new core curriculum

23
New Core Curriculum New Core Curriculum Molecular Genetics & Gene Molecular Genetics & Gene Function Function Foundations of Scientific Foundations of Scientific Process Process

Upload: bernadette-freddy

Post on 02-Jan-2016

47 views

Category:

Documents


3 download

DESCRIPTION

New Core Curriculum. Foundations of Scientific Process. Molecular Genetics & Gene Function. New Core Curriculum. Foundations of Scientific Process. Review Concepts covered so far:. Chromosomes Genome Genes Central Dogma of Molecular Biology DNA, RNA, proteins Hershey-Chase experiment - PowerPoint PPT Presentation

TRANSCRIPT

Page 2: New Core Curriculum

New Core CurriculumNew Core Curriculum

Review Concepts covered so far:Review Concepts covered so far:

Foundations of Scientific ProcessFoundations of Scientific Process

Chromosomes Genome Genes Central Dogma of Molecular Biology DNA, RNA, proteins Hershey-Chase experiment Mendel’s laws of heredity Alleles Heterozygous vs. homozygous

Page 3: New Core Curriculum

Transcription:DNA mRNA Translation:

mRNA protein

Regulation: DNA switched on

Page 4: New Core Curriculum
Page 5: New Core Curriculum

. .

Most DNA sequences are transcribed, but only few RNAs are translated to proteins

Human Genome100%

transcribed

transcribed, both strands

Messenger RNAs~ 2%

Mattick, J., Human Molecular Genetics, 2006, Vol. 15, Review Issue 1

Page 6: New Core Curriculum

What Is A Virus?: Genetics Review

The structure of DNA:

Meaning of a genetic code ProteinsMeaning of a genetic code Proteins

variable sequence (string) built of variable sequence (string) built of 20 amino acids (building blocks) 20 amino acids (building blocks)

strings of amino acids fold up into strings of amino acids fold up into particular shapeparticular shape

Shape governs the Function (Meaning)Shape governs the Function (Meaning)

Page 7: New Core Curriculum

1) DNA encodes RNA2) RNA encodes Proteins3) Proteins encode shape/function

Genetic information (the MEANING) is encoded in the SEQUENCE of basis along the DNA strand; DNA is not a direct template for protein synthesis;

The Central Dogma of The Central Dogma of Molecular Biology:Molecular Biology:

DNA RNA Protein

Page 8: New Core Curriculum

The Codon CodeThe Codon Code

Triplets of RNA bases translate to particular amino acids. Triples are called Codons.

Page 9: New Core Curriculum

CodonsCodons

Codons are three-base strings, so the number of possible codons are theoretically 4·4·4 = 64

There are 20 amino acids

This includes the 1 START codon (Methionine)

The 3 STOP codons don't code for amino acids

What is the biological significance of the extensive redundancy of the genetic code ???

Page 10: New Core Curriculum

. . . AAAGCTTTTTATGCGTTCAAG . . .

. . . AAAGCUUUUUAUGCGUUCAAG . . .

. . . Lys-Ala-Phe-Tyr-Ala-Phe-Lys . . .

The Central Dogma of Molecular BiologyThe Central Dogma of Molecular Biology

DNA RNA Protein

Page 11: New Core Curriculum

Lys Ala Phe Ala Phe LysTyr

The Central Dogma of Molecular BiologyThe Central Dogma of Molecular Biology

DNA RNA Protein

Page 12: New Core Curriculum

The Central Dogma of Molecular BiologyThe Central Dogma of Molecular Biology

DNA RNA Protein

The essential amino acids are isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine. These amino acids are not produced by the body and must be obtained through

protein-rich foods like beef, poultry, fish, eggs, and dairy products, or through healthy supplementation.

Page 13: New Core Curriculum

atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc atggtgcatctgactcctgaggagaagtctgccgttactgccctgtgg ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg ctggtggtctacccttggacccagaggttctttgagtcctttggggat ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac aagtatcactaagctcgctttcttgctgtccaatttctattaaaggtt cctttgttccctaagtccaactactaaactgggggatattatgaaggg ccttgagcatctggattctgcctaataaaaaacatttattttcattgc

Real Genes: Globin

find a reading frame

Page 14: New Core Curriculum

Real Genes: Globin

atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg ctggtggtctacccttggacccagaggttctttgagtcctttggggat ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac aagtatcactaagctcgctttcttgctgtccaatttctattaaaggtt cctttgttccctaagtccaactactaaactgggggatattatgaaggg ccttgagcatctggattctgcctaataaaaaacatttattttcattgc

START of globin

Page 15: New Core Curriculum

atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg ctggtggtctacccttggacccagaggttctttgagtcctttggggat ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac aagtatcacTAAgctcgctttcttgctgtccaatttctattaaaggtt cctttgttccctaagtccaactactaaactgggggatattatgaaggg ccttgagcatctggattctgcctaataaaaaacatttattttcattgc

STOP of globin

Page 16: New Core Curriculum

atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg ctggtggtctacccttggacccagaggttctttgagtcctttggggat ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac aagtatcacTAAgctcgctttcttgctgtccaatttctattaaaggtt cctttgttccctaagtccaactactaaactgggggatattatgaaggg ccttgagcatctggattctgcctaataaaaaacatttattttcattgc

Real Genes: Globin

Page 17: New Core Curriculum

Activity: Sickle cell anemia

Page 18: New Core Curriculum

Chemical: Molecules that encode hereditary information are complex, yet built out of the same atomic set: in particular C, H, O, N, P, and S.

Meaningful: Sequences or strings of bases encode meaningful information (govern structure & function of proteins).

Page 19: New Core Curriculum

Improbable: Likelihood of 2 DNA sequences being equal by chance is exceedingly small.

Historical: If you took at two people and compare a small stretch of their DNA, the chance that that small stretch agrees in all but one base pair is extraordinarily tiny if due to pure chance. It is far more likely that the correct explanation should be that all humans are related by some sort of process of inheritance. Inheritance implies ancestry, which in turn implies history.

Humans share ~99.8 % of DNA with one another,~98% of DNA with chimpanzees (our closest living relatives),and some fraction of DNA with all life on Earth.

Page 20: New Core Curriculum
Page 21: New Core Curriculum

Probability: one way of quantifying what outcomes are liable to be observed

Probability P = (number of outcomes of interest) / (number of possible outcomes)

Always a number between zero and one

P(A OR B OR C) = P(A) + P(B) + P(C)

P(A AND B AND C) = P(A) x P(B) x P(C)

Page 22: New Core Curriculum

What is a virus?

DNA or RNA molecule carrying virus’ genetic code

Encapsulated into protective protein shell (capsid)

Viruses generally cannot self-replicate

So they hijack the cell’s machinery

New Central Dogma of New Central Dogma of Molecular Biology:Molecular Biology:

Ex: HIV is a strand of RNA capable of transferring its information “backwards” into the cell’s DNA.

DNA RNA Protein

Page 23: New Core Curriculum

Vaccines against Viral Infections

Potential Problem: The vaccine version of the virus reverts to a virulent form.QUESTION: Suppose the chance of a base mutating is 20%, and chance to mutate back to original base is 1/3. What is the chance that base in a modified virus will revert back to what it was originally?

QUESTION: Some poliovirus vaccines involves 5 effective mutations that weaken the virus. Imagine that the vaccine is administered to 5,000,000 people. How many people are liable to be infected by harmful polio that originates from a reversion of the vaccine?