Module 4 – Mutational analysis of the lac operon

Week 1

Overview

• Week 1: Bioinformatics to identify mutations in DNA and analyze restriction enzyme maps

• Week 2: Confirm mutations using RE digestion and agarose gel electrophoresis

• Week 3: Oral presentations of the lac operon mutants we discover.

LacZ coding regionCAP StartOper.-35 -10

Structure of the E. coli lac operon

• Operons are regulatory units in bacterial genomes

• Promoter region (above) controls when transcription of mRNA from DNA template occurs

• Lac operon controls expression of three genes needed for metabolizing lactose– LacZ, LacY and LacA genes

Nucleotide sequence in promoter region of lac operon

• CAP = cAMP binding protein (CAP) recognition site• -35 and -10 are transcription factor binding sites• Operator/LacI = Operator region when the LacI inhibitor protein binds• Trans. Start = place where RNA polymerase binds to start transcription• ATG codon is the starting methionine of the coding region for β-Gal

CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGG

CTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGA

GCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATT

CAP binding site

Operator/LacI…-10 site-35 site

…binding site Transcription start Methionine start

LacZ coding regionCAP StartOper.-35 -10

Glu Lac

RNA polymerase binds and transcribes DNA

CAP -35 -10 Oper. Start Coding region

Regulation of the lac operon by sugar

• Absence of glucose and presence of lactose required for activation of transcription of the lac operon.

Plasmids are autonomous,self-replicating DNA molecules

• Plasmids are closed, circular, double-stranded DNA

• Small size (<10 kb) allows efficient transfer into cell

• Autonomously replicate (separate from chromosomal DNA of host)

• Selectable marker (e.g., antibiotic resistance gene, ampicillin) discriminates plasmid-containing cells

• Multiple cloning site (MCS) allows insertion of foreign DNA using restriction enzymes

pBS(3kB)

MCSAmp.

Ori.

Using plasmids as carriers of genetic material

• Example shown is genomic DNA

• Insert DNA fragments into cloning vector

• Once created, plasmids can be purified and analyzed for genetics mutations

Inserting the lac operon into the plasmid allows us to look for mutations

• A set of plasmids is available in which the wild-type lac operon and mutant lac operons have been cloned into a plasmid

• Increased size of plasmid due to insert

• Easy to purify, sequence the DNA, and analyze using restriction enzymes

pLac/WT(6kB)

lacoperonAmp.

Ori.

DNA sequences for lac operon will be provided to you

• pLac/WT is the DNA sequence for the lac operon without mutations

• Mutants m1 through m7 will be compared with the WT for genetic variations

• Types of mutations you might find:– Substitutions– Insertions (frameshift?)– Deletions (frameshift?)– Truncation

Compare DNA sequences using a program that performs alignment

• Biology Workbench 3.2 will be used• Enter sequences of WT and your mutant• Using ALIGN program to perform alignment

Alignment results• A portion of the alignment results shown below• Length of sequences reported• Identify number of identities/mis-matches

Restriction endonucleases: molecular scissors

• Enzymes that cleave double-stranded DNA at specific restriction site on DNA

• Recognize very specific base sequences– Usually palindromic sequences• Two strands are identical when read in same polarity

– Typically 4-8 nucleotides in length– Cleavage of bond on each strand often leads to

“sticky ends” with nucleotide overhang• Blunt ends occur when restriction enzyme does not

leave overhang

Many restriction enzymes create “sticky ends”

• NdeI:5’ CATATG3’

GTATAC

·BamHI: 5’ GGATCC3’ CCTAGG

Restriction map

• Use the full-length sequence of lac operon inserted into plasmid backbone

• Analyze all possible RE cutting sites with program TACG

• Carry out analysis for both WT and mutant.• Look for differences in the RE cutting pattern

that can be used as a diagnostic

Results from TACG program for pLac/WT

• Selected Sequence(s)pLac/WT insert

• Enzymes that DO NOT MAP to this sequence• Total Number of Hits per Enzyme• Cut Sites by Enzyme• Pseudo-Gel Map of Digestions• Fragment Sites by Enzyme• Linear Map of Sequence

Enzymes that DO NOT MAP to this sequence:

• AarI • AclI • AflII • AgeI • AhdI • AjuI • AjuI • AloI • AloI • ArsI • ArsI • AscI • AsiSI • AvrII

• BarI • BarI • BbeI • BbvCI • BglII • BmgBI • BmtI • BplI • BpuEI • BsaI • BseRI • BsmI • BspEI • BspHI

•BsrDI •BsrGI•BstAPI •BstEII •CspCI •CspCI •EcoNI •FalI •FseI •FspAI •KasI •KflI •MfeI •MreI •MscI •NaeI •NarI

• NcoI • NgoMIV • NheI • NruI • NsiI • PacI • PasI • PmeI • PmlI • PpiI • PpiI • PshAI • PsiI • PsrI

•PsrI •RsrII •SapI •SbfI •ScaI •SexAI •SfiI •SfoI •SgrAI •SgrDI •SnaBI •SphI •SrfI •StuI •SwaI •Tth111I •XbaI •XmnI

Cut Sites by Enzyme (examples)• AatII G_ACGT'C (0 Err) - 1 Cut(s) 1011 • AbsI CC'TCGA_GG (0 Err) - 1 Cut(s) 286 • Acc65I G'GTAC_C (0 Err) - 2 Cut(s) 271 568• AcuI CTGAAGnnnnnnnnnnnnnn_nn' (0 Err) - 1 Cut(s) 1122 • AfeI AGC'GCT (0 Err) - 1 Cut(s) 2223 • AleI CACnn'nnGTG (0 Err) - 4 Cut(s) 1728 2677 3223 3458

Determine size of fragments produced

• 0 cuts will leave plasmid DNA supercoiled• 1 cut will linearize DNA; need to know total bp to

predict its size• 2 cuts will first linearize and then generate two

different fragment• Acc65I - 2 Cut(s) at position 271 and 568– 568-271 = 297 bp– Second piece is 5911 – 297 = 5614 bp– Separating RE digest shows two bands at these sizes

Comparing WT and mutant RE maps can reveal differences in predicted fragment size

• Look for appearance or disappearance of a restriction site

• Look for a large shift in the size of a fragment of the mutant versus WT DNA

Restriction Wild-type:position of

# cuts

mutant: Position of site(s)

# cuts Enzyme site(s) & size of fragments & size of fragments

AatII

Position:

Position:

Size: Size:

AseI

Position:

Position:

Size: Size:

BamHI

Position:

Position:

Size: Size:

BsrGI Position: Position:

Homework

• Email or give to Krist by next Tuesday• Exercise #1– Copy of your alignment– Answers to three questions

• Exercise #2– Copy of your restriction analysis output– Answers to two questions

• Next time: use the restriction analysis to cut the DNA and run gels