oulu 2016 d 1387 university of oulu p.o. box 8000 fi-90014...
TRANSCRIPT
UNIVERSITY OF OULU P .O. Box 8000 F I -90014 UNIVERSITY OF OULU FINLAND
A C T A U N I V E R S I T A T I S O U L U E N S I S
Professor Esa Hohtola
University Lecturer Santeri Palviainen
Postdoctoral research fellow Sanna Taskila
Professor Olli Vuolteenaho
University Lecturer Veli-Matti Ulvinen
Director Sinikka Eskelinen
Professor Jari Juga
University Lecturer Anu Soikkeli
Professor Olli Vuolteenaho
Publications Editor Kirsti Nurkkala
ISBN 978-952-62-1344-6 (Paperback)ISBN 978-952-62-1345-3 (PDF)ISSN 0355-3221 (Print)ISSN 1796-2234 (Online)
U N I V E R S I TAT I S O U L U E N S I S
MEDICA
ACTAD
D 1387
ACTA
Justiina Ronkainen
OULU 2016
D 1387
Justiina Ronkainen
ROLE OF FTO IN THE GENE AND MICRORNA EXPRESSION OF MOUSE ADIPOSE TISSUES IN RESPONSE TO HIGH-FAT DIET
UNIVERSITY OF OULU GRADUATE SCHOOL;UNIVERSITY OF OULU,FACULTY OF MEDICINE;MEDICAL RESEARCH CENTER;BIOCENTER OULU;OULU UNIVERSITY HOSPITAL
A C T A U N I V E R S I T A T I S O U L U E N S I SD M e d i c a 1 3 8 7
JUSTIINA RONKAINEN
ROLE OF FTO IN THE GENE AND MICRORNA EXPRESSION OF MOUSE ADIPOSE TISSUES IN RESPONSE TO HIGH-FAT DIET
Academic dissertation to be presented with the assentof the Doctoral Training Committee of Health andBiosciences of the University of Oulu for public defencein the Leena Palotie auditorium (101A) of the Faculty ofMedicine (Aapistie 5 A), on 4 November 2016, at 12noon
UNIVERSITY OF OULU, OULU 2016
Copyright © 2016Acta Univ. Oul. D 1387, 2016
Supervised byProfessor Markku SavolainenDoctor Tuire Salonurmi
Reviewed byDocent Eerika SavontausDocent Marjukka Kolehmainen
ISBN 978-952-62-1344-6 (Paperback)ISBN 978-952-62-1345-3 (PDF)
ISSN 0355-3221 (Printed)ISSN 1796-2234 (Online)
Cover DesignRaimo Ahonen
JUVENES PRINTTAMPERE 2016
OpponentProfessor Vesa Olkkonen
Ronkainen, Justiina, Role of Fto in the gene and microRNA expression of mouseadipose tissues in response to high-fat diet. University of Oulu Graduate School; University of Oulu, Faculty of Medicine; MedicalResearch Center; Biocenter Oulu; Oulu University HospitalActa Univ. Oul. D 1387, 2016University of Oulu, P.O. Box 8000, FI-90014 University of Oulu, Finland
Abstract
Obesity is associated with greater risk of several diseases, such as type 2 diabetes and metabolicsyndrome. Single nucleotide polymorphisms (SNP) within the fat mass- and obesity-associatedgene FTO are robustly associated with increased body mass index (BMI) in several age and ethnicgroups. Studies with transgenic mice support a mechanistic role for FTO protein in energymetabolism. Fto-deficient mice are leaner than wild-type and overexpression of Fto leads to obesephenotype; however, the precise mechanism of FTO action in the control of BMI has remainedobscure. Fto mRNA is most abundant in the brain while high expression is present also in whiteand brown adipose tissues (WAT and BAT, respectively). WAT stores the nutritional energy andBAT dissipates it to produce heat. Furthermore, these organs participate in a complex endocrinenetwork affecting the whole body metabolism, which is more or less disrupted in obesity. In thebrowning process, white adipocytes begin to manifest brown characteristics. MicroRNAs(miRNA) are small RNA molecules, which fine-tune post-transcriptionally the expression ofgenes important in several cellular processes, including WAT and BAT differentiation andbrowning of WAT. FTO has been shown to participate in these processes as well as miRNAregulation.
The current study used a new Fto-deficient mouse model to reveal deeper insights into the roleof Fto on genes affecting WAT and BAT differentiation and function, as well as WAT browning.Furthermore, the effects of Fto on the miRNA regulation in WAT browning and BAT wereinvestigated. Our results supported a role for Fto in adipose tissue. Fto-deficient mice wereresistant to diet-induced obesity and their WAT and BAT adipocytes did not become hypertrophicsimilar to wild-type on high-fat diet. Furthermore, the expression of genes affecting adipose tissuedifferentiation and function was altered in Fto-deficient WAT and BAT, especially after high-fatdiet, and the changes may be mediated via altered miRNA expression. Fto-deficient WAT wasmore susceptible to browning, which in part contributed to the lean phenotype of these mice.Current study supported a role for Fto in whole body metabolism and adaptation of adipose tissueto changes in dietary environment.
Keywords: brown adipose tissue, FTO, gene expression, high-fat diet, microRNAexpression, white adipose tissue, white adipose tissue browning
Ronkainen, Justiina, Fto:n vaikutus hiiren rasvakudosten geenien ja mikro-RNA:nsäätelyssä rasvaisen ruokavalion jälkeen. Oulun yliopiston tutkijakoulu; Oulun yliopisto, Lääketieteellinen tiedekunta; Medical ResearchCenter; Biocenter Oulu; Oulun yliopistollinen sairaalaActa Univ. Oul. D 1387, 2016Oulun yliopisto, PL 8000, 90014 Oulun yliopisto
Tiivistelmä
Lihavuus on toistuvasti yhdistetty useisiin liitännäissairauksiin, kuten tyypin 2 diabetekseen jametaboliseen oireyhtymään. FTO-geenissä (fat mass- and obesity-associated) esiintyvien yhdennukleotidin muutoksien (single nucleotide polymorphia, SNP) on useissa ikä- ja etnisissä ryh-missä raportoitu liittyvän korkeampaan painoindeksiin ihmisillä. Muuntogeenisillä hiirillä teh-dyt tutkimukset tukevat FTO:n mekanistista roolia energia-aineenvaihdunnassa, sillä Fto-poisto-geeniset hiiret ovat villityypin hiiriä laihempia ja sen yliekspressio johtaa ylipainoon. FTO:ntarkka rooli painon säätelyssä on kuitenkin vielä epäselvä. Fto:ta tuotetaan eniten aivoissa, muttamyös valkoisessa ja ruskeassa rasvassa. Valkoinen rasva varastoi ravinnosta saatavan energian jaruskea hajottaa sitä lämmöntuotantoon. Näillä kudoksilla on lisäksi tärkeä rooli energia-aineen-vaihdunnan monimutkaisessa verkostossa. Valkoisen rasvakudoksen ruskettumisprosessissa val-koiset rasvasolut alkavat muistuttaa ruskeita rasvasoluja. Mikro-RNA:t (miRNA) ovat pieniäRNA-juosteita, jotka hienosäätävät geenien ekspressiota transkription jälkeen ja vaikuttavatuseisiin solun tärkeisiin tapahtumiin, myös valkoisen ja ruskean rasvasolun erilaistumiseen jaruskettumiseen. FTO osallistuu näihin prosesseihin sekä miRNA-säätelyyn.
Tämän tutkimuksen tavoitteena oli selventää Fto:n roolia valkoisen ja ruskean rasvakudok-sen erilaistumisessa ja toiminnassa Fto-poistogeenisen hiirimallin avulla. Lisäksi selvitettiinFto:n vaikutuksia valkoisen rasvan ruskettumiseen ja ruskean rasvan toimintaan osallistuvienmiRNA:iden säätelyyn. Tulokset tukivat FTO:n roolia rasvakudoksessa. Fto-poistogeeniset hii-ret eivät lihoneet rasvaisella ruokavaliolla eivätkä niiden rasvasolut varastoineet rasvaa yhtä pal-jon kuin villityypin hiirillä rasvaisen ruokavalion jälkeen. Lisäksi Fto-poistogeenisen rasvaku-doksen erilaistumiseen ja toimintaan liittyvien geenien esiintyvyys muuttui erityisesti rasvaisel-la ruokavaliolla. Nämä muutokset voivat osittain selittyä muuttuneella miRNA-säätelyllä.Tulokset viittasivat siihen, että Fto-poistogeeninen valkoinen rasvakudos oli alttiimpaa ruskettu-miselle, mikä osaltaan vaikutti Fto-poistogeenisten hiirten laihuuteen. Tutkimus tuki Fto-geeninroolia energia-aineenvaihdunnan säätelyssä sekä rasvakudoksen mukautumisessa ruokavalionmuutoksiin.
Asiasanat: FTO, geeniekspressio, mikro-RNA-ekspressio, rasvainen ruokavalio, ruskearasvakudos, valkoinen rasvakudos, valkoisen rasvakudoksen ruskettuminen
7
Acknowledgements
This study was conducted in the Department of Internal Medicine, Biocenter Oulu,
University of Oulu and Medical Research Center, Oulu University Hospital. I
appreciate the vision of the people who have created the facilities for science in
these institutes.
I owe my deepest gratitude to my supervisors Professor Markku Savolainen
and Doctor Tuire Salonurmi. Markku provided fantastic facilities, working
environment and encouragement during the time I spent in his group. His vast
knowledge and support was very motivating and important to me. I am especially
grateful to Tuire, who was enormous support during this project. She provided me
this fascinating topic to study and endless enthusiasm regarding experimental and
scientific questions. I want to thank the official referees Docent Eriika Savontaus
and Docent Marjukka Kolehmainen for their comments and inspiring conversations
that greatly improved this thesis. I thank MA Anna Vuolteenaho for the careful
revision of the language.
I express my gratitude to all my co-authors. Especially I am deeply indebted to
Docent Sylvain Sebért whose intelligence and vision constituted the exciting view
for the original articles and who helped with the summary figure illustrated in the
discussion of this thesis. I express my warmest gratitude to Marja-Leena
Kytökangas, Saara Korhonen and Sari Pyrhönen for the excellent technical
assistance and help in numerous problems in the field of science and life. I thank
Tuija Huusko, Antti Nissinen and Saeid Haghighi for the technical and
methodological help. I greatly acknowledge the former and current members of our
group Timo, Tiia, Anna-Maria, Sanna, Marketta, Satu and Minna for the shared
moments and ideas. The help of our secretaries Marita Ahola and Terttu Niemelä
has been invaluable during these years. I acknowledge Risto Bloigu for the help in
statistical analysis. All my former and current colleagues and friends at the CRC,
Saija, Elina, Nina, Minna, Meiju, Elina M and Heta are greatly acknowledged for
the shared coffee and lunch breaks with important conversations and their expertise
in all matters of life.
Warmest thanks go to my network of good friends. Veera, Maarit, Merja, Aino,
Annika and Satu, you have provided me enormous support and laughter during my
entire life. Special thanks to the Kuusamo hairy sisters and the beautiful Bättre Folk
posse for the best memories. I thank my parents, Tarja and Timo for giving me a
solid basis for life and supporting my decisions unconditionally. I also thank my
sister Eveliina for the help and advises in every situations, including this project. I
8
thank my brother Iisakki and his fiancé Janina for the graphical expertise and good
company. I have always felt loved and safe because of my family and friends.
This work was financially supported by the Biocenter Oulu, the Sigrid Juselius
Foundation, the University of Oulu Scholarship Foundation and the Academy of
Finland.
Oulu, September 19, 2016 Justiina Ronkainen
9
Abbreviations
A adenosine
Adam17 a disintegrin and metallopeptidase domain 17
ALKBH AlkB homolog
AR adiposity rebound
ATP adenosine triphosphate
Ay nonagouti mutation mouse model with human metabolic syndrome
phenotype
BAT brown adipose tissue
Bdnf brain-derived neurotrophic factor gene
BMI body mass index
C cytosine
C/EBP CCAAT/enhancer binding protein
CaMKII calcium/calmodulin-dependent protein kinase II
cAMP cyclic adenosine monophosphate
CD control diet
Cebpa C/EBPα gene
Cebpb C/EBPβ gene
Cpefat carboxypeptidase E-deficient mouse model with diabetic phenotype
CREB cAMP response element binding protein
D2R dopamine receptor type 2
D3R dopamine receptor type 3
DNA deoxyribonucleic acid
eWAT epididymal WAT
f6A N6-formyladenosine
Fto mouse fat mass- and obesity-associated gene
FTO human fat mass- and obesity-associated gene
FTO fat mass- and obesity-associated protein
Fto-KO Fto-knockout
G guanine
H adenosine, cytosine or uracil
HEK293 human embryonic kidney 293 cell
HFD high-fat diet
HH hedgehog
hm6A N6-hydroxymethyladenosine
IFNγ interferon γ
10
IRX3 iroquois homeobox 3
KO knockout
Lepob leptin-deficient mouse model
Leprdp leptin receptor-deficient mouse model
LRS leucyl-tRNA synthetase
m3T 3-methylthymidine
m5C 5-methylcytosine
m6A N6-methyladenosine
MCE mitotic clonal expansion
MEF mouse embryonic fibroblast
mESC mouse embryonic stem cell
METTL3 methyltransferase-like 3
miRNA microRNA
mTORC1 mechanistic target of rapamycin complex 1
MYF5 myogenic factor 5
NPY neuropeptide Y
Npy1r neuropeptide receptor 1 gene
PCR polymerase chain reaction
PDGFRα platelet-derived growth factor α
PPAR peroxisome proliferator activated receptor
Prdm16 PR domain containing 16
PREF1 preadipocyte factor 1
R adenosine or guanine
RNA ribonucleic acid
ROCK Rho-associated protein kinase
rRNA ribosomal RNA
RT-qPCR quantitative real-time reverse-transcriptase PCR
Runx1t1 runt-related transcription factor 1 gene
scWAT subcutaneous WAT
SNP single nucleotide polymorphism
SNS sympathetic nervous system
SRPK1 SRSF protein kinase 1
SRSF2 serine/arginine-rich splicing factor 2
TGFβ transforming growth factor β
tRNA transfer RNA
tub adult onset obesity mouse model
U uracil
11
UCP1 uncoupling protein 1
UTR untranslated region
WAT white adipose tissue
WTAP Wilms tumor 1 associated protein
YTHDF2 YTH-domain family member 2
α-KG α-ketoglutarate
12
13
List of original publications
This thesis is based on the following publications, which are referred to throughout
the text by their Roman numerals:
I Ronkainen J, Huusko TJ, Soininen R, Mondini E, Cinti F, Mäkelä KA, Kovalainen M, Herzig KH, Järvelin MR, Sebért S, Savolainen MJ & Salonurmi T (2015) Fat mass- and obesity-associated gene Fto affects the dietary response in mouse white adipose tissue. Sci Rep 5:9233.
II Ronkainen J, Mondini E, Cinti F, Cinti S, Sebért S, Savolainen MJ & Salonurmi T (2016) Fto-deficiency affects the gene and microRNA expression involved in brown adipogenesis and browning of white adipose tissue in mice. Manuscript.
14
15
Contents
Abstract
Tiivistelmä
Acknowledgements 7 Abbreviations 9 List of original publications 13 Contents 15 1 Introduction 17 2 Review of the literature 19
2.1 Genome-wide association studies ........................................................... 19 2.1.1 Original findings ........................................................................... 19 2.1.2 FTO SNPs associated with human obesity and adiposity ............. 20 2.1.3 Mechanism of association ............................................................ 22
2.2 Mechanism of FTO action ...................................................................... 23 2.2.1 Expression in mouse ..................................................................... 23 2.2.2 Transgenic mouse models ............................................................ 24 2.2.3 In vitro studies .............................................................................. 28
2.3 m6A in RNA ........................................................................................... 30 2.3.1 Biology and effects of m6A.......................................................... 30 2.3.2 Demethylation of m6A by FTO and ALKBH5 ............................. 32 2.3.3 Methyltransferases and m6A binding proteins ............................. 34
2.4 Adipose tissue ......................................................................................... 35 2.4.1 White, brown and beige adipocytes .............................................. 35 2.4.2 Adipogenesis ................................................................................ 38 2.4.3 Adipose tissue miRNA ................................................................. 43
3 Aims of the study 49 4 Materials and methods 51
4.1 Generation of Fto-KO mice (I) ............................................................... 51 4.2 Dietary treatment (I) ................................................................................ 52 4.3 Metabolic and physical performance (I) ................................................. 52 4.4 Light microscopy and immunohistochemistry (I, II) .............................. 53 4.5 Protein extraction and Western blotting (I) ............................................. 53 4.6 Total RNA and miRNA isolation and cDNA synthesis (I, II) ................. 54 4.7 Gene and miRNA expression studies (I, II) ............................................ 55 4.8 Statistics .................................................................................................. 56
16
5 Results 59 5.1 Generation and characterization of Fto-KO mouse model (I) ................. 59 5.2 Morphology of white and brown adipose tissue (I, II) ............................ 61 5.3 Fto gene expression in the WT adipose tissue (I) ................................... 63 5.4 Adipokine production from eWAT (I) ..................................................... 64 5.5 Gene expression related to WAT adipogenesis and function (I) .............. 65 5.6 Gene expression related to browning of WAT and BAT
adipogenesis and metabolism (II) ........................................................... 66 5.7 Expression of miRNAs related to adipogenesis and adipose
tissue metabolism (II) .............................................................................. 68 6 Discussion 71
6.1 Weight development (I) ........................................................................... 71 6.2 Adipose tissue morphology (I, II) ........................................................... 72 6.3 Effect of HFD on Fto expression in WT mice (I, II) ............................... 73 6.4 Expression of genes related to white adipogenesis (I) ............................ 74 6.5 Browning of scWAT and BAT adipogenesis (II) ..................................... 75 6.6 Confounding factors ................................................................................ 76 6.7 Future prospects ...................................................................................... 77 6.8 Summary ................................................................................................. 78
7 Concluding remarks 79 References 81 Original publications 97
17
1 Introduction
Obesity and overweight have become a world-wide epidemic in recent decades
with an increased risk of type 2 diabetes, metabolic syndrome, hypertension, heart
disease, stroke and certain forms of cancer (1). Development of obesity is
attributable to the interaction of genetic, developmental, behavioral and
environmental factors. Human BMI is highly heritable, and several independent
studies strongly associate SNPs in one gene – the FTO – with higher BMI (2-7).
SNPs within human FTO associate with BMI and adiposity; however, the
biological mechanism behind this association is not clear, since they do not directly
alter the actions of FTO or its mRNA expression (5). However, FTO mRNA
expression in WAT is associated with BMI independently from SNP genotype,
indicating a functional role for FTO in WAT (8-10). Evidently, placental FTO has
a role during intrauterine development, since FTO expression in the placenta is
associated with increased fetal weight and length, independently from SNP
genotype (11). FTO mRNA is expressed ubiquitously in mouse as well as man, with
the most abundant expression found in brain regions that control energy balance
(12, 13). In addition, Fto expression is decreased in WAT of several obesity mouse
models, supporting a role also in WAT (13, 14). Fto-deficient mice are leaner than
wild-type and Fto overexpression leads to obesity, further establishing its effect on
energy metabolism (15-20). In vitro studies indicate a role for FTO in adipocyte
differentiation (adipogenesis) and WAT browning as well as nutrient sensing (21-
24).
FTO gene encodes a non-heme iron and α-ketoglutarate-dependent
demethylase with substrate specificity towards N6-methyladenosine (m6A) in
single-stranded RNA (12, 25). This RNA modification was found already in the
1970s, but its physiological significance is only currently being resolved (26).
Evidently, m6A is a signal for mRNA processing and/or export from nucleus, while
the precise mechanism of the specificity for these processes is yet obscure
(reviewed in (27)). In addition, m6A has been found from miRNA binding sites
within mRNA, indicating a role for m6A in the fate of these small RNA molecules
21 to 23 nucleotides in length (28). MiRNAs fine-tune the expression of genes
important in several developmental processes, including adipogenesis (reviewed in
(29, 30)). During adipogenesis, mesenchymal stem cells differentiate with the
guidance of distinct transcription factors, first into preadipocytes and then into
mature adipocytes. White adipocytes store the excess energy while brown
adipocytes dissipate it for thermogenesis. BAT was previously considered absent
18
in adult humans; however, growing evidence of BAT in adults has recently emerged
and its activity has been inversely associated with BMI (31-33). In the browning
process, white adipocytes begin to manifest characteristics of brown adipocytes,
thus dissipating energy instead of storing it (reviewed in (34)).
The current study aimed to assess the role of Fto in WAT and BAT as well as
the browning process of WAT. The metabolic phenotype of an Fto-deficient mouse
model was characterized and expression of genes and miRNAs related to
adipogenesis as well as adipose tissue function and homeostasis was determined.
In addition, mice were subjected to high-fat feeding so that the effects of Fto in the
“obesogenic” environment could be estimated.
19
2 Review of the literature
2.1 Genome-wide association studies
2.1.1 Original findings
In 1999, the Fto gene (then named Fatso due to its large size) was found to be one
of the genes deleted in mouse fused toes (Ft) mutation (35). This mutation was
created via insertional mutagenesis into D region of chromosome 8 and resulted in
deletion of several hundred kilobases of genome (36). In addition to Fto, at least
five other genes are deleted in the Ft mutation: Fts, Ftm and iroquois homeobox
genes Irx3, Irx5 and Irx6 (reviewed in (37)). Homozygous Ft mice with craniofacial
malformation, fused toes (syndactyly), disorganization of spinal cord, and defects
in left-right axis formation, die at embryonic day 10. Heterozygous Ft mice display
syndactyly of forelimbs and thymic hyperplasia due to defects in programmed cell
death (36). Ft mice are a poor model for assessment of Fto functions since other
genes are affected as well, but it shows that this region in chromosome 8
(chromosome 16 in humans) is developmentally important (37). At the time of its
finding, Fto did not gain much attention, but once several groups in 2007 reported
an association between type 2 diabetes and SNPs in the human FTO gene, interest
began to rise (3-7). Findings were established with genome-wide association
studies (GWAS), which test the correlation between SNPs across the whole genome
and trace variation within the sample population (38). Further analysis showed that
the association was abolished after adjustment for BMI (weight per height squared
(kg/m2)), indicating that the effect exists via BMI, thus FTO was renamed fat mass-
and obesity-associated gene (37). Sequence analysis with subsequent functional
studies revealed that the FTO protein is a demethylase able to remove methyl
groups from single-stranded DNA and RNA (12, 39). Originally, 3-methylthymine
(m3T) was indicated as substrate for FTO, but in 2011, Jia et al. revealed that the
activity of FTO is actually more pronounced towards m6A which is the most
abundant modification found in mRNA (25). FTO mRNA is expressed in several
human and mouse tissues, with the highest expression found in the brain (4, 12).
The first Fto-deficient mice generated by Fischer et al. were leaner than wild-type,
supporting the phenotype seen in humans and indicating a functional role for FTO
in energy metabolism (15).
20
2.1.2 FTO SNPs associated with human obesity and adiposity
The SNPs that are associated most strongly with obesity are located in the first and
second intron within the FTO gene and are in high linkage disequilibrium with each
other (4, 5). FTO SNP rs9939609 is a very intensively studied obesity-associated
SNP located in the first intron of FTO. Around 16% of the Caucasian population
are homozygous for the risk allele A of rs9939609, weigh approximately 3 kg more
and have 1.67-fold increased odds of obesity compared to individuals with the
protective TT genotype (4). Furthermore, association with BMI is absent at birth
but becomes significant during childhood. Increased adiposity has been associated
with FTO locus in several studies focusing on children (4, 5, 40), adolescents (40,
41) and adults (40, 42, 43). Closer analysis shows an interesting age-dependence
of FTO SNP association during post-natal development as AA genotype is
associated with BMI from 5.5 years of age onwards while inversely, TT genotype
shows association below 2.5 years of age (44). This indicates that variation within
the FTO gene may be associated with the timing of adiposity rebound (AR) during
childhood, which occurs at the same time with the genotypic switch (44). AR is a
phase of childhood when BMI growth curve rises rapidly between ages 5 to 7 years,
mainly due to increase in fat mass (45). Earlier AR is generally associated with
higher BMI and the risk of obesity in later life, the mean AR age being 3 years in
obese individuals compared with 6 years in reference population (46). Interestingly,
the effect of rs9939609 genotype on AR timing applies to BMI but not to height,
indicating that the effect is specific to an increase in adiposity, not to general
maturation (44).
