origins of diversity in the bacterioplankton theory, observations and evolutionary experiments...

Origins of diversity in Origins of diversity in the bacterioplanktonthe bacterioplankton

Theory, observations and Theory, observations and evolutionary experimentsevolutionary experiments

7/24/077/24/07

Lecture OutlineLecture Outline Diversity -Diversity -

Classification and observing Classification and observing

Generation -Generation - vertical and horizontal mechanismsvertical and horizontal mechanisms

Persistence -Persistence - Neutral TheoryNeutral Theory Niche TheoryNiche Theory Ecological trends in pelagic systemsEcological trends in pelagic systems

BIODIVERSITY

A

Macro Micro

Marine AssemblageFluorescent microscopy

Diversity: Classification and observingDiversity: Classification and observing

Genetic diversityGenetic diversity

BacteriaArchaea

Eucarya

Kingdom Animalia

Nucleic Acids

Pace, 1997


Ribosomal RNA-ubiquitous-conserved function-conserved+variable sequence

Image credit:NIH inside the cell

Areas in red and grey may vary in this molecule, and areas in violet and blue may not.

variable

fixed

VARIABLEVARIABLE

Quantitatively inferring relationships

Homo sapiens ...GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG...S. cereviceae ...GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAG...Zea maize ...GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAG... Escherichia coli ...GTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCG...Anacystis nidulans ...GTGCCAGCAGCCGCGGTAATACGGGAGAGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCG...Thermotoga maritima ...GTGCCAGCAGCCGCGGTAATACGTAGGGGGCAAGCGTTACCCGGATTTACTGGGCGTAAAGGG... Methanococcus vannielii ...GTGCCAGCAGCCGCGGTAATACCGACGGCCCGAGTGGTAGCCACTCTTATTGGGCCTAAAGCG... Thermococcus celer ...GTGGCAGCCGCCGCGGTAATACCGGCGGCCCGAGTGGTGGCCGCTATTATTGGGCCTAAAGCG... Sulfolobus sulfotaricus ...GTGTCAGCCGCCGCGGTAATACCAGCTCCGCGAGTGGTCGGGGTGATTACTGGGCCTAAAGCG...

“Alignment” of 16S/18S rRNA

Bacteria Archaea

Eucarya


“Domain” Bacteria

1994 - 13 divisions (all cultured)

2004 - 80 divisions 26/54

BACTERIAL “PHYLA/CLASS” ~80-90% rRNA SIMILARITY


RDP Global Census, 2003RDP Global Census, 2003

FIG. 3. Collector's curve of the Chao1 nonparametric richness estimator for sequences in the RDP-II. Accession numbers were used to determine the order in which sequences have been sampled. OTUs defined by a collection of identical sequences reached an estimate of 325,040 different OTUs.

Schloss and Handlesman, 2004Diversity: Classification and observingDiversity: Classification and observing

Strategy for exploringgenetic diversity

(Culture-independent)

estimates ofdiversity

Chao-1 non-parametric richness estimator

S = Sobs + (a2/2b)

Sobs total # observed species

a species observed once

b species observed twice

identification andremoval of artifacts

environment

clone, sequence and analyze

PCR amplified rRNA genes


Estimating diversity in microbial Estimating diversity in microbial ecologyecology

Extrapolated diversity of a Extrapolated diversity of a sampled abundancesampled abundance Depend on several factors:Depend on several factors:

Underlying distributionUnderlying distribution Sample sizeSample size Sampling strategySampling strategy

0

50

100

150

200

250

300

350

400

450

0 1 2 3 4 5 6 7 9 11 13 14 16 21 27 32 43 45

abundance

Number of OTUs observed


Two types of estimators for diversityTwo types of estimators for diversity Non-parametric estimators (Chao and lee, 1992)Non-parametric estimators (Chao and lee, 1992)

No abundance distribution model is assumed No abundance distribution model is assumed predict minimum number expected-> not total diversity!predict minimum number expected-> not total diversity!

