jia yi_heng plan 2016

Plan of work

Title :Transcriptional expression of BK𝛾 regulatory subunits in smooth muscles

Name :Jia Yi Heng

Student ID :D00160240

Subject :Biopharmaceutical Research Project

Supervisor :Dr. Mark Hollywood

Date :5th December 2016

Table of Contents:

1. Introduction………………………………………………………………………….…………….1

1.1 BK channel……………………………………………………………………..……………..1

1.2 BKγ subunits…………………………………………………………………………………1

1.3 Structure of BKγ subunits…………………………………………………….………………1

1.4 Expression level of BKγ subunits in different human tissues………………….…………….2

2. Project objectives……………………………………………………………………………….…3

3. Timeline………….………………………………………………………………………….…….3

4. Materials and Methods………………………………………………………………...…….…….5

4.1 Materials………………………………………………………………….…………………...5

4.1.1 Equipment……………………………………………………………………………..5

4.1.2 Reagents ………………………………………………………………………………6

4.2 Methods……………………………………………………………………….………...……7

4.2.1 Tissues collection………………………………………………………...………...…7

4.2.2 RNA extraction and purification………………………………………….…….…….8

4.2.3 cDNA synthesis……………………………………………………………….………9

4.2.4 PCR analysis………………………………………………………………..…………9

4.2.5 Agarose gel electrophoresis…………………………………………………..…..….10

4.2.6 qPCR analysis………………………………………………..…………………..…..10

5. Preliminary work……………………………………………………………………..………….10

5.1 Primers design…………………………………………………………..…….…….……….10

6. Safety considerations/ Risk assessment ………………………………………...…………….…12

7. References………………………………………………………………………………………..13

8. Appendix…………………………………………………………………………………………14

Appendix A- Primer design……………………………………………………………..….……14

Appendix B- RNA extraction and purification…………………………………….…………….22

Appendix C- cDNA synthesis and PCR analysis………………………………………….…….23

Appendix D- Agarose gel electrophoresis protocol……………………………….…..…………27

Appendix E- RT-PCR……………………………………………………………..…….……….29

Appendix F- Material safety data sheet (MSDS)…………………………………..…………….31

Appendix G- Biological and chemical agents risk assessment…………………………………..34

i. SMRC2 Tissue Dissection v.1……………………………………………….…….41

ii. SMRC15 Centrifuges…………………………………………….……….…….….42

iii. SMRC4 Cell Dispersal v.1………………………………………………...……….43

iv. SMRC11 cDNA Preparation……………………………………………….…..….44

v. SMRC13 Flammable liquids/organic solvents…………………………………….45

1. Introduction

1.1 BK channel

BK channels are large conductance, voltage and Ca2+ activated K+ channels that can be

activated by voltage and the presence of calcium. BK channels are abundantly expressed

throughout the body and play a key role in regulating smooth muscle tone and neuronal

excitability. The dysfunction of BK channel can cause diseases such as overactive bladder,

erectile dysfunction and etc. (Kshatri et al. 2016).

1.2 BKγ subunits

Recently, a group of leucine-rich repeat containing membrane proteins (LRRC) were

identified as a family of BK channel auxiliary γ subunits. This γ family consists of γ1

(LRRC26), γ2 (LRRC52), γ3 (LRRC55), and γ4 (LRRC38). They all have different tissue

specific expression patterns like β subunits, however their mode of action and structure are

very different from β subunits. The γ subunits consist of a classic consensus sequence:

LxxLxLxxN (where x can be any amino acid residue and L can be leucine, phenylalanine,

isoleucine or valine). The four γ subunits are quite small proteins and they share similar

molecular weights which are about 35kDa. The sequence similarities between 𝛾1 and its

paralogs are 38.2% (𝛾2), 33.4% (𝛾3), and 37.4% (𝛾4) (Yan and Aldrich 2012).

1.3 Structure of BKγ subunits

The structure of BKγ subunits shown in figure 1 is a banana shaped structure which formed

by six leucine rich repeat containing peptides stacked together in the middle, two cysteine

rich regions on the N-terminal side and C-terminal side: LRRNT and LRRCT, a classical

amino-terminal cleavable signal peptide, a single transmembrane (TM) segment and a

cytoplasmic C-terminal tail (C-tail). Studies found that the modulatory functions of the BKγ

subunits are determined by TM segment and C-tail (Yan and Aldrich 2012).

Biopharmaceutical Research Project, Plan of Work Page 1

Figure 1: 𝛾 subunits predicted membrane topology (Yan and Aldrich 2012).

1.4 Expression level of BKγ subunits in different human tissues

There is a huge variation in transcriptional expression from tissues to tissues. According to

figure 2, γ 1 expressed very highly in prostate, salivary gland, colon, trachea and a moderate

level of expression was found in thymus, aorta and thyroid gland but hardly at all in brain

except the fetal brain. In contrast, γ2 is expressed predominantly in the testis and skeletal

muscle, a much lower level also detected in kidney, lung and some other glands. γ3 appears

to be expressed mostly in the nervous system, which is most abundant in fetal brain and

secondly in adult brain, but also present in the spleen and thymus. γ4 expressed massively in

skeletal muscle, thymus and adrenal gland, and a moderate level expression was also

detected in cerebellum and brain (Yan and Aldrich 2012). These results suggest that the

differential transcription expression of BKγ subunits not just between different organs but

also between different smooth muscles. However, very little is known about the expression

level of BKγ subunits in corpus cavernosum, bronchi and urogenital tract smooth muscle,

and this will be determined and elaborated in this project.