Studies focusing on the relation of obesity risk FTO SNPs and energy or
macronutrient intake report controversial results. Several studies indicate that the
energy intake is increased in obesity risk FTO SNP carriers whereas others do not
confirm such association (reviewed in (47)). This discrepancy may result from too
small sample sizes and/or measuring errors due to underreporting of dietary intake
in individual studies. In a recent large-scale meta-analysis comprising over 177,000
adult individuals, an association with higher protein intake and obesity risk allele
of FTO SNP was found (48). However, the risk allele appears to relate to lower
energy intake when compared to non-risk allele carriers, which is speculated to
result from underreporting the dietary intake among people with higher BMI (48).
A similar study focusing on children and adolescents indicates that energy intake,
but not protein intake, is increased in risk allele carriers (49). This inconsistency
may be due to the fact that errors from self-reporting the food consumption are
21
smaller in children than in adults. Interestingly, there is evidence of significant
interaction between FTO variation and protein intake on higher BMI in children
and adolescents, indicating that low protein intake may attenuate the effect of FTO
variation (49). Again, these results indicate that the effect of FTO variation on BMI
may be blunted by behavioral choices.
It is noteworthy that while FTO locus has the greatest effect on obesity, is the
most common and has the largest explained variance reported to date, its effect on
BMI variation is modest (50). Explained variance measures the contribution of
FTO SNPs to BMI variation and while being the largest known SNP associated
with human BMI, it is still only 0.34%, indicating a small effect on a person’s risk
of being obese (51). Furthermore, while genetic factors are estimated to account for
40–70% of BMI variation, only about 2.7 % of it may be explained by currently
known SNPs (52). In part, this discrepancy may result from a limited amount of
SNPs identified as yet, but there is growing evidence of gene-environment
interaction, which needs to be fully established (reviewed in (53)). For example,
SNPs have different effect on risk of obesity depending on the person’s year of
birth, so that one risk allele leads to a 0.16-unit increase in BMI of men born in
1930 compared with 0.47-unit increase among those born in 1970 (54). Thus, as
the environment has become more “obesogenic”, individuals with higher genetic
predisposition for obesity gain more weight compared with lower genetic risk
carriers. The gene-environment interaction is important also when suitable
intervention methods for weight loss are assessed. This is apparent in a study
revealing that individuals homozygous for the FTO SNP rs9939609 risk allele show
improved weight loss after low-fat, but not low-carbohydrate hypocaloric dietary
intervention, while the improvement is evident on both diets in the group of non-
risk allele carriers (55).
Lifestyle intervention studies show that obesity-associated SNPs within FTO
do not predict weight loss among obese individuals (56-61). There is evidence that
weight regain is higher in obesity risk allele carriers after lifestyle intervention (57,
58); however, this is not observed in all studies (59-61). This indicates that
behavioral factors such as adherence to weight loss recommendations may blunt
the FTO effects on weight regulation (57, 58). It is also speculated that as regular
physical activity very often reduces after lifestyle intervention, the effect of FTO
on BMI may then have been exposed, leading to increased weight regain in obesity
risk allele carriers (58). There seems to be no association between FTO SNPs and
lifestyle factors such as physical activity, supporting the notion that behavioral
strategies may overrule the genotypic effect of FTO SNPs (40, 59, 62, 63).
22
2.1.3 Mechanism of association
SNPs within the FTO locus affecting BMI and adiposity are located in the intronic,
i.e. non-coding regions of the gene, which complicates the assessment of biological
effects behind the association (3-7). Functional mutations are not found within
linkage disequilibrium of obesity-associated SNPs, including exon 2 and exon-
intron junctions from obese individuals, indicating that the activity of FTO protein
is not altered due to obesity-associated SNPs. Thus, the mechanism of association
is more complex and not necessarily directly related to altered FTO function (5).
Indeed, studies focusing on the effects of obesity-associated SNPs on FTO mRNA
expression have revealed controversial results as discussed in the latter part of this
chapter. However, SNPs within the FTO locus affect mRNA expression of another
important developmental gene, IRX3 via long-range regulatory interactions (64).
In the study by Smemo et al. 11 FTO SNPs previously associated with increased
BMI were shown to associate with increased IRX3 expression, but not with FTO
expression in human brain. Thus, obesity-associated SNPs within the FTO gene
may alter the enhancer activity of other genes, such as IRX3. Indeed, the obesity-
associated regions of the FTO gene contain several cis-regulatory elements that
regulate the expression of near-by genes (64). Recently, Claussnitzer et al.
confirmed this long-range regulation of IRX3 and IRX5 expression, and reported
the first functional evidence of how FTO SNPs regulate energy metabolism (65).
Subcutaneous WAT preadipocytes isolated from obesity risk allele carriers of
rs1421085 SNP in the first intron of FTO exhibit impaired binding of ARID5B (AT-
rich interaction domain 5B). In non-risk allele carriers, ARID5B binds rs1421085
region and represses IRX3/5 expression. Without this repression in risk allele
carriers, IRX3/5 induces adipogenic lipid accumulation and represses
thermogenesis, leading to a developmental shift from browning to whitening
programs and loss of mitochondrial thermogenesis. IRX3/5 expression is increased
only in preadipocytes, not in the whole adipose tissue of risk allele carries,
indicating that the effect is specific to early differentiation and may thus affect other
tissues as well (65). These findings are further supported by the recent analysis of
public datasets focusing on functional elements, long-range chromatin–chromatin
interaction, enhancer activity and gene expression of the BMI-associated FTO
locus (66).
FTO SNPs have been reported to affect primary transcript level of FTO mRNA,
but the effect of SNPs on FTO gene expression across different ethnic and study
populations is obscure (67). The expression of FTO mRNA in visceral and
23
subcutaneous adipose tissue associates with BMI irrespective of the SNP genotype
(8-10). In vitro adipocyte glycerol release and in vivo plasma glycerol level are
increased in women with the protective homozygous allele TT of rs9939609
irrespective of BMI, indicating a role for FTO in lipolysis (8). This supports a direct
role for FTO in adipose tissue and obesity, but does not explain the mechanism of
association between FTO variation and BMI. The expression of FTO mRNA in
placenta is associated with increased fetal weight and length as well as placental
weight independently from mother’s SNP genotype (11). This definitely indicates
a role for FTO in the intrauterine development but does not explain the association
between FTO SNPs and obesity seen after birth (11). Loss-of-function mutation
caused by substitution of 316th arginine to glutamine of the FTO protein was found
from nine members of a Palestinian Arab family (68). The affected individuals had
postnatal growth retardation, microcephaly, severe psychomotor delay, brain
deficits, facial dysmorphias and early lethality as the children died at 1 to 30 months
of age. While supporting the important role of FTO in the early development, such
drastic a phenotype may result from aggregated inactive FTO protein with toxic
effects rather than represent a true consequence of FTO deficiency in humans (68).
The first alternative is supported by results from Fto-deficient mouse models which
possess a milder, albeit distinct phenotype, as discussed in the next chapter.
Interestingly, a chromosomal duplication containing also duplication of the FTO
gene leads to obesity and mental retardation in humans, further supporting a direct
role in energy metabolism (69).
2.2 Mechanism of FTO action
2.2.1 Expression in mouse
Fto mRNA is expressed in several mouse tissues including brain, skeletal muscle,
pancreas, liver, heart, spleen, kidney, lung as well as WAT and BAT (12, 13).
Furthermore, Fto is expressed ubiquitously in whole mouse embryo at embryonic
day 13.5, indicating a role for FTO also in early development (13). The highest
expression in adult mouse is observed in the energy balance controlling regions of
the brain, such as arcuate (ARC), paraventricular (PVN), dorsomedial and
ventromedial nuclei of the hypothalamus (12, 13). Specifically, more FTO-positive
neurons in ARC and PVN are activated during eating termination than initiation
and FTO colocalizes with oxytocin, an important hormone participating in feeding
24
inhibition, suggesting involvement in feeding inhibitory mechanisms (70). Indeed,
Fto overexpression increases oxytocin expression of hypothalamic neuronal cells
in vitro (71). Fasting reduces Fto expression in ARC, which reduction is not rescued
by leptin supplementation, indicating that Fto regulation is independent of
circulating leptin (12-14). In addition, while leptin has a role during embryonic
development, Lep deficiency does not alter the Fto expression pattern in Lepob
mouse embryos (13). Interestingly, when mice are divided into two groups based
on their tendency to eat “small” or “big”, the hypothalamic Fto expression is
increased in the group of “small eaters” compared with “big eaters” (70).
Hypothalamic Fto mRNA expression is not associated with food preference in mice,
nor is it affected by high-sucrose or lipid-supplemented diets (70).
Interestingly, the expression of Fto mRNA is reduced in WAT of several mouse
models of obesity, such as leptin- and leptin receptor-deficient Lepob and Leprdp
mice, Ay mice with nonagouti mutation representing a model for human metabolic
syndrome, Cpe-deficient Cpefat mice with diabetic phenotype and adult onset
obesity mouse model tub (13, 72). This supports a role for FTO in adipose tissue.
Furthermore, the expression of Fto is upregulated in mouse macrophages treated
with interferon γ (IFNγ) and lipopolysaccharide, indicating that FTO may mediate
the pathophysiology of obesity and inflammation (72). The expression of Fto in
WAT or BAT is not altered by fasting or glucose administration in mice, while in
liver and skeletal muscle, Fto expression is increased after fasting (73). Hepatic Fto
expression is at normal level when glucose is injected in to mice i.p. at the end of
fasting period. Thus, FTO may have a role in hepatic gluconeogenesis which is
increased (together with Fto expression) during fasting, resulting in increased
glucose output and subsequent increase in circulating glucose, which in turn
reduces hepatic gluconeogenic activity (73).
2.2.2 Transgenic mouse models
To date, at least nine transgenic mouse lines related to Fto have been generated,
eight of which are Fto-deficient (15-19) and one overexpressing (20) model,
summarized in Table 1.
25
Ta
ble
1. F
to m
ou
se
mo
de
ls. M
od
ifie
d f
rom
(7
4).
Gen
otyp
e Tr
ansg
ene
cons
truct
G
row
th
reta
rdat
ion
Wei
ght
CD
/ H
FD
Ene
rgy
inta
ke
Ene
rgy
expe
nditu
re Fa
t mas
s /
Lean
mas
s
Phy
sica
l
activ
ity
Circ
ulat
ing
horm
one
(Ref
)
Glo
bal F
to-K
O
Del
etio
n of
exo
ns 2
-3
Yes
↓
/ ↓
→1 ↑2
↑
↓ / ↓
↓
Adr
enal
ine ↑
Adi
pone
ctin
↑
Lept
in ↓
(15)
Glo
bal F
to-K
O
Del
etio
n of
exo
n 3
Yes
↓
/ →
→1 ↑2
↑
→ / ↓
ND
IG
F-1 ↓
(16)
Glo
bal F
to-K
O
Del
etio
n of
exo
n 3
Yes
↓
/ ND
→
1 →
↓
/ ↓
ND
N
D
(17)
Glo
bal F
to-K
O
Loss
-of-f
unct
ion
mut
atio
n N
o ↓
/ ↓
→1
↑ ↓
/ →
→
Nor
epin
ephr
ine ↑
Dop
amin
e ↑
(18)
Adu
lt on
set g
loba
l Fto
-KO
Ta
mox
ifen-
indu
ced
dele
tion
of e
xon
3
No
↓ / N
D
→1
→
↑ / ↓
N
D
ND
(1
7)
Cen
tral n
ervo
us s
yste
m
spec
ific
Fto
-KO
Del
etio
n of
exo
n 3
in c
ells
expr
essi
ng n
estin
Yes
↓
/ ND
→
1 ↑2
↑
→ / ↓
ND
IG
F-1 ↓
(16)
Dop
amin
e ne
uron
spe
cific
Fto
-KO
Del
etio
n of
exo
n 3
in
dopa
min
e ne
uron
s
No
→ /
ND
→
1 →
→
/ →
↑
ND
(1
9)
Adu
lt on
set h
ypot
hala
mic
Fto
-KO
Del
etio
n of
exo
n 3
with
vect
or-d
eriv
ed C
re
No
→ /
ND
↓1
→
→
/ →
N
D
ND
(1
7)
Glo
bal F
to o
vere
xpre
ssio
n In
serti
on o
f 1 o
r 2 a
dditi
onal
copi
es o
f Fto
No
↑ / ↑
↑1
,2
→
↑ / →
→
Le
ptin
↓
(20)
Fto
-KO
Fto
-kno
ckou
t; C
D c
ontro
l die
t; H
FD h
igh-
fat d
iet; ↓
decr
ease
d re
lativ
e to
wild
-type
; → u
nalte
red
rela
tive
to w
ild-ty
pe; ↑
incr
ease
d re
lativ
e to
wild
-type
;
ND
not
det
erm
ined
; 1 abs
olut
e en
ergy
inta
ke; 2 e
nerg
y in
take
rela
tive
to le
an m
ass
26
Mice with global germline Fto-knockout (Fto-KO) are generally smaller compared
with wild-type (WT) mice; however, the severity of phenotype differs between the
models (15-18). Fto-KO mice with the drastic phenotype are generated by targeted
deletion of the second and third (15) or only the third (16, 17) exon of the Fto gene.
These mice are born at Mendelian ratio and their body weight is unaltered at birth;
however, they begin to manifest growth retardation and more frequent postnatal
mortality compared with WT from the second postnatal day onwards (15-17).
Anatomical characteristics are unaltered while body weight and nose-anus length
are reduced in the Fto-KO mice compared with WT mice (15-17). The source of
body weight reduction differs between models as Fischer et al. show that both fat
and lean mass of Fto-KO mice are reduced (15) while Gao et al. report unaltered
fat mass and decreased lean mass (16). The most drastic effect of Fto-KO is related
to viability; approximately half of homozygous KO pups die within weeks after
birth in three of the global germline KO models, all with deletions in the genome
(15-17). The reason for the reduced viability is not clear, but it is speculated to
relate to phenotypic disadvantage of smaller body size since the mortality rate is
decreased by postponed weaning and reduction in litter size (15). Thus, the
mortality may not be due to FTO absence per se, but rather to unfavorable position
in the litter resulting from growth retardation.
Indeed, Fto-KO model with a more subtle phenotype, which is produced
without deletion of any part of the genome, lacks the postnatal growth retardation
and is as viable as WT (18). These Fto-KO mice are born the same size as WT
while their body weight begins to reduce at 12 weeks of age, which is mainly due
to reduced fat mass (18). It is yet unclear whether the phenotypic difference is
because of altered structure of the genome in deletion-induced Fto-KO or if there
is still some FTO activity left in the model without the deletion. The first option is
supported by the fact that the Fto locus contains a vast amount of regulatory
sequences inside non-coding regions of the gene and the SNPs related to human
BMI variation are all located in the introns of Fto gene indicating that the regulation
of other genes may be also affected (64-66). Evidently, lean phenotype does not
result from reduced caloric intake since the absolute energy intake of Fto-KO mice
is unaltered and in the case of some mouse models even increased when corrected
for lean or body mass (15-18). Fto-KO mice show increased plasma adiponectin,
improved glucose tolerance and reduced adipocyte size (15, 17). Mild improvement
in insulin sensitivity of Fto-KO mice is likely a consequence of increased
circulating adiponectin (15). Physical activity of Fto-KO mice is reduced or
unaltered depending on the mouse model. The reduction in physical activity may
27
be due to increased sympathetic activity revealed by increased heat production and
plasma adrenaline concentration (15). Increased sympathetic activity may
contribute to Fto-KO WAT adipocytes to be more prone to browning process, which
is manifested by increased BAT marker gene expression (23).
To overcome the issue with reduced viability, adult-onset Fto-KO mice have
been produced by McMurray et al. (17). In this model, global Fto-KO is introduced
with tamoxifen-inducible ubiquitin-Cre recombinase system by treating mice with
tamoxifen at six weeks of age. The weight of these adult-onset Fto-KO mice begins
to reduce about one week after the tamoxifen treatment. Interestingly, the weight
reduction is mainly due to reduction in lean mass while the fat mass is in fact
increased due to Fto-KO. The weight difference between adult-onset Fto-KO and
control mice becomes smaller with time, being no longer significant at 26 weeks
of age due to redistribution of lean and fat mass (17). Conditional Fto-KO mouse
models have been generated to further untangle the tissue-specific roles of FTO (16,
17, 19). Central nervous system -specific Fto-KO mice resemble phenotypically
global Fto-KO mice, including increased postnatal mortality and growth
retardation indicating, that FTO functions in the brain to control growth (16).
However, hypothalamus-specific adult-onset Fto-KO mice have only a small
reduction in weight gain compared with WT, indicating additional functions for
FTO in peripheral tissues as well (17). Indeed, there are no structural alterations in
the adult hypothalamus of mice with global Fto-KO or indication of alterations
during embryonic development, which is further supported by unaltered
neuropeptide mRNA expression in the hypothalamus (15). Dopaminergic (DA)
neuron-specific as well as constitutive Fto-KO mice show altered control of DA
transmission, which is important in the regulation of learning, reward behavior,
motor functions and feeding (19). Specifically, FTO participates in dopamine
receptor type 2 and 3 (D2R and D3R) -mediated neuronal responses without
affecting D2R protein level per se. Interestingly, the weight development and
growth of these DA neuron specific Fto-KO mice are normal, supporting the notion
that FTO acts in several tissues to affect energy metabolism (19).
In addition to Fto-deficient models, mice with one and two additional copies
(that is three and four copies in total) of the Fto gene have been generated to reveal
insights into the effects of Fto overexpression on metabolic performance (20). Fto
overexpressing mice become heavier from four weeks of age onwards in a dose-
dependent manner so that the body weight of mice with four Fto copies is highest
while mice with two Fto copies (WT mice) are leanest. While fat mass is increased
in Fto overexpressing mice, body length as well as other anatomical features are
28
unaltered. Interestingly, the phenotype is more prominent in transgenic females
than males, which is opposite to Fto-deficient models. The perigonadal WAT
adipocyte area is increased in Fto overexpressing females on control diet (CD) and
high-fat diet (HFD), while the difference is seen in male mice only on HFD. Lean
mass is increased in female mice on CD while there is no difference in male mice
or mice of either gender on HFD. Mice with four copies of Fto show glucose
intolerance when fed HFD which is not observed in mice with two or three copies.
Circulating leptin level is decreased in eight-week-old Fto overexpressing mice
while the difference is diminished by the age of 20 weeks (20).
2.2.3 In vitro studies
In addition to animal studies, several in vitro systems have been established to
further untangle the precise mechanisms behind FTO actions. Selection of in vitro
studies are summarized in Table 2.
Table 2. In vitro studies focusing on FTO.
Cell line Species FTO-related outcome (Ref)
Adipocytes
3T3-L1 Mouse mRNA expression is decreased during adipogenesis (21)
Downregulation impairs adipogenesis (21)
Downregulation after differentiation decreases ATP concentration (75)
Downregulation after differentiation decreases glucose uptake (75)
MEF Mouse mRNA is decreased upon essential amino acid deprivation (24)
Deficiency reduces early phase of adipogenesis (76)
Deficiency reduces growth rate and mRNA translation rate (77)
SGBS Human Downregulation after differentiation increases UCP1 expression (23)
Neurons
N46 Mouse mRNA is decreased upon essential amino acid deprivation (24)
SH-SY5Y Human Downregulation increases ATP concentration (75)
Downregulation decreases glucose uptake (75)
FTO and CaMKII induce genes regulating food intake (78)
Other
HeLa Human C/EBPα is able to bind and activate FTO promoter (22)
HEK293 Human mRNA is decreased upon essential amino acid deprivation (24)
C/EBPα is able to bind and activate FTO promoter (22)
FTO fat mass- and obesity-associated protein; ATP adenosine triphosphate; UCP1 uncoupling protein 1;
CaMKII calcium/calmodulin-dependent protein kinase II; C/EBPα CCAAT/enhancer binding protein α
29
Studies with 3T3-L1 preadipocytes indicate that FTO is necessary for adipogenesis,
since Fto knockdown severely impairs the differentiation of preadipocytes into
mature adipocytes with concurrent increase in global m6A levels (21). A study
using mouse embryonic fibroblasts (MEF) indicate that FTO acts during early
phase of adipogenesis, mitotic clonal expansion, since Fto-KO reduced the
expression of short isoform of runt-related transcription factor 1 (Runx1t1) (76).
Further support for FTO’s involvement in adipogenesis comes from the notion that
CCAAT/enhancer binding protein α (C/EBPα), a key transcription factor also in
adipogenesis, is able to directly bind and activate Fto promoter in HeLa and human
embryonic kidney 293 (HEK293) cells (22). Besides the most plausible and
recently indicated substrate, m6A of RNA, FTO is also able to demethylate 5-
methylcytosine (m5C) from DNA (79). In this context, FTO may act as
transcriptional coactivator for the C/EBP family of transcription factors as
recombinant FTO demethylates m5C from C/EBP promoter in silico (79). C/EBPβ,
but not FTO, alone is able to activate C/EBP promoter to some extent, indicating
that FTO is an enhancer of the C/EBP protein family, but not essential for the
activation (79). FTO knockdown in differentiated SGBS adipocytes increases
uncoupling protein 1 (UCP1) expression with a subsequent increase in cyclic
adenosine monophosphate (cAMP)-stimulated respiration rate, supporting the role
for FTO in adipocyte browning process (23).
In hypothalamic N46 cells, MEFs and HEK293 cells, FTO is decreased when
essential amino acids are deprived while deprivation of non-essential amino acids
does not alter FTO protein levels (24). FTO does not seem to be the actual sensor
for cellular amino acids, since the decrease of its protein level occurs quite late, 6
hours after removal of amino acids. In addition, degradation of Fto mRNA occurs
faster than naturally, indicating an active degradation and transcriptional regulation
of Fto mRNA expression, not regulation mediated by amino acid availability (24).
Furthermore, FTO may have a role in determination of cellular energy status, since
Fto knockdown induces an ATP concentration decrease in differentiated 3T3-L1
mouse adipocytes and conversely, an increase in SH-SY5Y neurons, while glucose
uptake is decreased in both cell lines (75). Growth rate and mRNA translation rate
are reduced in Fto-KO MEFs, which is due to decreased mechanistic target of
rapamycin complex 1 (mTORC1) signaling (77). FTO modulates protein level of
leucyl-tRNA synthetase (LRS), which is critical in mTORC1 regulation in amino
acid deprivation, further supporting the role for FTO in cellular nutrient sensing
(77). A recent study shows that FTO interacts with calcium/calmodulin-dependent
protein kinase II (CaMKII) to modulate the cAMP response element binding
30
protein (CREB) signaling pathway (78). Interaction between FTO and CaMKII
induces a prolongation of CREB phosphorylation in SH-SY5Y neurons, which
increases mRNA expression of neuropeptide receptor 1 (Npy1r) and brain-derived
neurotrophic factor (Bdnf), important regulators of food intake and energy
homeostasis (78). In addition, CREB promotes adipogenesis by activating C/EPBβ
and induces thermogenesis via UCP1 upregulation, indicating a CREB-mediated
role for FTO also in white and brown adipocytes (80, 81). Incubation of SH-SY5Y
cells with FTO containing loss-of-function mutation has an intermediate effect on
CREB phosphorylation, which indicates that the demethylase activity of FTO
contributes to the CREB activity, but does not fully explain the effects (78).
2.3 m6A in RNA
2.3.1 Biology and effects of m6A
Over 100 types of RNA modifications have been identified in all kingdoms of life,
of which the most intensively studied are related to ribosomal and transfer RNA
(rRNA and tRNA, respectively) due to their high cellular abundance, diversity and
importance in translation. However, modifications in messenger and long non-
coding RNA (mRNA and lncRNA, respectively) are also present and of growing
interest. m6A is the most abundant modification found in mRNA and lncRNA (26).
While this RNA modification was found already decades ago, its physiological
significance has only recently been resolved (82-84). RNA editing such as
adenosine-to-inosine and cytosine-to-uridine as well as 5’ capping of mRNA are
well-understood modifications due to their drastic impact on target RNA. However,
m6A is a more subtle modification and its effects are difficult to predict, since it
does not affect the base pairing or the general appearance of RNA (26). As there is
no change in base pairing, it is not possible to detect m6A by standard
hybridization- or sequencing-based methods. Furthermore, m6A is not susceptible
to chemical modification such as bisulfite treatment, which is used to detect m5C
in DNA. Lack of available detection methods is at least partly the reason why this
modification has received less attention compared with other DNA and RNA
modifications (28). Recent development of techniques that are sensitive enough has
launched a new era of m6A research and cellular pathways and effects for m6A
action on RNA have begun to be elucidated (Fig. 1).
