Peptidoglycan Fragment Release from Neisseria meningitidis

Katelynn L. Woodhams, Jia Mun Chan, Jonathan D. Lenz, Kathleen T. Hackett, Joseph P. Dillard

Department of Medical Microbiology and Immunology, University of Wisconsin—Madison School of Medicine and Public Health, University of Wisconsin, Madison,Wisconsin, USA

Neisseria meningitidis (meningococcus) is a symbiont of the human nasopharynx. On occasion, meningococci disseminate fromthe nasopharynx to cause invasive disease. Previous work showed that purified meningococcal peptidoglycan (PG) stimulateshuman Nod1, which leads to activation of NF-�B and production of inflammatory cytokines. No studies have determined if me-ningococci release PG or activate Nod1 during infection. The closely related pathogen Neisseria gonorrhoeae releases PG frag-ments during normal growth. These fragments induce inflammatory cytokine production and ciliated cell death in human fallo-pian tubes. We determined that meningococci also release PG fragments during growth, including fragments known to induceinflammation. We found that N. meningitidis recycles PG fragments via the selective permease AmpG and that meningococcalPG recycling is more efficient than gonococcal PG recycling. Comparison of PG fragment release from N. meningitidis and N.gonorrhoeae showed that meningococci release less of the proinflammatory PG monomers than gonococci and degrade PG tosmaller fragments. The decreased release of PG monomers by N. meningitidis relative to N. gonorrhoeae is partly due to ampG,since replacement of gonococcal ampG with the meningococcal allele reduced PG monomer release. Released PG fragments inmeningococcal supernatants induced significantly less Nod1-dependent NF-�B activity than released fragments in gonococcalsupernatants and tended to induce less interleukin-8 (IL-8) secretion in primary human fallopian tube explants. These resultssupport a model in which efficient PG recycling and extensive degradation of PG fragments lessen inflammatory responses andmay be advantageous for maintaining meningococcal carriage in the nasopharynx.

Neisseria meningitidis (meningococcus) colonizes the naso-pharynx of up to 40% of the healthy human adult population

(1). In �1,525 cases annually in the United States, N. meningitidisdisseminates from the nasopharynx to cause a highly inflamma-tory meningitis and septicemia (2). Even with treatment, there is ahigh rate of morbidity and mortality associated with meningococ-cal disease. Giardin et al. showed that purified meningococcalpeptidoglycan (PG) stimulates NF-�B activation via the intracel-lular pattern recognition receptor Nod1, which could contributeto the inflammatory state observed during invasive disease (3).That study demonstrated that N. meningitidis peptidoglycan isinflammatory, although it remains unclear if meningococci re-lease PG during infection. Even though meningococcal disease ishighly inflammatory, meningococci are usually carried asymp-tomatically, implying that the bacteria are able to control release ofinflammatory compounds and/or have differential interactionswith host cells.

Neisseria gonorrhoeae (gonococcus) is the etiologic agent of thesexually transmitted disease gonorrhea and is closely related to N.meningitidis. During normal growth, gonococci release fragmentsof cell-wall-derived PG (4). Nearly 50% of gonococcal PG is bro-ken down per generation, but in the recycling process, most PGfragments are brought back into the cytoplasm and a much lowerpercentage of PG fragments is released (5). Gonococci release 15%of their PG per generation (6). AmpG, a permease selective for1,6-anhydro-muramyl residues, is required for PG recycling ingonococci and other Gram-negative bacteria, such as Escherichiacoli (6–9). An ampG deletion in gonococci leads to a large increasein PG monomer release (6).

Released PG fragments stimulate inflammation and cell dam-age in multiple bacterial infections. In Bordetella pertussis infec-tion, release of the 1,6-anhydro-disaccharide tetrapeptide PGmonomer (also known as tracheal cytotoxin [TCT]) causes the

death and sloughing of ciliated cells of the trachea (10–12). Exam-ination of the mechanism involved in this cell damage, deter-mined using the hamster tracheal ring model, demonstrated thatthe damage is immune mediated. Nonciliated cells sense TCT andrespond with interleukin-1 (IL-1) production (12). Ciliated cellsrespond to IL-1 with increased expression of inducible nitric oxidesynthase (iNOS), and the amount of nitric oxide produced is suf-ficient to kill the ciliated cells (12, 13). Similar pathology is seenin gonococcal infection of human fallopian tubes (FT), and cili-ated cells die and slough from the epithelium (14). The addition ofgonococcal PG monomers (a mixture of 1,6-anhydro-disaccha-ride tetrapeptide and 1,6-anhydro-disaccharide tripeptide) wasshown to recapitulate the cell damage (15). During Shigella flex-neri infections, release of tripeptide monomer leads to Nod1 stim-ulation and inflammatory cytokine production (16). HumanNod1 (hNod1) specifically recognizes PG fragments containingdiaminopimelic acid (DAP) as the C-terminal amino acid, includ-ing the tripeptide monomer (17). In gonococcal infections, it isunclear if it is the tetrapeptide PG monomer (TCT), tripeptide PGmonomer, or a combination of both that causes the ciliated celldamage in the fallopian tube.

Since N. meningitidis is most often an asymptomatic colonizer(1), we hypothesized that proinflammatory PG fragment release

Received 1 March 2013 Returned for modification 23 March 2013Accepted 2 July 2013

Published ahead of print 8 July 2013

Editor: R. P. Morrison

Address correspondence to Joseph P. Dillard, jpdillard@wisc.edu.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/IAI.00279-13

3490 iai.asm.org Infection and Immunity p. 3490–3498 September 2013 Volume 81 Number 9

from N. meningitidis may be lower than that from bacteria thattypically cause disease. This limiting of PG fragment release couldcontribute to the ability of meningococci to exist as a member ofthe nasopharyngeal microbiota. Therefore, we determined theidentity and amounts of PG fragments released by meningococci.We also examined PG recycling in N. meningitidis and found thatmeningococci are very efficient in uptake of liberated PG frag-ments, recycling 96% of PG monomers. Quantitative comparisonwith N. gonorrhoeae revealed that meningococci release less of theproinflammatory monomers than gonococci and differ in the ra-tio of tripeptide monomer and tetrapeptide monomer. In a directtest of inflammatory potential, supernatants from N. meningitidiswere found to stimulate less NF-�B activation via Nod1 than su-pernatants from N. gonorrhoeae. Meningococcal supernatantsalso induced less IL-8 production in human fallopian tube tissuethan gonococcal supernatants, suggesting that differences in therelease and breakdown of PG fragments contribute to differencesin the inflammatory response to the pathogenic Neisseria.