Figure 2: Expression level of BKγ subunits in different human tissues (Yan and Aldrich

2012).

2. Project objectives𝛾 family appears to have distinct tissue-specific expression patterns, but very little is known

about their expression in smooth muscle from the urogenital tract and airways. The aim of this

project is to determine the transcriptional expression of BK𝛾 subunits in corpus cavernosum,

bronchi and urogenital tract smooth muscle using a combination of PCR and qPCR.

3. Timeline

The experimental protocols will be carried out over a period of 10 weeks. The timeline of

experimental protocols is shown in table 1.


Table 1: The timeline of experimental protocols

TasksWeek

1

Week

2

Week

3

Week

4

Week

5

Week

6

Week

7

Week

8

Week

9

Week

10

Literature

review

Review of

methods

Protocol 1

Protocol 2

Protocol 3

Protocol 4

Protocol 5

Protocol 6

Protocol 7

Report

preparation

Protocol 1: Dissection of mouse brain from mouse A (3 mice will be dissected in total and

named as mouse A, B and C). The brain tissues will be served as one of the positive control of

this project. The RNA of the brain will be extracted and purified. The purity of the RNA will be

checked using spectrophotometer. Also, cDNA will be synthesised.

Protocol 2: Dissection of mouse brain, testis and colon from mouse A (positive controls). mRNA

of these three tissues will be isolated and cDNA will be generated.

Protocol 3: PCR will be used to check if the primer works (using positive control and negative

control as sample). According to Yan and Aldrich 2012, the following tissues are abundantly

expressed in particular BKα subunit, therefore these tissues can be used as positive controls. The


positive controls in this project will be colon (γ 1¿, testis (γ 2¿ ,brain (γ3 and γ4), and non cDNA

will be used as negative control. Agarose gel electrophoresis will be performed to check the

product length. The corpus cavernosum, bronchi and urogenital tract smooth muscles will be

collected from mouse A, and the cDNA of these three tissues will be generated.

Protocol 4: PCR will be used to amplify the cDNA of corpus cavernosum, bronchi and urogenital

tract smooth muscles. PCR results will be analysed.

Protocol 5: qPCR will be used to quantify the level of expression of BKγ subunits in different

mouse tissues: corpus cavernosum, bronchi and urogenital tract smooth muscles.

Protocol 6: Protocol 4 and 5 will be replicated with another animal (mouse B and C) in order to

access reproducibility.

Protocol 7: troubleshooting will be solved and experiment will be replicated if needed.

4. Materials and Methods

4.1 Materials

4.1.1 Equipment

Mouse dissection/tissues collection

Scissors

Forceps

blades

dissection pins

tray

RNA isolation

Thermo Scientific™ NanoDrop 2000 Spectrophotometer

PCR analysis

Bio-Rad T100™ Thermal Cycler (PCR)


Gel electrophoresis

Bio-Rad gel electrophoresis apparatus

qPCR analysis

Techne® prime RT-PCR thermal cycler

4.1.2 Reagents

Mouse dissection/tissues collection

RNAlater® solution

RNA isolation

TRIzol® reagent

Chloroform

Isopropanol

75% Ethanol

RNase-free water

cDNA synthesis

dNTP mix

random primers/ Oligo (dT)/ gene-specific primer (GSP)

5X First-strand buffer (250 mM Tris- HCl, pH 8.3 at room temperature; 375mM

KCl; 15mM MgCl2)

0.1M DTT

RNase

SuperScriptTM II Reverse Transcriptase

RNA

PCR analysis

10X PCR buffer [200mM Tris-HCl (pH8.4), 500mM KCl]

50mM MgCl2


10mM dNTP Mix

10μM Forward primer

10μM Reverse primer

5U/μL Taq DNA polymerase

Distilled water

cDNA

Gel electrophoresis

1X TAE buffer ( 40mM Tris/HCl, 20mM Acetic Acid, 1mM EDTA)

Agarose powder

SYBR Safe® DNA gel stain

qPCR analysis

5μM Forward primer

5μM Reverse primer

SYBR® Green Master Mix

Distilled water

4.2 Methods

4.2.1 Tissues collection

Three adult mice (C57BL/6, 6-10 weeks old) were bred in house in Smooth Muscle

Research Centre and will be humanely killed by inhalation of CO2 and then

decapitated and used in this study. All experimental procedures were conducted in

accordance with institutional guidelines and were approved by Research Ethics

Committee and Animal Use Care Committee of Dundalk Institute of Technology.

This work has already approved under the project ‘Investigation of bladder

contractions in TRPC4 null mice’ (19th October 2015). The collected tissues will be

stored in RNAlater® solution at 4°C until use in order to postpone RNA isolation for

a week without sacrificing the integrity of the RNA.


Brain tissues, colon, testis (positive control)

The skull of the mouse will be removed and the brain tissues will be collected. The

colon and testis of the mouse will be collected and added into a microcentrifuge tube

filled with RNAlater® solution.

Corpus Cavernosum

The penises of the male mice will be removed and the corpus cavernosum smooth

muscle strips will be obtained by dissection of the tunica albuginea and surrounding

connective tissues. Each penis will result in two strips, one for each corpus

cavernosum (Jucá et al. 2016). The collected tissues will be added to a microcentrifuge

tube filled with RNAlater® solution.

Bronchi

The lungs of the mice will be removed and bronchus from each lung will be collected

and added in a microcentrifuge tube filled with RNAlater® solution.

Urogenital tract smooth muscle

The bladder smooth muscle of the mice will be collected and added into a

microcentrifuge tube filled with RNAlater® solution.