31
Fig. 1. Cellular pathways of N6-methyladenosine (m6A) in nuclear RNAs. N6-position of
adenosine in RNA is methylated by methyltransferase complex from which
methyltransferase-like (METTL) 3 and 14 and Wilms tumor 1 associated protein (WTAP)
have been identified. Demethylases such as fat mass- and obesity-associated protein
(FTO) and AlkB homolog 5 (ALKBH5) remove m6A from RNA. Readers of m6A, such as
YTH-domain family members (YTHDF) bind to methylated RNA and mediate specific
functions in nucleus and cytoplasm. Modified from (27).
Consensus sequence for m6A is RRACH (R=A/G, A=m6A and H=A/C/U) (82, 85).
High-throughput transcriptome-wide methods have been developed for m6A
mapping which use RNA immunoprecipitation with m6A antibody and subsequent
sequencing (28, 86). These studies show that while the consensus sequence is found
throughout the transcriptome, m6As are primarily located around stop codons, at
the beginning of 3’ untranslated region (3’UTR), within long internal exons, and
largely devoid from poly(A) tail (28, 86). It is yet unknown how this specificity is
achieved and whether cellular mechanisms that involve recognition of the above-
mentioned regions are involved in the specificity of m6A methylation. 3’UTR is
important region for RNA stability, subcellular localization and translation
regulation, indicating that m6A may have a role in these crucial processes. Majority
of m6As are found in mRNA while a fraction of m6As are also located in lncRNA
and within predicted miRNA binding sites of mRNA as discussed later in more
detail (28).
METTL14METTL3-
WTAP + Others?
Demethylation Export
Nucleus
Cytoplasm
Methylation
Transcription
DNA Nuclear RNA m6A-modified RNA
Co-transcriptional m6A installation?
Alternative splicing?
Me Nuclear m6A readers
Other functions?
Cytoplasmic m6A readers
Me
mRNA decay
YTHDF2
Me
Me
Me YTHDF1
mRNA translation
Me ?
mRNA storage?
32
Evidently, upregulation of m6A accompanies neuronal maturation, since m6A
is present at low levels during embryogenesis of mouse brain but increases
dramatically by adulthood (28). Furthermore, decreased m6A in mouse embryonic
stem cells (mESC) results in improved self-renewal and when differentiated into
cardiomyocytes or neural cells, mESCs with decreased m6A show severe
impairment of differentiation (87). Thus, m6A may be required for mESCs to exit
the stem cell program and indeed, m6A targets include pluripotency-related
transcripts with dynamically controlled prevalence during differentiation in human
and mouse ESCs (87). Decreased m6A results in decreased cell proliferation rate
and expression of genes related to pluripotency, while developmental regulators are
increased, indicating that m6A is essential to maintain mESCs at ground state (88).
2.3.2 Demethylation of m6A by FTO and ALKBH5
FTO is the first demethylase identified to remove m6A from RNA, which revealed
that m6A actually is a dynamic, reversible RNA modification (25). Up to date, one
other m6A demethylase, AlkB homolog 5 (ALKBH5), has been identified (89).
Demethylase activity of ALKBH5 is comparable to FTO and they both require non-
heme iron (Fe(II)) and α-ketoglutarate (α-KG) to function (89). Structural and
functional studies show that demethylation activity of FTO, as well as ALKBH5,
is higher towards m6A in single-stranded than double-stranded nucleic acids (25,
89, 90). As illustrated in Fig. 2, FTO demethylates m6A through sequential
oxidation, first to N6-hydroxymethyladenosine (hm6A), then to N6-
formyladenosine (f6A) and finally to adenosine (A). Compared with other similar
intermediates, hm6A is relatively stable and hm6A as well as f6A are not
recognized by m6A binding proteins, indicating that also these intermediates may
represent a new type of RNA modification (91). Interestingly, ALKB5 does not
produce such intermediates, suggesting distinct reaction mechanisms between the
two m6A demethylases (89).
33
Fig. 2. FTO and ALKBH5 remove methyl group of m6A by oxidation. FTO oxidizes m6A
to form N6-hydroxymethyladenosine (hm6A) and N6-formyladenosine (f6A), which
decompose back to adenosine (A). Modified from (92).
Fto depletion increases m6A abundance around splicing sites and enhances the
binding of serine/arginine-rich splicing factor 2 (SRSF2) to its target genes (21).
Specifically, Fto depletion inhibits exon skipping and promotes inclusion of
alternative exons in these SRSF2 targets via m6A modification. The increased
binding ability of SRSF2 to RNA with increased m6A may thus promote exon
inclusion in alternative splicing of FTO target genes. Indeed, Fto depletion results
in increased m6A levels in exons of Runx1t1 gene followed by significant increase
in SRSF1 binding, which in turn decreases the abundance of the short isoform of
Runx1t mRNA and protein. RUNX1T1 is an important transcription factor in
adipogenesis and expression of its short isoform is decreased concurrently with
FTO during adipocyte differentiation in 3T3-L1 cells, further supporting a direct
role for FTO and m6A in adipogenesis (21). ALKBH5 colocalizes with mRNA
splicing factors in nuclear speckles supporting a role in mRNA splicing (89).
However, m6A is not enriched around exon-exon junctions indicating that the effect
on splicing is unlikely through direct influence on binding of splicing factors (28).
ALKBH5 knockdown in HeLa cells results in increased levels of cytoplasmic RNA,
indicating also a role in mRNA export (89). The mechanism for this is not direct,
since ALKBH5 knockdown decreases the phosphorylation of splicing factor SRSF2
N
NN
N
N
DNA
MeH
N
NN
N
N
DNA
H
FTO FTO
N
NN
N
N
DNA
HO
H
N
NN
NDNA
A
-HCHO
-HCOOH
ALKBH5
Fe(II), KG, α O2 Fe(II), αKG, O2
Fe(II), KG, α O2
RNA methyltransferaseNH2
m6A hm6 6A
OH
A f
34
mainly via subcellular relocation of the main kinase (SRSF protein kinase 1,
SRPK1) responsible for the phosphorylation. Thus, m6A may influence the fate of
mRNA by affecting cellular dynamics of the mRNA processing factors (89).
2.3.3 Methyltransferases and m6A binding proteins
Methyltransferases that add m6A to the substrate RNA form a multicomponent
complex that has not yet been fully characterized (27). The first identified
participant of this complex was methyltransferase-like 3 (METTL3), and recently,
METTL14 was also found to possess m6A methyltransferase activity (88, 93).
Recombinant METTL3/14 proteins form a tight complex with a stoichiometry of
1:1 and methylation activity is strongest when these proteins are incubated together,
indicating that they act together in the m6A methyltransferase complex (94).
METTL3/14 targets are involved in transcription, RNA splicing, chromatin
modification, programmed cell death and cell fate determination (88). Pre-mRNA
splicing regulator WTAP (Wilms tumor 1 associated protein) is able to interact with
METTL3/14 complex and also to affect m6A deposition of the cell, indicating that
WTAP may be part of the m6A methyltransferase complex as well (94).
YTH-domain family members (YTHDF) recognize and bind m6A. YTHDF1
has been identified to promote the translation and YTHDF2 to facilitate the
degradation of mRNA (95, 96). Knockdown of YTHDF1 from HeLa cells does not
affect m6A content of total mRNA, while it is increased in cytoplasmic non-
ribosome mRNA pool and decreased in translatable mRNA pool containing the
ribosomes (95). Conversely, binding of YTHDF2 to m6A destabilizes mRNA since
YTHDF2 knockdown decreases m6A in non-ribosome mRNA pool and increases it
in translatable mRNA pool (96). Overexpression of YTHDF2 leads to reduced m6A
of total mRNA, indicating that YTHDF2 itself affects also m6A levels (96). While
these two RNA-binding proteins have their distinct targets, they also share a large
set of common target mRNAs (95). YTHDF1 binds mRNA earlier than YTHDF2,
indicating that they may act together to promote translation of transcripts that are
dynamic and require temporary control (95). In addition to YTHDF1 and 2, two
other YTH-domain family members, YTHDF3 and YTHDC1, have been shown to
bind m6A (86, 97). The biological purpose of these and possible additional m6A
binding proteins is yet to be discovered.
35
2.4 Adipose tissue
2.4.1 White, brown and beige adipocytes
WAT has an important role in buffering nutrient availability by storing excess
calories, preventing toxic accumulation of fat in non-adipose tissues and secreting
adipokines as a part of a dynamic endocrine system (reviewed in (34)). BAT is the
main site of non-shivering and adaptive thermogenesis, which are activated by cold
exposure and increased lipid rich dietary intake, respectively (reviewed in (98)).
Beige adipocytes have characteristics of white and brown adipocytes and are
recruited in the process of WAT browning as a response to cold or increased caloric
intake (34). BAT was previously considered absent in adult humans; however,
recently the presence of functional BAT has been discovered and its activity
associated with decreased BMI (34). The phenotype of brown adipocytes is
morphologically and functionally distinct from white adipocytes. While white
adipocytes comprise a single lipid droplet that fills about 90% of the cell volume,
brown adipocytes contain several small lipid droplets and multiple large
mitochondria packed with cristae (reviewed in (99)). Furthermore, mitochondria in
brown adipocytes contain UCP1, which uncouples oxidative phosphorylation from
ATP synthesis and results in energy dissipation via thermogenesis. Beige
adipocytes show features that are intermediate between white and brown, in that
the lipid droplet is multilocular and mitochondrial content is increased compared
with white adipocytes. Beige adipocytes may express UCP1 depending on their
differentiation stage (99).
Origins
The main source of white and brown precursors is vascular endothelium of adipose
tissue (100-102). As indicated in Fig. 3, BAT precursor cells are derived from
progenitors expressing myogenic factor 5 (MYF5+), thus sharing a common
developmental origin with skeletal myoblasts. The majority of WAT adipocytes
derive from MYF5- progenitors; however, lineage-tracing studies show that a
subset of WAT precursors may be of MYF5+ origins (103-105). The origin of beige
adipocytes is yet obscure. There is evidence suggesting that beige adipocytes arise
from trans-differentiation of white adipocytes, but also reports of differentiation
from specific precursors that are distinct from white and brown precursors
(reviewed in (106)). In addition, progenitors expressing platelet-derived growth
36
factor α (PDGFRα+) have been identified to be bi-potential, thus having the ability
to differentiate into both white and beige adipocytes (106).
Fig. 3. Origins of white, beige and brown adipocytes. White and brown adipose tissue
(WAT and BAT) precursors derive from mesenchymal origins. WAT precursors may
originate from myogenic factor 5 positive and negative (MYF5+ and MYF5-) lineages
while BAT precursors derive exclusively from MYF5- lineage. In addition, WAT and BAT
adipocytes may be generated from endothelial cells and BAT adipocytes from stem cell-
like skeletal muscle satellite cells. WAT contains a mixture of uncoupling protein 1
negative (UCP1-) white adipocytes and positive (UCP1+) beige adipocytes, whereas BAT
is characterized by UCP1+ brown adipocytes. Modified from (34).
The physiological significance of MYF5+ population in WAT is yet largely elusive.
In mouse, the amount of MYF5+ progenitors in WAT is depot-specific, being at
comparable level to BAT in interscapular and retroperitoneal WAT, while being 15-
20 times lower in subcutaneous and perigonadal WAT (104). This distribution does
not correlate with mRNA expression of the BAT-markers Ucp1 and Prdm16 (PR
domain containing 16), while the WAT markers Hoxc8, Hoxc9 and Dpt are
expressed in the MYF5+ WAT cells. Thus, MYF5+ precursors may give rise to a
subset of white adipocytes in addition to brown adipocytes. β3-adrenoreceptor
stimulation induces beige adipocytes to arise from both MYF5+ and MYF5- cells
in WAT (104). Surprisingly however, when isolated from the same mouse
subcutaneous WAT depot, MYF5+ cells express lower levels of brown and beige
WAT adipocyte precursor
Endothelial precursor
Muscle satellite cell
BAT adipocyte precursor
MYF5 -
Mesenchymal precursors
White UCP1 - Beige UCP1 + Brown UCP1 +
Adipocyte precursor lineage origins
Adult origins
Mature adipocytes
MYF5 +
37
adipocyte markers than MYF5- cells, indicating that MYF5- progenitors in WAT
may be more prone to browning (105).
Adipose tissues and homeostasis
In excess nutrient availability, energy is captured by WAT via glucose and lipid
uptake, lipogenesis and inhibition of lipolysis, which are regulated by insulin
(reviewed in (34)). Responses to energy deficits, such as fasting or increased energy
expenditure due to cold exposure, are regulated by the sympathetic nervous system
(SNS) (34). SNS neurons release noradrenaline from their nerve endings to transmit
signals, after which noradrenalin binds to adrenergic receptors on the target organ
(reviewed in (107)). In WAT, β-adrenergic SNS stimulation induces lipolysis in
which triglycerides are dissipated into glycerol and free fatty acids. WAT lipolysis
is regulated from the hypothalamus by neurons expressing neuropeptide Y (NPY)
and melanocortin. Insulin and leptin both inhibit NPY neurons, while they have
opposite effects on SNS output towards WAT. Insulin decreases and leptin increases
SNS activation with subsequent inhibition and induction of lipolysis in WAT,
respectively (107). SNS-mediated BAT thermogenesis and triglyceride-clearance
as well as SNS-innervation of BAT are controlled by the hypothalamus and other
brain regions (reviewed in (81)). Generally, increased SNS outflow toward BAT
results in increased triglyceride clearance and combustion to heat. Binding of
noradrenalin to β3-adrenergic receptor in BAT results in increased UCP1 synthesis
and lipolysis with increased fatty acid flux to mitochondria for combustion (81). In
addition, several SNS-independent routes for thermogenic response, such as irisin,
vitamin A derivatives, bile acids and FGF21, have been identified. This is an
intriguing field of research, specifically since anti-obesity drugs activating BAT via
global SNS activation have been associated with cardiovascular side effects. Thus,
drugs activating BAT thermogenesis independently of SNS may yield in a safer
way to induce negative energy balance and weight loss (reviewed in (108)).
Adiponectin and leptin
Adipokines, i.e., adipose tissue cytokines are secreted from adipose tissue to
modulate the metabolism and function of other distant targets such as central
nervous system, skeletal muscle, liver, cardiovascular system, and pancreas.
Numerous adipokines have been identified from which adiponectin and leptin are
introduced next in more detail. Expression of the adiponectin gene Adipoq is
38
regulated by transcription factors such as peroxisome proliferator activated
receptor γ (PPARγ) and C/EBPs. Adiponectin maintains “healthy” adipose tissue
expansion, which enhances lipid storage and insulin sensitivity. Decreased plasma
adiponectin level is associated with obesity and type 2 diabetes in humans
(reviewed in (109, 110)). Circulating leptin levels are inversely correlated with fat
mass. In the hypothalamus, leptin binds to receptors that stimulate anorexigenic
peptides and in skeletal muscle, liver and pancreatic β cells, it reduces intracellular
lipid levels with subsequent improvement in insulin sensitivity. Absence of either
leptin or leptin receptor leads to severe obesity mainly due to hyperphagia
(reviewed in (111)). In addition, leptin is decreased after fasting, indicating other
regulation of its secretion aside from fat mass (109).
2.4.2 Adipogenesis
Adipocyte differentiation, i.e., adipogenesis, consists of chronological changes in
the expression of genes that eventually determine the adipocyte phenotype. It is
divided into three distinct phases: (i) lineage commitment of stem cell, (ii)
determination of committed preadipocyte and finally (iii) terminal differentiation
into mature adipocyte (Fig. 4). While WAT and BAT adipocytes derive from distinct
mesenchymal progenitors, they share a similar transcription factor cascade.
39
Fig. 4. Overview of adipogenesis. Several pro- and anti-adipogenic factors participate
in maturation of mesenchymal stem cell first to preadipocyte and then to mature
adipocyte. BMP bone morphogenetic protein; Wnt wingless-type MMTV integration site;
C/EBP CCAAT/enhancer binding protein; PPARγ peroxisome proliferator activated
receptor γ. Modified from (112).
Lineage commitment
Adipocytes originate from pluripotent mesenchymal stem cells (MSCs) that have
the capability to develop into several cell lines such as adipocytes, osteoblasts,
chondrocytes, neurons and myocytes (reviewed in (113)). These stem cells can be
isolated from various human and mouse tissues. In adipose tissue, MSCs reside in
the vasculature, specifically in the endothelium (100-102). Several signaling
pathways participate in the lineage commitment of MSC to differentiate into
adipocyte. These pathways include Bone morphogenetic protein (BMP) signaling,
Wingless-type MMTV integration site (WNT) signaling, Hedgehog (HH) signaling
and NOTCH signaling (113, 114). Since lineage determination is regulated by a
network of signaling pathways and MSC may have several destinies, it is the
balance of the signaling factors that ultimately determines the lineage. In addition,
one pathway may often simultaneously promote one lineage and inhibit another
(114).
Mesenchymal stem cell Committed preadipocyte Mature adipocyte
BMP4
BMP2
Pro-adipogenic factors
Wnt5b
miR-26 miR-193b-365 miR-378
Wnt5a
Wnt10b
miR-27 miR-130 miR-155 miR-196a miR-106b-93
Extracellular matrix stiffness Increased mechanical tension Low cell confluence
Determination Terminal
differentiation
Anti-adipogenic factors
C/EBPα C/EBPδC/EBPβ PPARγ
C/EBP signaling cascade
40
BMPs are members of the transforming growth factor β (TGFβ) superfamily
that have pleiotropic effects on various cells during development (115). BMP4
induces an adipogenic commitment in mouse C3H10T1/2 stem cells, a commercial
in vitro model for MSCs (115). Together with specific cofactors, BMP2 at low
concentration induces adipogenic lineage commitment whereas a high dose drives
osteogenic and chondrogenic differentiation (113, 116). Also cell shape is
implicated in stem cell fate decision. This occurs via RhoA GTPase and its effects
on Rho kinase (ROCK)-mediated cytoskeletal tension (117). Specifically, low level
of RhoA induces adipogenic differentiation of hMSC, while high level results in
osteogenic commitment even without traditional differentiation cocktails (118).
WNTs are a family of secreted glycoproteins acting in an autocrine and
paracrine manner to regulate tissue homeostasis and remodeling (119). Two distinct
routes for WNT actions are the canonical pathway that acts via β-catenin and the
non-canonical pathway that is independent of β-catenin (reviewed in (119, 120)).
The canonical WNT inhibits β-catenin phosphorylation, which stabilizes it and
results in increasing amount of cytoplasmic β-catenin that can enter into the nucleus.
In the nucleus, β-catenin dimerizes with specific transcription factors by displacing
their corepressors and subsequently regulates the transcription of target genes (120).
Disruption of β-catenin signaling induces adipogenesis while stabilization of β-
catenin induces osteogenesis (121, 122). The non-canonical WNT pathway is more
divergent and leads to regulation of intracellular activity of such enzyme as
CaMKII which, interestingly, is also associated with FTO as discussed in chapter
2.2.3 (120). Generally, the canonical WNT pathway inhibits adipogenesis by
inhibition of PPARγ and C/EBPα whereas the non-canonical pathway promotes
adipogenesis by antagonism of the canonical pathway (123-125).
Similarly to canonical WNT, HH signaling inhibits adipogenesis and promotes
osteogenesis during MSC lineage commitment (126, 127). While HH signaling is
downregulated during adipocyte differentiation, its inhibition is not sufficient to
activate adipogenesis in hMSCs (127). Interestingly, HH signaling is decreased in
human and mouse obesity, indicating that increased HH activity inhibits adipose
tissue expansion in vivo (128, 129). Furthermore, IFNγ is elevated in obesity and
opposes the HH-induced repression of adipogenesis, suggesting that HH plays a
role in adipocyte hyperplasia and pathophysiology of obesity (129). Evidently,
NOTCH signaling has a dual role in adipogenesis since both constitutive
expression and downregulation of Hes1, a target of NOTCH, reduces adipogenesis
(130). C/EBPβ is unaltered while C/EBPα and PPARγ are completely blocked due
to retroviral overexpression of Hes1 while knockdown of Hes1 induces an increase
41
in preadipocyte factor 1 (PREF1), which is anti-adipogenic. PREF1 is increased in
preadipocytes and down-regulated prior to terminal differentiation being absent in
mature adipocytes, indicating that NOTCH signaling is also a prerequisite for
adipogenesis via inhibition of PREF1 (130).
Mitotic clonal expansion and determination
MSCs become preadipocytes when they lose their ability to differentiate into other
mesenchymal lineages, thus becoming ‘committed’ to the adipocytic lineage.
Several, but not all, cellular models of adipogenesis require few rounds of cell
division between lineage commitment and determination (reviewed in (131). This
event is named mitotic clonal expansion (MCE) and while it has not been
established as an unequivocal requirement for adipogenesis in all cellular models
(incl. human bone marrow MSCs), several cell cycle proteins that regulate mitosis
also regulate adipocyte differentiation supporting MCE to be a valid phase of
adipogenesis in vivo (131). C/EBPβ and δ are the main transcription factors acting
during the determination phase of adipogenesis (132). C/EBPβ/δ are distributed
diffusely into nucleus between 4 and 12 h after differentiation induction; however,
they begin to localize to centromeric satellite DNA between 12 and 24 h as the
preadipocytes enter S phase. This coincides with the phosphorylation of
retinoblastoma (RB), an important hallmark of cell cycle progression into S phase
(133). RB signaling evidently affects MCE by association with C/EBPβ, resulting
in inhibition of C/EBPβ-DNA binding (132). Phosphorylated RB is not able to
inhibit C/EBPβ, which couples the RB phosphorylation with C/EBPβ activation
subsequently driving adipogenesis onwards (132). Interestingly, while C/EBPβ/δ is
expressed rapidly after differentiation induction (within 4 h) of 3T3-L1
preadipocytes, expression of C/EBPα is induced much later, about 30 h after
differentiation is initiated (133). Furthermore, C/EBPα becomes associated with
centromeric satellite DNA between 24 and 48 h after induction of differentiation,
permitting C/EBPβ/δ to bind its promoter. Thus, C/EBPβ/δ become associated with
centromeres, possibly via RB phosphorylation, at the onset of MCE and
subsequently gain the ability to bind and activate C/EBPα promoter. C/EBPα is
anti-mitotic; the indicated time lag between C/EBPβ/δ and C/EBPα activation may
thus be crucial for MCE to be completed (133).
42
Terminal differentiation
C/EBPβ and δ activate the expression of PPARγ and C/EBPα by direct binding to
their promoters to complete the differentiation of preadipocyte into mature
adipocyte (133). Furthermore, C/EBPα and PPARγ synergistically activate each
other and the adipogenic genes to achieve and maintain the mature adipocyte
phenotype (134). C/EBPα colocalizes with the majority of PPARγ binding sites and
of genes upregulated during adipogenesis, 60% are bound by both C/EBPα and
PPARγ, while 25% are bound only by C/EBPα and only 3% by PPARγ (135).
C/EBPα and PPARγ targets include genes involved in insulin sensitivity,
lipogenesis and lipolysis, such as glucose transporter 4 (Glut4), fatty acid binding
protein 4 (Fabp4), lipoprotein lipase (Lpl), 1-acylglycerol-3-phosphate O-
acyltransferase 2 (Agpat2), perilipin and secreted adipokines adiponectin and leptin
(reviewed in (136)).
C/EBPα is a transcription factor most abundantly expressed in adipose tissue,
placenta and liver (137). Homozygous Cebpa-KO mice die within 8 hours after
birth due to severe hypoglycemia resulting mainly from defects in the liver.
Adipocytes of Cebpa-KO neonates are devoid of lipid droplets; however, these
mice frequently do not suckle after birth, which makes it unclear whether the failure
to accumulate fat is due to defects in adipocytes or secondary to absence of
substrates (137, 138). To overcome the problem of reduced viability, a conditional
Cebpa-KO mouse line was established in which Cebpa gene is under albumin
promoter, thus Cebpa is expressed only in the liver (138). BAT of these conditional
Cebpa-KO mice is unaltered while WAT is almost completely absent. Interestingly,
mammary WAT is present and morphologically similar to WT, indicating that some
adipose lineages have C/EBPα dependence, whereas others do not (138). Krüppel-
like factor 3 (KLF3), together with a corepressor CtBP (C-terminal binding protein),
represses Cebpa transcription by direct binding to its promoter with subsequent
inhibition of adipogenesis (139). In addition, early B cell factors (EBF) 1 and 2
bind and activate Cebpa and Pparg promoters to induce adipogenesis (140).
Nuclear hormone receptor PPARγ is a ligand-activated transcription factor,
which in adipose tissue acts in heterodimer with retinoid X receptor α (RXRα) and
induces genes important in adipose tissue homeostasis, function and signaling.