MATERIALS AND METHODSBacterial strains and growth conditions. All strains used for this studyare listed in Table 1. Meningococci and nonpiliated gonococci were bothgrown in gonococcal base liquid medium (GCBL) with Kellogg’s supple-ments and 0.042% NaHCO3 (cGCBL) with aeration or on GCB agarplates (Difco) in the presence of 5% CO2 (18). E. coli cells were grown inLB broth or on LB agar plates (Difco). Chloramphenicol was used forselection at concentrations of either 25 �g/ml (E. coli) or 5 �g/ml (N.meningitidis). Kanamycin was used at 40 �g/ml (E. coli) and 80 �g/ml (N.meningitidis). Erythromycin was used for selection of meningococci at 10�g/ml and for E. coli at a concentration of 500 �g/ml. Isopropyl-�-D-thiogalactopyranoside (IPTG) was used at a concentration of 1 mM toinduce expression of the ampG complement.

Plasmid and strain construction. All plasmids used in this study arelisted in Table 1. A strain with a mutation in ampG was constructed toexamine meningococcal PG recycling. The fragment containing an in-frame deletion of ampG and flanking DNA was excised from pDG132 withrestriction enzymes HindIII and SpeI and subcloned into the cloningvector pKH6 at the same restriction sites to generate plasmid pKL26. Thekanamycin resistance marker was cut from pKH99 with EcoRV andEcoICRI. Plasmid pKL26 was cut with BglII and blunted with T4 DNApolymerase. The kanamycin resistance marker was inserted into theblunted BglII site in the same orientation as ampG to generate pKL37.Strain ATCC 13102 Str was transformed with pHC10 in order to generatea capsule-null variant, ATCC 13102 cap. To generate an ampG deletion inN. meningitidis, ATCC 13102 cap was transformed with pKL37 linearizedwith NheI. Deletion of ampG was confirmed by PCR. An ampG comple-mentation construct was generated by amplifying the ampG coding regionfrom ATCC 13102 chromosomal DNA with primers SacI ampG F (CGGGAGCTCGCGATATTTGCTACAATAGGC) and XbaI ampG R (GCCCTCTAGACACAATATCAGGTAAACGCTCC). Restriction sites in theprimer sequences are underlined. Both the PCR product and plasmidpMR33 were digested with SacI and XbaI and then ligated together tocreate pKL47. Strain KL1074 was transformed with pKL47 linearized withNcoI to make the ampG complement strain KL1090.

The DNA fragment containing the ampG coding region with 50 bp offlanking DNA was amplified from ATCC 13102 chromosomal DNA usingprimers ampG-F2 (GGCGATATTTGCTACAATAGGCT) and ampG-1325R (CAATATCAGGTAAACGCTCCAGTTTGA). A fragment con-taining 600 bp of ampG upstream DNA sequence was amplified fromMS11 chromosomal DNA using primers Mc-ampG-SacI-F3 (ATTCAGAGCTCCATCGGCGGCATCATCAAAC) and ampG-5=-flank-R (AGCCTATTGTAGCAAATATCGCC), while the fragment containing around 400bp of ampG downstream DNA sequence was amplified similarly usingprimers ampG-3=-flank-F (TCAAACTGGAGCGTTTACCTGATATTG)and ampG-3=flank-R-BamHI (CTCAGGATCCGTTCTTTATATGAGCG

TABLE 1 Bacterial strains and plasmids used in this study

Strain or plasmid Description Source or reference

StrainsN. meningitidis

ATCC 13102 Clinical isolate, serogroup C ATCCATCC 13102 Str ATCC 13102 rpsL(K43R) 40ATCC 13102 cap ATCC 13102 Str transformed with pHC10 [rpsL(K43R) siaD::cat] This studyKL1074 ATCC 13102 cap transformed with pKL37 [rpsL(K43R) siaD::cat �ampG::kan] This studyKL1090 KL1074 transformed with pKL47 [rpsL(K43R) siaD::cat �ampG::kan ampG�] This study

N. gonorrhoeaeMS11 Wild-type N. gonorrhoeae 41DG130 MS11 transformed with pGC3 (ampG::ermC) This studyDG132 MS11 �ampG 6EC505 DG130 transformed with pEC006 (meningococcal ampG) This study

PlasmidspKL26 pDG132 (�ampG) insert subcloned into pKH6 at HindIII and SpeI This studypKL37 aph3 from pKH99 (EcoRV EcoICRI) in �ampG of pKL26 at blunted BglII This studypKL47 ampG coding sequence in pMR33 complementation vector at SacI and XbaI This studypEC006 ampG coding region from ATCC 13102 with MS11 flanking DNA in pIDN3 at SacI and BamHI This studypIDN3 Cloning plasmid containing Neisseria DNA uptake sequences 42pHC10 siaD::cat construct from serogroup C N. meningitidis 43pGC3 N. gonorrhoeae ampG::ermC in pZero2.1 W. GoldmanpDG132 In-frame ampG deletion construct 6pMR33 IPTG-inducible Neisseria complementation vector for insertion at iga-trpB 44pKH6 Cloning vector derived from pIDN1 and pGCC6 40pKH99 aph3 from pHSS6 in BamHI site of pIDN2 40

Meningococcal Release of Peptidoglycan Fragments

September 2013 Volume 81 Number 9 iai.asm.org 3491

GCAGG). The full-length DNA fragment containing N. meningitidisATCC 13102-derived ampG coding sequence flanked by N. gonorrhoeaeMS11-derived ampG upstream and downstream DNA sequence was gen-erated using a PCR-based method of extension overlap using the afore-mentioned DNA fragments and primers Mc-ampG-SacI-F3 and ampG-3=flank-R-BamHI. The full-length DNA fragment and plasmid pIDN3were digested with SacI and BamHI and ligated together to generatepEC006. To generate a gonococcal strain expressing meningococcalampG, strain DG130 (N. gonorrhoeae ampG::ermC) was transformed withplasmid pEC006. The resulting strain, EC505, was screened for loss oferythromycin resistance, and the expected construction was confirmed byPCR and DNA sequencing.

Characterization of released PG fragments. Labeling and character-ization of released fragments were performed according to the methodsdescribed by Rosenthal and Dziarski as modified by Cloud and Dillard(19, 20). Quantitative fragment release analysis was performed as de-scribed by Garcia and Dillard (6). Meningococci and gonococci werepulse-labeled with 10 �Ci/ml [6-3H]glucosamine in GCBL without glu-cose but containing pyruvate as the carbon source. A 2-h chase period incGCBL followed. For quantitative release, radioactive counts per minute(cpm) in cell pellets after labeling were determined by liquid scintillationcounting. The chase period started with equal numbers of cpm in eachstrain. After the chase, the cells were removed by centrifugation and su-pernatants were passed through a 0.22-�m-pore filter. PG fragments inthe supernatants were separated by size exclusion chromatography anddetected by liquid scintillation counting. Relative amounts of PG frag-ments were determined by calculating the area under the curve. Themonomer fractions were pooled, concentrated, and desalted.

High-performance liquid chromatography (HPLC) analysis was car-ried out as described by Kohler et al. (21). Desalted PG monomers wereseparated by reversed-phase HPLC over a 4.6- by 250-mm C18 columnusing a 4 to 13% acetonitrile gradient over 30 min. PG monomers weredetected by liquid scintillation counting.

