olfactory sensory neurons; TG = trigeminal ganglia; PLG =
posterior lateral line ganglia; Hb = hindbrain; ONH = optic nerve head; CSG = cranial
sensory ganglia.
Figure 4:
Expression of trpm3 in whole-mount zebrafish during embryonic and larval stages. A-
C: lateral (A, A’, C) and dorsal (B) views of embryos 24 hpf with (A’) showing staining in
NC cells of the tail and (C) providing a higher magnification of trpm3 expression in
cranial NC cells; D-F: lateral (D, F) and dorsal (E) views of embryos staged 48 hpf; G-
J: 3 dpf larvae shown from the dorsal (G-H) and lateral (J) side, respectively; K-M:
lateral (K), dorsal (L), and ventral (M) views of larvae staged 5 dpf. Zebrafish are
orientated with anterior to the left in all pictures but M, where anterior is to the top.
Scale bars of 100 µm are indicated in the first picture of a series until changed. Scale
bar in C refers to 25 µm. Abbreviations: NC = neural crest; Ha = habenula; E =
epiphysis; DT = dorsal thalamus; Nhp = neurohypophysis; Hb = hindbrain; LEp = lens
epithelium; TeO = optic tectum; CP = choroid plexus; GCL = ganglion cell layer.
Figure 5:
Expression of trpm4 channel genes, trpm4a and trpm4b1, shown in whole-mount
during zebrafish development. Expression pattern of both, trpm4b2 and trpm4b3 are
identical to trpm4b1. A-K: trpm4a expression with A-B: lateral (A) and ventral (B) views
of embryos 24 hpf; C-D: lateral views of embryos staged 48 hpf; E-F: 3 dpf larvae
shown laterally; G-H: lateral views of larvae staged 5 dpf. J-W: Expression of trpm4bs
with J-M: dorsal (J-K) and lateral (L-M) views of embryos 24 hpf; N-P: embryos staged
48 hpf shown from the lateral (N, P) and ventral (O) side; Q-T: lateral (Q, S-T) and
Page 26 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
27
ventral (R) views of larvae 3 dpf; U-W: lateral (U) and ventral (V-W)) views of larvae
5dpf. Zebrafish are orientated with anterior to the left. Scale bars of 100 µm are
indicated in the first picture of a series until changed. Abbreviations: Cl = cloaca; PEc
= pharynx ectoderm; IB = intestinal bulb; OSN = olfactory sensory neurons; LLN =
lateral line neuromast; LLP = lateral line primordium; GEc = gill ectoderm.
Figure 6:
Expression of trpm5 in taste bud cells during zebrafish development. A-C: lateral (A)
and ventral (B-C) whole-mount views of larvae 3 dpf; D-F: lateral (D) and ventral (E-F)
whole-mount views of larvae staged 5 dpf, with anterior to the left in all pictures. Scale
bars of 100 µm are indicated in A for all pictures shown. Abbreviations: PTB =
pharynx taste bud; GTB = gill taste bud.
Figure 7:
Expression of trpm7 in whole-mount zebrafish during embryonic and larval stages. A-
C: dorsal (A), lateral (B), and ventral (C) views of embryos 24 hpf; D-F: lateral views of
embryos staged 48 hpf; G-J: 3 dpf larvae shown from lateral (G) and ventral (H-J)
sides, respectively; K-M: lateral (K) and ventral (L-M) views of larvae staged 5 dpf.
Zebrafish are orientated with anterior to the left. Arrowheads in E, G, and H mark
expression domains in unknown anatomical structures. Scale bars of 100 µm are
indicated in the first picture of a series until changed, but scale bar in H refers to 50 µm.
Abbreviations: L = lens; PST = proximal straight tubule; Ic = ionocyte; PCT = proximal
convoluted tubule.
