PCR based detection of nosocomial infection causing MRSA (Methicillin resistant Staphylococcus aureus)

Archana Panchapakesan Iyer Experimental Biochemistry Unit

King Fahad Medical Research Centre Jeddah, Saudi Arabia

e-mail: arch729@gmail.com

Taha Abdulah Kumosani Experimental Biochemistry Unit

King Fahad Medical Research Centre Jeddah, Saudi Arabia

e-mail: t.kumosani@yahoo.com

Abstract— Nosocomial infections are infections that develop as a result of a stay in hospital or are produced by microorganisms and viruses acquired during hospitalization. Nasal carriage of S. aureus is very common and may be due to hand to nose transmission. The objective of the present study was to screen individuals from various sectors as carriers of MRSA. The study group included hospital staff such as nurses, doctors and visitors. Nasal swabs were taken from the volunteers and cultured on media selective for Staphylococcus aureus. Pathogenecity was confirmed using PCR for the coagulase gene. Coagulase positive strains were subjected to PCR for the mec gene. A comparison was done with a student population to serve as a group non exposed to MRSA.

Keywords-MRSA, coagulase gene, mec gene, nosocomial infections, PCR based detection

I. INTRODUCTION Nosocomial infections are infections that develop as a

result of a stay in hospital or are produced by microorganisms and viruses acquired during hospitalization. They may be endogenous, arising from an infectious agent present within a patient's body, or exogenous, transmitted from another source within the hospital. In addition to patient-to-patient spread, others may be involved, including staff, students, visitors and voluntary workers[1]. Staphylococci and Enterococci are major causes of nosocomial infections. They cause superficial skin lesions such as boils, styes and more serious infections such as pneumonia, mastitis, phlebitis, meningitis and urinary tract infections; and deep-seated infections, such as osteomyelitis and endocarditis. Methicillin-resistant S. aureus (MRSA) is a strain of S. aureus which by definition is resistant to the semi- synthetic penicillins (i.e. methicillin, nafcillin, and oxacillin). As such, it is resistant to all other beta-lactam antibiotics (including other penicillins, cephalosporins and cephamycins). Additionally, MRSA is often resistant to other classes of antibiotics including aminoglycosides, macrolides and quinolones. Thus, MRSA is not only methicillin-resistant but also multiply-resistant as well[2]. MRSA colonization and infection in acute and non-acute care facilities have increased dramatically over the past two decades, evidenced by the increasing number of reported

outbreaks in the medical literature. Because of its resistance to antibiotics, management of MRSA infections requires more complicated, toxic and expensive treatment. It is important for the health care professional to understand the difference between colonization and infection. Colonization indicates the presence of the organism without symptoms of illness. S. aureus permanently colonizes the anterior nares of about 20% to 30% of the general population. Hospital workers are more likely to be colonized than persons in the general population, presumably because of increased exposure [3]. The resistance to antibiotics is due to a gene called mecA which is part of the staphylococcal cassette chromosome. It codes for a Pencicillin Binding Protein (PBP2a) that prevents the action of beta lactam antibiotics [4]. This study is hence focused on rapid detection of the MRSA using gene specific primers designed to detect the mecA gene. Recently, coagulase gene typing is being used as an important tool to characterize pathogenic Staphylococci. Its discriminatory power relies on the heterogeneity of the region containing the 81-bp tandem repeats at the 3' ends of the coagulase gene. PCR amplification of this particular region produces DNA fragments of different sizes which can then be further discriminated by AluI digestion [5]. In this study I have used coagulase gene PCR and RFLP to type the MRSA strains from various populations.

II. EXPERIMENTAL PROCEDURE Samples were taken from hospital workers such as nurses

and technicians.The sample group consisted of volunteers from various clinics and hospitals. A total of 50 samples was used for the study. All volunteers signed a consent form for ethical approval of the study. A control group of students not exposed to hospitals was also used for the study. Swabs were taken from both the anterior nares using sterile swabs moistened in saline. The swabs were used to spread on Media specific for Staphylococcus aureus (Fig 1). Cultures were then subjected through three rounds of purification and subculturing to get single colonies.

1

2011 2nd International Conference on Biotechnology and Food Science IPCBEE vol.7 (2011) © (2011) IACSIT Press, Singapore

Fig 1. Nasal sw

Colonies wX 100 at 95°Cand 10 ul of tPrimers specimethicillin gefor presence othe coagulaseshown in table Table 1. Pdetection of m

Gene

Mec A FP:5′ARP:5′A

Coagulase FP : 5RP :

PCR prodagarose gel. Mfor coagulaseproducts wererestriction enzwas used as M

wabs cultured on m

were boiled inC for 15 minsthe supernatanfic for the mecene. mecA poof the coagulae gene. Primee 1[5-8].

Primers and mecA and co

Primers used

AAAATCGATGGTAAAGTTCTGCAGTACC

5′ATAGAG ATGCTG5′GCTTCCGATTGTT

ducts were visuMec A positive gene. Thee subjected tozyme for 1 ho

MRSA positive

media specific for

n lysis buffer cs. The suspensnt was used ac A gene wereositive strains ase gene usingers used and

PCR condagulase gene

d co

AAGGTTGGC3' CGGATTTGC3’ 9

5

eGGTACAGG3′

TCGATGC3′ 9

5

e

ualized by eleve strains wer

e different sio restriction dour at 37°C. Ae control.

r Staphylococcus

containing 1%sion was centras template foe used to ampwere then sc

g primers specPCR conditio

ditions useds.