4.2.2 RNA extraction and purification

The tissues that are stored in RNAlater® solution can be removed by homogenization

and the tissues will be lysed in TRIzol® reagent. The fatty tissues will be removed by

adding chloroform and followed by centrifugation (phenol extraction). During

centrifugation, the sample will be separated into three phases, the upper aqueous

phase that containing RNA will be collected using 75% ethanol (alcohol

precipitation). RNA concentration and purity will be examined by using Thermo

Scientific™ NanoDrop 2000 Spectrophotometer at 260nm and 280nm (refer to

Appendix B). The A260/A280 ratio will be used to determine the purity of the RNA


sample, if the ratio is between 1.8 to 2.1, this indicates that the sample is high

purified.

(Thermo Fisher Scientific 2015).

4.2.3 cDNA synthesis

Complementary DNA (cDNA) is produced by reverse transcription, which is the

synthesis of DNA from an RNA template. Approximately 1ng-5μg of RNA will be

used as template and a random primer/ oligo dT will be added and will anneal to the

3’ end of the RNA to direct synthesis the first strand of cDNA, which can be used as

a template for PCR. The combination of reverse transcription and PCR will allows the

detection of low abundance RNAs in the sample and production of cDNA. The

thermostable SuperScript® II Reverse Transcriptase (RT) will be used to reduce

RNAse H activity and therefore increase the production of first-strand cDNA (New

England Biolabs 2007). The full procedure of cDNA synthesis has been attached in

Appendix C.

4.2.4 PCR analysis

The cDNA of different mouse tissues will be amplified using PCR (refer to Appendix

C). Table 2 shows the steps involved in PCR and the duration of each stage. The

three main steps of PCR cycle: denaturation, annealing and extension will be repeated

for 30 cycles. The PCR product will be kept at 4℃ until use (Thermo Fisher

Scientific 2015).

Table 2: The working temperature and duration of each PCR cycle (Thermo Fisher

Scientific 2015).

Stages Temperature and duration

Predenaturation 94°C for 1-2 minutes

Denaturation 94°C for 30 seconds

Annealing 50°C for 30 seconds

Extension 72°C for 1 minute

Final extension 72°C for 10 minutes


4.2.5 Agarose gel electrophoresis

The PCR products and the controls will be run on a 2% agarose gel and the

expression of different mouse tissues will be examined. In order to visualise the

cDNA PCR products on the gel, SYBR Safe® DNA gel stain will be added into the

gel. After the gel has been solidified, the samples and loading dyes will be loaded into

the wells and the running buffer (1× Tris-Acetate-EDTA buffer) will be added to the

tray until the gel is covered. The gel will be run at 90V for 30-40minutes (refer to

Appendix D). The bands will be visualised and examined using the UV

transilluminators.

4.2.6 qPCR analysis

Real-time PCR (qPCR) will be used to quantify the expression level of each LRR

protein in different tissues (refer to Appendix E).

5. Preliminary work

5.1 Primers design

Primers against mouse γ1, γ 2, γ3 and γ4 have been designed (refer to Appendix A) and will be

used for PCR and qPCR analysis. According to table 3, the length of the designated forward and

reverse primers are about 19-20 base pairs, the melting temperatures (Tm) of mouse BKγ

subunits are about 57-60℃ and the GC content of all the designated BKγ primers are about 45-

58%. All of these meet the requirements of good primer design described below:

Primer length 20-30 base pairs

Melting temperature (Tm) between 52 and 58°C

GC content 40-60%


Table 3: Primer design of mouse BKγ subunits

Mouse γ1 primer 150bp (NM_146117.2)

Sequences Tm (℃)

GC content (%)

Forward TTCACTATCGGCAATCGAGG

(20bp)

57.49 50.00

Reverse TCAGTTTCTGAGGCTGGACG

(20bp)

59.68 55.00


Forward CATATGGACCACCCAGATGC

(20bp)

58.10 55.00

Reverse AAGATGCAGAAGCCGATGAG

(20bp)

58.05 50.00


Forward TGGCTTTTCTGAGCCTTGAA

(20bp)

57.64 45.00

Reverse CAGCAAGCTGAGAATCCGC

(19bp)

59.28 57.89


Forward TGCTGGAACTCAACGACAAC

(20bp)

58.70 50.00

Reverse ATCGAGGCCTTTGGGCAAT

(19bp)

59.69 52.63

The databases that were used in designing primers are:

NCBI: Finding Mus musculus LRRC26, LRRC52, LRRC55 and LRRC38, mRNA

https://www.ncbi.nlm.nih.gov/



NCBI/ Primer-BLAST: Finding primers specific to PCR template

https://www.ncbi.nlm.nih.gov/tools/primer-blast/

6. Safety considerations/ Risk assessment

All experimental procedures will be conducted in accordance with the laboratory safety

guidelines provided by department of Applied Sciences of DKIT. The material safety data sheets

(MSDS) that contain the potential risks associated with the use of chemicals in this project are

attached in Appendix F. The MSDS sheets will be reviewed every time before handling and

using any chemicals. The risk assessment sheets of chemical and instruments that will be used

are attached in Appendix G. Personal protective equipment (PPE) must be worn any time in the

lab. Safety towards others and environment will also be considered.