PPARγ has two isoforms transcribed by alternative promoter usage and alternative
first exon (reviewed in (141)). PPARγ2 is more potent in adipose tissue while
PPARγ1 also has some adipogenic action. Natural ligands for PPARγ include
polyunsaturated fatty acids, long-chain monounsaturated fatty acids and phytanic
43
acid (142). Synthetic ligands such as thiazolidinedione (TZD) class of anti-diabetic
drugs are widely used as PPARγ agonists to increase insulin sensitivity in type 2
diabetes via increased adipogenesis. In addition, TZD is one of the main ingredients
of the standard adipogenic cocktail in cellular studies (141). Several KLF
transcription factors regulate PPARγ; for example, KLF2 inhibits Pparg promoter
activity while KLF5 and KLF15 activate it (143-145). In addition to coregulation
with C/EBPα, PPARγ has its own coactivators (141). One of these is PPARγ
coactivator 1α (PGC1α), which has a crucial role in brown adipogenesis and
browning of white adipocytes. Interestingly, PGC1α-mediated activation of PPARγ
does not activate all PPARγ target genes. For example, PGC1α together with
PPARγ induce Ucp1, a BAT specific gene, but not fatty acid binding protein 4
(Fabp4), which is expressed in WAT and BAT (141). This tissue and gene
specificity is obtained by phosphorylation of PGC1α which only occurs in BAT
adipocytes and leads to recruitment of phosphorylated PGC1α to PPARγ binding
site on Ucp1 promoter (146).
2.4.3 Adipose tissue miRNA
MiRNAs are post-transcriptional regulators of gene expression 21 to 24 nucleotides
(nt) in length, usually affecting mRNA translation by binding (reviewed in (147)).
MiRNA may be expressed from intron of its host gene, when the expression occurs
jointly with the host mRNA, or it can have its own promoter, which enables
independent expression (148). MiRNA target sites are usually located at the 3’UTR
or coding region of mRNA. MiRNA biogenesis is illustrated in Fig. 5. Generally,
miRNAs act as repressors of mRNA translation, although miRNA-mediated up-
regulation of mRNA expression has also been reported (147). Translation activation
by miRNAs, while being less reported than repression, is prominent in specific
situations such as mouse germ cell development (149). Mechanisms for the
activation are not completely resolved, but they include increase of mRNA stability
or translation efficiency, relief of miRNA repression and direct miRNA-induced
activation (149).
44
Fig. 5. Biogenesis of microRNA. (1) RNA polymerase II (Pol II) transcribes several
hundred nt-long primary miRNA (pri-miRNA) from DNA after which miRNA stem loop is
excised from pri-miRNA by ribonuclease drosha together with RNA binding protein
DGCR8. (2) This approximately 70 nt-long hairpin, now called precursor miRNA (pre-
miRNA), is exported from nucleus by exportin-5. (3) Dicer, a cytoplasmic ribonuclease,
removes the hairpin loop from pre-miRNA creating a double-stranded miRNA duplex
from which one or both strands can be incorporated into multiprotein RNA-induced
silencing complex (RISC). (4) After this, the miRNA molecule may have three destinies;
(a) perfect pairing with target site of mRNA leads to mRNA cleavage, degradation and
repression of mRNA by RISC protein argonaute (AGO), (b) partial pairing results in
mRNA deadenylation in which polyA tail is excised by CCR4-NOT complex, leaving
mRNA vulnerable to ribonuclease activity, or (c) partial pairing may cause RISC-induced
repression by blocking mRNA translation initiation, or reading in mechanisms such as
ribosome drop-off from mRNA or destabilization of mRNA binding cap protein. Modified
from (148).
Interestingly, 67% of mRNA 3’UTRs with m6A contain also one or more predicted
miRNA binding sites, indicating interactions between m6A and miRNA pathways
(28). Furthermore, m6A peaks within miRNA binding sites are more enriched near
the 3’ end of 3’UTR, which is opposite to the distribution of m6A sites in mRNA
where m6A are most abundant near the stop codons and generally decrease in
frequency along 3’UTR length. This may indicate that a spatial separation is
required for m6A to influence the function of a downstream-bound miRNA or vice
5' UTR
Pri-miRNA
Pr -miRNAe
Pr -miRNAe
miRNA duplex
Host gene
RNA polymerase II
Drosha
DGCR8
Dicer
Passenger strandLeading strand
RISC
Translational inhibition
or inhibition of mRNA cap binding protein
Deadenylation and mRNA degradation
Direct mRNA cleavage by AGO
(c) Partial binding
( ) Partial bindingb
RISC RISC
RISC
( ) Perfect bindinga
Degraded or also incorporated into RISC
Normal translation
Ribosome
RNAse
CCR4-NOT
AAAAA
AAAAAAAA
AAAAAAAAAAAAAAAAGO
AGO
AGO
AGO
mRNA
mRNA
mRNAmRNA
Nucleus
Cytoplasm
Protein
GDP-Ran
Exportin-5
AAAAAAAAAA
mRNA cap
binding protein
GW182
5' UTR
5' UTR
5' UTR
3' UTR
3' UTR
3' UTR
3' UTR
5'
3
1
2
by, for example, ribosome drop-off
45
versa (28). A recent study shows mechanistic evidence for a role of m6A in miRNA
processing (150). METTL3 recognition motif GGAC, which is also part of the m6A
consensus sequence, is enriched in pri-miRNA, but not in pre-miRNA. Knockdown
of METTL3, resulting in reduced m6A levels, causes downregulation of mature
miRNA expression, while METTL3 overexpression increases mature miRNA
levels (150). Accumulation of unprocessed pre-miRNA is observed due to loss of
METTL3, indicating that m6A is necessary for pre-miRNA processing. RNA
binding protein DGCR8 binds equally methylated and unmethylated RNA,
suggesting that m6A is not a direct signal for binding of DGCR8. Messenger RNA
tends to form secondary structures such as hairpins similar to pri-miRNA, thus a
potential role of pri-miRNA m6A may be to distinguish pri-miRNA from mRNA
hairpin and facilitate the recognition of pri-miRNA structures by DGCR8 (150).
Several miRNAs have been reported to either induce or suppress adipogenesis
and adipose tissue browning (summarized in Table 3). The majority of miRNAs
involved in adipose tissue suppress their target mRNAs; however, a subset of
miRNAs enhance the translation. A selection of key miRNAs involved in WAT and
BAT adipogenesis as well as browning of WAT is introduced next (reviewed in (29,
30)).
Table 3. Selection of miRNAs involved in white and brown adipogenesis as well as
browning of white adipose tissue. Modified from (29, 30).
miRNA Target gene Effect on adipogenesis Regulator (Ref)
BAT WAT Beige
miR-26a/b Adam17*, Ucp1 ↑ ↑ ↑ Cold temperature (151)
miR-27a/b Pparg*, Prdm16, Pgc1b,
Ppara,
↓ ↓ ↓ Cold temperature (152, 153)
miR-106b-93 Ucp1, Prdm16, Ppara*?,
Pgc1a
↓ (154)
miR-130a/b Pparg* ↓ ↓ (155)
miR-155 Cebpb*, Pgc1a, Ucp1 ↓ ↓ TGFβ1 (156)
miR-193b-365 Runx1t1*, Pparg, Cebpa ↑ ↑ PRDM16, PPARα* (157)
miR-196a Runx1t1* → ↓ ↑ Cold temperature (158)
miR-378 Cebpa*?, Cebpb*?,
Runx1t1*
→1 Cold temperature (159)
* Direct binding; 1 Increased lipogenesis; Adam17 a disintegrin and metallopeptidase domain 17; Ucp1
uncoupling protein 1; Pparg peroxisome proliferator activated receptor γ; Prdm16 PR domain containing
16; Pgc1b PPARG coactivator 1 β; Ppara peroxisome proliferator activated receptor α; Pgc1b PPARG
coactivator 1 α; Cebpa CCAAT/enhancer binding protein α; Cebpb CCAAT/enhancer binding protein β;
Runx1t1 runt-related transcription factor 1; TGFβ1 transforming growth factor β 1
46
Pro-adipogenic miRNAs
Members of the miR-26 family, miR-26a and b, are upregulated during early
adipogenesis of human multipotent adipose-derived stem cells (151). Inhibition of
both miR-26a and b results in inhibition of adipogenesis while overexpression leads
to accelerated adipocyte differentiation. Furthermore, miR-26 induces pathways
related to energy dissipation and shift the mitochondrial morphology towards beige
adipocyte characteristics, indicating miR-26 to be important in the browning
process. These pro-adipogenic and pro-browning effects of miR-26 are mediated
by blunting of a disintegrin and metallopeptidase domain 17 (Adam17) mRNA
translation via direct binding its 3’UTR. Adam17 knockdown induces a phenotype
similar to miR-26a/b overexpression such as increased lipid accumulation at early
differentiation stage and increased Ucp1 expression at all stages. Furthermore, BAT
of mice exposed to cold temperature exhibits increased miR-26 and Ucp1
expression while Adam17 is downregulated, indicating that the miR-26 family is
important also in BAT-induced thermogenesis (151).
Expression of the miR-193b-365 cluster is upregulated during brown
adipogenesis (160). Markers shared by both WAT and BAT such as Pparg, Cebpa,
Adipoq, Glut4 and Fabp4 are downregulated due to miR-193b-365 inhibition in
SVF cells isolated from mouse BAT as well as subcutaneous WAT (scWAT).
Similarly, BAT-specific genes are decreased upon miR-193b-365 inhibition in BAT
and scWAT preadipocytes supporting a role also in browning. Expression of miR-
193b is induced by PRDM16 via PPARα, a BAT-specific member of PPAR
transcription factors. PPARα is able to bind the miR-193b-365 promoter region and
this effect is observed only in preadipocytes, indicating that miR-193b-365 is
important during adipogenesis but not in mature adipocytes. Specifically, miR-
193b has a binding site in the 3’UTR of Runx1t1 mRNA, an inhibitor of
adipogenesis. Furthermore, several myogenic markers are increased due to miR-
193b-365-knockdown, indicating that the lineage commitment is affected. Indeed,
miR-193b-knockdown in C2C12 myoblasts represses myogenesis and induces
adipogenesis with lipid droplet containing morphology similar to adipocytes and
expression of adipocyte markers at levels comparable to cultured brown adipocytes
(157). These in vitro results have been challenged by in vivo studies using miR-
193b-365-/- mice, which develop normal BAT, thus indicating that miR-193b-365
is not a prerequisite for brown adipogenesis. The reason for this discrepancy has
not yet been resolved, but one possibility is that in vivo, other miRNAs may
compensate for the absence of miR-193b-365 (160).
47
Similarly, miR-378 is upregulated during adipogenesis of 3T3-L1
preadipocytes and ST2 mesenchymal stem cells (159). Its overexpression
stimulates lipogenesis with no effect on adipogenesis or β-oxidation and leads to
increased lipid droplet size in mature adipocytes. Expression of Pparg and Glut4 is
increased due to miR-378 overexpression. Transactivation of Glut4 promoter by
C/EBPα and β is increased in miR-378 overexpressing cells, indicating that the
effects on lipid synthesis and adipocyte gene expression are mediated at least partly
through coactivation of C/EBP transcription factors. Inhibition of miR-378
decreases triacylglycerol and phospholipid synthesis in 3T3-L1-derived adipocytes
(159).
Anti-adipogenic miRNAs
MiR-130 family members miR-130a and b reduce white and brown adipogenesis
by repressing Pparg mRNA translation via direct binding to its coding and 3’UTR
regions (155). Furthermore, miR-130 is decreased (with subsequent increase in
Pparg) in the adipose tissue of obese women compared with that of non-obese.
Overexpression of miR-130 in human preadipocytes leads to decreased Pparg, Lep
and Adipoq expression. Thus, miR-130 is suggested to prevent unscheduled
differentiation, the regulation of which may be disrupted in obesity contributing at
least in part to altered adipokine production (155). MiR-155 is induced during early
adipogenesis and declines after the induction of differentiation (156). Inhibition of
miR-155 in brown preadipocytes leads to increased lipid accumulation
accompanied by increased Cebpb, Cebpa, Pparg and Fabp4 expression, indicating
that miR-155 is a repressor of adipogenesis. Furthermore, miR-155 has a negative
role also in BAT thermogenesis since its inhibition increases the expression of Ucp1
and Pgc1a. Regulation of miR-155 occurs via TGFβ1-mediated SMAD4 signaling.
Once induced by TGFβ1, miR-155 downregulates Cebpb mRNA expression via
direct interaction with its 3’UTR. Interestingly, the miR-155 promoter contains a
binding motif for C/EPBβ indicating that miR-155 may be regulated by its own
target, which is further supported by the finding that Cebpb overexpression
decreases and downregulation increases miR-155 expression in brown
preadipocytes. In scWAT, miR-155 has similar inverse effects on Ucp1 and Pgc1a
as observed in BAT indicating that miR-155 represses also the browning of WAT
(156).
Members of the miR-27 family (a and b) are downregulated during BAT, WAT
and beige adipogenesis (152, 153). Inhibition of miR-27a/b in preadipocytes
48
isolated from subcutaneous and visceral WAT stromal vascular fraction (SVF) as
well as immortalized brown adipocytes leads to increased expression of BAT
markers Prdm16, Ucp1, Pparg, Ppara, Pgc1a, Adrb3, Cidea and Fabp4 suggesting
increased browning potential and adipogenesis. Overexpression leads to full
repression of Prdm16, indicating that miR-27 is a major negative regulator of
brown adipogenesis. During white adipogenesis, overexpression of miR-27b
inhibits translation of Pparg and Cebpa mRNA via direct binding to Pparg 3’UTR
(153). MiR-196a suppresses the expression of white-specific Hoxc8 during
browning of human scWAT progenitor cells with subsequent increase in brown
markers in vitro (158). Hoxc8 mRNA contains miR-196a binding site in its 3’UTR,
indicating a direct interaction. Furthermore, cold exposure and β3-adrenergic
stimulation decrease HOXC8 protein expression and increase miR-196a expression
in mouse scWAT and BAT, but to a lesser extent in epididymal WAT (eWAT), which
is known to be the WAT depot least prone to browning. However, miR-196a
expression is lower in BAT than scWAT, is not altered during SVF brown
preadipocyte differentiation and endogenous Hoxc8 is not detected in BAT. Thus,
miR-196a may regulate beige but not brown adipogenesis (158). Cluster of miR-
106b and miR-93 also possess anti-adipogenic function since inhibition of miR-
106b-93 in brown preadipocytes leads to increased BAT marker and Adipoq
expression. Sequence analysis indicates that Ppara is a potential target for direct
miR-106b-93 binding; however, this has not yet been functionally verified (154).
49
3 Aims of the study
The overall aim of this study was to reveal new insights into the role of FTO in
adipose tissue. The specific aims were:
1. To characterize the metabolic phenotype of a new Fto-deficient mouse model
2. To assess the role of Fto and high-fat diet in gene expression related to white
and brown adipogenesis and function as well as the browning process of white
adipose tissue
3. To determine the role of Fto in microRNA expression in the above-mentioned
processes.
50
51
4 Materials and methods
4.1 Generation of Fto-KO mice (I)
The KO-construct targeting the second intron of the Fto gene is illustrated in Fig.
6. The Fto-KO mice used in the experiments, contain the whole KO-cassette in
their genome which, due to polyadenylation signal, causes termination of Fto gene
transcription inside the second intron without deleting any part of the gene.
Fig. 6. Fto-knockout construct targeting the second intron of mouse Fto gene
disrupting the transcription and leading to production of truncated mRNA. Arrows are
primer binding sites used in genotyping; E1-E9 exons 1-9; En2SA En2 splice acceptor;
β-geo fusion of β galactosidase and neomycin resistance genes; pA polyadenylation
signal; UTR untranslated region; Frt flippase recognition target site; loxP locus of
crossover in P1 site.
To generate an Fto-KO mouse line, C57BL/6N embryonic stem (ES) cells targeted
with the KO-construct were obtained from the European Conditional Mouse
Mutagenesis Program (EUCOMM). ES cells (clone EPD0103_5_G10) were
injected in blastocyst injections to C57BL/6JOlaHsd females in the transgenic core
facility of Biocenter Oulu. Transgenic mice were backcrossed to the
C57BL/6JOlaHsd background for up to three generations in the Laboratory Animal
Center, University of Oulu. WT controls were C57BL/6JOlaHsd mice and all the
experiments were conducted on male mice. The animal experiments were approved
by the University of Oulu Animal Ethics Committee and the Southern Finland
Regional State Administrative Agency (license numbers ESLH-2008-06715/Ym-
23 and ESAVI/4464/04.10.03/ 2011) and followed national Finnish legislation, the
European Convention for the protection of vertebrate animals used for
experimental and other scientific purposes (ETS 123) and EU Directive
2010/63/EU.
E2E1
E1
E4Targeted allele
Mutant transcript
Wild-type transcript
En2 SA β-geo pAFrt Frt loxP loxP
E3 E5 E6 E7 E8 E9 UTR
Neo FtoFto Neo
En2 SA β-geo pAE2
E3E1 E4 E8 E9E7E6E5E2
52
Genotype was confirmed using primers specific for Fto and Neo (Table 4).
Polymerase chain reaction (PCR) protocol for Fto primers was: 95°C for 12 min,
30 cycles of (denaturation at 94°C for 30 sec, annealing at 50°C for 30 sec,
extension at 72°C for 45 sec), 72°C for 10 min, 10 °C for 1 min and 4°C forever.
Neo PCR was the same as Fto except that the annealing temperature was 55°C and
the number of cycles 32.
Table 4. Primer sequences for genotyping the transgenic mice. Primers were purchased
from Sigma-Aldrich (St. Louis, MO, USA) and the sequences are indicated from 5’ to 3’
end.
Gene Forward primer 5’ – 3’ Reverse primer 5’ – 3’
Fto TTACTGCATTCTCTTCCAGAGAGG ACGCCCAGACACTCTCCAGTGAGC
Neo TGTCATCTCACCTTGCTCCTG TCAAGAAGGCGATAGAAGGCG
4.2 Dietary treatment (I)
Male mice were housed in the Laboratory Animal Center, University of Oulu at
21±2°C temperature on 12/12-hour dark-light cycle with ad libitum access to water
and either CD or HFD. At six weeks of age, mice were allocated into four groups
according to genotype and diet: WT on CD (n=9), Fto-KO on CD (n=5), WT on
HFD (n=9) and Fto-KO on HFD (n=8). CD contained 10 kJ-% fat, 20 kJ-% protein
and 70 kJ-% carbohydrate (total energy 16.1 kJ/g) and HFD consisted 45 kJ-% fat,
20 kJ-% protein and 35 kJ-% carbohydrate (total energy 19.8 kJ/g) (D12450B and
D12451, Research Diets, New Brunswick, NJ, USA). The dietary treatment lasted
16 weeks during which the mice were weighed every two weeks and eventually
sacrificed by carbon dioxide inhalation and cervical dislocation. Specimens of
eWAT, scWAT from inguinal region and interscapular BAT were snap-frozen in
liquid nitrogen and stored at -70°C until subsequent protein and RNA isolations.
4.3 Metabolic and physical performance (I)
At the end of the 16-week dietary experiment, metabolic performance, physical
activity as well as water and food intake were analyzed in a home cage-based
monitoring system for laboratory animals (LabMaster TSE System, Bad Homburg,
Germany) as described previously in (161). Briefly, mice were housed in separate
cages and after one week of acclimatization, each of the following parameters was
measured every 30 minutes during a total period of 95 hours: water and food
53
consumption were measured by sensors attached to cage lids, O2 consumption, CO2
production, respiratory exchange ratio and heat production were determined by
indirect calorimetric system and physical activity including ambulatory and fine
movement was detected by infrared light-beam sensors around the cages.
4.4 Light microscopy and immunohistochemistry (I, II)
Adipose tissue depots (eWAT, scWAT and BAT) were fixed by immersion in 4%
paraformaldehyde in 0.1M phosphate buffer pH 7.4, overnight at +4°C. After
fixation, samples were dehydrated in ethanol, cleared in xylene and embedded in
paraffin. Serial sections with thickness of 3µm were obtained from each adipose
tissue depot specimens. One section was reserved for hematoxylin and eosin
staining to assess morphology and the others for immunohistochemical processing
to determine UCP1 protein expression in scWAT and BAT.
For immunohistochemistry, sections were incubated with rabbit polyclonal
anti-UCP1 (Abcam, Cambridge, UK) diluted by 1:1000 for scWAT and 1:200 for
BAT. To inactivate endogenous peroxidase, 0.3% hydrogen peroxide was used,
followed by normal goat serum to reduce nonspecific staining. Sections were
incubated in anti-UCP1 overnight at 4°C. Biotinylated HRP-conjugated goat anti-
rabbit IgG (Vector Laboratories, Burlingame, CA) was used as secondary antibody.
Histochemical reactions were performed using Vector's Vectastain ABC Kit
(Burlingame, CA) and Sigma Fast 3,3’-diaminobenzidine as substrate (Sigma, St.
Louis, MO), and sections were counterstained with hematoxylin. Sections were
imaged with Nikon Eclipse E800 light microscope using 40X objective and images
were captured with Nikon DXM 1200 digital camera. UCP1 expression was studied
in two mice in scWAT of WT in the HFD group and in three mice in all the
remaining groups.
4.5 Protein extraction and Western blotting (I)
To ascertain that FTO was absent at protein level, proteins from eWAT, scWAT and
BAT were extracted. Protein levels of adiponectin and leptin were studied from
eWAT only. The protocol proceeded as follows, 2.5 volumes of lysis buffer (20 mM
Tris-HCl pH 7.5, 150 mM NaCl, 1% Triton-X, 2 mM EDTA, 10X Protease
Inhibitor Cocktail (Sigma-Aldrich, St-Louis, MO, USA)) were added to 100 mg of
frozen tissue and homogenized with Tissue-Lyser LT (Qiagen, Hilden, Germany)
at +4°C for 2 min at 35 Hz, then centrifuged at +4°C for 10 min at 18000 x G.
54
Equal amounts of proteins were loaded to 4/20% SDS-PAGE gel and blotted to
nitrocellulose (FTO) or polyvinylidene fluoride (adiponectin and leptin)
membranes. The primary antibody for FTO was mouse anti-FTO (AG-20A-0088,
AdipoGen International, San Diego, CA, USA). Adiponectin antibody (PA1-054)
was obtained from Affinity Bioreagents (Golden, USA) and leptin antibody (500-
P68) from PeproTech (Rocky Hill, NJ, USA). Glyceraldehyde-3-phosphate
dehydrogenase (GAPDH, sc-25778, Santa Cruz Biotechnology, Dallas, TX, USA)
was used as loading control. The secondary antibody for FTO was donkey anti-rat
IgG (NBP1-73749, Novus Biologicals, Littleton, CO, USA) and for adiponectin,
leptin and GAPDH, donkey anti-rabbit IgG (NA934, GE Healthcare, UK).
Immunocomplexes were detected from the membranes using Pierce ECL Western
Blotting Substrate (Thermo Scientific, Rockford, IL, USA). Adiponectin and leptin
levels relative to the protein amount loaded to the gel were calculated from band
intensities using Fiji image analysis software (162).
4.6 Total RNA and miRNA isolation and cDNA synthesis (I, II)
Total RNA was isolated from 50-100 mg of frozen eWAT, scWAT and BAT
specimens. Tissues were homogenized using Tissue Lyser LT and QIAzol Lysis
Reagent according to manufacturer’s instructions (Qiagen, Hilden, Germany).
Total RNA and miRNA-enriched fraction were isolated separately from eWAT and
scWAT with RNeasy Mini kit and RNeasy MinElute Cleanup Kit. From BAT,
miRNA-included total RNA was isolated with miRNeasy Mini Kit (Qiagen, Hilden,
Germany). The quality and the concentration of total RNA were analyzed using
NanoDrop ND-1000 UV-Vis Spectrophotometer (NanoDrop Technologies,
Wilmington, DE, USA). Due to the small size of miRNAs, it was not possible to
measure the concentration of miRNA-enriched fraction with spectrophotometric
techniques, so fluorescence-based RediPlate 96 RiboGreen RNA Quantitation Kit
was used according to manufacturer’s instructions (Molecular Probes, Eugene, OR,
USA).
Genomic DNA was removed from total RNA with DNAase treatment after
which cDNA was synthetized from 500 ng of RNA using RevertAidTM First Strand
cDNA Synthesis Kit (Fermentas, Sankt Leon-Rot, Germany). MiRNA cDNA
synthesis was conducted from 100 ng of eWAT and scWAT miRNA-enriched
fraction and from 500 ng of BAT total RNA with qScript microRNA cDNA
Synthesis Kit (Quanta BioSciences, Gaithersburg, MD, USA).