Chao-1Chao-1

ACE (abundance-based coverage estimator of species ACE (abundance-based coverage estimator of species richness) estimates the diversity of rare and abundant taxa richness) estimates the diversity of rare and abundant taxa separatelyseparately

Parametric estimators (see discussion in Hong, PNAS, 2006)Parametric estimators (see discussion in Hong, PNAS, 2006) The abundance distribution is assumed to have a specific formThe abundance distribution is assumed to have a specific form Observed distribution is fit by maximum likelihood modelObserved distribution is fit by maximum likelihood model

Power-lawPower-law LognormalLognormal ParetoPareto GammaGamma

Large potential for error as we really don’t understand Large potential for error as we really don’t understand the natural distributions of biodiversity!the natural distributions of biodiversity!

€

CHAO1: S = Sobserved +S1

2

2S2


EnvironmenEnvironmentt

UnitsUnits Richness Richness (model)(model) ReferenceReference

Meso and Deep Meso and Deep SeaSea

97% V6 (16S 97% V6 (16S variable region)variable region)

~10~104 4 (chao1 and (chao1 and ACE)ACE)

Sogin et al,Sogin et al,

PNAS 2006PNAS 2006

Sargasso Sargasso seawaterseawater-10103 3 LL- all samplesall samples

100%16S rRNA 100%16S rRNA

94% rpoA94% rpoA

100% 16S rRNA100% 16S rRNA

1,412 (observed)1,412 (observed)

~1000 (chao1) ~1000 (chao1)

10106 6 (chao1)(chao1)

Venter et al., Venter et al., Science 2004Science 2004

Plum Island Plum Island Sound seawaterSound seawater - 1L- 1L

100% 16S rRNA100% 16S rRNA

99% 16S rRNA99% 16S rRNA1633 (chao1)1633 (chao1)

520 (chao1)520 (chao1)Acinas and Acinas and Klepac-Ceraj et Klepac-Ceraj et al., Nature 2004al., Nature 2004

Hypersaline Hypersaline

microbial matmicrobial mat100% 16S rRNA100% 16S rRNA

99-100% 16S 99-100% 16S rRNArRNA

1,336 (observed)1,336 (observed)

>10>104 4 (chao1 and (chao1 and ACE)ACE)

Ley R. E. et al., Ley R. E. et al., AEM 2006AEM 2006

Salt marsh Salt marsh sedimentsediment - 5g - 5g

99% 16S rRNA99% 16S rRNA 2411 ± 542 2411 ± 542

(pareto distribution)(pareto distribution)Hong et al., Hong et al.,

PNAS 2006PNAS 2006

How many types coexist in marine microbial How many types coexist in marine microbial communities? - wide variation in estimatescommunities? - wide variation in estimates


Why such variabilities in Why such variabilities in distribution? Rare Biospheredistribution? Rare Biosphere

Most diversity is rareMost diversity is rare New approach: Tag-New approach: Tag-

sequencing 16S allows high-sequencing 16S allows high-sample number = 118,000 sample number = 118,000 PCR amplicons ~120 bp hyper-PCR amplicons ~120 bp hyper-variable region of 16S rRNAvariable region of 16S rRNA

Non-parametric (chao1 and Non-parametric (chao1 and ACE) estimation of diversity at ACE) estimation of diversity at eight oceanic sites - meso- and eight oceanic sites - meso- and bathypelagic realms combined bathypelagic realms combined predict ~10predict ~104 4 coexisting types coexisting types per site (10-fold higher than per site (10-fold higher than other marine estimates)other marine estimates)

Relative abundance of OTUs Relative abundance of OTUs varies 1000-fold. Most of varies 1000-fold. Most of diversity is low-abundance diversity is low-abundance populationspopulationsSogin, PNAS 2006 Sogin, PNAS 2006

~25% ~25%


Q: How is relatedness of 16S rRNA Q: How is relatedness of 16S rRNA correlated to genomic similarity?correlated to genomic similarity?

