Download - M Rodell et al. Nature 460 , 999 - 1002 (2009) doi:10.1038/nature08 238

Transcript

Page 1: M Rodell et al. Nature 460 , 999 - 1002 (2009) doi:10.1038/nature08 238

M Rodell et al. Nature 460, 999-1002 (2009) doi:10.1038/nature08238

Monthly time series of water storage anomalies in northwestern India.

Top Related

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

XQ Wang et al. Nature 461 , 947 - 955 (2009) doi:10.1038/nature08 435

XQ Wang et al. Nature 461 , 947 - 955 (2009) doi:10.1038/nature08 435

The PHILIPPINES - Playing Out Long Conflicts - Paul Rodell

The PHILIPPINES - Playing Out Long Conflicts - Paul Rodell

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

GI Motility online (May 2006) | doi:10.1038/gimo6

GI Motility online (May 2006) | doi:10.1038/gimo6

Published in Nature Materials (2016) doi:10.1038/nmat4569

Published in Nature Materials (2016) doi:10.1038/nmat4569

Vol 451 doi:10.1038/nature06451 LETTERS - The Pierce Labpiercelab.caltech.edu/assets/papers/nature08.pdf · disassembly reaction (3) ... 1Department of Bioengineering, 2Department

Vol 451 doi:10.1038/nature06451 LETTERS - The Pierce Labpiercelab.caltech.edu/assets/papers/nature08.pdf · disassembly reaction (3) ... 1Department of Bioengineering, 2Department