DKIT Health and Safety Policy, available from:

https://www.dkit.ie/system/files/General%20Statement%20of%20Policy_2016.pdf

Ancillary Safety Statement- School of Health and Science DKIT, available from:

https://www.dkit.ie/system/files/Updated%20Anc%20safety%20statement

%20Jan2014.fin.eh_.pdf

(Word count: 2156 words)


https://www.dkit.ie/system/files/Updated%20Anc%20safety%20statement%20Jan2014.fin.eh_.pdf

https://www.dkit.ie/system/files/Updated%20Anc%20safety%20statement%20Jan2014.fin.eh_.pdf

https://www.dkit.ie/system/files/General%20Statement%20of%20Policy_2016.pdf


7. References

Caister Academic Press. (2013). Real-Time PCR Quantification Analysis [online]. Available

from: http://www.highveld.com/pcr/real-time-pcr-quantification-analysis.html [accessed 2

December 2016].

Jucá, T., Napolitano, M., Carvalho, F., Campos, R., Mónica, F., Claudino, M., Antunes, E.,

Lopes, A. and Nucci, G. (2016). Hydrochlorothiazide Potentiates Contractile Activity of Mouse

Cavernosal Smooth Muscle. Sexual Medicine [online], 4(2). Available from:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5005312/ [accessed 2 December 2016].

Kshatri, A., Li, Q., Yan, J., Large, R., Sergeant, G., McHale, N., Thornbury, K. and Hollywood,

M. (2016). Differential efficacy of GoSlo-SR compounds on BKα and BKαγ1-4 channels.

Channels [online], 1(13). Available from:

http://www.tandfonline.com/doi/abs/10.1080/19336950.2016.1213930?journalCode=kchl20

[accessed 2 December 2016].

New England Biolabs. (2007). cDNA Synthesis & RT-PCR [online]. Available from:

https://www.neb.com/applications/rna-analysis/cdna-synthesis-and-rt-pcr[accessed 2 December

2016].

Thermo Fisher Scientific. (2015). PCR Amplification for Genotyping [online]. Available from:

https://www.thermofisher.com/ie/en/home/references/protocols/nucleic-acid-amplification-and-

expression-profiling/pcr-protocol/pcr-amplification-for-genotyping.html [accessed 2 December

2016].

Thermo Fisher Scientific. (2015). The Basics: RNA Isolation [online]. Available from:

https://www.thermofisher.com/ie/en/home/references/ambion-tech-support/rna-isolation/general-

articles/the-basics-rna-isolation.html [accessed 2 December 2016].


Yan, J. and Aldrich, R. (2012). BK potassium channel modulation by leucine-rich repeat-

containing proteins. Section of Neurobiology [online], 27/1. Available from:

http://www.pnas.org/content/109/20/7917.full.pdf [accessed 2 December 2016].

8. Appendix

Appendix A: Primer design

Step 1: Search Mus Musculus leucine rich repeat containing 26(γ 1¿, 52(γ 2¿, 55(γ 3¿ and 38(

γ 4¿ sequence from NCBI database (available from: https://www.ncbi.nlm.nih.gov/)

Mus musculus leucine rich repeat containing 26 (Lrrc26), mRNA

>NM_146117.2 Mus musculus leucine rich repeat containing 26

(Lrrc26), mRNA

GGGCAGGAGAGTTAATACTTGTGCAGGTGAGGCTGAGACGGCTTTGGGGCACCTTGACTCCAAAG

CCCGAAGCCGCACATGCGGGGTTCTTTTTTCTCGCGGCTTCCGCCGCAACTCTCTCTGCTGCTGC

TGCTGTCGTTGAGGCGAGTCTGGACCCAGGAGGATATTGGAACTGCCCCTTCTAAATCCCCGGTG

GCCCCCGAATGCCCCGAGGCATGTTCATGTTCACTAGGCGGCAAGGCCAATTGCTCCGCACTCGC

GCTGCCTGCGGTACCAGCGGACCTGAGCTGGCAAGTACGCTCACTGCTGCTGGATCACAATCGCG

TGAGCGCGCTGCCTCCGGGTGCCTTCGCCAATGCAGGCGCGCTGCTATACCTAGATCTGAGGGAG

AACCGGCTTCGGTCGGTGCACGCACGAGCTTTCTGGGGTCTGGGAGTGTTGCAATGGCTGGACCT

GAGCTCCAACCAGCTGGAAACTCTGCCTCCTGGCACCTTCGCGCCGCTGCGCGCGCTTAGTTTCC

TCTCCCTAGCGGGTAACCGGCTGGCACTCCTGGAGCCTTCGATCCTGGGCCCGCTTCCATTACTG

CGAGTGCTCAGCCTGCAGGACAATTCACTATCGGCAATCGAGGCGGGTTTGCTGAATAACTTGCC

TGCCCTCGATGTGTTGCGCTTGCATGGCAACCCCTGGACGTGCAACTGTGCGCTGCGTCCCCTTT

GCACTTGGCTGCGTAAGCACCCGCGTCCAGCCTCAGAAACTGAGACCCTGCTCTGCGTGTCTCCA

AGACTCCAGACGCTCAGCCTACTGACAGCTTTTCCGGATGCCGCCTTCAAACAGTGCACTCAGTC

ACTAGCAGCGCGAGACCTGGCGGTGGTCTACGCTCTCGGGCCGGTCTCTTTCCTTGCTAGTTTGG

CCATCTGCCTGGCATTGGGCTCCGTGCTCACTGCTTGTGGTGCACGGCGCCGCCGCCGCCGCCGC

ACCACGGTGCGCCACTTACTAAGGAGACAGCTAGACCCCGAGGGCCCACCCTCCCTGGAGGATGC


Forward primer Reverse primer Target gene


TGGGAGCCCTGTAACAGCAGCTATCCAAGCCTAAGGGGACTGCAGGTTGTTTCTAGTGCTCCTGA

AGTGCCTCCGTACTTTGAGAACTCTCCCCAAATCCCTGATCCTCCCTTCACATTCCCTGTAGGCG

TCAACAATAGACAAAACCCGGAAATTTTCTGACATTC

(Product length: 150bp)