55
4.7 Gene and miRNA expression studies (I, II)
Relative expression of genes and miRNAs related to WAT and BAT adipogenesis
as well as metabolism of adipose tissue and browning of scWAT was studied by
quantitative real-time reverse-transcriptase PCR (RT-qPCR) using the ΔΔCt
method (163). β-actin (Actb) and Gapdh were used as reference genes for gene
expression analysis whereas non-coding RNAs SNORD47 and SNORD85 were
used as internal references for miRNA expression studies. The primer sequences
and annealing temperatures for the gene expression studies are shown in Table 5
and for miRNA analysis in Table 6. The primers for the gene expression studies
were purchased from Sigma-Aldrich (St. Louis, MO, USA) and for miRNA studies
from Quanta BioSciences (Gaithersburg, MD, USA).
RT-qPCR reactions of gene expression studies were performed using iCycler
thermal cycler and iQ5 Real-Time Detection System with iQ SYBR Green
Supermix (Bio-Rad Laboratories, Hercules, CA, USA). The PCR protocol was:
95°C for 3 min, 40 cycles of (95°C for 10 sec, annealing temperature for 10 sec,
72°C for 10 sec) and then 72°C for 2 min. Melting curve analysis was included at
the end of every run with increasing temperature from 55°C to 95°C at 0.5°C
intervals, 10 sec at each temperature. MiRNA expression was studied with CFX96
Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) and
PerfeCTa SYBR Green SuperMix (Quanta BioSciences, Gaithersburg, MD, USA).
The PCR protocol for miRNAs was: 95°C for 2 min, 40 cycles of (95°C for 5 sec,
annealing temperature for 30 sec), after which melt curve was produced with
increasing temperature from 65°C to 95°C at 0.5°C intervals, 5 sec at each
temperature. Each sample was analyzed in duplicates with inter-run calibrator and
no-template control in every plate.
56
Table 5. Sequences and annealing temperatures of primers used in the RT-qPCR
studies. Primers were purchased from Sigma-Aldrich (St. Louis, MO, USA) and
sequences are indicated from 5’ to 3’ end.
Gene Forward primer 5’ – 3’ Reverse primer 5’ – 3’ Annealing °C
Actb TGGATCGGTGGCTCCATCCTGG CGCAGCTCAGTAACAGTCCGCCTA Several
Adrb3 CTCTAGTTCCCAGCGGAGTT CATAGCCATCAAACCTGTTG 62
Bmp4 AGCCGAGCCAACACTGTGAG GAGCTCTGCCGAGGAGATCAC 62
Cebpa ACGGCGGGAACGCAACAACA GCTTGCGCAGGCGGTCATTG 62
Cebpb CGCAACCTGGAGACGCAGCA GGCTCGGGCAGCTGCTTGAA 61
Fto GCGGAGGAACGAGAGCGGGA GCTGCCGGCCTCTCGGAAAA 61
Gapdh CCAATGTGTCCGTCGTGGATCT GTTGAAGTCGCAGGAGACAACC Several
Glut4 GAGCTGGTGTGGTCAATACG GTTCCAGCAGCAGCAGAG 60
Pgc1a ACAACAATGAGCCTGCGAAC GCTCCATCTGTCAGTGCATC 61
Pparg ACTCCCTCATGGCCATTGAG TGAGACATCCCCACAGCAAG 61
Prdm16 AACTGTGTCAAGGTGTTCAC GCATATGAATGGCTTCAC 59
Rxra CACCTGCCGAGACAACAAG GTTCTCATTCCGGTCCTTGC 60
Ucp1 TGCCTCACTCAGGATTGG GCTTGCATTCTGACCTTCAC 63
Table 6. Quanta BioSciences miRNA assay (Gaithersburg, MD, USA) information of
primers used in the miRNA expression studies.
miRNA Quanta BioSciences miRNA assay (ref#) Annealing °C
miR-26a hsa-miR-26a-5p (68676137) 60
mir-27a hsa-miR-27a* (68676138) 65
mir-93 HSMIR-0093 (69002641) 60
mir-130b MMIR-0130B* (69002636) 60
mir-155 MMIR-0155 (69002637) 60
mir-193b HSMIR-0193B-5P (69002642) 60
mir-365a HSMIR-0365A-5P (69002640) 60
mir-378a HSMIR-0378* (69002632) 60
mir-455 HSMIR-0455-5P (69002644) 60
SNORD47 MM-SNORD47 (69002634) 60
SNORD85 MM-SNORD85 (69002633) 60
4.8 Statistics
Variable distributions were tested with Shapiro-Wilk test and variance equalities
with Levene’s test. Logarithmic transformation was applied for skewed distribution
and/or unequal variance. Weight development was analyzed with repeated
measures ANOVA, and since there was a significant interaction effect (Wilks’
Lambda p<0.001), also with two-way ANOVA and simple main effect analysis with
57
Bonferroni correction at individual time points. Phenotypic characteristics, protein
expressions as well as relative expression of genes and miRNAs were analyzed
with two-way ANOVA followed by simple main effect analysis with Bonferroni
correction if there was a significant interaction effect or possible moderation effect.
Since Fto expression was absent in Fto-KO specimens, the difference between
relative expression of Fto in WT mice after CD and HFD was analyzed with
Student’s t-test. P values lower than 0.05 were considered statistically significant
and results are expressed as mean and SEM. All analyses were conducted with IBM
SPSS Statistics software package version 20.0 (IBM, Armonk, NY, USA).
58
59
5 Results
5.1 Generation and characterization of Fto-KO mouse model (I)
The correct targeting of the knockout cassette was verified by PCR and the
depletion of FTO protein by Western blotting (Fig. 7). Genotypes of the pups
obtained from heterozygote matings were born in the normal Mendelian ratios.
Fig. 7. Genotyping of WT and Fto-KO mice by PCR. A 500-bp fragment was produced
from WT allele with Fto primers, which lack in the Fto-KO allele. Primers targeting the
neomycin resistance gene (Neo) produced a 475-bp fragment from the Fto-KO construct,
which was not present in WT allele. (b) Absence of FTO protein in Fto-KO mice was
confirmed with Western blot. Antibody against mouse FTO and donkey anti-rat IgG as
secondary antibody were used. Recombinant FTO (Rec.FTO) was used as a positive
control (60 kDa) which was run in the same 4/20% SDS-PAGE gel and blotted to
nitrocellulose membrane under the same experimental conditions as the samples.
Dotted lines indicate the cropping lines.
The weight of the animals did not differ in the beginning of the dietary experiment;
however, from the age of eight weeks onwards, the WT mice on HFD gained more
weight in comparison to other groups (Fig. 8).
1000 bp900 bp800 bp700 bp600 bp
500 bp
400 bp
Fto NeoWT Fto-KO Rec.
FTO WT Fto-KOFto Neo
(a) (b)
60
Fig. 8. Weight development of mice during 16 weeks of dietary experiment. WT wild-
type; Fto-KO Fto-knockout; CD control diet; HFD high-fat diet. Results are shown as
mean ± SEM (n=5–9 per group). Two-way ANOVA followed by simple main effects
analysis with Bonferroni correction because of the significant interaction effect in
repeated measures two-way ANOVA, **p < 0.01, ***p < 0.001 between WT and HFD
groups, except 1 between WT groups and 2 between HFD groups.
6 8 10 12 14 16 18 20 22
20
25
30
35
40
45
50
∗∗∗∗∗∗
∗∗∗
∗∗∗∗∗∗
∗∗∗∗∗∗1
∗∗2W
eig
ht
(g)
Age (wk)
WT CD
Fto-KO CD
WT HFD
Fto-KO HFD
∗∗1
61
Interestingly, despite a significant difference in weight of the WT and Fto-KO mice
on HFD, no genotypic-dependent differences were observed in water or food intake
or any other measures of energy expenditure (Table 7).
Table 7. Phenotype of mice after 16 weeks’ consumption of control or high-fat diet.
p value
Parameter
Diet
WT
Fto-KO
Effect of
Genotype
Effect of
Diet
Genotype
x diet
Final weight CD 31.5 ± 1.09a 28.2 ± 1.06 < 0.001 < 0.001 0.001
(g) HFD 45.4 ± 1.07 32.3 ± 1.64a
Water intake CD 3.74 ± 0.34 3.03 ± 0.26 0.35 < 0.001 0.14
(ml) HFD 2.28 ± 0.26 2.45 ± 0.22
Energy intake CD 62.7 ± 2.8 67.0 ± 5.3 0.33 0.77 0.82
(kJ) HFD 59.6 ± 7.9 66.7 ± 3.8
Heat production CD 95.3 ± 2.1 96.3 ± 1.7 0.79 0.12 0.99
(kJ/h) HFD 100.8 ± 3.7 101.7 ± 3.7
Heat production per weight CD 3.30 ± 0.11 3.56 ± 0.22 0.40 < 0.001 0.36
(kJ/h/g) HFD 2.64 ± 0.15 2.63 ± 0.11
Respiratory exchange ratio CD 45.1 ± 0.71 45.1 ± 1.03 0.53 < 0.001 0.48
(VCO2/VO2) HFD 37.9 ± 0.62 38.8 ± 0.37
Ambulatory movement CD 8429 ± 1577 10098 ± 1190 0.79 0.01 0.24
(counts) HFD 6596 ± 593 5527 ± 951
Fine movement CD 6546 ± 1169 7829 ± 774 0.66 0.09 0.30
(counts) HFD 5927 ± 400 5395 ± 790
Total movement CD 17480 ± 1312 17927 ± 1948 0.90 < 0.001 0.81
(counts) HFD 12523 ± 970 12386 ± 821
CD control diet; HFD high-fat diet; WT wild-type; Fto-KO Fto-knockout
Weight is indicated as mean ± SEM, metabolic and physical parameters are indicated as mean per day ±
SEM, n = 5–9 per group. P values are obtained with two-way ANOVA and simple main effects analysis
with Bonferroni correction if there was a significant interaction effect (genotype x diet), after which: ap <
0.001 compared with WT mice fed HFD.
5.2 Morphology of white and brown adipose tissue (I, II)
Morphology of eWAT was assessed with hematoxylin-eosin staining and scWAT
and BAT with UCP1-immunostaining (Fig. 9). Of these WAT depots, eWAT
represents a “pure” white adipose tissue as it is not prone to browning under
physiological conditions (164). This is in contrast to scWAT, which is reported to
be the most susceptible to browning (165). In the eWAT, WT mice on HFD showed
enlarged adipocytes, which was not observed in the Fto-KO on HFD. To analyze
62
the effect of Fto on browning of WAT, UCP1 protein expression with
immunohistochemistry of scWAT was assessed. In WT mice, adipocytes were
unilocular and mainly UCP1-negative while in Fto-KO scWAT, adipocytes were
multilocular and UCP1-positive. When fed HFD, adipocytes in scWAT of WT mice
were unilocular, hypertrophic and UCP1-negative whereas Fto-KO scWAT, while
containing unilocular and UCP1-negative adipocytes, included also small and
multilocular UCP1-positive cells. In BAT, UCP1 protein was expressed most
highly in Fto-KO mice which was also seen in Ucp1 gene expression (Fig. 14). In
addition, Fto-KO BAT did not accumulate lipid droplets on HFD similar to WT.
63
Fig. 9. Hematoxylin-eosin staining of mouse eWAT and UCP1-immunostaining of mouse
scWAT and BAT. WT wild-type; Fto-KO Fto-knockout; eWAT epididymal white adipose
tissue; scWAT subcutaneous white adipose tissue; BAT brown adipose tissue; CD
control diet; HFD high-fat diet. Scale bars are 50 μm (eWAT) and 60 μm (scWAT and BAT).
5.3 Fto gene expression in the WT adipose tissue (I)
To ascertain that the expression of Fto mRNA was absent in the Fto-KO mice, the
relative expression of Fto with RT-qPCR was examined. Fto expression was
undetectable in Fto-KO WAT and BAT depots. Interestingly, a 1.3-fold decrease of
Fto expression in eWAT of WT mice on HFD in comparison to WT on CD was
CD HFD
eWAT
WT
Fto-KO
CD HFD
scWAT
CD HFD
BAT
WT
Fto-KO
64
observed (Fig. 10). Furthermore, there was no such dietary effect in scWAT or BAT,
indicating a depot-specific metabolic change. The Fto level was increased by 2.4
fold in scWAT relative to eWAT. It was not possible to compare the expression of
Fto between WAT and BAT depots due to different inter-run controls during RT-
qPCR run setup.
Fig. 10. Relative expression of Fto in WAT and BAT of wild-type mice. eWAT epididymal
white adipose tissue; scWAT subcutaneous white adipose tissue; BAT brown adipose
tissue; CD control diet; HFD high-fat diet. The amount of Fto mRNA was normalized
using Actb and Gapdh as reference genes. Comparison between WAT and BAT depots
is not possible due to experimental conditions. Results are shown as mean ± SEM (n=9
per group). Student’s t-test, **p < 0.01.
5.4 Adipokine production from eWAT (I)
Protein levels of adiponectin and leptin from eWAT of WT and Fto-KO mice are
illustrated in Fig. 11. No difference was observed between WT and Fto-KO mice
on CD; however, adiponectin was reduced by 3.3-fold and leptin increased by 2.7-
fold in WT mice on HFD, the reduction that was not observed in Fto-KO.
eWAT scWAT
0.0
0.5
1.0
1.5
2.0
2.5
3.0
BAT
0.0
0.5
1.0
1.5
2.0
2.5
3.0
Fto
mR
NA
re
lati
ve
to A
ctb
an
d G
ap
dh
HFD CD
65
Fig. 11. Protein level of adipokines in eWAT. WT wild-type; Fto-KO Fto-knockout; CD
control diet; HFD high-fat diet. Band intensities were analyzed relative to protein
amount loaded to the gel. All samples were run under the same experimental conditions
and dotted lines indicate the cropping lines. Results are shown as mean ± SEM (n=6 per
group). Two-way ANOVA followed by simple main effects analysis with Bonferroni
correction because of the significant interaction effect, *p < 0.05, **p < 0.01, ***p < 0.001.
5.5 Gene expression related to WAT adipogenesis and function (I)
Relative expression of genes related to adipogenesis and adipose tissue function
were studied in eWAT of WT and Fto-KO mice (Fig. 12). In Fto-KO mice on HFD,
Bmp4 was at the same level as on CD; however, in WT mice on HFD, Bmp4 was
decreased by 2 fold compared with their CD counterparts. Interestingly, there was
no difference between Cebpb expression of WT and Fto-KO eWAT while HFD
consumption was associated with a 1.4- and 1.5-fold increase in Cebpb of WT and
Fto-KO eWAT, respectively.
Relative expression of Cebpa was at the same level between both genotypes
when fed CD; however, HFD introduced a 2.1-fold decrease in Cebpa expression
in WT, which was not observed in Fto-KO mice (Fig. 12). Pparg expression was
1.2-fold higher in Fto-KO mice compared with WT when fed CD. Furthermore, on
HFD Pparg was decreased by 2.2-fold in WT eWAT but only 1.3-fold in Fto-KO.
A similar trend was observed in Rxra expression, a heterodimeric counterpart of
PPARγ. The expression of Glut4 was unaltered between genotypes on CD; however,
HFD decreased the expression by 6.2-fold in WT which was not observed in Fto-
KO.
CD HFD
0.0
0.5
1.0
1.5
2.0
2.5
3.0
Fto-KO WT
Adiponectin
Re
lati
ve b
and
inte
nsi
ty
CD HFD
0.0
0.5
1.0
1.5
2.0
2.5
3.0
Leptin
Adiponectin
Leptin
GAPDH
WT KO WT KO CD HFD
66
Fig. 12. Relative expression of genes related to white adipogenesis in eWAT. WT wild-
type; Fto-KO Fto-knockout; CD control diet; HFD high-fat diet. The amount of mRNA
was normalized using Actb and Gapdh as reference genes. Results are shown as mean
± SEM (n=5-9 per group). Two-way ANOVA followed by simple main effects analysis with
Bonferroni correction because of the significant interaction effect or moderation effect,
*p < 0.05, **p < 0.01, ***p < 0.001.
5.6 Gene expression related to browning of WAT and BAT
adipogenesis and metabolism (II)
In the browning process, WAT adipocytes begin to resemble BAT adipocytes and
utilize energy instead of reserving it, resulting in an increase in the expression of
BAT-specific marker genes in the WAT (reviewed in (34)). Relative expression of
BAT-specific genes was analyzed in scWAT of WT and Fto-KO mice, since scWAT
has been shown to be most susceptible to browning in comparison to other WAT
depots (165). As shown in Fig. 13, the expression of Cebpb was increased by 1.4-
fold in Fto-KO mice compared with WT when mice were on HFD. Concurrently,
Pparg was increased by 1.6-fold in Fto-KO on HFD compared with WT. Compared
with mice on CD, the expression of Prdm16 was increased by 1.7-fold in Fto-KO
mice on HFD; this increase was not observed in WT. Adrb3 expression was at the
same level in Fto-KO scWAT fed either of the diets while HFD decreased Adrb3
by 3.1-fold in WT scWAT. The expression of Pgc1a was increased by 3-fold in Fto-
KO on HFD compared with WT on HFD.
Bmp4 CD HFD
0.0
0.2
CD HFD
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
Cebpb
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
Cebpa CD HFD
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
Pparg CD HFD
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
mR
NA
re
lati
ve
to A
ctb
an
d G
apd
h
CD HFD
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
Rxra CD HFD
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
Glut4
Fto-KO WT
67
Fig. 13. Relative expression of genes related to WAT browning in scWAT. WT wild-type
mice; Fto-KO Fto-knockout mice; CD control diet; HFD high-fat diet. The amount of
mRNA was normalized using Actb and Gapdh as reference genes. Results are shown
as mean ± SEM (n=5-9 per group). Two-way ANOVA followed by simple main effects
analysis with Bonferroni correction because of the significant interaction effect or
moderation effect, *p < 0.05, **p < 0.01, ***p < 0.001.
The relative expression of genes related to adipogenesis and metabolism in BAT of
WT and Fto-KO mice is illustrated in Fig. 14. In the BAT of Fto-KO mice on HFD,
Cebpb expression was increased by 1.3-fold which increase was not observed in
WT. There was no difference in Ucp1 expression between CD-fed mice. However,
it was increased by 1.5-fold in BAT of Fto-KO on HFD; this increase was not
observed in WT. Concurrently, Prdm16 expression was unaltered in Fto-KO mice
on either of the diets, while in WT on HFD its expression was decreased by 1.3-
fold compared with WT on CD. Compared with CD-fed mice, Adrb3 expression
was increased by 1.2- and 1.4-fold in the BAT of HFD-fed WT and Fto-KO mice,
respectively, without significant effect of genotype. The expression of Pgc1a was
increased by 1.4-fold in Fto-KO mice on HFD compared with WT mice.
Cebpb CD HFD
0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6
2.4 2.2 2.0 1.8
CD HFD
0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6
Pparg
2.2 2.0 1.8
2.4
CD HFD
0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6
2.4
Prdm16
2.2 2.0 1.8
CD HFD
0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6
Adrb3
2.2 2.0 1.8
2.4
CD HFD
0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6
2.4
Pgc1a
2.2 2.0 1.8
Fto-KO WT
mR
NA
re
lati
ve
to A
ctb
an
d G
apd
h
68
Fig. 14. Relative expression of genes related to BAT adipogenesis and metabolism in
BAT. WT wild-type mice; Fto-KO Fto-knockout mice; CD control diet; HFD high-fat diet.
The amount of mRNA was normalized using Actb and Gapdh as reference genes.
Results are shown as mean ± SEM (n=5-9 per group). Two-way ANOVA followed by
simple main effects analysis with Bonferroni correction if there was significant
interaction effect or moderation effect, *p < 0.05, **p < 0.01, ***p < 0.001.
5.7 Expression of miRNAs related to adipogenesis and adipose
tissue metabolism (II)
Several miRNAs have been reported to “fine-tune” the expression of genes related
to white and brown adipogenesis as well as browning of WAT (reviewed in (29, 30,
166)). As shown in Fig. 15, the expression of miR-130b, a repressor of Pparg (155)
in scWAT of HFD-fed mice was increased by 2.3-fold in WT but not in Fto-KO
mice. A similar pattern was observed in miR-155, a repressor of Cebpb (156). The
expression of miR-130b was approximately 1.7-fold decreased in BAT of Fto-KO
mice compared with WT irrespective of the diet. The expression of miR-378, which
has been shown to increase Pparg and Glut4 expression (159), was unaltered in
Fto-KO mice fed either of the diets while it showed a 1.4-fold decrease in WT on
HFD when compared with CD.
CD HFD
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
Pgc1a Cebpb CD HFD
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
CD HFD
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
Ucp1 CD HFD
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
Prdm16
1.8
CD HFD
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
Adrb3
Fto-KO WT
mR
NA
re
lati
ve
to A
ctb
an
d G
apd
h
effect of diet
69
Fig. 15. Relative expression of miRNAs related to beige and BAT adipogenesis. WT wild-
type mice; Fto-KO Fto-knockout mice; CD control diet; HFD high-fat diet. The amount
of miRNA was normalized using SNORD47 and 85 as internal controls. Results are
shown as mean ± SEM (n=4 per group). Two-way ANOVA followed by simple main
effects analysis with Bonferroni correction if there was significant interaction effect or
moderation effect, *p < 0.05, **p < 0.01, ***p < 0.001.
CD HFD
0.0
0.5
1.0
1.5
2.0
2.5
3.0
WT Fto-KO
miR-130b CD HFD
0.0
0.5
1.0
1.5
2.0
2.5
3.0
miR-155 CD HFD
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
miR-130b CD HFD
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
miR-378
miR
NA
rel
ati
ve t
o S
NO
RD
47
and
85
scWAT BAT
miR
NA
rel
ati
ve t
o S
NO
RD
47
and
85
effect of genotype
70
71
6 Discussion
6.1 Weight development (I)
The results of this study indicate that Fto-KO mice were resistant to diet-induced
obesity. After 16 weeks of dietary experiment, Fto-KO mice on CD weighed as
much as Fto-KO mice on HFD. Weight of WT mice on HFD was significantly
higher compared with mice on CD. Furthermore, food and water intake as well as
activity and energy expenditure were unaltered, which is in line with McMurray et
al. (17) but contradicts with an earlier Fto-deficient mouse model generated by
Fischer et al. (15). Previously published Fto-deficient mouse models differ in the
severity of the phenotype. Generally, mouse models containing a deletion of part
of the Fto gene possess a more severe phenotype with high postnatal mortality and
low body weight from the second postnatal day onwards (15-17). On the other hand,
an Fto-KO mouse model generated by Church et al. with point-mutation inside the
coding region of Fto and without deletion from the genome, possesses more subtle
phenotypic changes such as weight reduction as late as 12 weeks of age onwards
compared with WT and no postnatal mortality (18). The current mouse model was
similar to the latter one as our KO-model terminated Fto mRNA production inside
the second intron without deleting any part of the genome. This allows the
regulation of other genes to occur via non-coding regions of the Fto gene. Indeed,
recent studies indicate that the mechanism in which SNPs within human FTO affect
BMI may be via long-range regulatory alteration of iroquois homeobox 3 and 5
genes IRX3 and 5 (64, 65). IRX family members are important developmental
proteins during regionalization of cell differentiation (reviewed in (167)).
Interestingly, Irx3-deficient mice exhibited reduced body weight from an early age
compared with WT, indicating IRX3 to be also important in energy metabolism
(64).
In this study, only male mice were examined. In previously published Fto-KO
mouse models, males were reported to manifest stronger (15, 17) or similar (16, 18)
phenotype compared with females. Milder phenotype in females unlikely indicate
different mechanism of FTO action between two sexes, but rather reflect the
distinct ability of genders to buffer changes in metabolism and differences in sex
hormone actions in growth and behavior (17). This is supported by the notion that,
opposite to Fto-KO, Fto overexpressing female mice show more pronounced
phenotype than males (20). We observed similar weight development in our Fto-
72
KO females than males (data not shown), so we decided to focus on the males only.
However, it is important to examine females in the near future as well. Aside from
metabolic effects of FTO in adults, results from human study indicate that placental
FTO expression is associated with fetal growth, which should be assessed in more
detail with Fto-KO females (11). All reports show that the birth weight of Fto-KO
mice is unaltered; however, usually in the transgenic mouse studies, heterozygous
males and females are used to produce WT, KO and heterozygote pups in the same
litter. With the use of homozygote Fto-KO females, new insights may be revealed
on the role of FTO during intrauterine development. In addition, the effect of
maternal nutrition may be relevant to study, as our results show HFD-dependent
changes in Fto-KO mice which are distinct from WT.
6.2 Adipose tissue morphology (I, II)
Adipocytes were smaller in Fto-KO eWAT, scWAT and BAT after HFD compared
with WT. This is important when the function of FTO in the etiology of obesity and
related diseases is assessed, since the capacity of adipocytes to become
hypertrophic in response to energy intake is key in the pathogenicity of obesity
(168). In addition, the size of adipocytes is highly correlated with the capacity of
adipose tissue to become insulin resistant (169) and pro-inflammatory via various
mechanisms including endoplasmic reticulum stress response (reviewed in (170)).