70% DNA-DNA re-association has been the “gold standard” for assigning culture-positive organisms to microbial species. - correlates to 97-100% rRNA identity. The reciprocal relationship does not hold.

A: Not that well…

Sediment actinobacteriaStackebrandt and Goebel, 1994


e.g. three e.g. three E. coliE. coli strains have in common <40% of total protein genes strains have in common <40% of total protein genes

Welch et al. (2002)• strains from different environments

Core genome:- shared by all

(e.g., housekeeping)

Flexible genome:- strain specific

(e.g., pathogenicity islands, antibiotic resistance, integrons)

How are bacterial genomes differentiated?How are bacterial genomes differentiated?


Size variation among bacterioplanktonic Size variation among bacterioplanktonic ““V. splendidusV. splendidus” genomes” genomes

phylogenetic relationshipsof Hsp60 alleles

Genome sizes (4.5 to 5.6 Mb)

Isolates paired by identical Hsp60 alleles and represent spectrum of observed diversity

Suggests some diversification is due to large-scale genome changes


What drives genome diversification?What drives genome diversification?

Elements In Elements Out

DuplicationHorizontal gene transfer-homologous recombination-non-homologous recombination

Gene Loss

Dynamic genome contentDynamic genome content

GENOME

Diversity: GenerationDiversity: Generation

ConjugationConjugation: A bacterium attaches to another : A bacterium attaches to another bacterium and passes a fragment of its DNA bacterium and passes a fragment of its DNA (chromosomal or plasmid) to the recipient cell. (chromosomal or plasmid) to the recipient cell.

Foreign DNA uptake:

ConjugationTransformationTransduction

Mechanisms of Lateral Diversification

It is not known how many environmental bacterial exchange DNAthrough conjugation.(CAMERA query): What is the ratio of genes encoding sex pili to recA?


TransformationTransformation::Fragments of bacterial DNA are taken up by a cell from the environment. Fragments of bacterial DNA are taken up by a cell from the environment. These genetic fragments may recombine with the host chromosome, These genetic fragments may recombine with the host chromosome, permanently adding new genes.permanently adding new genes.

Foreign DNA uptake:



WH Freeman


Transduction:Transduction:Phage carry bacterial DNA from one bacterium to anotherPhage carry bacterial DNA from one bacterium to another

Foreign DNA uptake:



WH Freeman


What happens after DNA uptake?What happens after DNA uptake?

DestructionDestructionPlasmid replication Plasmid replication Homologous RecombinationHomologous RecombinationSite-specific RecombinationSite-specific RecombinationNon-homologous RecombinationNon-homologous Recombination



DestructioDestructionnPlasmid replication Plasmid replication Homologous RecombinationHomologous RecombinationSite-specific RecombinationSite-specific Recombination

Foreign DNA recognized by foreign methylation patternsRestriction endonucleases cleave foreign DNA

* * *ATTGCCCGTAATATTACGTAACGGGCATTATAATGC

A AA

A

T

T TTG

G

C

C

G

C


DNA as Food?DNA as Food?

FIG. 3. Average growth yields of wild-type (WT) or com mutant cells in minimal medium supplemented with 0.1% ultrapure sonicated salmon sperm DNA as the sole source of carbon and energy. Growth yields (indicated above each bar) were determined by dividing the number of cells after 24 h of incubation by the number of cells at inoculation.