(Lrrc52), mRNA

AGATCAGAAGGACAGCTTGTACCCGCCCTCAGGAAGGTAGAAGGAGGGGAACCTTGGCTTCTTAC

TATGTCCCTTGCTTCAGGCCCTAGCTCCAAGTTGTTACTCTTTTCTCTTGGAATGGGGTTGGTAT

CAGGGTCCAAGTGTCCAAACAAGTGTGTGTGTCAAGACCAAGAAGTAGCCTGCATAGATTTGCAC

CTAACGGAATACCCAGCTGATATTCCTCTGAACACCCGGAGACTATACCTGAACAATAACAAAAT

CACTAGTTTACCAGCTTTGCAGCTGGGATTCCTCAGTGACCTCGTTTACTTGGACTGTCAGAACA

ACCGGATTCGAGAGGTGATGGATTATACCTTCATCGGGATCTTCAGACTCATCTACCTTGACCTC

AGCTCCAACAACCTAACTTCCATCTCCCCTTTCAGCTTCTCAGTGCTCACCAACCTGGTGCGGCT

GAACATTTCACACAACCCTCACCTGTTGTATCTTGACAAATACGTCTTTGCCAACACCACGTCTT

TGAGGTACCTGGACCTCAGAAACACCGGATTGCACATCATCGACCATAATGGCTTCCACCACCTG

GTGGTGCTCCAGACTCTGTACCTAAGTGGGAACCCCTGGATATGCAACTGCTCCTTCCTGGACTT

CACCATCCACTTATTAGTGTCCCATATGGACCACCCAGATGCCCAGAACGCCACGTGTACGGAGC

CTGCTGAGCTGAAAGGGTGGCCCATCACGAAGGTGGGGAATCCACTCCAGTACATGTGCATCACA

CACCTGGACCAGCAGGACTACATCTTCTTACTGCTCATCGGCTTCTGCATCTTCGCTGCCGGCAC

GGTGGCTGCCTGGCTCACGGGTGTATGTGCTGTGCTGTACCAGAATGCCCTCCGAACGTCGAGCG

GGGATGATACCGAAGATGAAACTGGGAGTAGATTCGCCAACCAGATTTTTCGAAGCAACACACAC

TTGGGCCCCATTCGTCGGTTCCCTGAACTGATCTAGCTGTCAGGGAGCACCACCGACTGTGCCTT

CCCTGGTCTGGCTCCCTGATTTCTCTCTTGCCCTCCCATTTTACCATCACTGTCTTGGAGACTGA

AGCCCTCTAGTAAAATAAAATATTTGGTGGTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

(Product Length: 161bp)