Indeed, our results indicated an altered adipokine production from Fto-KO eWAT
especially when the mice were fed HFD. In WT mice, adiponectin production was
significantly decreased and leptin increased in HFD-treated mice. This is in
agreement with previous studies that show a dysregulated, inverse relationship of
adiponectin and leptin in obese adipose tissue and serum in humans (171, 172). In
Fto-KO mice on HFD, adipokine production was not altered similar to WT,
indicating a role for Fto in the whole body metabolism and adaptation to changes
in dietary environment. Indeed, serum level of adiponectin was increased and leptin
decreased in the previously published Fto-KO mouse model (15).
Fat mass was not quantified separately from lean mass in the current study. We
are therefore unable to estimate if the weight difference between the Fto-KO and
WT mice is because of altered amount of adipocytes or altered capability of
adipocytes to store the dietary fat. In the light of previous reports, the latter
explanation is more plausible as generally, the fat mass of Fto-KO mice has been
reported to be either reduced (15, 17, 18) or unaltered (16) when compared with
WT. In addition, the International Mouse Phenotyping Consortium database
73
(www.mousephenotype. org) indicates that the fat mass of a similar mouse model
presented here (Ftotm1a(EUCOMM)Wtsi) is unaltered (173). Thus, we may postulate that
the fat mass of the current Fto-KO mice is at least not increased. From the unaltered
body and fat mass, unaltered adipocyte area between WT and Fto-KO mice on CD
and the lack of hypertrophy after HFD, we may conclude that the number of
adipocytes is unaltered, and rather that the ability to store dietary fat is challenged
in Fto-KO adipose tissue when the standard conditions are confronted by HFD.
This is in line with Church et al. as they found increased expression of carbohydrate
metabolic genes in muscle of Fto-KO mice and concluded, that it may result from
altered nutrient storage and consequent release from WAT (18). In addition, fatty
acid synthase levels were increased without a change in fat storage in Fto-KO
muscle, indicating a decreased supply of fatty acids from WAT, further supporting
a role for FTO in fat accumulation, which is reduced in Fto-KO contributing to the
lean phenotype of these mice (18). Lack of HFD-mediated downregulation of Glut4
expression in Fto-KO eWAT indicates that FTO may have a role in adipocyte
glucose metabolism since GLUT4 is the main insulin responsive glucose
transporter in adipocytes (reviewed in (174)). Furthermore, adipose tissue-specific
Glut4-deficiency leads to insulin resistance while overexpression contributes to
improved glucose homeostasis (175, 176).
6.3 Effect of HFD on Fto expression in WT mice (I, II)
Interestingly, the relative expression of Fto mRNA was down-regulated in eWAT
of WT mice on HFD, which is in line with previous studies reporting decreased Fto
expression in several mouse models of obesity (13, 72). However, this effect was
not observed in scWAT or BAT, indicating a tissue-specific adaptation to HFD.
Furthermore, Fto level was increased by 2.4 fold in scWAT relative to eWAT. In
mice, eWAT has been reported to be least prone to browning in vivo, thus
representing the “purest” white adipose depot (164). On the contrary, scWAT is
associated with increased browning potential of all WAT depots (165). Thus,
decreased Fto expression in eWAT due to HFD indicates that Fto has a role in the
adaptation of white adipocytes into “obesogenic” environment, while increased Fto
in scWAT relative to eWAT supports a place for Fto also in browning. These results
were further supported by findings from Fto-KO mice, as discussed next in detail.
74
6.4 Expression of genes related to white adipogenesis (I)
Observations of morphological changes were further supported by the changes in
gene expression related to white adipogenesis and adipose tissue function in eWAT.
The precise mechanism through which FTO regulates energy balance and the
response to dietary changes is unknown. Our results indicate that the role of FTO
in adipose tissue may be relevant especially in response to HFD as the changes are
more striking in Fto-KO mice on HFD. Genes related to WAT adipogenesis were
expressed higher in the Fto-KO eWAT when stimulated by HFD. Whether these
differences arise from the altered adipogenesis per se or from some other
developmental change before or after adipocyte differentiation cannot be estimated
from the current data. However, these data clearly indicate that Fto has a role in the
adaptation of WAT to environmental changes such as excess dietary fat. Relative
expression of such adipogenesis-related genes as Bmp4, Cebpa, Pparg and Rxra
was significantly decreased in WT mice on HFD; this decrease was not observed
in Fto-KO. A recent study shows that Fto-KO MEFs exhibit decreased mTOR
signaling and mRNA translation with increased autophagy, indicating a role for
FTO in nutrient sensing (77). Furthermore, total inhibition of mTOR prevents 3T3-
L1 preadipocytes from differentiating in mature adipocytes while a partial mTOR
inhibition enhances adipogenesis with increased Pparg and Cebpa expression (177).
Thus, altered mTOR signaling may have contributed to the changes observed in the
current Fto-KO mice.
We found that Fto-deficiency has only a modest effect on gene expression in
each of the adipose tissue depots studied. This could result at least partly from the
nonstoichiometric nature of the m6A modification, which was also observed in
METTL3-depleted mESCs and hESCs (87). METTL3 adds m6A to the consensus
sequence RRACH; however, this consensus sequence occurs more often in mRNA
than m6A residues, indicating that additional sequence or structural features may
be required to define the methylation site (82, 85, 93). Indeed, a recent study reveals
that FTO and ALKBH5 do not actually exhibit strict sequence requirements for
substrate specificity (178). Instead, m6A was suggested to induce a conformational
switch from duplex to hairpin in RNA (and also DNA). This subsequently led to
increased binding ability of FTO, ALKBH5 and possibly other m6A binding
proteins as well (178). Thus, mere sequence analysis may not be sufficient to reveal
FTO targets; it may be necessary to assess the RNA structure as well.
75
6.5 Browning of scWAT and BAT adipogenesis (II)
In addition to eWAT, we observed morphological differences also in the Fto-KO
scWAT and BAT depots compared with WT. Adipocytes in scWAT and BAT of Fto-
KO mice on HFD did not exhibit hypertrophy similar to WT mice on HFD. In
addition, immunohistochemical staining of these depots using UCP1-specific
antibody revealed increased UCP1 abundance in Fto-KO scWAT and BAT. The
mitochondrial membrane protein UCP1 is characteristic to BAT adipocytes and is
important in the non-shivering thermogenesis in which heat is generated via
lipolysis rather than ATP (reviewed in (81)). FTO together with CaMKII induces
prolongation of CREB phosphorylation in human neurons, resulting in an
upregulation of genes important in energy metabolism (78). FTO was shown to
directly interact with CaMKII; however, loss-of-function-mutated FTO induced
also a moderate increase in expression of metabolic genes, indicating that FTO’s
demethylase activity does not fully explain the prolonged CREB phosphorylation
(78). Furthermore, CREB phosphorylation has been shown to activate also C/EBPβ
and UCP1 in preadipocytes (80, 81). Our results indicate that lack of Fto leads to
increased Cebpb and Ucp1 expression in scWAT and BAT of HFD-fed mice,
whereas in eWAT the increase of Cebpb was apparent in both genotypes. Thus,
altered CREB signaling may contribute at least partly to the lean phenotype of our
Fto-KO mice via increased scWAT browning and BAT induction. Adipogenesis of
CREB-deficient MEFs is disrupted due to decreased Cebpb expression (80).
However, our results indicate increased Cebpb expression upon Fto-KO, thus the
possible effect of invalidation of Fto on CREB is indirect and compensatory
mechanisms may be present in Fto-KO adipose tissues.
Fto-deficiency was connected to increased Ucp1 and Pgc1a expression in
mouse eWAT and scWAT by Tews et al. with smaller adipocyte size (23). We did
not observe Ucp1 expression in eWAT of any mice, but the results from scWAT and
BAT are in concert with Tews et al. although we did not observe changes on CD.
This discrepancy may be due to the fact that the mice were older in the current
study. We were not able to analyze Ucp1 mRNA expression reliably from scWAT;
however, the immunohistochemistry analysis shows increased UCP1 protein
abundance in Fto-KO mice on HFD, which was also seen in Ucp1 mRNA and
protein of BAT. The reason for incoherent mRNA expressions of Ucp1 in scWAT
is unknown. We analyzed the samples with two to three different primer pairs as
well as with Taqman Gene Expression Assay (ID Mm01244861_m1) and always
received similar results, with expression values differing by 10,000-fold from each
76
other regardless of the mouse group. Moreover, we extracted RNA from an
additional scWAT specimens and again, found similar discrepancy with the results.
While UCP1 is an important brown fat marker, PRDM16 has been shown to be
crucial for brown adipogenesis (103). Our results show that Prdm16 expression is
increased in Fto-KO scWAT and BAT after HFD. Furthermore, C/EBPβ co-
operates with PRDM16 to induce BAT differentiation, which subsequently leads to
activation of thermogenic genes such as Adrb3 and Pgc1a, and these genes are also
characteristic to beige adipocytes (179-181). These brown fat markers are increased
in Fto-KO scWAT and BAT after HFD, further supporting enhanced browning and
BAT adipogenesis.
Many miRNAs have been demonstrated to regulate the gene expression related
to white and brown adipogenesis (reviewed in (29, 30, 166)) as well as browning
of WAT (156, 182). In addition, FTO has been shown to participate in the regulation
of certain miRNAs (183). Our results indicate that the adaptation to HFD observed
in the scWAT and BAT of Fto-KO mice may be mediated by miRNAs. MiR-130b
is reported to downregulate Pparg mRNA expression via direct binding (155), and
this effect was present in scWAT of our mice where miR-130b was increased in WT
mice on HFD with concurrent decrease in Pparg expression. In the BAT, the Pparg
expression followed a similar trend without statistical significance (data not shown).
Furthermore, miR-130 is shown to be increased in adipocyte hypertrophy and fat
inflammation (184). MiR-155 is another inhibitor of adipogenesis having direct
interaction with Cebpb mRNA (156). In this study, miR-155 was increased in the
scWAT of WT mice on HFD also with a decrease in the Cebpb expression, which
effect was not observed in Fto-KO scWAT. MiR-378 is upregulated during
adipogenesis and it activates C/EBP transcription factors, including Cebpb (159),
which was seen in the BAT of the current Fto-KO mice after HFD.
6.6 Confounding factors
The current results indicate Fto-dependent changes in murine WAT and BAT, but
do not reveal the developmental onset of these changes. In addition, these changes
are subtle, which may result from the selective nature of m6A modification, i.e. not
all consensus sites are methylated. Another possibility for the subtle changes is the
fact that adipose tissue is a plastic organ and as the mice analyzed here were
relatively old, compensatory effects may have diminished the differences. This was
also speculated to be a confounding factor in the study by Church et al. in which
adult Fto overexpressing mice were investigated; the analysis was thus carried out
77
after the body weight had already diverged (20). Indeed, human studies indicate a
stronger effect of FTO SNPs on BMI in younger individuals and also an association
between placental FTO mRNA expression and fetal weight (11, 44, 72). Thus, it is
important to analyze the effects of Fto-KO on different developmental phases from
early embryonic days onwards.
This study, as well as most of mouse studies, was conducted with mice that
were housed at room temperature (~21°C). However, there is growing evidence
that this temperature, while being optimal for humans, is too cold for mice
(reviewed in (185)). Main problem with the housing at room temperature is that it
is well below mouse thermoneutral zone (~30°C) i.e. mice need to increase their
metabolic rate above basal metabolic rate to maintain their core body temperature.
This may be problematic when BAT and browning are under investigation since
main function of these tissues is thermogenesis. In addition, if the results obtained
from mouse studies are eventually going to be translated to human biology, the
problem arise from the fact that generally, humans live within their thermoneutral
zone with the help of clothes and heating systems (185). Indeed, Ucp1-KO mice
exhibit obese phenotype when housed at thermoneutrality, but not at room
temperature (186).
6.7 Future prospects
The mechanism by which FTO acts in placenta is not clear and the effects of FTO
during pre- and post-natal development should be assessed in more detail.
Environmental factors such as mothers eating behavior during pregnancy are
known to affect the epigenetics and lifelong development of a child and FTO may
have a role in this as well. Furthermore, detailed assessment of gene-environment
interactions will broaden our understanding of the genetics behind obesity and the
role of FTO in it. The physiological significance of m6A modification is only
currently being resolved and the specificity of m6A demethylase activity of FTO is
still obscure. The current study indicates a role for FTO in adipose tissue plasticity
via miRNA regulation. Several studies predict miRNA target sites with subsequent
binding experiments; however, the presence and consequence of such
modifications as m6A in the miRNA binding site are yet to be identified. It is thus
crucial to investigate the precise mechanism of m6A actions in the near future. In
addition to FTO, one other m6A demethylase, ALKBH5, has been identified. The
existence of additional m6A demethylases is plausible and an important question
to be answered.
78
6.8 Summary
From the current results, it is difficult to estimate, which came first in Fto-KO mice,
the improved adipokine production or decreased body weight on HFD. What is
clear however, is that these mice do not develop diet-induced obesity despite
unaltered energy intake, heat production, respiratory exchange ratio and activity
relative to WT. While adipocytes do not become larger on HFD, where does the
excess energy go? Whether the issue is about nutrient absorption or accumulation
of fat into other peripheral tissues remains to be answered. Results of the current
study are summarized in the Fig. 16.
Fig. 16. Altered response of Fto-deficient adipose tissue to high-fat diet. In wild-type
mice, FTO decreases the levels of genes related to adipogenesis while promoting
adipocyte hypertrophy and obesity with unhealthy consequences. In Fto-deficient mice,
genes related to adipogenesis remain elevated after high-fat diet which prevents
adipocytes from becoming hypertrophic and improves overall metabolic performance.
miR-378
miR-130 miR-155
Pparg Cepba Rxra
Bmp4
FTO
High-fat diet
Pparg Cepba Rxra
Bmp4 miR-130 miR-155 miR-378
Wild-type adipose tissue
Fto-deficient adipose tissue
RNA methylation?
FTO
High-fat diet
Small adipocytes
Adipocyte hypertrophy
LeptinInsulin resistance? Inflammation?
mTOR, nutrient sencing? CREB signaling?
AdiponectinBrowningInsulin sensitive?
79
7 Concluding remarks
The findings of this thesis are as follows:
1. Fto-deficient mice were resistant to diet-induced obesity and adipocyte
hypertrophy while energy intake, heat production, respiratory exchange ratio
and physical activity were unaltered relative to wild-type.
2. Adaptation to high-fat diet was altered in the Fto-deficient adipose tissues.
Expression of genes related to white and brown adipogenesis and function as
well as browning were not attenuated as a response to high-fat diet similar to
wild-type. Thus, in the wild-type mice FTO regulated these genes in response
to dietary fat while this regulation was absent in Fto-deficient mice.
3. Expression of microRNAs that are previously reported to regulate genes
related to above-mentioned processes was altered in the Fto-deficient mice.
This indicated that FTO regulated the adipose tissue adaptation to high-fat diet
via microRNA regulation.
80
81
References
1. Tsigos C, Hainer V, Basdevant A, Finer N, Fried M, Mathus-Vliegen E, Micic D, Maislos M, Roman G, Schutz Y, Toplak H, Zahorska-Markiewicz B & Obesity Management Task Force of the European Association for the Study of Obesity (2008) Management of obesity in adults: European clinical practice guidelines. Obes Facts 1(2): 106-116.
2. Min J, Chiu DT & Wang Y (2013) Variation in the heritability of body mass index based on diverse twin studies: a systematic review. Obes Rev 14(11): 871-882.
3. Saunders CL, Chiodini BD, Sham P, Lewis CM, Abkevich V, Adeyemo AA, de Andrade M, Arya R, Berenson GS, Blangero J, Boehnke M, Borecki IB, Chagnon YC, Chen W, Comuzzie AG, Deng HW, Duggirala R, Feitosa MF, Froguel P, Hanson RL, Hebebrand J, Huezo-Dias P, Kissebah AH, Li W, Luke A, Martin LJ, Nash M, Ohman M, Palmer LJ, Peltonen L, Perola M, Price RA, Redline S, Srinivasan SR, Stern MP, Stone S, Stringham H, Turner S, Wijmenga C & Collier DA (2007) Meta-analysis of genome-wide linkage studies in BMI and obesity. Obesity (Silver Spring) 15(9): 2263-2275.
4. Frayling TM, Timpson NJ, Weedon MN, Zeggini E, Freathy RM, Lindgren CM, Perry JR, Elliott KS, Lango H, Rayner NW, Shields B, Harries LW, Barrett JC, Ellard S, Groves CJ, Knight B, Patch AM, Ness AR, Ebrahim S, Lawlor DA, Ring SM, Ben-Shlomo Y, Jarvelin MR, Sovio U, Bennett AJ, Melzer D, Ferrucci L, Loos RJ, Barroso I, Wareham NJ, Karpe F, Owen KR, Cardon LR, Walker M, Hitman GA, Palmer CN, Doney AS, Morris AD, Smith GD, Hattersley AT & McCarthy MI (2007) A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science 316(5826): 889-894.
5. Dina C, Meyre D, Gallina S, Durand E, Korner A, Jacobson P, Carlsson LM, Kiess W, Vatin V, Lecoeur C, Delplanque J, Vaillant E, Pattou F, Ruiz J, Weill J, Levy-Marchal C, Horber F, Potoczna N, Hercberg S, Le Stunff C, Bougneres P, Kovacs P, Marre M, Balkau B, Cauchi S, Chevre JC & Froguel P (2007) Variation in FTO contributes to childhood obesity and severe adult obesity. Nat Genet 39(6): 724-726.
6. Scott LJ, Mohlke KL, Bonnycastle LL, Willer CJ, Li Y, Duren WL, Erdos MR, Stringham HM, Chines PS, Jackson AU, Prokunina-Olsson L, Ding CJ, Swift AJ, Narisu N, Hu T, Pruim R, Xiao R, Li XY, Conneely KN, Riebow NL, Sprau AG, Tong M, White PP, Hetrick KN, Barnhart MW, Bark CW, Goldstein JL, Watkins L, Xiang F, Saramies J, Buchanan TA, Watanabe RM, Valle TT, Kinnunen L, Abecasis GR, Pugh EW, Doheny KF, Bergman RN, Tuomilehto J, Collins FS & Boehnke M (2007) A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. Science 316(5829): 1341-1345.
7. Scuteri A, Sanna S, Chen WM, Uda M, Albai G, Strait J, Najjar S, Nagaraja R, Orru M, Usala G, Dei M, Lai S, Maschio A, Busonero F, Mulas A, Ehret GB, Fink AA, Weder AB, Cooper RS, Galan P, Chakravarti A, Schlessinger D, Cao A, Lakatta E & Abecasis GR (2007) Genome-wide association scan shows genetic variants in the FTO gene are associated with obesity-related traits. PLoS Genet 3(7): e115.
82
8. Wahlen K, Sjolin E & Hoffstedt J (2008) The common rs9939609 gene variant of the fat mass- and obesity-associated gene FTO is related to fat cell lipolysis. J Lipid Res 49(3): 607-611.
9. Kloting N, Schleinitz D, Ruschke K, Berndt J, Fasshauer M, Tonjes A, Schon MR, Kovacs P, Stumvoll M & Bluher M (2008) Inverse relationship between obesity and FTO gene expression in visceral adipose tissue in humans. Diabetologia 51(4): 641-647.
10. Grunnet LG, Nilsson E, Ling C, Hansen T, Pedersen O, Groop L, Vaag A & Poulsen P (2009) Regulation and function of FTO mRNA expression in human skeletal muscle and subcutaneous adipose tissue. Diabetes 58(10): 2402-2408.
11. Bassols J, Prats-Puig A, Vazquez-Ruiz M, Garcia-Gonzalez MM, Martinez-Pascual M, Avelli P, Martinez-Martinez R, Fabrega R, Colomer-Virosta C, Soriano-Rodriguez P, Diaz M, de Zegher F, Ibanez L & Lopez-Bermejo A (2010) Placental FTO expression relates to fetal growth. Int J Obes (Lond) 34(9): 1365-1370.
12. Gerken T, Girard CA, Tung YC, Webby CJ, Saudek V, Hewitson KS, Yeo GS, McDonough MA, Cunliffe S, McNeill LA, Galvanovskis J, Rorsman P, Robins P, Prieur X, Coll AP, Ma M, Jovanovic Z, Farooqi IS, Sedgwick B, Barroso I, Lindahl T, Ponting CP, Ashcroft FM, O'Rahilly S & Schofield CJ (2007) The obesity-associated FTO gene encodes a 2-oxoglutarate-dependent nucleic acid demethylase. Science 318(5855): 1469-1472.
13. Stratigopoulos G, Padilla SL, LeDuc CA, Watson E, Hattersley AT, McCarthy MI, Zeltser LM, Chung WK & Leibel RL (2008) Regulation of Fto/Ftm gene expression in mice and humans. Am J Physiol Regul Integr Comp Physiol 294(4): R1185-96.
14. Poritsanos NJ, Lew PS, Fischer J, Mobbs CV, Nagy JI, Wong D, Ruther U & Mizuno TM (2011) Impaired hypothalamic Fto expression in response to fasting and glucose in obese mice. Nutr Diabetes 1: e19.
15. Fischer J, Koch L, Emmerling C, Vierkotten J, Peters T, Bruning JC & Ruther U (2009) Inactivation of the Fto gene protects from obesity. Nature 458(7240): 894-898.
16. Gao X, Shin YH, Li M, Wang F, Tong Q & Zhang P (2010) The fat mass and obesity associated gene FTO functions in the brain to regulate postnatal growth in mice. PLoS One 5(11): e14005.
17. McMurray F, Church CD, Larder R, Nicholson G, Wells S, Teboul L, Tung YC, Rimmington D, Bosch F, Jimenez V, Yeo GS, O'Rahilly S, Ashcroft FM, Coll AP & Cox RD (2013) Adult onset global loss of the fto gene alters body composition and metabolism in the mouse. PLoS Genet 9(1): e1003166.
18. Church C, Lee S, Bagg EA, McTaggart JS, Deacon R, Gerken T, Lee A, Moir L, Mecinovic J, Quwailid MM, Schofield CJ, Ashcroft FM & Cox RD (2009) A mouse model for the metabolic effects of the human fat mass and obesity associated FTO gene. PLoS Genet 5(8): e1000599.
19. Hess ME, Hess S, Meyer KD, Verhagen LA, Koch L, Bronneke HS, Dietrich MO, Jordan SD, Saletore Y, Elemento O, Belgardt BF, Franz T, Horvath TL, Ruther U, Jaffrey SR, Kloppenburg P & Bruning JC (2013) The fat mass and obesity associated gene (Fto) regulates activity of the dopaminergic midbrain circuitry. Nat Neurosci 16(8): 1042-1048.
83
20. Church C, Moir L, McMurray F, Girard C, Banks GT, Teboul L, Wells S, Bruning JC, Nolan PM, Ashcroft FM & Cox RD (2010) Overexpression of Fto leads to increased food intake and results in obesity. Nat Genet 42(12): 1086-1092.
21. Zhao X, Yang Y, Sun BF, Shi Y, Yang X, Xiao W, Hao YJ, Ping XL, Chen YS, Wang WJ, Jin KX, Wang X, Huang CM, Fu Y, Ge XM, Song SH, Jeong HS, Yanagisawa H, Niu Y, Jia GF, Wu W, Tong WM, Okamoto A, He C, Rendtlew Danielsen JM, Wang XJ & Yang YG (2014) FTO-dependent demethylation of N6-methyladenosine regulates mRNA splicing and is required for adipogenesis. Cell Res 24(12): 1403-1419.
22. Ren W, Guo J, Jiang F, Lu J, Ding Y, Li A, Liang X & Jia W (2014) CCAAT/enhancer-binding protein alpha is a crucial regulator of human fat mass and obesity associated gene transcription and expression. Biomed Res Int 2014: 406909.
23. Tews D, Fischer-Posovszky P, Fromme T, Klingenspor M, Fischer J, Ruther U, Marienfeld R, Barth TF, Moller P, Debatin KM & Wabitsch M (2013) FTO Deficiency Induces UCP-1 Expression and Mitochondrial Uncoupling in Adipocytes. Endocrinology 154(9): 3141-3151.
24. Cheung MK, Gulati P, O'Rahilly S & Yeo GS (2013) FTO expression is regulated by availability of essential amino acids. Int J Obes (Lond) 37(5): 744-747.
25. Jia G, Fu Y, Zhao X, Dai Q, Zheng G, Yang Y, Yi C, Lindahl T, Pan T, Yang YG & He C (2011) N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat Chem Biol 7(12): 885-887.