DNA uptake mutants

Wild-type E. coli

Palchevskiy and Finkel, J. Bac, 2006

[DNA][DNA]marinemarine >100ug/L >100ug/L

[DNA][DNA]sedimentsediment >100ug/g >100ug/g



DestructionDestructionPlasmid replicationPlasmid replication Homologous RecombinationHomologous RecombinationSite-specific RecombinationSite-specific Recombination

WH Freeman


Ratio: recombination to Ratio: recombination to mutationmutation

Guttman and Dykhuizen, Science 1994

In E. coli recombination is 50-fold more likely to change a nucleotide site than mutationIn E. coli recombination is 50-fold more likely to change a nucleotide site than mutation

Multiple locus sequence typing (MLST) -> Multiple locus sequence typing (MLST) -> Similar recombination rates in other pathogen populationsSimilar recombination rates in other pathogen populations

Identify recombination events as deviations from phylogenetic congruency Identify recombination events as deviations from phylogenetic congruency 12 strains of E. coli (method of Wilson et al 1977)12 strains of E. coli (method of Wilson et al 1977)



DestructionDestructionPlasmid replication Plasmid replication Homologous RecombinationHomologous RecombinationSite-specific RecombinationSite-specific Recombination

~1% of Vibrio genomes are annotated as transposases or integrases.

V. vulnificus “super-integron” gene-capture system contains 188 attC sites and 202 orfs

Mobile genetic elements insert in genome:• Transposons (IS + transposase)• Integrons (attI site + integrase + gene cassette with attC site)

integrase


Point mutations

neutral (wobble)

nonsense/frameshift

Chromosomal mutations

Deletion

Duplication

Rearrangements

3.5 billion years in the making

Mechanisms of Vertical (clonal) Diversification

Vertical inheritance


How fast does the molecular clock How fast does the molecular clock tick?tick?

Neutral mutation rates:Neutral mutation rates:

E.coli lab cultures: 0.003 mutations per E.coli lab cultures: 0.003 mutations per genome division (Drake, 1991, 1993, 1998)genome division (Drake, 1991, 1993, 1998)

E.coli natural populations: 0.0001-0.0002 E.coli natural populations: 0.0001-0.0002 mutations per genome divisionmutations per genome division

Buchnera natural populations: 0.0001-Buchnera natural populations: 0.0001-0.0002 mutations per genome division0.0002 mutations per genome division

1-2% 16S rRNA divergence per 50 million 1-2% 16S rRNA divergence per 50 million years (Moran et al 1993) based on years (Moran et al 1993) based on BuchneraBuchnera

3.5 billion years of evolution!3.5 billion years of evolution!

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Co-evolution of thebuchnera-aphid symbiosisallows calibration ofmicrobial evolution rate.


Fitness differences: Fitness differences: Diversification by mutationDiversification by mutation

Evolution of Evolution of ggrowth rowth aadvantage in dvantage in sstationary tationary pphase: older hase: older cultures out-compete younger cultures.cultures out-compete younger cultures.

Mapped to mutations in rpoS (stress-response sigma Mapped to mutations in rpoS (stress-response sigma factor).factor).

Finkel, et al PNAS (1999)

Fig. 1. Consecutive generations of GASP mutants arise in the same culture. Progressively aged cultures were mixed. (A) One-day-old in the majority (solid line) vs. 10-day-old in the minority (broken line). (B) Ten-day-old in the majority (solid line) vs. 20-day-old in the minority (broken line). (C) Twenty-day-old in the majority (solid line) vs. 30-day-old in the minority (broken line). Asterisks indicate that cfu ml-1 were below the limit of detection (<102 cfu ml-1).


So far:So far:

There is vast (unknown) diversity of 16S rRNA There is vast (unknown) diversity of 16S rRNA ribotypesribotypes

There is even more genomic diversity There is even more genomic diversity associated with those ribotypesassociated with those ribotypes

There are many mechanisms for microbial There are many mechanisms for microbial diversification… diversification…

So, what drives the cohesion of populations So, what drives the cohesion of populations into the recognizable types we can observe?into the recognizable types we can observe?


Fraser, Science 2007

The frequency of recombination falls off The frequency of recombination falls off exponentially with the degree of genomic exponentially with the degree of genomic

DNA sequence divergence.DNA sequence divergence.