PG monomers were analyzed by liquid chromatography-mass spec-trometry (LC-MS) at the University of Wisconsin—Madison Biotechnol-ogy Center Mass Spectrometry facility. Liquid chromatography separa-tion was performed on an Agilent 1200 high-performance liquidchromatography system using an Agilent Zorbax SB-C18 2.1- by 50-mmcolumn with 1.8-�m particles. The following solvents were used: A, 0.1%formic acid in water; B, 0.1% formic acid in acetonitrile. The flow rate was250 �l/min, and the gradient was as follows: 2% B, hold for 1 min, ramp to40% B at 48 min, ramp to 60% B at 55 min, ramp to 95% B at 60 min,return to 2% B at 62 min, and hold for 18 min. The column was held at35°C. The mass spectrometer was an Agilent LC/Mass selective detectortime of flight (MSD TOF) model G1969A operated in the positive-ionmode. Data were collected over the m/z range 100 to 3,200 with 10,000transients collected per scan and 0.89 scan acquired per second. Thesource was held at 35°C with electrospray voltage of 3,600 V. The dryinggas was 8 liters/min, the nebulizer gas was at 40 psi (gauge) (psig), and thefragmentor was at 160 V. Spectra were internally calibrated using a dual-electrospray ionization (ESI) source in which the second electrospray de-livered calibrant solution at a flow rate of 20 �l/min.

Peptidoglycan turnover. Meningococcal PG was metabolically la-beled with 10 �Ci/ml [6-3H]glucosamine as described above. During a2-h chase period, 500-�l samples were taken every 30 min. Whole sacculiwere purified from each sample as described by Cloud and Dillard (20).Cell pellets were resuspended in 165 �l 50 mM sodium phosphate buffer,pH 5.0. An equivalent amount of boiling 8% SDS was added to the sample.After 30 min of boiling, whole sacculi were collected by centrifugation at41,000 relative centrifugal force (RCF) for 30 min at 15°C. The superna-tant was removed, and the pellet was resuspended in 100 �l sterile water.Radiation in the entire sample was detected by liquid scintillation. Thedata shown are the average of three independent experiments, with errorbars representing the standard deviation. Significance was determinedusing the Student t test.

NF-�B activation in epithelial cells. HEK293-Blue hNod1 cells(InvivoGen) were grown in Dulbecco’s modified Eagle’s medium(DMEM) with 4.5 g/liter glucose, 2 mM L-glutamine, 10% fetal bovineserum (FBS), 100 �g/ml Normocin, 30 �g/ml blasticidin, and 100 �g/mlZeocin at 37°C with 5% CO2. These cells overexpress human Nod1 andexpress a soluble alkaline phosphatase NF-�B reporter. Gonococci andmeningococci were grown into the log phase in liquid culture. Cultureswere centrifuged to remove bacteria, and supernatants were filtered with a0.22-�m-pore filter. Total protein in the cell pellet was determined bybicinchoninic acid (BCA) assay (Pierce), and supernatants were normal-ized based on total protein. HEK293-Blue cells were resuspended at adensity of 2.8 � 105 cells/ml in DMEM with 4.5 g/liter glucose, 2 mML-glutamine, and 10% heat-inactivated fetal bovine serum (FBS). Cells(180 �l) were plated in a 96-well plate along with 20 �l of bacterial super-natant, 10 �g/ml Tri-DAP positive control (InvivoGen), 10 �g/ml Tri-Lysnegative control (InvivoGen), or medium-only control and incubated at37°C with 5% CO2 for 24 h. After incubation, 20 �l of supernatant wasadded to 200 �l of QUANTI-Blue reagent (InvivoGen). The reaction mix-ture was incubated at 37°C for 2 h. Absorbance was read at 650 nm in aplate reader to determine alkaline phosphatase activity. The values re-ported are the mean fold increase over medium only from three indepen-dent biological replicates performed in duplicate. Significance was deter-mined using the Student t test.

FTOC and cytokine analysis. Samples of human fallopian tube (FT)were obtained from consenting donors via the National Human TissueResource Center at the National Disease Research Interchange in accor-dance with the University of Wisconsin—Madison Human Studies pro-tocol. This work was approved by the University of Wisconsin—MadisonHuman Subjects Institutional Review Board (IRB). Upon arrival, FT sam-ples were placed in Eagle’s minimal essential medium (MEM) (Cellgro)with HEPES (pH 7.4) and penicillin-streptomycin, where they weretrimmed to remove muscle tissue and cut to expose epithelia prior todissection with a 3-mm biopsy punch. Segments were removed to indi-vidual wells of a 24-well plate containing 1 ml of the above medium andcultured overnight at 37°C with 5% CO2. Following overnight incubation,segments were evaluated microscopically to confirm the presence ofperipheral ciliated cell activity. Prior to treatment, each punch was washedwith sterile phosphate-buffered saline (PBS) and removed to a new 24-well plate containing 900 �l of the above medium without antibiotics. Aminimum number of three segments per condition were then treated witheither 100 �l of GCBL (mock) or supernatant from strain MS11, DG132,ATCC 13102, or KL1074 grown into log phase in liquid culture as de-scribed above. At 24 h postinfection, 250 �l of fallopian tube organ culture(FTOC) medium was removed, filtered by centrifugation through a 0.22-�m-pore filter (Costar), and stored at �80°C. Filtered FTOC superna-tants were assayed for the presence of IL-8 by sandwich enzyme-linkedimmunosorbent assay (ELISA) using the Ready-Set-Go human IL-8ELISA kit (eBioscience), according to the manufacturer’s standard proto-col. Significance was determined by the Mann-Whitney test.

RESULTSPeptidoglycan fragment release by N. meningitidis. Purified N.meningitidis peptidoglycan (PG) induces an inflammatory re-sponse and inflammatory cytokine production (3), but it has notbeen determined if meningococci release PG fragments or how PGaffects meningococcal disease and carriage. We hypothesized thatmeningococci could be limiting proinflammatory PG fragmentrelease, which may facilitate carriage in the human nasopharynx.To examine PG fragment release from N. meningitidis, we used apulse-chase, metabolic labeling method that has been used tocharacterize PG fragment release from N. gonorrhoeae and otherbacteria. Growth of N. meningitidis strain ATCC 13102 in thepresence of [6-3H]glucosamine with pyruvate as the carbonsource was successful in incorporating label into the SDS-insolu-

Woodhams et al.

3492 iai.asm.org Infection and Immunity

ble cell wall PG. However, a substantial amount of label was in-corporated into other molecules, likely the polysaccharide cap-sule. Therefore, we constructed an isogenic capsule-null strain ofATCC 13102 by introduction of an siaD mutation. The unencap-sulated strain exhibited 1.9-fold-increased labeling efficiency forintroduction of [6-3H]glucosamine into the cell wall PG (data notshown). All subsequent labeling with [6-3H]glucosamine was per-formed on capsule-null strains.