(Lrrc55), mRNA

GGACCTAGGGACACCGCTCTCATGGGCTCCCTACAGCACTGCTGCTGCCAGCTGCCAAAGATGGG

TGACACCTGGGCCCAACTTCCCTGGCCTGGGCCTCCCCACTCAGCCTTGTTGCTGGTCTTCTTCC

TCTTGGCAGCTGGGGTGATGCACTCTGATGCGGGTACCAGTTGCCCAGTCCTTTGTACATGTCGT

AACCAAGTAGTGGACTGCAGCAACCAGCGGCTGTTCTCTGTACCCCCGGACCTGCCAATGGACAC

CCGCAACCTCAGCCTAGCCCACAATCGCATTGCAGCTGTACCGCCAGGCTATCTCACATGCTACA

TGGAACTCCGCGTGCTGGATTTGCGAAACAACTCCTTGATGGAGCTGCCCCCTGGCCTCTTTCTC

CACGCCAAGCGCTTAGCACACCTGGATCTAAGCTACAACAACCTCAGTCATGTGCCAGCTGACAT

GTTCCGGGAAGCTCATGGACTGGTACATATCGACCTGAGCCACAACCCCTGGCTGCGGAGGGTGC

ACCCCCAGGCCTTCCAGGGCCTTGTGCATCTCAGAGACCTGGACCTCAGCTATGGCGGCCTGGCT

TTTCTGAGCCTTGAAGCCCTTGAGGGCCTCCCAGGGCTGGTGACCCTACAGATCGGGGGTAACCC

ATGGGTATGTGGCTGCACCATGGAGCCCTTGCTGAAGTGGCTGCGGAATCGGATACAGCGCTGTA

CAGCGGATTCTCAGCTTGCTGAGTGTCGGGGACCCCCTGAAGTTGAGGGTGCCCCCCTCTTTTCA

CTCACTGAAGAGAGCTTCAAGGCCTGCCACCTGACTCTGACCCTGGATGATTACCTCTTCATCGC

ATTTGTGGGCTTTGTGGTCTCCATCGCTTCTGTAGCCACCAACTTCCTCCTGGGCATCACGGCCA

ACTGTTGTCACCGTTGGAGCAAGGCTAATGAAGAAGAAGAGATTTGACACAGATCTTTGGAAAAC

AGGAGATGTACCTCTACTGTGTTGTGTTGCAAGAGAAACTGAAGGATCTGAGAAAATGATAGGTG

AGAACCCCTGAACAGGAGATGGGGAGATCCATCTGGGTAGTCCCAGTCCTGTTAGCAAGGCTGGC

TTGGTAAGAAAATGAAACAAGAGCTTTCTATCTTGGCTCCAACCCTGGCAAGCATCCATCATACA

CCCTGCCACCCAGCTGACTTACAATGCATGGAGAAGGGGAACGTGTCGTAATCCAACTCATCTGC

ATTGATCTAATCAGCCAAAACAGACCCTGGAAGCTTTCCCCCCCACCCCCACTCTTGCTTTCAAT

GCCTAGGCCACAGCTCTGCTCCTATAAAATATGACATAGAACTATGCCCTGCTCTCCCTGACCAC

TCAACTGTGGCCAACAATGGTAGACTCTAGCTAGTCTCCATAAGCTAAGCTTCTTGCCTAAAGTG

TTTTTGGAAAGGAACTTTTAGAAATAGTATTCCTGATTTTAAAAAAAAAATCATTTAACTTTCCT

TAGAAGAACATCATGCTCACTGATAGTAATCTCCTGGACACCACTGTTTACTGAATTATAGTTAC


CATATTTTAAGATCTACTACTCTGTTTTACATAGAATTAGAACAAGACAAGACACCAAATGCCTC

TTGAGATCAAGTGTTCTTTTGAGTGGCACAATTTGATCTCCATTAATGGCGAAGACTTCTAAGCA

AGCTATATCAAGACAATGTTTCTCCAGCGTCTAAAAGGTCCCCAGTTAACTAAGGCACAAGAAGA

GGAACATTCAGCCTCCACACGAACATGGAATTCTAATGCCACCATCACCAGTTCAGGCTTTCAGA

ATTAAGTGTCTCGAAATAGTCTAATAATCCTTGCGACAAATGTTTACATGTCCTGGTGAGGACAA

GCCCATTATGATGTTTCCATGAAGTTTTGTTCAGTTTTTTTCCACACTGGCTAATGTGGGATCAT

TTGTTTGTCTATATGTGTATCTATGGTTCATTTATGTTGGTTGTATACTGACTTGGAGAATATTC

CTTTAGAACTTGGGTTCAAACCTCTAACACAGTCCACTCAGTTATCAAGTTGATAAACAAATAAG

CACCCTGCCCATTTGTCTAGCTGCTCAGGAAATATGAAAAGAGCCAATGCTATAGTGGAAACAAT

CTAATGAGACCTGGCTCCTCCCTACTTTCCTCTGTCCTCCTCTATCCTCTAGAGACTTGTACCTA

TCACAGAAGTTTTCTTTATACTGTGTCTGAAGATATCAGGTCATACATAACTAACCAACAAGCTT

ATGCTGGTCAAGGGCTAGCCAATAAAATTCTTTTCAGAAAAGATCCCACATATGCACCACACCAT

TCTGGACCATGCCCCTATGGTTGTCCTCTAGATACCACCTTCTTTTCCATTTTCACCAGGATTCC

CATGGAAACTTGAAGAAATACATTGCCCAGAGATGCTATAGAGTTTCATGGTCTCAGTTAGGGGC

TTGATGTAATGTATTTGAAGAGATCAGGACTTGAATTTCATTCCAACCTTTGAAAAAGGTCAAGA

GCTCCATTTTCTCCATGCACATACTTGCCACCATTCTTTCCAGCTGTAGAAGAGCACAAAAAGAT

ACCTTTGTTCATTCCTCCAAGCTAGGGAACCTTGTCTTGTTTTGTATACTCCGAAAGGAGGCAAA

AGGAAGTAAAGGAGGCAAGACCCAAGGACCTTTTGTAAATCATGGCACTGGTTGGGAGTTGGGTC

CATAGACCTCTCAGTGTTCCTAAGCCCTGATGTCTGGTGGTGGGAGGGTTAGGGGAGGAATTGGG

AAGATGCCAACCTTTGTATGGAAATTATTTTATAACCATGCACTTTTGTAACTGTGAAGAATTTT

TCATAAACGCACATTAATAATAAAAAAGTGTATAGTTTAA





(Lrrc38), mRNA

TGAGGGTGGCGCTCTGGGCGCATGCCCCAGACACGCCCCATGGAAATCGCTCCAGGGATCCGTCA

CTGAACTTAGTCTTGAGCACCGCTGGCCAGGTCTGTGCGACAGGTCCCACTTCCCCGCCCGAGTG

GGGTCGCTCTGGGCTCCCTCCACGATCTCCACCTGTGCTTTTGAATGTTCCAGAGGGTCAGTTTC

CTGTGCGGGTAAATTCTGCGCCCAGCACCTCTCATCTTCCTCCTCCCTCCCCGCCTCCCGGACAC

CCCGGGTCGCTCTGTCCCCGCCGCACTCTCATCGCCCCCGCGCGCCCCGGCGCAGCCTCCCCGCC

CTGCGCCGCTGCCCTGGGGCTCTCGGCGCCCCGGAGCCAGGGCCCCGCTGCGTCCTCCTTGCTGC

GAGCTGAGTCCTCCGGAGTCCCCCGGGCCATGAGTCTCTGCGTTGCCCCCCGCCACCCCACGGGC