Bacillus, Staphylococcus and E. coli

Is homologous recombination more likely Is homologous recombination more likely within phylogenetic clusters?within phylogenetic clusters?

genetransfer amongclosely related strains

Microbial phylogenetic taxa may Microbial phylogenetic taxa may show some degree of biological show some degree of biological

isolationisolation(similar to Mayr 1942)(similar to Mayr 1942)

Zebra x Horse = HebraZebra x Horse = Hebra

HUMAN & DONKEY

~99% rRNA SIMILARITY

BACTERIAL “SPECIES” ~97% rRNA SIMILARITY

10

12

14

16

1463 1470 1477 1484

TIME

ABUNDANCE

X Y A B C

? %

A test:Do sequence clusters have coherent environmental dynamics?

Cohesive sequence clusters = ecotypes?

Population 2 Population 1

1

2

Units of BiologyUnits of Biology

Biological speciesBiological species PhylotypesPhylotypes

EcotypesEcotypes

PatternPatternPluralismPluralism

Reproductive Isolation

Ecological niche

Single lineage

Multiple models relevant

Operational TaxonomyOperational Taxonomy Phylotypes Phylotypes

Proxies for evolutionary speciesProxies for evolutionary species Single-lineage of ancestral populations/smallest Single-lineage of ancestral populations/smallest

diagnostable cluster of individualsdiagnostable cluster of individuals (Cracraft, 1983; Eldregde and Cracraft 1980)(Cracraft, 1983; Eldregde and Cracraft 1980)

Debatable assumption:Debatable assumption: The evolutionary history for the biomarker gene is a The evolutionary history for the biomarker gene is a

(good) proxy for the evolutionary history of the (good) proxy for the evolutionary history of the organism.organism.

ExamplesExamples 16S ribosomal RNA16S ribosomal RNA Housekeeping genesHousekeeping genes


EcotypesEcotypes


Operational TaxonomyOperational Taxonomy Biological SpeciesBiological Species

Earnst Mayr, 1942Earnst Mayr, 1942 Groups of organisms that can interbreedGroups of organisms that can interbreed Reproductive isolationReproductive isolation Homologous recombination in microbes may enable bio-Homologous recombination in microbes may enable bio-

species like evolutionspecies like evolution Observed in microbes through multi-locus sequence Observed in microbes through multi-locus sequence

typing (MLST) or whole-genome comparisonstyping (MLST) or whole-genome comparisons


EcotypesEcotypes


Operational TaxonomyOperational Taxonomy Ecological Species (Ecotype)Ecological Species (Ecotype)

Lineage that occupies an ecological niche (adaptive Lineage that occupies an ecological niche (adaptive zone)zone)

Definition allows for “hybridization” events if niche is Definition allows for “hybridization” events if niche is unchangedunchanged

Observed in microbes through population dynamicsObserved in microbes through population dynamics Van Valen, 1976Van Valen, 1976


EcotypesEcotypes


Operational TaxonomyOperational Taxonomy Pattern PluralismPattern Pluralism

Similarities and differences between organisms may be Similarities and differences between organisms may be accounted for by evolutionary mechanisms, however a accounted for by evolutionary mechanisms, however a single-tree like pattern (tree of life) is not the expected single-tree like pattern (tree of life) is not the expected outcome.outcome.

““Different evolutionary models and representations of Different evolutionary models and representations of relationships will be appropriate, and true, for different relationships will be appropriate, and true, for different taxa or at different scales or for different purposes”taxa or at different scales or for different purposes”

Doolittle and Bapteste, PNAS 2007Doolittle and Bapteste, PNAS 2007


EcotypesEcotypes


““Pattern Pluralism” in Chimeric ThermotogaPattern Pluralism” in Chimeric Thermotoga

Nesbo, Dlutek and Doolittle, 2006

“Different parts of a genome may belong to different biological Species if our species concept is based on the ability to share Information by homologous recombination.”