We metabolically labeled ATCC 13102 cap with [6-3H]gluco-samine, and after a 2-h chase period, the supernatant was collectedfor evaluation of released PG fragments. PG fragments in the me-dium were separated by size exclusion chromatography, and bycomparison with known standards, we were able to identify most ofthe PG fragments released by N. meningitidis. The release profile forstrain ATCC 13102 cap shows the presence of PG dimers, PG mono-mers, free disaccharide, and a monosaccharide fraction containing1,6-anhydro-N-acetylmuramic acid (anhydro-MurNAc) and possi-bly other molecules (Fig. 1).

As is seen in the release of PG fragments by N. gonorrhoeae, themajor PG fragments released by N. meningitidis include PGmonomers and free disaccharide (Fig. 1). PG monomers are gen-erated by the action of lytic transglycosylases that break down PGstrands into 1,6-anhydro-disaccharide tripeptide and 1,6-an-hydro-disaccharide tetrapeptide monomers (11, 22–24). Free di-saccharides are generated by the N-acetylmuramyl-L-alanine ami-dase AmiC, which cleaves peptides from the glycan chains (6, 25).The PG fragment that elutes at the 390-ml point in the N. menin-gitidis profile (Fig. 1) was only barely detected in N. gonorrhoeaeprofiles and has not been previously analyzed (22). We performedadditional size exclusion chromatography and demonstrated thatthis molecule released by N. meningitidis is larger than glucos-amine and N-acetylglucosamine (data not shown). Mass spec-trometry of an unlabeled sample demonstrated the presence of1,6-anhydro-N-acetylmuramic acid (anhydro-MurNAc) at this

elution time in the meningococcal profile. The less abundant PGfragments released by N. meningitidis include PG dimers: peptide-cross-linked PG dimer, glycosidically linked PG dimer, and a tetra-saccharide with a single peptide chain. We also noted that N. men-ingitidis has an additional PG monomer peak not found in therelease profile of N. gonorrhoeae, representing a molecule smallerthan the tripeptide monomer. The presence of this smaller mono-mer suggests that meningococci degrade liberated PG monomers,possibly removing more of the peptide side chain or removing theglucosamine from the PG monomers.

Since PG monomers induce an inflammatory response in mul-tiple bacterial infections (12, 15, 26) and purified N. meningitidispeptidoglycan stimulates Nod1, we examined what types of PGmonomers are released by N. meningitidis. PG monomers releasedby unencapsulated ATCC 13102 were purified by size exclusionchromatography and analyzed by LC/MS (Fig. 2). The mass spec-trometry analysis identified mass-to-charge ratios consistent with1,6-anhydro-disaccharide tetrapeptide monomer (Fig. 2A), 1,6-anhydro-disaccharide tripeptide monomer (Fig. 2B), reducing di-saccharide tetrapeptide monomer, and reducing disaccharide tri-peptide monomer (data not shown). Together, the size exclusionanalysis and the LC/MS data show that meningococci releaseknown proinflammatory PG fragments into the extracellularmilieu.

Meningococci efficiently recycle peptidoglycan. Examinationof the N. meningitidis genome sequences shows that meningococcihave a homologue of the anhydromuramyl-specific permease,AmpG, which is involved in uptake of PG fragments for recyclingin N. gonorrhoeae, Citrobacter freundii, and other Gram-negativebacterial species (6, 7, 9). In order to characterize meningococcalPG recycling, we made a deletion of ampG in N. meningitidis anda complemented ampG mutant and examined PG turnover dur-ing growth. We metabolically labeled capsule-null N. meningitidis

0

500

1000

1500

2000

2500

3000

3500

0 50 100 150 200 250 300 350 400 450

CPM

Volume (ml)

Void

Dimers

Monomer

Disaccharide

N-acetylmuramic acid GlcNAc

Ala Glu mDAP

anhMurNAc

MurNAc

FIG 1 Meningococci release peptidoglycan fragments during normal growth.Meningococci were metabolically labeled with [6-3H]glucosamine. After achase period, supernatants were collected. Radiolabeled fragments were sepa-rated by size exclusion chromatography and detected by liquid scintillationcounting. During logarithmic growth, meningococci release PG dimers,monomers, free disaccharide, and anhydro-N-acetylmuramic acid. GlcNAc,N-acetylglucosamine; MurNAc, N-acetylmuramic acid; anhMurNAc, an-hydro-N-acetylmuramic acid. Although only one structure is shown, the loca-tion of the peptide on the tetrasaccharide-peptide is not known.

FIG 2 Meningococci release anhydro-disaccharide tripeptide monomer andanhydro-disaccharide tetrapeptide monomer. PG fragments in supernatantfrom unlabeled ATCC 13102 were separated by size exclusion chromatogra-phy. The monomer fractions were pooled, desalted, and concentrated. LC/MSanalysis showed species with mass-to-charge ratios consistent with 1,6-an-hydro-disaccharide tetrapeptide monomer (A) and 1,6-anhydro-disaccharidetripeptide monomer (B).

Meningococcal Release of Peptidoglycan Fragments

September 2013 Volume 81 Number 9 iai.asm.org 3493

strain ATCC 13102, the isogenic ampG deletion mutant, and thecomplemented strain and measured the radioactivity remainingin purified sacculi over a 2-h chase period. We found that theampG mutant released significantly more PG throughout thechase period than both the wild-type (WT) and complementedstrains (Fig. 3), suggesting that meningococci recycle significantamounts of PG fragments generated during cell wall growth anduse AmpG in this process.

To determine the effects of an ampG deletion on fragmentrelease, the wild-type and ampG mutant strains were radiolabeledas described above; however, at the beginning of the chase periodthe cultures were diluted to give equal amounts of radioactivity inthe wild-type and ampG mutant cultures to allow for a quantita-tive comparison of PG fragment release. The ampG deletion strainshowed increased release of PG monomers and free disacchariderelative to the wild-type parent strain (Fig. 4). The amount ofmonomer released by the ampG mutant was 29 times greater thanthat released by the wild type, indicating that wild-type meningo-cocci recycle 96% of monomers. Similarly, meningococci werefound to recycle 90% of disaccharide fragments. Previous workwith N. gonorrhoeae showed that gonococci recycle 85% of PGmonomer (6). Therefore, meningococci release 4% of their PGmonomer and gonococci release 15%, indicating that 3.7-foldmore of this proinflammatory molecule is released by N. gonor-rhoeae. Our results suggest that N. meningitidis recycles PG frag-ments via AmpG more efficiently than does N. gonorrhoeae.