Page 27 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
28
Table 1: Overview of zebrafish trpm expression during development
24 hpf 48 hpf 3 dpf 5 dpf
trpm1a
melanoblasts (mel) melanophores (mel), retina: ciliary
marginal zone (CMZ)
melanophores, retina: ciliary marginal
zone, retinal pigment epithelium
(RPE), inner nuclear layer (INL)
melanophores, retina: ciliary marginal
zone, retinal pigment epithelium, inner
nuclear layer
trpm1b future RPE cells future RPE cells, choroid fissure (CF) retina: retinal pigment epithelium,
inner nuclear layer
retina: retinal pigment epithelium,
inner nuclear layer
trpm2
Lens (L), motoneurons (Mn) lens, olfactory sensory neurons
(OSN), hindbrain (Hb), trigeminal
ganglia (TG), posterior lateral line
ganglia (PLG)
optic nerve head (ONH), olfactory
sensory neurons, hindbrain, cranial
sensory ganglia
optic nerve head, olfactory sensory
neurons, hindbrain, cranial sensory
ganglia
trpm3
lens, neural crest cells (NC), habenula
(Ha)
lens, habenula, epiphysis (E), dorsal
thalamus (DT), hindbrain, choroid
plexus (CP), neurohypophysis (Nhp)
lens, habenula, epiphysis, dorsal
thalamus, hindbrain, choroid plexus,
optic tectum (TeO)
Lens, retinal ganglion cells (RGC),
habenula, dorsal thalamus, optic
tectum
trpm4a cloaca (C) pharyngeal ectoderm (PEc), cloaca intestinal bulb (IB), cloaca intestinal bulb (IB), posterior part of
the pronephros
trpm4bs
olfactory sensory neurons, lateral line
promordium (LLP) and lateral line
neuromasts (LLN), cloaca
olfactory sensory neurons, pharyngeal
ectoderm, lateral line neuromasts,
cloaca
olfactory sensory neurons, pharyngeal
and gill ectoderm (GEc), lateral line
neuromasts, cloaca
olfactory sensory neurons, pharyngeal
and gill ectoderm, intestinal bulb,
cloaca
trpm5 no detectable expression no detectable expression taste bud cells in pharynx and gills taste bud cells in pharynx and gills
trpm6 no detectable expression no detectable expression no detectable expression no detectable expression
trpm7 lens, ionocytes (IC), pronephros:
proximal straight tubules (PST)
lens, ionocytes, pronephros: proximal
straight tubules
pronephros: proximal straight tubules pronephros: proximal convoluted
tubules and proximal straight tubules
Page 28 of 36
John Wiley & Sons, Inc.
Developmental Dynamics
5051525354555657585960
Dev
elop
men
tal D
ynam
ics
29
Table 2: Oligonucleotides used for WISH probes
Gene Forward primer 5’-3’ Reverse primer 5’-3’ Length
trpm1a_dr GCAGGAGAAATGGTCGGT GGGCGAAGGAAATGATGT 764 nt
trpm1b_dr AGAGGGCATGGATTGAAAGG GGTTTGGTAGGGTCGTGT 632 nt
trpm2_dr TGTCTCCCTCTTTCCAGC CGAAGGAAGAAGCAGGAG 1439 nt
trpm3_dr GTAAGCACCAAAGACCACCA GAATGATGAAGAGATGCTGGG 1006 nt
trpm4a_dr GGGGGAGGAGAGAGAAAA GCACACACAAAACAGGAA 826 nt
trpm4b1_dr TTTCGACCTACTTGACTTACAA GCCTCTCGAATCTCCTCG 1099 nt
trpm4b2_dr GAAGTTTCCTCAGACGTTGA CATAATCCACTGTAGAGAGGAAT 986 nt
trpm4b2_dr UTR CCGAGTTTCCTGCTCSTCTC GATGAAAAGCAGAACATGGG 118 nt
trpm4b2_dr UTR CCGAGTTTCCTGCTCSTCTC GCTAGGATTAGGGATGTAGAAG 409 nt
trpm4b3_dr TTCCTCTTCCTGTTTCTGTAC GCGTTTGAGCCTCTGG 1026 nt
trpm4b3_dr UTR GTGTTCATCTTCTGTCTTCATTC CTAGTTTAAAGATGGAAAGCG 111 nt
trpm4b3_dr UTR GTGTTCATCTTCTGTCTTCATTC GGATTAGGGATGTAAAATATGATC 388 nt
trpm5_dr CGTAAGGGTGACCAGCTC CCTGACATTCGTTTTCTGG 1212 nt
trpm6_dr CTCCTCACATCATTTCCTTC CTTTTTCTGCCCCTTCTT 914 nt
trpm7_dr CACAGAGTTGGACAGAAACC GAGGGACGCAGTTCTTTAG 1122 nt
Page 29 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
1
144x181mm (300 x 300 DPI)
Page 30 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
2
191x210mm (300 x 300 DPI)
Page 31 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
3
152x132mm (300 x 300 DPI)
Page 32 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
4
180x185mm (300 x 300 DPI)
Page 33 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
5
213x259mm (300 x 300 DPI)
Page 34 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
6
92x48mm (300 x 300 DPI)
Page 35 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s
7
178x277mm (300 x 300 DPI)
Page 36 of 36
John Wiley & Sons, Inc.
Developmental DynamicsD
evel
opm
enta
l Dyn
amic
s