m rodell et al. nature 460 , 999 - 1002 (2009) doi:10.1038/nature08 238

M Rodell et al. Nature 460, 999-1002 (2009) doi:10.1038/nature08238 Monthly time series of water storage anomalies in northwestern India.

Upload: ataret

Post on 04-Jan-2016

21 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

DESCRIPTION

Monthly time series of water storage anomalies in northwestern India. M Rodell et al. Nature 460 , 999 - 1002 (2009) doi:10.1038/nature08 238. - PowerPoint PPT Presentation

TRANSCRIPT

M Rodell et al. Nature 460, 999-1002 (2009) doi:10.1038/nature08238

Monthly time series of water storage anomalies in northwestern India.

Overall Coordination:Program Design:Singer: Julio Quinones, Rodell Reed, ESFL BoardJulio QuinonesAmanda Walzer Meet Coordinator:Stats Liaison/Heat Sheet

CD Putnam et al. Nature 000 , 1 - 6 (2009) doi:10.1038/nature08 217

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Matt Rodell Hydrological Sciences Branch, NASA GSFC Enhancing the Value of GRACE for Hydrology Matt Rodell 1, Jay Famiglietti 2, and Ben Zaitchik 1,3 1

GI Motility online (May 2006) | doi:10.1038/gimo46

JB Kim et al. Nature 461 , 649 - 653 (2009) doi:10.1038/nature08 436

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

GI Motility online (May 2006) | doi:10.1038/gimo6

GI Motility online (May 2006) | doi:10.1038/gimo12

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NPHYS3211 Supplementary Information for

Macroporous nanowire nanoelectronic scaffolds …cmliris.harvard.edu/assets/10.1038-nmat3404.pdfARTICLES PUBLISHED ONLINE: 26 AUGUST 2012 |DOI:10.1038/NMAT3404 Macroporous nanowire

Woe Unto You, Lawyers - Rodell (1939)

17 September 2009 doi:10.1038/nature08355 LETTERS

doi:10.1038/nature05202 LETTERS

DOI: 10.1038/ncomms1280 molecular dynamics of single

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Published in Nature Materials (2016) doi:10.1038/nmat4569

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

Supplementary information - Nature · © 200 9 Macmillan Publishers Limited. ... 10.1038/nchem.290 Supplementary information 6 ... 10.1038/nchem.290 Supplementary information 7 Preparation

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

2014 Internal Elections - Rodell Board Elections Addresses

1 November 2007 doi:10.1038/nature06221 LETTERS

Charles Alan Wright - Goodbye to Fred Rodell

The PHILIPPINES - Playing Out Long Conflicts - Paul Rodell

GRACE and Human Impacts on the Water Cycle · Matt Rodell NASA GSFC GRACE and Human Impacts on the Water Cycle Matt Rodell, Ph.D. Chief, Hydrological Sciences Laboratory NASA Goddard

XQ Wang et al. Nature 461 , 947 - 955 (2009) doi:10.1038/nature08 435

FRED RODELL Professor of Law, Yale University I. II. IV. V. · FRED RODELL Professor of Law, Yale University Written in 1939 “Woe unto you, lawyers! For ye have taken away the key

Nature Biotechnology: doi:10.1038/nbt

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

doi:10.1038/nature06481 LETTERS