We wondered whether the differences in PG fragment releasebetween meningococci and gonococci could be directly attributedto AmpG. Alignment of AmpG from N. meningitidis and N. gon-orrhoeae showed that AmpG is 97% identical at the amino acidlevel, with the differences spread throughout the amino acid se-quence. We constructed a gonococcal strain, EC505, that ex-presses meningococcal ampG in place of the native gonococcalampG. Quantitative comparison of EC505 to the parental gono-coccal strain MS11 showed that EC505 releases 50.7% as much PG

monomer as MS11 (Fig. 5). Release of PG dimers and free disac-charide was also reduced, although release of anhydro-MurNAcwas unchanged. This result indicates that AmpG itself is partiallyresponsible for the lower PG monomer release from N. meningi-tidis compared to N. gonorrhoeae.

Meningococci release less proinflammatory PG monomersthan gonococci. To examine differences in PG fragment releasebetween N. meningitidis and N. gonorrhoeae, we labeled meningo-cocci and gonococci with [6-3H]glucosamine and used a quanti-tative method to determine differences in PG fragment releasebetween the two species (Fig. 6). We also determined that menin-gococci and gonococci incorporate [6-3H]glucosamine into PG atnearly identical labeling frequencies—56.06% and 56.58%, re-

0

20

40

60

80

100

0 20 40 60 80 100 120

% C

PM R

emai

ning

Time (min)

13102 KL1074 KL1090

ampG wt

*

*

* *

ampG + ampG

FIG 3 Turnover of peptidoglycan is significantly increased in an ampG mu-tant over the wild type. Meningococcal strains were labeled with [6-3H]glucos-amine. During the 120-min chase period, samples were taken every 30 min.Whole sacculi were purified, and total cpm were determined by liquid scintil-lation counting. The ampG deletion mutant KL1074 showed significantlymore PG turnover than its parent, ATCC 13102 cap, and the complementedstrain, KL1090. *, P 0.05 by ANOVA. Error bars represent the standarddeviation. n 3.

0

20000

40000

60000

80000

100000

0 50 100 150 200 250 300 350 400 450

CPM

Volume (ml)

ATCC 13102

KL1074

Dimers

Monomer

Disaccharide

ampG wt

FIG 4 Deletion of ampG results in increased monomer and free disacchariderelease over the level in the wild type. An ampG deletion mutant (KL1074) andits parent (ATCC 13102 cap) were labeled with [6-3H]glucosamine. Followinga 2-h chase, supernatants were collected, and fragments were separated by sizeexclusion chromatography and detected by liquid scintillation counting.Based on differences in monomer peak area, meningococci recycle 96% of PGmonomers.

0

2000

4000

6000

8000

10000

0 50 100 150 200 250 300 350 400 450

CPM

Volume (ml)

N. gonorrhoeae

N. gonorrhoeae + Mc ampG

Dimers

Monomer

Disaccharide

anhMurNAc

N. gonorrhoeae

N. gonorrhoeae + Mc ampG

FIG 5 Expression of meningococcal ampG increases recycling efficiency in N.gonorrhoeae. Gonococcal strains expressing either gonococcal ampG or me-ningococcal ampG were equivalently labeled with [6-3H]glucosamine, andfragment release was analyzed. Gonococci expressing meningococcal ampGshow a 1.97-fold decrease in peptidoglycan monomer release compared towild-type gonococci.

Woodhams et al.

3494 iai.asm.org Infection and Immunity

spectively. We found that N. meningitidis releases 2.8 times less PGmonomer than N. gonorrhoeae (Fig. 6). The differences in mono-mer release between the pathogenic neisseriae are likely partiallydue to differences in ampG (Fig. 5). The levels of free disacchariderelease were very similar between meningococci and gonococci,but dimer release appeared slightly reduced in the meningococcalprofile. As noted above, the meningococcal profile includes a PGmonomer peak for a molecule smaller than the tripeptide mono-mer and a large peak for anhydro-N-acetylmuramic acid. The lat-ter is also seen to a smaller extent in the N. gonorrhoeae profile ofreleased fragments. The appearance of these smaller PG fragmentssuggests that N. meningitidis is degrading multiple PG fragmentsto smaller products.

The PG monomer fractions from N. meningitidis and N. gon-orrhoeae were further analyzed by reversed-phase HPLC (Fig. 7).The N. meningitidis monomer fraction contained both tripeptidemonomer (human Nod1 agonist) and tetrapeptide monomer(TCT), consistent with our LC/MS analysis described above. Theamount of tripeptide monomer released by N. meningitidis was1.8-fold as much as tetrapeptide monomer. In addition, we de-tected three peaks with retention times that are consistent withthose of reducing monomers, i.e., monomers lacking the 1,6-an-hydro bond on the N-acetylmuramic acid. The PG monomersreleased by N. gonorrhoeae included tripeptide monomer andtetrapeptide monomer. The gonococcal strain released 2.6 timesmore tripeptide monomer than tetrapeptide monomer, consis-tent with previous results (21). The decrease in the ratio of tri-peptide monomer to tetrapeptide monomer in N. meningitidiscould alter PG sensing by Nod1 as human Nod1 only recognizestripeptide monomer and not tetrapeptide monomer (17). In total,these data indicate that meningococci are breaking down PG moreextensively or to different products than those found in gono-cocci.

Meningococci stimulate less Nod1-dependent activation ofNF-�B than gonococci. To determine if differences in PG fragmentrelease and recycling between N. meningitidis and N. gonorrhoeae may

result in altered host responses, we measured Nod1-dependentNF-�B activation in response to supernatants from meningococcaland gonococcal cultures. We exposed HEK293 cells overexpressinghuman Nod1 (hNod1) along with an alkaline phosphatase NF-�Breporter to meningococcal or gonococcal supernatants or a medium-only control. Supernatants were from bacteria grown to the log phaseand were normalized based on total protein in the cell pellet. After 24h of exposure to bacterial supernatants, alkaline phosphatase activityin the medium was measured and compared to the activity in themedium-only control (Table 2). NF-�B activity was significantlyhigher in cells expressing hNod1 than the parental null line, indicat-ing that we were detecting hNod1-dependent NF-�B activity (datanot shown). As expected, HEK293 cells overexpressing hNod1showed NF-�B activity in response to tripeptide containing DAP, butnot to tripeptide containing lysine. We found that gonococcal super-natants stimulated significantly more hNod1-dependent NF-�B ac-tivity than meningococcal supernatants, suggesting that differencesin the amounts and types of PG fragments released by these specieswill affect NF-�B activity and inflammatory cytokine productionduring infection (Table 2).

Cytokine induction in human fallopian tube explants. WhileN. gonorrhoeae and N. meningitidis are naturally human-restrictedpathogens, and few relevant in vivo models of human disease areavailable, a human fallopian tube organ culture (FTOC) model

0

1000

2000

3000

4000

0 50 100 150 200 250 300 350 400 450

CPM

Volume (ml)

N. gonorrhoeae N. meningitidis

Void Dimers

Monomer

Disaccharide anhMurNAc

FIG 6 N. meningitidis releases less cytotoxic monomer than N. gonorrhoeae.Meningococci and gonococci were quantitatively labeled with [6-3H]gluco-samine. After a chase period, supernatants were collected, and fragments wereseparated by size exclusion chromatography and detected by liquid scintilla-tion counting. N. meningitidis releases less monomer than N. gonorrhoeae andhas altered PG multimer release.