Diversity Metrics*Diversity Metrics*

MetricMetric UnitUnit Pro’sPro’s Con’sCon’sRibotype (16S rRNA)Ribotype (16S rRNA) phylotypephylotype universal,universal,

Culture-independentCulture-independent

High associated genomic variabilityHigh associated genomic variability

Single-locus Single-locus Housekeeping geneHousekeeping gene

phylotypephylotype Higher phylogenetic resolution, Higher phylogenetic resolution,

Culture-independentCulture-independent

Not universal,Not universal,

High associated genomic variabilityHigh associated genomic variability

Multi-locus sequence Multi-locus sequence types (MLST)types (MLST)

phylotypephylotype

Biospecies?Biospecies?

Can determine recombination Can determine recombination rates and clonality of population rates and clonality of population structurestructure

Not universal, Not universal,

Need cultured isolates*Need cultured isolates*

Environmental Environmental

Gene clustersGene clusters

ecotypeecotype

phylotypephylotype

Culture-independent and Culture-independent and suggests ecological significancesuggests ecological significance

Must link to environmental data set, Must link to environmental data set, within cluster genomic variation is within cluster genomic variation is unknown.unknown.

Metagenome Metagenome fragmentsfragments

ecotypesecotypes

phylotypesphylotypes


Environmental detection, Environmental detection, presents total genetic diversitypresents total genetic diversity

Challenges associated with linking Challenges associated with linking phylogetically-informative genes to phylogetically-informative genes to genetic diversitygenetic diversity

Whole GenomesWhole Genomes ecotypesecotypes

phylotypesphylotypes


Most accurateMost accurate Large sequencing effort, Need Large sequencing effort, Need cultured isolates*cultured isolates*

*Conclusions subject to debate!

Lecture OutlineLecture Outline Diversity -Diversity -

definitions and measurement definitions and measurement

Generation -Generation - vertical and horizontal mechanismsvertical and horizontal mechanisms

Persistence -Persistence - Neutral TheoryNeutral Theory Niche TheoryNiche Theory Ecological trends in pelagic systemsEcological trends in pelagic systems

Paradox of the planktonParadox of the plankton

1961 G. E. Hutchinson (Am. Nat. 95:137-145)1961 G. E. Hutchinson (Am. Nat. 95:137-145)““The problem that is presented by the phytoplankton The problem that is presented by the phytoplankton is essentially how is it possible for a number of is essentially how is it possible for a number of species to co-exist in a relatively isotropic or species to co-exist in a relatively isotropic or unstructured environment all competing for the same unstructured environment all competing for the same sorts of materials?”sorts of materials?”

Persistence of DiversityPersistence of Diversity Neutral TheoryNeutral Theory

stochastic interactions and dispersalstochastic interactions and dispersal

Niche TheoryNiche Theory SpecializationSpecialization Environmental heterogeneityEnvironmental heterogeneity

Neutral TheoriesNeutral Theories Unified Neutral Theory of Biodiversity (Hubble, Unified Neutral Theory of Biodiversity (Hubble,

2001)2001) Seek to explain community level patterns without Seek to explain community level patterns without

(before) invoking specialization of species.(before) invoking specialization of species. Highly similar (ecologically-equivalent or functionally-Highly similar (ecologically-equivalent or functionally-

redundant) species co-exist by stochastic mechanisms.redundant) species co-exist by stochastic mechanisms. Diversity is a balance of immigration and local Diversity is a balance of immigration and local

extinctionextinction



How strong is How strong is “purifying selection” “purifying selection” over the scale of ocean over the scale of ocean mixing?mixing?

Neutral TheoriesNeutral Theories

Island biogeography (MacArthur and Wilson, Island biogeography (MacArthur and Wilson, 1967)1967)

Number of species on a island is determined by effect of Number of species on a island is determined by effect of distance from mainland and the island size.distance from mainland and the island size.