26. Pan T (2013) N6-methyl-adenosine modification in messenger and long non-coding RNA. Trends Biochem Sci 38(4): 204-209.
27. Yue Y, Liu J & He C (2015) RNA N6-methyladenosine methylation in post-transcriptional gene expression regulation. Genes Dev 29(13): 1343-1355.
28. Meyer KD, Saletore Y, Zumbo P, Elemento O, Mason CE & Jaffrey SR (2012) Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell 149(7): 1635-1646.
29. Mercado C, Eades G & Zhou Q (2013) MicroRNAs: A New Class of Master Regulators of Adipogenesis. Human Genet Embryol 3(2): 108.
30. Zhou JY & Li L (2014) MicroRNAs are key regulators of brown adipogenesis. Biochim Biophys Acta 1841(11): 1590-1595.
31. van Marken Lichtenbelt WD, Vanhommerig JW, Smulders NM, Drossaerts JM, Kemerink GJ, Bouvy ND, Schrauwen P & Teule GJ (2009) Cold-activated brown adipose tissue in healthy men. N Engl J Med 360(15): 1500-1508.
32. Cypess AM, Lehman S, Williams G, Tal I, Rodman D, Goldfine AB, Kuo FC, Palmer EL, Tseng YH, Doria A, Kolodny GM & Kahn CR (2009) Identification and importance of brown adipose tissue in adult humans. N Engl J Med 360(15): 1509-1517.
33. Virtanen KA, Lidell ME, Orava J, Heglind M, Westergren R, Niemi T, Taittonen M, Laine J, Savisto NJ, Enerback S & Nuutila P (2009) Functional brown adipose tissue in healthy adults. N Engl J Med 360(15): 1518-1525.
34. Peirce V, Carobbio S & Vidal-Puig A (2014) The different shades of fat. Nature 510(7503): 76-83.
84
35. Peters T, Ausmeier K & Ruther U (1999) Cloning of Fatso (Fto), a novel gene deleted by the Fused toes (Ft) mouse mutation. Mamm Genome 10(10): 983-986.
36. van der Hoeven F, Schimmang T, Volkmann A, Mattei MG, Kyewski B & Ruther U (1994) Programmed cell death is affected in the novel mouse mutant Fused toes (Ft). Development 120(9): 2601-2607.
37. Yeo GS (2014) The role of the FTO (Fat Mass and Obesity Related) locus in regulating body size and composition. Mol Cell Endocrinol 397(1-2): 34-41.
38. Hirschhorn JN & Daly MJ (2005) Genome-wide association studies for common diseases and complex traits. Nat Rev Genet 6(2): 95-108.
39. Sanchez-Pulido L & Andrade-Navarro MA (2007) The FTO (fat mass and obesity associated) gene codes for a novel member of the non-heme dioxygenase superfamily. BMC Biochem 8: 23.
40. Kilpelainen TO, Qi L, Brage S, Sharp SJ, Sonestedt E, Demerath E, Ahmad T, Mora S, Kaakinen M, Sandholt CH, Holzapfel C, Autenrieth CS, Hypponen E, Cauchi S, He M, Kutalik Z, Kumari M, Stancakova A, Meidtner K, Balkau B, Tan JT, Mangino M, Timpson NJ, Song Y, Zillikens MC, Jablonski KA, Garcia ME, Johansson S, Bragg-Gresham JL, Wu Y, van Vliet-Ostaptchouk JV, Onland-Moret NC, Zimmermann E, Rivera NV, Tanaka T, Stringham HM, Silbernagel G, Kanoni S, Feitosa MF, Snitker S, Ruiz JR, Metter J, Larrad MT, Atalay M, Hakanen M, Amin N, Cavalcanti-Proenca C, Grontved A, Hallmans G, Jansson JO, Kuusisto J, Kahonen M, Lutsey PL, Nolan JJ, Palla L, Pedersen O, Perusse L, Renstrom F, Scott RA, Shungin D, Sovio U, Tammelin TH, Ronnemaa T, Lakka TA, Uusitupa M, Rios MS, Ferrucci L, Bouchard C, Meirhaeghe A, Fu M, Walker M, Borecki IB, Dedoussis GV, Fritsche A, Ohlsson C, Boehnke M, Bandinelli S, van Duijn CM, Ebrahim S, Lawlor DA, Gudnason V, Harris TB, Sorensen TI, Mohlke KL, Hofman A, Uitterlinden AG, Tuomilehto J, Lehtimaki T, Raitakari O, Isomaa B, Njolstad PR, Florez JC, Liu S, Ness A, Spector TD, Tai ES, Froguel P, Boeing H, Laakso M, Marmot M, Bergmann S, Power C, Khaw KT, Chasman D, Ridker P, Hansen T, Monda KL, Illig T, Jarvelin MR, Wareham NJ, Hu FB, Groop LC, Orho-Melander M, Ekelund U, Franks PW & Loos RJ (2011) Physical activity attenuates the influence of FTO variants on obesity risk: a meta-analysis of 218,166 adults and 19,268 children. PLoS Med 8(11): e1001116.
41. Melka MG, Bernard M, Mahboubi A, Abrahamowicz M, Paterson AD, Syme C, Lourdusamy A, Schumann G, Leonard GT, Perron M, Richer L, Veillette S, Gaudet D, Paus T & Pausova Z (2012) Genome-wide scan for loci of adolescent obesity and their relationship with blood pressure. J Clin Endocrinol Metab 97(1): E145-50.
42. Kring SI, Holst C, Zimmermann E, Jess T, Berentzen T, Toubro S, Hansen T, Astrup A, Pedersen O & Sorensen TI (2008) FTO gene associated fatness in relation to body fat distribution and metabolic traits throughout a broad range of fatness. PLoS One 3(8): e2958.
43. Pecioska S, Zillikens MC, Henneman P, Snijders PJ, Oostra BA, van Duijn CM & Aulchenko YS (2010) Association between type 2 diabetes loci and measures of fatness. PLoS One 5(1): e8541.
85
44. Sovio U, Mook-Kanamori DO, Warrington NM, Lawrence R, Briollais L, Palmer CN, Cecil J, Sandling JK, Syvanen AC, Kaakinen M, Beilin LJ, Millwood IY, Bennett AJ, Laitinen J, Pouta A, Molitor J, Davey Smith G, Ben-Shlomo Y, Jaddoe VW, Palmer LJ, Pennell CE, Cole TJ, McCarthy MI, Jarvelin MR, Timpson NJ & Early Growth Genetics Consortium (2011) Association between common variation at the FTO locus and changes in body mass index from infancy to late childhood: the complex nature of genetic association through growth and development. PLoS Genet 7(2): e1001307.
45. Rolland-Cachera MF, Deheeger M, Bellisle F, Sempe M, Guilloud-Bataille M & Patois E (1984) Adiposity rebound in children: a simple indicator for predicting obesity. Am J Clin Nutr 39(1): 129-135.
46. Rolland-Cachera MF, Deheeger M, Maillot M & Bellisle F (2006) Early adiposity rebound: causes and consequences for obesity in children and adults. Int J Obes (Lond) 30 Suppl 4: S11-7.
47. Sebert S, Salonurmi T, Keinanen-Kiukaanniemi S, Savolainen M, Herzig KH, Symonds ME & Jarvelin MR (2014) Programming effects of FTO in the development of obesity. Acta Physiol (Oxf) 210(1): 58-69.
48. Qi Q, Kilpelainen TO, Downer MK, Tanaka T, Smith CE, Sluijs I, Sonestedt E, Chu AY, Renstrom F, Lin X, Angquist LH, Huang J, Liu Z, Li Y, Asif Ali M, Xu M, Ahluwalia TS, Boer JM, Chen P, Daimon M, Eriksson J, Perola M, Friedlander Y, Gao YT, Heppe DH, Holloway JW, Houston DK, Kanoni S, Kim YM, Laaksonen MA, Jaaskelainen T, Lee NR, Lehtimaki T, Lemaitre RN, Lu W, Luben RN, Manichaikul A, Mannisto S, Marques-Vidal P, Monda KL, Ngwa JS, Perusse L, van Rooij FJ, Xiang YB, Wen W, Wojczynski MK, Zhu J, Borecki IB, Bouchard C, Cai Q, Cooper C, Dedoussis GV, Deloukas P, Ferrucci L, Forouhi NG, Hansen T, Christiansen L, Hofman A, Johansson I, Jorgensen T, Karasawa S, Khaw KT, Kim MK, Kristiansson K, Li H, Lin X, Liu Y, Lohman KK, Long J, Mikkila V, Mozaffarian D, North K, Pedersen O, Raitakari O, Rissanen H, Tuomilehto J, van der Schouw YT, Uitterlinden AG, Zillikens MC, Franco OH, Shyong Tai E, Ou Shu X, Siscovick DS, Toft U, Verschuren WM, Vollenweider P, Wareham NJ, Witteman JC, Zheng W, Ridker PM, Kang JH, Liang L, Jensen MK, Curhan GC, Pasquale LR, Hunter DJ, Mohlke KL, Uusitupa M, Cupples LA, Rankinen T, Orho-Melander M, Wang T, Chasman DI, Franks PW, Sorensen TI, Hu FB, Loos RJ, Nettleton JA & Qi L (2014) FTO genetic variants, dietary intake and body mass index: insights from 177,330 individuals. Hum Mol Genet 23(25): 6961-6972.
49. Qi Q, Downer MK, Kilpelainen TO, Taal HR, Barton SJ, Ntalla I, Standl M, Boraska V, Huikari V, Kiefte-de Jong JC, Korner A, Lakka TA, Liu G, Magnusson J, Okuda M, Raitakari O, Richmond R, Scott RA, Bailey ME, Scheuermann K, Holloway JW, Inskip H, Isasi CR, Mossavar-Rahmani Y, Jaddoe VW, Laitinen J, Lindi V, Melen E, Pitsiladis Y, Pitkanen N, Snieder H, Heinrich J, Timpson NJ, Wang T, Yuji H, Zeggini E, Dedoussis GV, Kaplan RC, Wylie-Rosett J, Loos RJ, Hu FB & Qi L (2015) Dietary Intake, FTO Genetic Variants, and Adiposity: A Combined Analysis of Over 16,000 Children and Adolescents. Diabetes 64(7): 2467-2476.
86
50. Loos RJ & Yeo GS (2014) The bigger picture of FTO: the first GWAS-identified obesity gene. Nat Rev Endocrinol 10(1): 51-61.
51. Speliotes EK, et al. (2010) Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. Nat Genet 42(11): 937-948.
52. Locke AE, et al. (2015) Genetic studies of body mass index yield new insights for obesity biology. Nature 518(7538): 197-206.
53. Llewellyn C & Wardle J (2015) Behavioral susceptibility to obesity: Gene-environment interplay in the development of weight. Physiol Behav 152(Pt B): 494-501.
54. Demerath EW, Choh AC, Johnson W, Curran JE, Lee M, Bellis C, Dyer TD, Czerwinski SA, Blangero J & Towne B (2013) The positive association of obesity variants with adulthood adiposity strengthens over an 80-year period: a gene-by-birth year interaction. Hum Hered 75(2-4): 175-185.
55. de Luis DA, Aller R, Izaola O, de la Fuente B, Conde R, Sagrado MG & Primo D (2012) Evaluation of weight loss and adipocytokines levels after two hypocaloric diets with different macronutrient distribution in obese subjects with rs9939609 gene variant. Diabetes Metab Res Rev 28(8): 663-668.
56. Muller TD, Hinney A, Scherag A, Nguyen TT, Schreiner F, Schafer H, Hebebrand J, Roth CL & Reinehr T (2008) 'Fat mass and obesity associated' gene (FTO): no significant association of variant rs9939609 with weight loss in a lifestyle intervention and lipid metabolism markers in German obese children and adolescents. BMC Med Genet 9: 85-2350-9-85.
57. McCaffery JM, Papandonatos GD, Huggins GS, Peter I, Kahn SE, Knowler WC, Hudnall GE, Lipkin EW, Kitabchi AE, Wagenknecht LE, Wing RR, Genetic Subgroup of Look AHEAD & Look AHEAD Research Group (2013) FTO predicts weight regain in the Look AHEAD clinical trial. Int J Obes (Lond) 37(12): 1545-1552.
58. Reinehr T, Wolters B, Roth CL & Hinney A (2014) FTO gene: association to weight regain after lifestyle intervention in overweight children. Horm Res Paediatr 81(6): 391-396.
59. Lappalainen TJ, Tolppanen AM, Kolehmainen M, Schwab U, Lindstrom J, Tuomilehto J, Pulkkinen L, Eriksson JG, Laakso M, Gylling H, Uusitupa M & Finnish Diabetes Prevention Study Group (2009) The common variant in the FTO gene did not modify the effect of lifestyle changes on body weight: the Finnish Diabetes Prevention Study. Obesity (Silver Spring) 17(4): 832-836.
60. Delahanty LM, Pan Q, Jablonski KA, Watson KE, McCaffery JM, Shuldiner A, Kahn SE, Knowler WC, Florez JC, Franks PW & Diabetes Prevention Program Research Group (2012) Genetic predictors of weight loss and weight regain after intensive lifestyle modification, metformin treatment, or standard care in the Diabetes Prevention Program. Diabetes Care 35(2): 363-366.
61. Hinney A, Wolters B, Putter C, Grallert H, Illig T, Hebebrand J & Reinehr T (2013) No impact of obesity susceptibility loci on weight regain after a lifestyle intervention in overweight children. J Pediatr Endocrinol Metab 26(11-12): 1209-1213.
62. Rampersaud E, Mitchell BD, Pollin TI, Fu M, Shen H, O'Connell JR, Ducharme JL, Hines S, Sack P, Naglieri R, Shuldiner AR & Snitker S (2008) Physical activity and the
87
association of common FTO gene variants with body mass index and obesity. Arch Intern Med 168(16): 1791-1797.
63. Holzapfel C, Grallert H, Huth C, Wahl S, Fischer B, Doring A, Ruckert IM, Hinney A, Hebebrand J, Wichmann HE, Hauner H, Illig T & Heid IM (2010) Genes and lifestyle factors in obesity: results from 12,462 subjects from MONICA/KORA. Int J Obes (Lond) 34(10): 1538-1545.
64. Smemo S, Tena JJ, Kim KH, Gamazon ER, Sakabe NJ, Gomez-Marin C, Aneas I, Credidio FL, Sobreira DR, Wasserman NF, Lee JH, Puviindran V, Tam D, Shen M, Son JE, Vakili NA, Sung HK, Naranjo S, Acemel RD, Manzanares M, Nagy A, Cox NJ, Hui CC, Gomez-Skarmeta JL & Nobrega MA (2014) Obesity-associated variants within FTO form long-range functional connections with IRX3. Nature 507(7492): 371-375.
65. Claussnitzer M, Dankel SN, Kim KH, Quon G, Meuleman W, Haugen C, Glunk V, Sousa IS, Beaudry JL, Puviindran V, Abdennur NA, Liu J, Svensson PA, Hsu YH, Drucker DJ, Mellgren G, Hui CC, Hauner H & Kellis M (2015) FTO Obesity Variant Circuitry and Adipocyte Browning in Humans. N Engl J Med 373(10): 895-907.
66. Rask-Andersen M, Almen MS & Schioth HB (2015) Scrutinizing the FTO locus: compelling evidence for a complex, long-range regulatory context. Hum Genet 134(11-12): 1183-1193.
67. Berulava T & Horsthemke B (2010) The obesity-associated SNPs in intron 1 of the FTO gene affect primary transcript levels. Eur J Hum Genet 18(9): 1054-1056.
68. Boissel S, Reish O, Proulx K, Kawagoe-Takaki H, Sedgwick B, Yeo GS, Meyre D, Golzio C, Molinari F, Kadhom N, Etchevers HC, Saudek V, Farooqi IS, Froguel P, Lindahl T, O'Rahilly S, Munnich A & Colleaux L (2009) Loss-of-function mutation in the dioxygenase-encoding FTO gene causes severe growth retardation and multiple malformations. Am J Hum Genet 85(1): 106-111.
69. Stratakis CA, Lafferty A, Taymans SE, Gafni RI, Meck JM & Blancato J (2000) Anisomastia associated with interstitial duplication of chromosome 16, mental retardation, obesity, dysmorphic facies, and digital anomalies: molecular mapping of a new syndrome by fluorescent in situ hybridization and microsatellites to 16q13 (D16S419-D16S503). J Clin Endocrinol Metab 85(9): 3396-3401.
70. Olszewski PK, Fredriksson R, Olszewska AM, Stephansson O, Alsio J, Radomska KJ, Levine AS & Schioth HB (2009) Hypothalamic FTO is associated with the regulation of energy intake not feeding reward. BMC Neurosci 10: 129.
71. Olszewski PK, Fredriksson R, Eriksson JD, Mitra A, Radomska KJ, Gosnell BA, Solvang MN, Levine AS & Schioth HB (2011) Fto colocalizes with a satiety mediator oxytocin in the brain and upregulates oxytocin gene expression. Biochem Biophys Res Commun 408(3): 422-426.
72. Qi L, Kang K, Zhang C, van Dam RM, Kraft P, Hunter D, Lee CH & Hu FB (2008) Fat mass-and obesity-associated (FTO) gene variant is associated with obesity: longitudinal analyses in two cohort studies and functional test. Diabetes 57(11): 3145-3151.
88
73. Poritsanos NJ, Lew PS & Mizuno TM (2010) Relationship between blood glucose levels and hepatic Fto mRNA expression in mice. Biochem Biophys Res Commun 400(4): 713-717.
74. Zhao X, Yang Y, Sun BF, Zhao YL & Yang YG (2014) FTO and obesity: mechanisms of association. Curr Diab Rep 14(5): 486-014-0486-0.
75. Pitman RT, Fong JT, Billman P & Puri N (2012) Knockdown of the fat mass and obesity gene disrupts cellular energy balance in a cell-type specific manner. PLoS One 7(6): e38444.
76. Merkestein M, Laber S, McMurray F, Andrew D, Sachse G, Sanderson J, Li M, Usher S, Sellayah D, Ashcroft FM & Cox RD (2015) FTO influences adipogenesis by regulating mitotic clonal expansion. Nat Commun 6: 6792.
77. Gulati P, Cheung MK, Antrobus R, Church CD, Harding HP, Tung YC, Rimmington D, Ma M, Ron D, Lehner PJ, Ashcroft FM, Cox RD, Coll AP, O'Rahilly S & Yeo GS (2013) Role for the obesity-related FTO gene in the cellular sensing of amino acids. Proc Natl Acad Sci U S A 110(7): 2557-2562.
78. Lin L, Hales CM, Garber K & Jin P (2014) Fat mass and obesity-associated (FTO) protein interacts with CaMKII and modulates the activity of CREB signaling pathway. Hum Mol Genet 23(12): 3299-3306.
79. Wu Q, Saunders RA, Szkudlarek-Mikho M, Serna Ide L & Chin KV (2010) The obesity-associated Fto gene is a transcriptional coactivator. Biochem Biophys Res Commun 401(3): 390-395.
80. Zhang JW, Klemm DJ, Vinson C & Lane MD (2004) Role of CREB in transcriptional regulation of CCAAT/enhancer-binding protein beta gene during adipogenesis. J Biol Chem 279(6): 4471-4478.
81. Cannon B & Nedergaard J (2004) Brown adipose tissue: function and physiological significance. Physiol Rev 84(1): 277-359.
82. Wei CM, Gershowitz A & Moss B (1975) Methylated nucleotides block 5' terminus of HeLa cell messenger RNA. Cell 4(4): 379-386.
83. Perry RP, Kelley DE, Friderici K & Rottman F (1975) The methylated constituents of L cell messenger RNA: evidence for an unusual cluster at the 5' terminus. Cell 4(4): 387-394.
84. Desrosiers RC, Friderici KH & Rottman FM (1975) Characterization of Novikoff hepatoma mRNA methylation and heterogeneity in the methylated 5' terminus. Biochemistry 14(20): 4367-4374.
85. Harper JE, Miceli SM, Roberts RJ & Manley JL (1990) Sequence specificity of the human mRNA N6-adenosine methylase in vitro. Nucleic Acids Res 18(19): 5735-5741.
86. Dominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg S, Cesarkas K, Jacob-Hirsch J, Amariglio N, Kupiec M, Sorek R & Rechavi G (2012) Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485(7397): 201-206.
87. Batista PJ, Molinie B, Wang J, Qu K, Zhang J, Li L, Bouley DM, Lujan E, Haddad B, Daneshvar K, Carter AC, Flynn RA, Zhou C, Lim KS, Dedon P, Wernig M, Mullen
89
AC, Xing Y, Giallourakis CC & Chang HY (2014) m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell 15(6): 707-719.
88. Wang Y, Li Y, Toth JI, Petroski MD, Zhang Z & Zhao JC (2014) N6-methyladenosine modification destabilizes developmental regulators in embryonic stem cells. Nat Cell Biol 16(2): 191-198.
89. Zheng G, Dahl JA, Niu Y, Fedorcsak P, Huang CM, Li CJ, Vagbo CB, Shi Y, Wang WL, Song SH, Lu Z, Bosmans RP, Dai Q, Hao YJ, Yang X, Zhao WM, Tong WM, Wang XJ, Bogdan F, Furu K, Fu Y, Jia G, Zhao X, Liu J, Krokan HE, Klungland A, Yang YG & He C (2013) ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol Cell 49(1): 18-29.
90. Han Z, Niu T, Chang J, Lei X, Zhao M, Wang Q, Cheng W, Wang J, Feng Y & Chai J (2010) Crystal structure of the FTO protein reveals basis for its substrate specificity. Nature 464(7292): 1205-1209.
91. Fu Y, Jia G, Pang X, Wang RN, Wang X, Li CJ, Smemo S, Dai Q, Bailey KA, Nobrega MA, Han KL, Cui Q & He C (2013) FTO-mediated formation of N6-hydroxymethyladenosine and N6-formyladenosine in mammalian RNA. Nat Commun 4: 1798.
92. Shen L, Song CX, He C & Zhang Y (2014) Mechanism and function of oxidative reversal of DNA and RNA methylation. Annu Rev Biochem 83: 585-614.
93. Bokar JA, Shambaugh ME, Polayes D, Matera AG & Rottman FM (1997) Purification and cDNA cloning of the AdoMet-binding subunit of the human mRNA (N6-adenosine)-methyltransferase. RNA 3(11): 1233-1247.
94. Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, Jia G, Yu M, Lu Z, Deng X, Dai Q, Chen W & He C (2014) A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nat Chem Biol 10(2): 93-95.
95. Wang X, Zhao BS, Roundtree IA, Lu Z, Han D, Ma H, Weng X, Chen K, Shi H & He C (2015) N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell 161(6): 1388-1399.
96. Wang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, Ren B, Pan T & He C (2014) N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 505(7481): 117-120.
97. Xu C, Wang X, Liu K, Roundtree IA, Tempel W, Li Y, Lu Z, He C & Min J (2014) Structural basis for selective binding of m6A RNA by the YTHDC1 YTH domain. Nat Chem Biol 10(11): 927-929.
98. Carobbio S, Rosen B & Vidal-Puig A (2013) Adipogenesis: new insights into brown adipose tissue differentiation. J Mol Endocrinol 51(3): T75-85.
99. Cinti S (2012) The adipose organ at a glance. Dis Model Mech 5(5): 588-594. 100. Tang W, Zeve D, Suh JM, Bosnakovski D, Kyba M, Hammer RE, Tallquist MD &
Graff JM (2008) White fat progenitor cells reside in the adipose vasculature. Science 322(5901): 583-586.
101. Tran KV, Gealekman O, Frontini A, Zingaretti MC, Morroni M, Giordano A, Smorlesi A, Perugini J, De Matteis R, Sbarbati A, Corvera S & Cinti S (2012) The vascular
90
endothelium of the adipose tissue gives rise to both white and brown fat cells. Cell Metab 15(2): 222-229.
102. Gupta RK, Mepani RJ, Kleiner S, Lo JC, Khandekar MJ, Cohen P, Frontini A, Bhowmick DC, Ye L, Cinti S & Spiegelman BM (2012) Zfp423 expression identifies committed preadipocytes and localizes to adipose endothelial and perivascular cells. Cell Metab 15(2): 230-239.
103. Seale P, Bjork B, Yang W, Kajimura S, Chin S, Kuang S, Scime A, Devarakonda S, Conroe HM, Erdjument-Bromage H, Tempst P, Rudnicki MA, Beier DR & Spiegelman BM (2008) PRDM16 controls a brown fat/skeletal muscle switch. Nature 454(7207): 961-967.
104. Sanchez-Gurmaches J, Hung CM, Sparks CA, Tang Y, Li H & Guertin DA (2012) PTEN loss in the Myf5 lineage redistributes body fat and reveals subsets of white adipocytes that arise from Myf5 precursors. Cell Metab 16(3): 348-362.