FIG 7 Meningococci release PG monomers in different proportions thangonococci. Radiolabeled PG monomer was pooled and analyzed by reversed-phase HPLC over a C18 column. Meningococci release 1.8 times more tripep-tide monomer than tetrapeptide monomer. N. gonorrhoeae releases 2.6 timesmore tripeptide monomer than tetrapeptide monomer, suggesting that me-ningococci degrade PG fragments differently than gonococci.

TABLE 2 Meningococci stimulate less hNod1-dependent NF-�Bactivity than gonococci

SampleNod1-dependent PhoAactivity (fold change)a

N. gonorrhoeae 6.4 � 0.5N. meningitidis 3.9 � 0.9b

Tri-DAP 12.0 � 4.1Tri-Lys 1.0 � 0.04a Fold increase over medium-only control.b Significantly less than the fold change stimulated by N. gonorrhoeae by t test (P 0.011).

Meningococcal Release of Peptidoglycan Fragments

September 2013 Volume 81 Number 9 iai.asm.org 3495

has been established to study the pathogenicity of the gonococcus(27). In this model, PG fragments from gonococci have beenshown to cause ciliated cell death in fallopian tube mucosa (15)and infection with gonococci has been shown to induce the pro-duction of proinflammatory cytokines as well as cause ciliated celldeath (28–30). Since PG fragments are known to stimulate thesecretion of proinflammatory cytokines and chemokines, the hu-man FTOC model could be used to evaluate the in vivo relevanceof proportional differences in bacterial PG fragment release. Fal-lopian tube tissue was obtained from two donors and was treatedwith supernatants from N. meningitidis, N. gonorrhoeae, or ampGmutants of these species. After 24 h, tissue culture medium wasremoved, filtered, and assayed for levels of IL-8. In Fig. 8, eachpoint represents the IL-8 produced from a single fallopian tubetissue segment. N. gonorrhoeae supernatants induced an averageof 131 and 145 ng/ml IL-8 for the WT and ampG mutant, respec-tively. The average for IL-8 induced by the wild-type N. meningi-tidis supernatant appeared considerably lower at 85 ng/ml, but theampG mutant gave an average IL-8 concentration of 136 ng/ml.There is a high degree in variability in response between the tissuesections, which may partly be due to differences in the humandonors. The differences between the treatment groups do notreach statistical significance but show a trend toward lower IL-8levels for the wild-type N. meningitidis-treated tissue and in-creased levels when ampG is mutated. These trends are in agree-ment with the results seen in hNod1-reporter cells (Table 2) andwith the amounts of PG monomers released by these strains (Fig.4 and 6).

DISCUSSION

It appears that all bacteria that produce PG release some portion ofwhat they produce into the environment in the course of normalgrowth. PG fragments are generated as the cell grows—PG strandsin the cell wall are degraded to make a space for insertion of addi-tional strands, and PG is broken down in the process of septum

formation and splitting (31). It is how the PG is broken down, intowhat form, that affects its potential to elicit an immune response.Also, the amounts of PG fragments taken back into the cytoplasmfor recycling affect the amounts available for release into the en-vironment and thus possible detection by the immune system(32). In this study, we found that N. meningitidis has high-effi-ciency recycling and increased degradation of PG fragments, re-sulting in reduced release of proinflammatory PG fragments rel-ative to N. gonorrhoeae.

We found that N. meningitidis releases soluble PG fragments,including the PG monomers that are known to induce inflamma-tory responses and cell death in various types of infections (11, 15,16, 33). These PG fragments may contribute to the large inflam-matory response that occurs during meningococcal sepsis or men-ingitis. Meningococci also release other proinflammatory mole-cules, including lipooligosaccharide (endotoxin) and Toll-likereceptor 2 (TLR2) agonist PorB (34, 35). It is unclear how anorganism that makes such potent inflammatory molecules cannormally be found as an asymptomatic colonizer of humans, butwe speculate that limiting PG fragment release may reduce inflam-matory responses during nasopharyngeal colonization.

By comparing the amounts of PG fragments released by thewild-type strain and an ampG mutant, we determined that N.meningitidis normally recycles 96% of the PG monomers liberatedfrom the cell wall. This rate of recycling is very similar to that seenwith E. coli but is substantially higher than the rate determined forN. gonorrhoeae (36). Gonococci recycle 85% of PG monomers (6).The higher rate of recycling in N. meningitidis is partly due todifferences in ampG. Replacement of gonococcal ampG with theallele from N. meningitidis resulted in an almost 2-fold reductionin PG monomer release (Fig. 5). Thus, although ampG does notaccount for all of the 2.8- to 3.7-fold reduction in amounts of PGmonomer released by N. meningitidis, it does explain a substantialpart of this difference (Fig. 4 and 6) (6). The meningococcal andgonococcal AmpG sequences are 97% identical at the amino acidlevel. It is possible that these minor differences may affect AmpGstability, activity, or interaction with other proteins involved inPG fragment recycling or release. Also, expression of ampG maybe higher in meningococci than in gonococci. It is clear that thereare differences between meningococci and gonococci in PG frag-ment recycling in addition to the amounts of PG monomers recy-cled. In N. gonorrhoeae, an ampG mutant is not affected in releaseof free disaccharide, and an ampD (recycling-defective) mutantshows increased uptake of free disaccharide (6). These data sug-gest that gonococci sense and respond to levels of PG in the cyto-plasm. In N. meningitidis, mutation of ampG leads to an increasein free disaccharide and PG monomer release over that in the wildtype, thus demonstrating that AmpG is responsible for free disac-charide uptake in meningococci and that meningococcal uptakeof free disaccharide differs from gonococcal free disaccharide up-take.

A comparison of the PG fragments released by N. meningitidisand N. gonorrhoeae shows that N. meningitidis releases smalleramounts of PG monomers and releases additional PG fragmentsnot released by N. gonorrhoeae. These additional PG fragmentsinclude smaller PG dimers, smaller PG monomers, and 1,6-an-hydro-N-acetylmuramic acid. The presence of these PG fragmentsindicates that meningococci are breaking down the liberated PGfragments more extensively than gonococci. Furthermore, theHPLC analysis of meningococcal PG monomers shows that this

250

200

0

50

100

150

IL-8

(ng/

mL)

mock

N. gonorrh

oeae

N. gonorrh

oeae ∆

ampG

N. men

ingitidis

N. men

ingitidis ∆a

mpG

FIG 8 Fallopian tube organ culture explants secrete the proinflammatorycytokine IL-8 in response to exposure to meningococcal and gonococcal su-pernatants. Explants from two patients were exposed to supernatants frommeningococci, gonococci, and isogenic ampG deletion mutants. After 24 h ofexposure, IL-8 secretion was measured by ELISA. Data points are representa-tive of IL-8 secretion from two independent experiments with � 3 replicatesper condition per experiment. Bars indicate the mean. There was no statisti-cally significant difference between samples as determined by the Mann-Whit-ney test.