Many types of “islands”: habitat surrounded by an Many types of “islands”: habitat surrounded by an inhabitable environment (fish, marine snow…)inhabitable environment (fish, marine snow…)

New species are created by isolation of gene pools and New species are created by isolation of gene pools and drift (allopatric speciation)drift (allopatric speciation)

Specialization: Niche TheorySpecialization: Niche Theory

pO2

Temperature

Niche#1

Niche #2

Fundamental Niches(Hutchinson, 1958)

pO2

Temperature

Niche#1

Competition = Niche Overlap

Fundamental NicheRealized Niche

Niche#3


pO2

Temperature

Niche#1

Specialization = Co-existence

e.g. Carbon Source


On Competitive On Competitive ExclusionExclusion

Complete competitors cannot coexist (Hardin, Complete competitors cannot coexist (Hardin, 1960)1960)

BUTBUT “…“…there are innumerable dimensions in which there are innumerable dimensions in which

differences could be found” (Valiela, 1995)differences could be found” (Valiela, 1995)



Sinking Detritus (Marine Snow):Sinking Detritus (Marine Snow):Ephemeral Microenvironments Ephemeral Microenvironments

(Niches)(Niches)

F. Azam, Nature 2001

Phytoplankton Niche AxesPhytoplankton Niche Axes

Fig. 3. Optimum temperature and light intensity for growth, (Topt) and (Iopt), of all initialized Prochlorococcus analogs (all circles) from the ensemble of 10 model integrations. Large circles indicate the analogs that exceeded a total biomass of 106 mol P along AMT13 in the 10th year. Colors indicate classification into model ecotypes. Bold diamonds indicate real-world Prochlorococcus ecotypes.

Follows, et al Science 2007

Emergent biogeography parallels Emergent biogeography parallels observationsobservations

Figure 1. Annual mean biomass and biogeography from single integration. (A) Total phytoplankton biomass (µM P, 0 to 50 m average). (B) Emergent biogeography: Modeled photo-autotrophs were categorized into four functional groups; color coding is according to group locally dominating annual mean biomass. Green, analogs of Prochlorococcus; orange, other small photo-autotrophs; red, diatoms; and yellow, other large phytoplankton. (C) Total biomass of Prochlorococcus analogs (µM P, 0 to 50 m average). Black line indicates the track of AMT13.

Follows, et al Science 2007

Units of selection are Light and Temperature optima - not taxa

……a study of biogeography on the basis of the global a study of biogeography on the basis of the global distribution of genes and their alleles and their distribution of genes and their alleles and their patterns of divergence and dispersal. This should patterns of divergence and dispersal. This should be a central guiding principle for the new be a central guiding principle for the new science of metagenomics….science of metagenomics….


……a study of biogeography on the basis of the global a study of biogeography on the basis of the global distribution of genes and their alleles and their distribution of genes and their alleles and their patterns of divergence and dispersal. This should patterns of divergence and dispersal. This should be a central guiding principle for the new be a central guiding principle for the new science of metagenomics….science of metagenomics….


Recent studies suggest gene-ecologies may circumvent much of the confusion around trying to link the activities of microbial communities to their phylogenetic structure

After all - functional genes, not ribosomes drive niche-partitioning

Persistence of DiversityPersistence of Diversity Neutral TheoryNeutral Theory

stochastic interactions and dispersalstochastic interactions and dispersal

Niche TheoryNiche Theory SpecializationSpecialization Environmental heterogeneityEnvironmental heterogeneity

Ecological trends in pelagic systemsEcological trends in pelagic systems Environmental gradientsEnvironmental gradients BiogeographyBiogeography

Do genes track environmental Do genes track environmental gradients?gradients?