105. Shan T, Liang X, Bi P, Zhang P, Liu W & Kuang S (2013) Distinct populations of adipogenic and myogenic Myf5-lineage progenitors in white adipose tissues. J Lipid Res 54(8): 2214-2224.
106. Pellegrinelli V, Carobbio S & Vidal-Puig A (2016) Adipose tissue plasticity: how fat depots respond differently to pathophysiological cues. Diabetologia.
107. Geerling JJ, Boon MR, Kooijman S, Parlevliet ET, Havekes LM, Romijn JA, Meurs IM & Rensen PC (2014) Sympathetic nervous system control of triglyceride metabolism: novel concepts derived from recent studies. J Lipid Res 55(2): 180-189.
108. Villarroya F & Vidal-Puig A (2013) Beyond the sympathetic tone: the new brown fat activators. Cell Metab 17(5): 638-643.
109. Stern JH, Rutkowski JM & Scherer PE (2016) Adiponectin, Leptin, and Fatty Acids in the Maintenance of Metabolic Homeostasis through Adipose Tissue Crosstalk. Cell Metab 23(5): 770-784.
110. Dadson K, Liu Y & Sweeney G (2011) Adiponectin action: a combination of endocrine and autocrine/paracrine effects. Front Endocrinol (Lausanne) 2: 62.
111. Ronti T, Lupattelli G & Mannarino E (2006) The endocrine function of adipose tissue: an update. Clin Endocrinol (Oxf) 64(4): 355-365.
112. Henry SL, Bensley JG, Wood-Bradley RJ, Cullen-McEwen LA, Bertram JF & Armitage JA (2012) White adipocytes: more than just fat depots. Int J Biochem Cell Biol 44(3): 435-440.
113. Chen Q, Shou P, Zheng C, Jiang M, Cao G, Yang Q, Cao J, Xie N, Velletri T, Zhang X, Xu C, Zhang L, Yang H, Hou J, Wang Y & Shi Y (2016) Fate decision of mesenchymal stem cells: adipocytes or osteoblasts? Cell Death Differ .
114. Tang QQ & Lane MD (2012) Adipogenesis: from stem cell to adipocyte. Annu Rev Biochem 81: 715-736.
115. Huang H, Song TJ, Li X, Hu L, He Q, Liu M, Lane MD & Tang QQ (2009) BMP signaling pathway is required for commitment of C3H10T1/2 pluripotent stem cells to the adipocyte lineage. Proc Natl Acad Sci U S A 106(31): 12670-12675.
91
116. zur Nieden NI, Kempka G, Rancourt DE & Ahr HJ (2005) Induction of chondro-, osteo- and adipogenesis in embryonic stem cells by bone morphogenetic protein-2: effect of cofactors on differentiating lineages. BMC Dev Biol 5: 1.
117. Huang HY, Hu LL, Song TJ, Li X, He Q, Sun X, Li YM, Lu HJ, Yang PY & Tang QQ (2011) Involvement of cytoskeleton-associated proteins in the commitment of C3H10T1/2 pluripotent stem cells to adipocyte lineage induced by BMP2/4. Mol Cell Proteomics 10(1): M110.002691.
118. McBeath R, Pirone DM, Nelson CM, Bhadriraju K & Chen CS (2004) Cell shape, cytoskeletal tension, and RhoA regulate stem cell lineage commitment. Dev Cell 6(4): 483-495.
119. Christodoulides C, Lagathu C, Sethi JK & Vidal-Puig A (2009) Adipogenesis and WNT signalling. Trends Endocrinol Metab 20(1): 16-24.
120. Muruganandan S, Roman AA & Sinal CJ (2009) Adipocyte differentiation of bone marrow-derived mesenchymal stem cells: cross talk with the osteoblastogenic program. Cell Mol Life Sci 66(2): 236-253.
121. Bain G, Muller T, Wang X & Papkoff J (2003) Activated beta-catenin induces osteoblast differentiation of C3H10T1/2 cells and participates in BMP2 mediated signal transduction. Biochem Biophys Res Commun 301(1): 84-91.
122. Castro CH, Shin CS, Stains JP, Cheng SL, Sheikh S, Mbalaviele G, Szejnfeld VL & Civitelli R (2004) Targeted expression of a dominant-negative N-cadherin in vivo delays peak bone mass and increases adipogenesis. J Cell Sci 117(Pt 13): 2853-2864.
123. Ross SE, Hemati N, Longo KA, Bennett CN, Lucas PC, Erickson RL & MacDougald OA (2000) Inhibition of adipogenesis by Wnt signaling. Science 289(5481): 950-953.
124. van Tienen FH, Laeremans H, van der Kallen CJ & Smeets HJ (2009) Wnt5b stimulates adipogenesis by activating PPARgamma, and inhibiting the beta-catenin dependent Wnt signaling pathway together with Wnt5a. Biochem Biophys Res Commun 387(1): 207-211.
125. Park HW, Kim YC, Yu B, Moroishi T, Mo JS, Plouffe SW, Meng Z, Lin KC, Yu FX, Alexander CM, Wang CY & Guan KL (2015) Alternative Wnt Signaling Activates YAP/TAZ. Cell 162(4): 780-794.
126. Spinella-Jaegle S, Rawadi G, Kawai S, Gallea S, Faucheu C, Mollat P, Courtois B, Bergaud B, Ramez V, Blanchet AM, Adelmant G, Baron R & Roman-Roman S (2001) Sonic hedgehog increases the commitment of pluripotent mesenchymal cells into the osteoblastic lineage and abolishes adipocytic differentiation. J Cell Sci 114(Pt 11): 2085-2094.
127. Fontaine C, Cousin W, Plaisant M, Dani C & Peraldi P (2008) Hedgehog signaling alters adipocyte maturation of human mesenchymal stem cells. Stem Cells 26(4): 1037-1046.
128. Suh JM, Gao X, McKay J, McKay R, Salo Z & Graff JM (2006) Hedgehog signaling plays a conserved role in inhibiting fat formation. Cell Metab 3(1): 25-34.
129. Todoric J, Strobl B, Jais A, Boucheron N, Bayer M, Amann S, Lindroos J, Teperino R, Prager G, Bilban M, Ellmeier W, Krempler F, Muller M, Wagner O, Patsch W,
92
Pospisilik JA & Esterbauer H (2011) Cross-talk between interferon-gamma and hedgehog signaling regulates adipogenesis. Diabetes 60(6): 1668-1676.
130. Ross DA, Rao PK & Kadesch T (2004) Dual roles for the Notch target gene Hes-1 in the differentiation of 3T3-L1 preadipocytes. Mol Cell Biol 24(8): 3505-3513.
131. Rosen ED & MacDougald OA (2006) Adipocyte differentiation from the inside out. Nat Rev Mol Cell Biol 7(12): 885-896.
132. Cole KA, Harmon AW, Harp JB & Patel YM (2004) Rb regulates C/EBPbeta-DNA-binding activity during 3T3-L1 adipogenesis. Am J Physiol Cell Physiol 286(2): C349-54.
133. Tang QQ & Lane MD (1999) Activation and centromeric localization of CCAAT/enhancer-binding proteins during the mitotic clonal expansion of adipocyte differentiation. Genes Dev 13(17): 2231-2241.
134. Wu Z, Rosen ED, Brun R, Hauser S, Adelmant G, Troy AE, McKeon C, Darlington GJ & Spiegelman BM (1999) Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol Cell 3(2): 151-158.
135. Lefterova MI, Zhang Y, Steger DJ, Schupp M, Schug J, Cristancho A, Feng D, Zhuo D, Stoeckert CJ,Jr, Liu XS & Lazar MA (2008) PPARgamma and C/EBP factors orchestrate adipocyte biology via adjacent binding on a genome-wide scale. Genes Dev 22(21): 2941-2952.
136. Lowe CE, O'Rahilly S & Rochford JJ (2011) Adipogenesis at a glance. J Cell Sci 124(Pt 16): 2681-2686.
137. Wang ND, Finegold MJ, Bradley A, Ou CN, Abdelsayed SV, Wilde MD, Taylor LR, Wilson DR & Darlington GJ (1995) Impaired energy homeostasis in C/EBP alpha knockout mice. Science 269(5227): 1108-1112.
138. Linhart HG, Ishimura-Oka K, DeMayo F, Kibe T, Repka D, Poindexter B, Bick RJ & Darlington GJ (2001) C/EBPalpha is required for differentiation of white, but not brown, adipose tissue. Proc Natl Acad Sci U S A 98(22): 12532-12537.
139. Sue N, Jack BH, Eaton SA, Pearson RC, Funnell AP, Turner J, Czolij R, Denyer G, Bao S, Molero-Navajas JC, Perkins A, Fujiwara Y, Orkin SH, Bell-Anderson K & Crossley M (2008) Targeted disruption of the basic Kruppel-like factor gene (Klf3) reveals a role in adipogenesis. Mol Cell Biol 28(12): 3967-3978.
140. Jimenez MA, Akerblad P, Sigvardsson M & Rosen ED (2007) Critical role for Ebf1 and Ebf2 in the adipogenic transcriptional cascade. Mol Cell Biol 27(2): 743-757.
141. Tontonoz P & Spiegelman BM (2008) Fat and beyond: the diverse biology of PPARgamma. Annu Rev Biochem 77: 289-312.
142. Grygiel-Gorniak B (2014) Peroxisome proliferator-activated receptors and their ligands: nutritional and clinical implications--a review. Nutr J 13: 17-2891-13-17.
143. Banerjee SS, Feinberg MW, Watanabe M, Gray S, Haspel RL, Denkinger DJ, Kawahara R, Hauner H & Jain MK (2003) The Kruppel-like factor KLF2 inhibits peroxisome proliferator-activated receptor-gamma expression and adipogenesis. J Biol Chem 278(4): 2581-2584.
93
144. Oishi Y, Manabe I, Tobe K, Tsushima K, Shindo T, Fujiu K, Nishimura G, Maemura K, Yamauchi T, Kubota N, Suzuki R, Kitamura T, Akira S, Kadowaki T & Nagai R (2005) Kruppel-like transcription factor KLF5 is a key regulator of adipocyte differentiation. Cell Metab 1(1): 27-39.
145. Mori T, Sakaue H, Iguchi H, Gomi H, Okada Y, Takashima Y, Nakamura K, Nakamura T, Yamauchi T, Kubota N, Kadowaki T, Matsuki Y, Ogawa W, Hiramatsu R & Kasuga M (2005) Role of Kruppel-like factor 15 (KLF15) in transcriptional regulation of adipogenesis. J Biol Chem 280(13): 12867-12875.
146. Cao W, Daniel KW, Robidoux J, Puigserver P, Medvedev AV, Bai X, Floering LM, Spiegelman BM & Collins S (2004) p38 mitogen-activated protein kinase is the central regulator of cyclic AMP-dependent transcription of the brown fat uncoupling protein 1 gene. Mol Cell Biol 24(7): 3057-3067.
147. Yao S (2016) MicroRNA biogenesis and their functions in regulating stem cell potency and differentiation. Biol Proced Online 18: 8-016-0037-y. eCollection 2016.
148. Krist B, Florczyk U, Pietraszek-Gremplewicz K, Jozkowicz A & Dulak J (2015) The Role of miR-378a in Metabolism, Angiogenesis, and Muscle Biology. Int J Endocrinol 2015: 281756.
149. Lee S & Vasudevan S (2013) Post-transcriptional stimulation of gene expression by microRNAs. Adv Exp Med Biol 768: 97-126.
150. Alarcon CR, Lee H, Goodarzi H, Halberg N & Tavazoie SF (2015) N6-methyladenosine marks primary microRNAs for processing. Nature 519(7544): 482-485.
151. Karbiener M, Pisani DF, Frontini A, Oberreiter LM, Lang E, Vegiopoulos A, Mossenbock K, Bernhardt GA, Mayr T, Hildner F, Grillari J, Ailhaud G, Herzig S, Cinti S, Amri EZ & Scheideler M (2014) MicroRNA-26 family is required for human adipogenesis and drives characteristics of brown adipocytes. Stem Cells 32(6): 1578-1590.
152. Sun L & Trajkovski M (2014) MiR-27 orchestrates the transcriptional regulation of brown adipogenesis. Metabolism 63(2): 272-282.
153. Karbiener M, Fischer C, Nowitsch S, Opriessnig P, Papak C, Ailhaud G, Dani C, Amri EZ & Scheideler M (2009) microRNA miR-27b impairs human adipocyte differentiation and targets PPARgamma. Biochem Biophys Res Commun 390(2): 247-251.
154. Wu Y, Zuo J, Zhang Y, Xie Y, Hu F, Chen L, Liu B & Liu F (2013) Identification of miR-106b-93 as a negative regulator of brown adipocyte differentiation. Biochem Biophys Res Commun 438(4): 575-580.
155. Lee EK, Lee MJ, Abdelmohsen K, Kim W, Kim MM, Srikantan S, Martindale JL, Hutchison ER, Kim HH, Marasa BS, Selimyan R, Egan JM, Smith SR, Fried SK & Gorospe M (2011) miR-130 suppresses adipogenesis by inhibiting peroxisome proliferator-activated receptor gamma expression. Mol Cell Biol 31(4): 626-638.
156. Chen Y, Siegel F, Kipschull S, Haas B, Frohlich H, Meister G & Pfeifer A (2013) miR-155 regulates differentiation of brown and beige adipocytes via a bistable circuit. Nat Commun 4: 1769.
94
157. Sun L, Xie H, Mori MA, Alexander R, Yuan B, Hattangadi SM, Liu Q, Kahn CR & Lodish HF (2011) Mir193b-365 is essential for brown fat differentiation. Nat Cell Biol 13(8): 958-965.
158. Mori M, Nakagami H, Rodriguez-Araujo G, Nimura K & Kaneda Y (2012) Essential role for miR-196a in brown adipogenesis of white fat progenitor cells. PLoS Biol 10(4): e1001314.
159. Gerin I, Bommer GT, McCoin CS, Sousa KM, Krishnan V & MacDougald OA (2010) Roles for miRNA-378/378* in adipocyte gene expression and lipogenesis. Am J Physiol Endocrinol Metab 299(2): E198-206.
160. Feuermann Y, Kang K, Gavrilova O, Haetscher N, Jang SJ, Yoo KH, Jiang C, Gonzalez FJ, Robinson GW & Hennighausen L (2013) MiR-193b and miR-365-1 are not required for the development and function of brown fat in the mouse. RNA Biol 10(12): 1807-1814.
161. Miinalainen IJ, Schmitz W, Huotari A, Autio KJ, Soininen R, Ver Loren van Themaat E, Baes M, Herzig KH, Conzelmann E & Hiltunen JK (2009) Mitochondrial 2,4-dienoyl-CoA reductase deficiency in mice results in severe hypoglycemia with stress intolerance and unimpaired ketogenesis. PLoS Genet 5(7): e1000543.
162. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P & Cardona A (2012) Fiji: an open-source platform for biological-image analysis. Nat Methods 9(7): 676-682.
163. Schmittgen TD & Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3(6): 1101-1108.
164. Petrovic N, Walden TB, Shabalina IG, Timmons JA, Cannon B & Nedergaard J (2010) Chronic peroxisome proliferator-activated receptor gamma (PPARgamma) activation of epididymally derived white adipocyte cultures reveals a population of thermogenically competent, UCP1-containing adipocytes molecularly distinct from classic brown adipocytes. J Biol Chem 285(10): 7153-7164.
165. Frontini A & Cinti S (2010) Distribution and development of brown adipocytes in the murine and human adipose organ. Cell Metab 11(4): 253-256.
166. Guller I, McNaughton S, Crowley T, Gilsanz V, Kajimura S, Watt M & Russell AP (2015) Comparative analysis of microRNA expression in mouse and human brown adipose tissue. BMC Genomics 16(1): 820-015-2045-8.
167. Houweling AC, Dildrop R, Peters T, Mummenhoff J, Moorman AF, Ruther U & Christoffels VM (2001) Gene and cluster-specific expression of the Iroquois family members during mouse development. Mech Dev 107(1-2): 169-174.
168. Giordano A, Murano I, Mondini E, Perugini J, Smorlesi A, Severi I, Barazzoni R, Scherer PE & Cinti S (2013) Obese adipocytes show ultrastructural features of stressed cells and die of pyroptosis. J Lipid Res 54(9): 2423-2436.
169. Bloor ID, Sebert SP, Saroha V, Gardner DS, Keisler DH, Budge H, Symonds ME & Mahajan RP (2013) Sex differences in metabolic and adipose tissue responses to juvenile-onset obesity in sheep. Endocrinology 154(10): 3622-3631.
95
170. Hotamisligil GS & Erbay E (2008) Nutrient sensing and inflammation in metabolic diseases. Nat Rev Immunol 8(12): 923-934.
171. Hu E, Liang P & Spiegelman BM (1996) AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem 271(18): 10697-10703.
172. Matsubara M, Maruoka S & Katayose S (2002) Inverse relationship between plasma adiponectin and leptin concentrations in normal-weight and obese women. Eur J Endocrinol 147(2): 173-180.
173. Brown SD & Moore MW (2012) The International Mouse Phenotyping Consortium: past and future perspectives on mouse phenotyping. Mamm Genome 23(9-10): 632-640.
174. Shepherd PR & Kahn BB (1999) Glucose transporters and insulin action--implications for insulin resistance and diabetes mellitus. N Engl J Med 341(4): 248-257.
175. Abel ED, Peroni O, Kim JK, Kim YB, Boss O, Hadro E, Minnemann T, Shulman GI & Kahn BB (2001) Adipose-selective targeting of the GLUT4 gene impairs insulin action in muscle and liver. Nature 409(6821): 729-733.
176. Shepherd PR, Gnudi L, Tozzo E, Yang H, Leach F & Kahn BB (1993) Adipose cell hyperplasia and enhanced glucose disposal in transgenic mice overexpressing GLUT4 selectively in adipose tissue. J Biol Chem 268(30): 22243-22246.
177. Yoon MS, Zhang C, Sun Y, Schoenherr CJ & Chen J (2013) Mechanistic target of rapamycin controls homeostasis of adipogenesis. J Lipid Res 54(8): 2166-2173.
178. Zou S, Toh JD, Wong KH, Gao YG, Hong W & Woon EC (2016) N(6)-Methyladenosine: a conformational marker that regulates the substrate specificity of human demethylases FTO and ALKBH5. Sci Rep 6: 25677.
179. Tanaka T, Yoshida N, Kishimoto T & Akira S (1997) Defective adipocyte differentiation in mice lacking the C/EBPbeta and/or C/EBPdelta gene. EMBO J 16(24): 7432-7443.
180. Kajimura S, Seale P, Kubota K, Lunsford E, Frangioni JV, Gygi SP & Spiegelman BM (2009) Initiation of myoblast to brown fat switch by a PRDM16-C/EBP-beta transcriptional complex. Nature 460(7259): 1154-1158.
181. Wu J, Bostrom P, Sparks LM, Ye L, Choi JH, Giang AH, Khandekar M, Virtanen KA, Nuutila P, Schaart G, Huang K, Tu H, van Marken Lichtenbelt WD, Hoeks J, Enerback S, Schrauwen P & Spiegelman BM (2012) Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 150(2): 366-376.
182. Zheng Z, Liu X, Zhao Q, Zhang L, Li C & Xue Y (2014) Regulation of UCP1 in the Browning of Epididymal Adipose Tissue by beta3-Adrenergic Agonist: A Role for MicroRNAs. Int J Endocrinol 2014: 530636.
183. Berulava T, Rahmann S, Rademacher K, Klein-Hitpass L & Horsthemke B (2015) N6-Adenosine Methylation in MiRNAs. PLoS One 10(2): e0118438.
184. Kim C, Lee H, Cho YM, Kwon OJ, Kim W & Lee EK (2013) TNFalpha-induced miR-130 resulted in adipocyte dysfunction during obesity-related inflammation. FEBS Lett 587(23): 3853-3858.
185. Maloney SK, Fuller A, Mitchell D, Gordon C & Overton JM (2014) Translating animal model research: does it matter that our rodents are cold? Physiology (Bethesda) 29(6): 413-420.
96
186. Feldmann HM, Golozoubova V, Cannon B & Nedergaard J (2009) UCP1 ablation induces obesity and abolishes diet-induced thermogenesis in mice exempt from thermal stress by living at thermoneutrality. Cell Metab 9(2): 203-209.
97
Original publications
I Ronkainen J, Huusko TJ, Soininen R, Mondini E, Cinti F, Mäkelä KA, Kovalainen M, Herzig KH, Järvelin MR, Sebért S, Savolainen MJ & Salonurmi T (2015) Fat mass- and obesity-associated gene Fto affects the dietary response in mouse white adipose tissue. Sci Rep 5:9233.
II Ronkainen J, Mondini E, Cinti F, Cinti S, Sebért S, Savolainen MJ & Salonurmi T (2016) Fto-deficiency affects the gene and microRNA expression involved in brown adipogenesis and browning of white adipose tissue in mice. Manuscript.
Original publications are not included in the electronic version of the dissertation.
98
A C T A U N I V E R S I T A T I S O U L U E N S I S
Book orders:Granum: Virtual book storehttp://granum.uta.fi/granum/
S E R I E S D M E D I C A
1370. Pelkonen, Sari (2016) Frozen embryo transfer : early pregnancy, perinataloutcomes, and health of singleton children
1371. Pohjanen, Vesa-Matti (2016) Toll-like receptor 4 and interleukin 6 genepolymorphisms in Helicobacter pylori related diseases
1372. Hekkala, Anne (2016) Ketoacidosis at diagnosis of type 1 diabetes in childrenunder 15 years of age
1373. Kujanpää, Tero (2016) Generalized anxiety disorder and health care utilization
1374. Hintsala, Hanna-Riikka (2016) Oxidative stress and cell adhesion in skin cancer
1375. Lehtonen, Ville (2016) Dental and otologic problems in cleft lip and palatepatients from Northern Finland : cleft associated problems
1376. Koivukangas, Jenni (2016) Brain white matter structure, body mass index andphysical activity in individuals at risk for psychosis : The Northern Finland BirthCohort 1986 Study
1377. Väyrynen, Sara (2016) Histological and molecular features of serrated colorectaladenocarcinoma and its precursor lesions
1378. Kujanpää, Kirsi (2016) Mechanisms behind stem cell therapy in acute myocardialinfarction
1379. Törmälä, Reeta-Maria (2016) Human zona pellucida abnormalities – a geneticapproach to the understanding of fertilization failure
1380. Pinola, Pekka (2016) Hyperandrogenism, menstrual irregularities and polycysticovary syndrome : impact on female reproductive and metabolic health from earlyadulthood until menopause
1381. Haghighi Poodeh, Saeid (2016) Novel pathomechanisms of intrauterine growthrestriction in fetal alcohol syndrome in a mouse model
1382. Helminen, Olli (2016) Glucose metabolism in preclinical type 1 diabetes
1383. Raatiniemi, Lasse (2016) Major trauma in Northern Finland
1384. Huhta, Heikki (2016) Toll-like receptors in Alimentary tract -special reference toBarrett’s esophagus
1385. Kelhälä, Hanna-Leena (2016) The effect of systemic treatment on immuneresponses and skin microbiota in acne
1386. Lappalainen, Olli-Pekka (2016) Healing of cranial critical sized defects with grafts,stem cells, growth factors and bio-materials
UNIVERSITY OF OULU P .O. Box 8000 F I -90014 UNIVERSITY OF OULU FINLAND
A C T A U N I V E R S I T A T I S O U L U E N S I S
Professor Esa Hohtola
University Lecturer Santeri Palviainen
Postdoctoral research fellow Sanna Taskila
Professor Olli Vuolteenaho
University Lecturer Veli-Matti Ulvinen
Director Sinikka Eskelinen
Professor Jari Juga
University Lecturer Anu Soikkeli
Professor Olli Vuolteenaho
Publications Editor Kirsti Nurkkala
ISBN 978-952-62-1344-6 (Paperback)ISBN 978-952-62-1345-3 (PDF)ISSN 0355-3221 (Print)ISSN 1796-2234 (Online)
U N I V E R S I TAT I S O U L U E N S I S
MEDICA
ACTAD
D 1387
ACTA
Justiina Ronkainen
OULU 2016
D 1387
Justiina Ronkainen
ROLE OF FTO IN THE GENE AND MICRORNA EXPRESSION OF MOUSE ADIPOSE TISSUES IN RESPONSE TO HIGH-FAT DIET
UNIVERSITY OF OULU GRADUATE SCHOOL;UNIVERSITY OF OULU,FACULTY OF MEDICINE;MEDICAL RESEARCH CENTER;BIOCENTER OULU;OULU UNIVERSITY HOSPITAL