Woodhams et al.

3496 iai.asm.org Infection and Immunity

fraction contains not just 1,6-anhydro-disaccharide tetrapeptidemonomer and 1,6-anhydro-disaccharide tripeptide monomer butalso contains reducing monomers. The net effect of the highlyefficient monomer recycling and additional PG fragment degra-dation contributes to detoxification of released PG fragments, asevidenced by meningococcal supernatants inducing less Nod-1-dependent NF-�B activation than gonococcal supernatants. (Ta-ble 2). Also the tendency of gonococcal supernatants to inducemore IL-8 production in fallopian tube tissue than was foundusing meningococcal supernatants is consistent with this idea(Fig. 8). E. coli also degrades PG fragments prior to their release. InE. coli, liberated PG monomers are degraded by the N-acetyl-muramyl-L-alanine amidase AmiD (37). AmiD converts PGmonomers into free peptides and free disaccharides. The free pep-tides could still participate in inducing inflammation through theNod1 pathway since free tetrapeptides or free tripeptides would beNod1 agonists in mice or humans, respectively (38). However, inthe B. pertussis model, peptides have to be blocked at the N termi-nus to have cell-damaging activity (39), and thus AmiD activitywould detoxify PG monomers.

This is the first characterization of PG fragments released by N.meningitidis during normal growth. We found that meningococcirelease multiple PG fragments, including proinflammatory PGmonomers. Meningococcal PG monomer release is lower thanthat of N. gonorrhoeae, and this difference is partly due to differ-ences in ampG. Meningococci also release additional PG frag-ments not present in the gonococcal PG fragment release profile,indicating that meningococci are breaking down PG further thangonococci. Reduction of proinflammatory monomer release andadditional PG degradation may be advantageous for meningo-cocci in maintaining an asymptomatic colonization of the humannasopharynx.

ACKNOWLEDGMENTS

We thank Sanjay Ram for the generous gift of plasmid pHC10.This work was supported by NIH grants R01AI097157 and

R21AI072605 to J.P.D.

REFERENCES1. Stephens DS, Greenwood B, Brandtzaeg P. 2007. Epidemic meningitis,

meningococcaemia, and Neisseria meningitidis. Lancet 369:2196 –2210.2. Cohn AC, MacNeil JR, Harrison LH, Hatcher C, Theodore J, Schmidt

M, Pondo T, Arnold KE, Baumbach J, Bennett N, Craig AS, Farley M,Gershman K, Petit S, Lynfield R, Reingold A, Schaffner W, Shutt KA,Zell ER, Mayer LW, Clark T, Stephens D, Messonnier NE. 2010.Changes in Neisseria meningitidis disease epidemiology in the UnitedStates, 1998 –2007: implications for prevention of meningococcal disease.Clin. Infect. Dis. 50:184 –191.

3. Girardin SE, Boneca IG, Carneiro LA, Antignac A, Jehanno M, Viala J,Tedin K, Taha MK, Labigne A, Zahringer U, Coyle AJ, DiStefano PS,Bertin J, Sansonetti PJ, Philpott DJ. 2003. Nod1 detects a unique muro-peptide from gram-negative bacterial peptidoglycan. Science 300:1584 –1587.

4. Rosenthal RS. 1979. Release of soluble peptidoglycan from growing gono-cocci: hexaminidase and amidase activities. Infect. Immun. 24:869 – 878.

5. Hebeler BH, Young FE. 1976. Chemical composition and turnover ofpeptidoglycan in Neisseria gonorrhoeae. J. Bacteriol. 126:1180 –1185.

6. Garcia DL, Dillard JP. 2008. Mutations in ampG or ampD affect pepti-doglycan fragment release from Neisseria gonorrhoeae. J. Bacteriol. 190:3799 –3807.

7. Jacobs C, Huang LJ, Bartowsky E, Normark S, Park JT. 1994. Bacterialcell wall recycling provides cytosolic muropeptides as effectors for beta-lactamase induction. EMBO J. 13:4684 – 4694.

8. Lindquist S, Weston-Hafer K, Schmidt H, Pul C, Korfmann G, Erickson

J, Sanders C, Martin HH, Normark S. 1993. AmpG, a signal transducerin chromosomal beta-lactamase induction. Mol. Microbiol. 9:703–715.

9. Johnson JW, Fisher JF, Mobashery S. 2013. Bacterial cell-wall recycling.Ann. N. Y. Acad. Sci. 1277:54 –75.

10. Goldman WE, Klapper DG, Baseman JB. 1982. Detection, isolation, andanalysis of a released Bordetella pertussis product toxic to cultured trachealcells. Infect. Immun. 36:782–794.

11. Rosenthal RS, Nogami W, Cookson BT, Goldman WE, Folkening WJ.1987. Major fragment of soluble peptidoglycan released from growingBordetella pertussis is tracheal cytotoxin. Infect. Immun. 55:2117–2120.

12. Heiss LN, Moser SA, Unanue ER, Goldman WE. 1993. Interleukin-1 islinked to the respiratory epithelial cytopathology of pertussis. Infect. Im-mun. 61:3123–3128.

13. Flak TA, Goldman WE. 1999. Signalling and cellular specificity of airwaynitric oxide production in pertussis. Cell. Microbiol. 1:51– 60.

14. McGee ZA, Johnson AP, Taylor-Robinson D. 1981. Pathogenic mecha-nisms of Neisseria gonorrhoeae: observations on damage to human fallo-pian tubes in organ culture by gonococci of colony type 1 or type 4. J.Infect. Dis. 143:413– 422.

15. Melly MA, McGee ZA, Rosenthal RS. 1984. Ability of monomeric pep-tidoglycan fragments from Neisseria gonorrhoeae to damage human fallo-pian-tube mucosa. J. Infect. Dis. 149:378 –386.

16. Nigro G, Fazio LL, Martino MC, Rossi G, Tattoli I, Liparoti V, DeCastro C, Molinaro A, Philpott DJ, Bernardini ML. 2008. Muramylpep-tide shedding modulates cell sensing of Shigella flexneri. Cell. Microbiol.10:682– 695.

17. Girardin SE, Jehanno M, Mengin-Lecreulx D, Sansonetti PJ, Alzari PM,Philpott DJ. 2005. Identification of the critical residues involved in pep-tidoglycan detection by Nod1. J. Biol. Chem. 280:38648 –38656.

18. Kellogg DS, Jr, Peacock WL, Jr, Deacon WE, Brown L, Pirkle CL. 1963.Neisseria gonorrhoeae. I. Virulence genetically linked to clonal variation. J.Bacteriol. 85:1274 –1279.