PCR onditions

No.of cycles

94°C – 30

secs

55°C – 30

secs

72°C –

1min

72°C –

5 min

final

extension

40

94°C – 1

min

55°C – 1

min

72°C –

1min 72°C – 5 min final

extension

40

ectrophoresis ure subjected tize coagulasedigestion usinATCC 700699

s aureus

% Triton rifuged

or PCR. lify the creened cific for ons are

d for

PCR product

size

533 bp

350 bp

430 bp

570 bp

630 bp

using 1% to PCR e gene ng AluI 9 strain

mdothcounpono

LaLawoLa

LaLaLaLa

coon35prdiamdi

III.PCR based

most of the heoctors were Mhe hospital viomparison wndergraduate opulation was on exposure to

Fig 2. Mec

ane 1 - 100 bpanes 2-12 –orkers ane 13 – mec A

Fig 3.

ane 1 - 100 bpane 2 - mec Aane 3 - PCR panes 4-11 – PC

Mec A posoagulase gene.n polymorphis50 bp, 430 broducts also gestion with

mongst the strfferent types.

RESULTSscreening for

ealth care woMRSA positivisitors also with the studstudents, it wfree from nas

o the pathogen

c A gene PCR pro

p DNA ladderPCR produ

A positive con

Mec A gene PCR

p DNA ladderA positive contproduct from hCR negative f

sitive strains w. Four differensms in the sizbp, 570 bp a

yielded diffthe enzyme

rains isolated

AND DISCUr carriers of Morkers such asve, but asympwere positivedent populatiwas observedsal carriage of n (Fig 2 and 3)

oducts from health

ucts from hea

ntrol ATCC 7

R from student po

trol ATCC 70health care wofrom student p

were subjectent strain typese of the coagu

and 630 bp (fferent restric

AluI (Fig 5from this stud

USSION MRSA showeds staff nursesptomatic. Some for MRSAon consisting

d that the stuf MRSA, indic).

h care workers

alth care

00699 strain

opulation.

0699 strain orker population

ed to PCR fos were found bulase gene su(Fig 4). The ction patterns5), indicating dy there were

d that s and me of . On g of udent cating

or the based ch as PCR

s on that

e four

2

Fig 4. Coagula

Lane 1: 100 bLane 2: NegaLane 3: coaguLane 4: coaguLane 5: coaguLane 6: coagu

Fig 5. Rest Lane 1 - 100 bLanes 2-7 –restriction pat

ase PCR product o

bp DNA laddeative control ulase product ulase product ulase product ulase product

triction analysis o

bp DNA ladd– coagulase Ptterns

of various sizes fr

er

of size 350 bpof size 430 bpof size 570 bpof size 630 bp

of coagulase PCR

er PCR products

from the MRSA is

p p p p

R products with A

s showing di

solates

AluI

ifferent

cadeouto mimdiinillabwogeexMhoMcatechoheprin

[1][2]

[3]

[4][5]

[6]

[7]

[8]

[9][10

MRSA coloare facilities hecades, evidenutbreaks in the antibiotics,

more complicamportant for thfference betw

ndicates the prlness. S. aureubout 20% to orkers are moeneral populaxposure. In mo

MRSA, but the our is develop

MRSA. This stuan be done usichnique can ospitals to avealth care profroper hand sanfections from

] Boyce, J M., I] Shrestha, B.,

(2009). ] Van Hal, S.J.

J.Clin.Microb] Jorgensen J H] Himabindu ,M

American J. In] Ercis,S., Sanc

26 : 21 (2008)] Ünal,S., Hosk

Skatrud, P.L.,] Graham, J.C.,

and Freeman,] J.Antimicrob.0] . Computation

Dec. 2007, pp

IV. COonization and ihave increasednced by the e medical litemanagement

ated, toxic, ahe health care

ween colonizatresence of the us permanently

30% of theore likely to bation, presumost cases culturesults take aing faster andudy shows thaing the PCR sbe used as a

void spread ofessionals on anitization mspreading.

REFE

Infect Control HoPokhrel, B and M

, Stark, D., Lockbiol, 10:1128 (200H., Infect Control M., Muthamilselvnfect.Dis, 5: 170 cak,B., Hascelik,). kins, J., Flokowit, J Clin Microbiol, Murphy, O.M., R, .Chemotheraphy,nal Intelligence

p. 57-64, doi:10.1

ONCLUSION infection in ac

d dramaticallyincreasing nurature. Becauof MRSA i

and expensivee professionaltion and infecorganism wit

y colonizes the general popbe colonized thmably becauure methods aat least 2 days[

d precise methat rapid identispecific for tha regular screof MRSA andthe importanc

methods to pr

ERENCES

osp Epidemiol, 1Mohapatra, T, Ne

kwood, B., Marrio07). Hosp Epidemiol,

van, S.D., Bishi, D(2009).

, G.,Indian Journ

tsch, J.E., Wu, Cl, 30:1685 (1992)Stewart, D., kear

45 : 111 (2000) in Scheduling (S109/SCIS.2007.3

cute and non-y over the pastumber of repse of its resistinfections reqe treatment. l to understanction. Colonizthout symptomhe anterior narpulation. Hoshan persons i

use of increare used to ide[3]. The need o

hods for identiification of M

he mecA geneeening prograd also to educe of frequentrevent the M

13:725 (1992). epal Med Coll J,1

ott, D and Harkn

, 1:14 (1991). D.K and Verma

nal of Med. Micr

C.Y., Preston and) rns, A.M., Gallow

SCIS 07), IEEE 357670.

acute t two orted tance

quires It is d the

zation ms of res of spital n the eased entify of the fying

MRSA . The

am in ucate t and

MRSA

11:123

ness, J,

a, R.S.,

robiol,

d D.A.,

way, A

Press,

3