GCTGCTGCGGCGCTGGGGCTCGGTAGCCTCTTGGTGCTGCTCGGGCCGGGACGCGCGTGCCCCGC

GGGCTGTGCTTGCACCGACCCCCATACCGTGGACTGTCGCGATCGCGGGCTGCCCAGCGTGCCCG

ATCCCTTCCCCCTGGACGTGCGCAAGCTGCTAGTGGCCGGCAACCGCATCCAGCAGATCCCCGAG

GACTTCTTCATCTTCCATGGAGATCTGGTGTATCTGGATTTCAGGAACAACTCGCTGCGCTCGCT

GGAGGAGGGCACGTTCAGCGGCTCGGGCAAGCTGGCCTTTCTGGACCTGAGCTACAACAACCTCA

CCCAGCTGGGGGCCGGCGCCTTCCGCTCGGCGGGGAGGCTGGTCAAGCTGAGCCTGGCCAACAAC

CATCTGGCCGGTGTACATGAGGCTGCCTTCGAGAGCCTGGAGTCCTTGCAGGTGCTGGAACTCAA

CGACAACAACCTGCGCAGCCTCAACGTGGCGGCTTTGGATGCGCTGCCGGCACTGCGCACTGTGC

GCCTGGACGGGAACCCCTGGCTGTGTGACTGTGACTTCGCTCACCTCTTCTCCTGGATTCAGGAG

AACACATCCAAATTGCCCAAAGGCCTCGATGCCATCCAGTGTTCACTGCCCATGGAGGACCGGAG

GGTGGCCCTGAGGGAGCTATCCGAAGCTAGTTTCAGCGAGTGTAAGTTCAGCCTGTCTCTCACAG

ACCTATTCATCATCATCTTCTCTGGGGTGGCTGTGTCCATTGCTGCCATCATCTCCAGCTTCTTC

CTGGCCACTGTGGTGCAGTGTTTCCAGAGGTGCGCCCCTAACAAGGACACGGAAGATGAGGATGA

TGATGAAGATGACTGAGCCACCTCCTCCCGCTCTTTGCTTTCCCACACTCAGCCAGTGGCACCTC

TCCAAGGGAGACTGATGCTGAAGACAGGAGCATCACATCACTCCAGGCAGTAAACGGGATGGAGC

TTGCCTAGATGCACCCGCTGGGGACAGCCGATCCCAGCGTATAGAATCAGCAGAGTAGAGACGCA

GGAAGGATGGAGAGATTCACTCTTAAGCAGAGCCAGCCTCCCAGGCTGGGGGACTCGTGTGTGAA

GATAATCAATTCAGGCTTCATGGCTTACAGCTTTACAACCCTCCCAAGCTGAAGTGAGAGCTCAC


AGCTTCTGACCTCAGAGTTGTTTGGGCCGTTCTTATTACAAGTTGCACAATGGACCATGAGCCCT

CTTCCCCATGAAAGACAGTAGTGTTCTCAGTGTAGATTCGTGTCGAGCTCCTTCTTCACAGGAGC

AGGAATCGTTTTCTTCTATAGAAGATCCCAGGAGCCTTGAGATGTTAGACCAAGAACAAACACAT

CTATTTGCCATAGACAATGTCTGTCTCCCCTGTGTTGCTGCAATGATATCTCACACCCAACGTGA

TGAACGTGGGTTGATGCGCGATGACCTGAGCCCGCAGTCCCGAGCTGGTGGGCTGGGGACCTAGA

CCTGAGGCGGAGGCTCACAAGGGGACCCAGTCCTTCAGGGTGTTTTGAAGAGGGCCCTTTGGATA

TGATTCCGTCTTGAGACCGAGTGCATTTACTGCCCTTATAAATCAGACTTTGGGGGCCTCCCTGT

CCCTTCTATCCAGTGAGGACCCAGTGAGAGGGTCTATGAACCAGGAAGGGGTCTCTCACAGGAAC

TCAACCATACTGGTGCCCTAGCCTCTACCTTCTAGCCTCCCAAACCGAGAGGAATAAATGTTTGT

TATTTATAAACCCTCATGTCTGTGACTGGGGGGGCTGAGGGGGAATAGAAGCTCAAGGATGCTAG

GACACCATCTTTAGCTGAAATGTTACCAAAAAATAAAAGCTTAGGTTTTGTC



Step 2: Copy the sequences or template numbers of each LRRC protein to NCBI/Primer-Blast

(available from: https://www.ncbi.nlm.nih.gov/tools/primer-blast/)

Figure 3: Mouse γ1 primer

Figure 4: Mouse γ 2 primer



Figure 5: Mouse γ 3 primer

Figure 6: Mouse γ4 primer


Appendix B: RNA extraction and purification

Use 50/100mg of tissue and homogenise in 1ml of TRIzol® reagent. Tissue can either be cut into

small pieces with sterile scissors or flash frozen in liquid nitrogen and ground into a powder.

After this, pass the sample through an 18 and then a 21 gauge syringe.

1. Incubate the sample for 5 minutes at room temperature.

2. Add 200ul of Chloroform per 1ml of TRIzol® reagent.

3. Cap and shake the tube for 15 seconds.

4. Incubate at room temp for 3 minutes.

5. Centrifuge at max speed in cold room for 15 minutes.

6. Transfer the upper aqueous layer into a sterile Eppendorf tube. (Be careful to avoid touching

the middle layer)

7. Precipitate the RNA by adding 500 ul of Isopropanol per 1ml of TRIzol® reagent.

8. Vortex briefly and incubate at room temperature for 10min.

9. Centrifuge for 10 min in a cold room.

10. The pellet should be seen. Remove the supernatant and add 1ml of 75% Ethanol

11. Vortex and centrifuge for 5 mins in a cold room.

12. Remove supernatant and air dry the pellet for 5 min or less.

13. Resuspend the pellet, in 50/100 ul of RNase-free water, by passing it through the pipette tip

several times.

Sample can now be stored in -80 freezer.

Note: Prior to using RNA in a reverse transciptase reaction, it should be DNase treated.

(Adapted from Dr. Mark

Hollywood).