Hawaii Ocean Time seriesHawaii Ocean Time series Depth variability of gene distributions Depth variability of gene distributions

examined by end-sequencing ~5000 fosmids examined by end-sequencing ~5000 fosmids from each depthfrom each depth

Look for specific genes and metabolic traits Look for specific genes and metabolic traits that were differentially distributed in the that were differentially distributed in the water column.water column.



Fig. 1. Temperature versus salinity (T-S) relations for the North Pacific Subtropical Gyre at station ALOHA (22°45'N, 158°W). The blue circles indicate the positions, in T-S "hydrospace" of the seven water samples analyzed in this study. The data envelope shows the temperature and salinity conditions observed during the period October 1988 to December 2004 emphasizing both the temporal variability of near-surface waters and the relative constancy of deep waters.

Habitat-enriched gene groupsHabitat-enriched gene groups



DeLong, et al Science 2006

Fig. 4. Cluster analyses of COG annotated photic zone and deep water sequence bins versus depth. Yellow shading is proportional to the percentage of categorized sequences in each category.

Photic Zone:Light-driven processes (KEGG)Motility (KEGG)Iron-transport

Deep sea:Transposases and integrasesPilus synthesis (KEGG)Antibiotic synthesis

Clusters of orthologous groups

Gene-based biogeographyGene-based biogeography

Global Ocean Survey:Global Ocean Survey: 7.6 million random sequence reads (Venter et 7.6 million random sequence reads (Venter et

al 2007)al 2007)



GOS transect map(Yutin, EM 2007)

Gene-based biogeographyGene-based biogeography

Global Ocean SurveyGlobal Ocean Survey PufM: subunit of anoxygenic photosynthetic reaction PufM: subunit of anoxygenic photosynthetic reaction

center.center.

(Yutin, EM 2007)



Fig. 4. Anoxygenic photosynthetic population compositions along the GOS transect. Colours used to represent different types of environments … colours representing the eight major phylogroups …Note that samples 5, 6 and 7 are different size fractions from the same station.

PufM-type Different types associated with different environments

Cosmopolitan: G Oligotrophic: A,B Coastal: E,K Offshore: C,D

SummarySummary How do we assess microbial diversity?How do we assess microbial diversity?

Classification and ObservationsClassification and Observations Contributions of 16S ribotyping to understanding the Contributions of 16S ribotyping to understanding the

potential scale of global microbial diversitypotential scale of global microbial diversity Use of statistical estimators to attempt total diversity Use of statistical estimators to attempt total diversity

estimatesestimates Microbial species concepts - can we define a unit of Microbial species concepts - can we define a unit of

selection?selection?

How is this diversity generated?How is this diversity generated? horizontal and vertical mechanismshorizontal and vertical mechanisms

3.5 million years of vertical evolution3.5 million years of vertical evolution Mobile genetic elements and LGT Mobile genetic elements and LGT Homologous recombination as a population-cohesive Homologous recombination as a population-cohesive

forceforce

SummarySummary

How is this diversity maintained in the oceans?How is this diversity maintained in the oceans?

Neutral TheoryNeutral Theory: Diversity can partially be explained by : Diversity can partially be explained by stochastic environmental interactions that drive stochastic environmental interactions that drive immigration and local extinctionsimmigration and local extinctions

Niche Theory: Diversity is explained by the Niche Theory: Diversity is explained by the specialization of co-existing typesspecialization of co-existing types

Linking structure (co-existing diversity) to function Linking structure (co-existing diversity) to function (e.g. global biogeochemical processes) can be (e.g. global biogeochemical processes) can be approached in a taxa-independent manner that relies approached in a taxa-independent manner that relies on the ecologies of genetic systems.on the ecologies of genetic systems.

The last slide

origins of diversity in the bacterioplankton theory, observations and evolutionary experiments...

Documents

estimating diversity

origins of diversity

rrna similarity diversity

variable fixed slide

abundance distribution

b species

sampled abundance

b s obs total