19. Rosenthal RS, Dziarski R. 1994. Isolation of peptidoglycan and solublepeptidoglycan fragments. Methods Enzymol. 235:235–285.

20. Cloud KA, Dillard JP. 2002. A lytic transglycosylase of Neisseria gonor-rhoeae is involved in peptidoglycan-derived cytotoxin production. Infect.Immun. 70:2752–2757.

21. Kohler PL, Hamilton HL, Cloud-Hansen K, Dillard JP. 2007. AtlAfunctions as a peptidoglycan lytic transglycosylase in the Neisseria gonor-rhoeae type IV secretion system. J. Bacteriol. 189:5421–5428.

22. Cloud-Hansen KA, Hackett KT, Garcia DL, Dillard JP. 2008. Neisseriagonorrhoeae uses two lytic transglycosylases to produce cytotoxic pepti-doglycan monomers. J. Bacteriol. 190:5989 –5994.

23. Sinha RK, Rosenthal RS. 1980. Release of soluble peptidoglycan fromgrowing gonococci: demonstration of anhydro-muramyl-containingfragments. Infect. Immun. 29:914 –925.

24. Lee M, Hesek D, Llarrull LI, Lastochkin E, Pi H, Boggess B, MobasheryS. 2013. Reactions of all Escherichia coli lytic transglycosylases with bacte-rial cell wall. J. Am. Chem. Soc. 135:3311–3314.

25. Heidrich C, Templin MF, Ursinus A, Merdanovic M, Berger J, SchwarzH, de Pedro MA, Höltje JV. 2001. Involvement of N-acetylmuramyl-L-alanine amidases in cell separation and antibiotic-induced autolysis ofEscherichia coli. Mol. Microbiol. 41:167–178.

26. Girardin SE, Tournebize R, Mavris M, Page AL, Li X, Stark GR, BertinJ, DiStefano PS, Yaniv M, Sansonetti PJ, Philpott DJ. 2001. CARD4/Nod1 mediates NF-kappaB and JNK activation by invasive Shigella flex-neri. EMBO Rep. 2:736 –742.

27. Melly MA, Gregg CR, McGee ZA. 1981. Studies of toxicity of Neisseriagonorrhoeae for human fallopian tube mucosa. J. Infect. Dis. 143:423– 431.

28. Maisey K, Nardocci G, Imarai M, Cardenas H, Rios M, Croxatto HB,Heckels JE, Christodoulides M, Velasquez LA. 2003. Expression of pro-inflammatory cytokines and receptors by human fallopian tubes in organculture following challenge with Neisseria gonorrhoeae. Infect. Immun.71:527–532.

29. McGee ZA, Clemens CM, Jensen RL, Klein JJ, Barley LR, Gorby GL.1992. Local induction of tumor necrosis factor as a molecular mechanismof mucosal damage by gonococci. Microb. Pathog. 12:333–341.

30. Velasquez L, Garcia K, Morales F, Heckels JE, Orihuela P, Rodas PI,Christodoulides M, Cardenas H. 2012. Neisseria gonorrhoeae pilus atten-uates cytokine response of human fallopian tube explants. J. Biomed. Bio-technol. 2012:491298.

31. Typas A, Banzhaf M, Gross CA, Vollmer W. 2012. From the regulation

Meningococcal Release of Peptidoglycan Fragments

September 2013 Volume 81 Number 9 iai.asm.org 3497

of peptidoglycan synthesis to bacterial growth and morphology. Nat. Rev.Microbiol. 10:123–136.

32. Boudreau MA, Fisher JF, Mobashery S. 2012. Messenger functions of thebacterial cell wall-derived muropeptides. Biochemistry 51:2974 –2990.

33. Koropatnick TA, Engle JT, Apicella MA, Stabb EV, Goldman WE,McFall-Ngai MJ. 2004. Microbial factor-mediated development in a host-bacterial mutualism. Science 306:1186 –1188.

34. Zughaier SM, Tzeng YL, Zimmer SM, Datta A, Carlson RW, StephensDS. 2004. Neisseria meningitidis lipooligosaccharide structure-dependentactivation of the macrophage CD14/Toll-like receptor 4 pathway. Infect.Immun. 72:371–380.

35. Massari P, Visintin A, Gunawardana J, Halmen KA, King CA, Golen-bock DT, Wetzler LM. 2006. Meningococcal porin PorB binds to TLR2and requires TLR1 for signaling. J. Immunol. 176:2373–2380.

36. Greenway DL, Perkins HR. 1985. Turnover of the cell wall peptidoglycanduring growth of Neisseria gonorrhoeae and Escherichia coli. Relative sta-bility of newly synthesized material. J. Gen. Microbiol. 131:253–263.

37. Uehara T, Park JT. 2007. An anhydro-N-acetylmuramyl-L-alanine ami-dase with broad specificity tethered to the outer membrane of Escherichiacoli. J. Bacteriol. 189:5634 –5641.

38. Magalhaes JG, Philpott DJ, Nahori MA, Jehanno M, Fritz J, Le BourhisL, Viala J, Hugot JP, Giovannini M, Bertin J, Lepoivre M, Mengin-

Lecreulx D, Sansonetti PJ, Girardin SE. 2005. Murine Nod1 but not itshuman orthologue mediates innate immune detection of tracheal cyto-toxin. EMBO Rep. 6:1201–1207.

39. Luker K, Tyler A, Marshall G, Goldman W. 1995. Tracheal cytotoxinstructural requirements for respiratory epithelial damage in pertussis.Mol. Microbiol. 16:733–743.

40. Woodhams KL, Benet ZL, Blonsky SE, Hackett KT, Dillard JP. 2012.Prevalence and detailed mapping of the gonococcal genetic island in Neis-seria meningitidis. J. Bacteriol. 194:2275–2285.

41. Swanson J. 1972. Studies on gonococcus infection. II. Freeze-fracture,freeze-etch studies on gonococci. J. Exp. Med. 136:1258 –1271.

42. Hamilton HL, Schwartz KJ, Dillard JP. 2001. Insertion-duplicationmutagenesis of Neisseria: use in characterization of DNA transfer genes inthe gonococcal genetic island. J. Bacteriol. 183:4718 – 4726.

43. Ram S, Cox AD, Wright JC, Vogel U, Getzlaff S, Boden R, Li J, PlestedJS, Meri S, Gulati S, Stein DC, Richards JC, Moxon ER, Rice PA. 2003.Neisserial lipooligosaccharide is a target for complement component C4b.Inner core phosphoethanolamine residues define C4b linkage specificity.J. Biol. Chem. 278:50853–50862.

44. Ramsey ME, Hackett KT, Kotha C, Dillard JP. 2012. New complementationconstructs for inducible and constitutive gene expression in Neisseria gonor-rhoeae and Neisseria meningitidis. Appl. Environ. Microbiol. 78:3068–3078.

Woodhams et al.

3498 iai.asm.org Infection and Immunity