Appendix C: cDNA synthesis and PCR

SuperScript™ II Reverse Transcriptase

Cat. No. 18064-022 Size: 2,000 units

Cat. No. 18064-014 Size: 10,000 units

Cat. No. 18064-071 Size: 4 × 10,000 units

Conc. 200 U/μL Store at –20°C (non-frost-free)

Description

SuperScript™ II Reverse Transcriptase (RT) is an engineered version of MMLV RT with

reduced RNase H activity and increased thermal stability. The enzyme is purified to near

homogeneity from E. coli containing the modified pol gene of Moloney Murine Leukemia Virus

(1,2). The enzyme can be used to synthesize first-strand cDNA at higher temperatures than

conventional MMLV RT, providing increased specificity, higher yields of cDNA, and more full-

length product. It can generate cDNA up to 12.3 kb.

Components

SuperScript™ II RT, 5X First-Strand Buffer (250 mM Tris-HCl, pH 8.3 at room temperature;

375 mM KCl; 15 mM MgCl2), 0.1 M DTT

Storage Buffer

20 mM Tris-HCl (pH 7.5), 100 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 0.01% (v/v) NP-40, 50%

(v/v) glycerol

Storage Conditions

Store all components at –20°C in a non-frost-free freezer. Thaw 5X First-Strand Buffer and 0.1

M DTT at room temperature just prior to use and refreeze immediately.

Unit Definition

One unit incorporates 1 nmole of dTTP into acid-precipitable material in 10 min. at 37°C using

poly(A)•oligo(dT)25 as template-primer (3).

Intended Use


For research use only. Not intended for any animal or human therapeutic or diagnostic use.

Part no. 18064.pps MAN0001342 Rev. Date: 20 May 2010

For technical support, email [email protected].

For country-specific contact information, visit www.invitrogen.com.

First-Strand cDNA Synthesis Using SuperScript™ II RT

A 20-μL reaction volume can be used for 1 ng–5 μg of total RNA or 1–500 ng of mRNA.

1. Add the following components to a nuclease-free microcentrifuge tube:

Reagent Volume added (μL)

Oligo (dT) 12-18 / 50-250 ng Random

Primer

1

1- 500ng RNA 0.5

1μL dNTP Mix (10mM) 1

Sterile, Distilled water 9.5

2. Heat mixture to 65°C for 5 min and quick chill on ice. Collect the contents of the tube by

brief centrifugation and add:

5X First-strand Buffer 4μL

0.1M DTT 2μL

RNaseOUT™ (40 units/μL) (optional)* 1 μL

*RNaseOUT™ (Cat. No. 10777-019) is required if using <50 ng starting RNA.

3. Mix contents of the tube gently. If you are using oligo (dT) 12-18 or GSP, incubate at 42°C

for 2 min. If you are using random primers, incubate at 25°C for 2 min.

4. Add 1 μL (200 units) of SuperScript™ II RT and mix by pipetting gently up and down.

If you are using less than 1 ng of RNA, reduce the amount of SuperScript™ II RT to 0.25 μL (50

units) and add sterile, distilled water to a 20 μL final volume. If you are using random primers,

incubate tube at 25°C for 10 min.


5. Incubate at 42°C for 50 min.

6. Inactivate the reaction by heating at 70°C for 15 min.

The cDNA can now be used as a template for amplification in PCR. However, amplification of

some PCR targets (>1 kb) may require the removal of RNA complementary to the cDNA. To

remove RNA complementary to the cDNA, add 1 μL (2 units) of E. coli RNase H and incubate

at 37°C for 20 min.

PCR Analysis

The following is intended as a guideline and starting point when using first strand cDNA in PCR

with Taq DNA polymerase. The optimal concentration of Mg++ will vary depending on the

template and primer pair. Use only 10% of the first-strand reaction for PCR. Higher volumes

may not increase amplification and may result in decreased amounts of PCR product.

1. Add the following to a PCR tube:

Reagents Volume (μL)

10X PCR Buffer [200 mM Tris-HCl (pH

8.4), 500 mM KCl]

5

50 mM MgCl2 1.5

10 mM dNTP Mix 1

Forward primer (10 μM) 1

Reverse primer (10 μM) 1

Taq DNA polymerase (5 U/μL) 0.4

cDNA from first-strand reaction 2

autoclaved, distilled water to 50

2. Mix gently and layer with 1–2 drops (~50 μL) of silicone oil. (Note: silicone oil is unnecessary

in thermal cyclers equipped with a heated lid.)

3. Heat reaction to 94°C for 2 min to denature.

4. Perform 15 to 40 cycles of PCR. Use the recommended annealing and extension conditions for

your Taq DNA polymerase.


Product Qualification

The Certificate of Analysis provides detailed quality control information for each product.

Certificates of Analysis are available at www.invitrogen.com/support.

(Adapted from Dr. Mark

Hollywood).


http://www.invitrogen.com/support

Appendix D: Agarose gel electrophoresis protocol

Step 1: Determining best suited % agarose gel that will be used

Agarose gel electrophoresis separates DNA based on size. The smaller the DNA, the farther it

runs to the gel. The greater the concentration of the agarose, the smaller the pores,formed in the

matrix and the more difficult for larger DNA to pass through the matrix. Therefore, prior to

separate DNA using agarose gel electrophoresis, the percentage of agarose has to be considered.

According to appendix A, the size of the PCR products will be 150bp (γ 1¿, 161bp(γ 2¿, 156bp(

γ 3¿ and 173bp(γ 4¿. For optimal result, 2% agarose gel was recommended to be used (refer to

table 4) as it can separate 50-2,000bp of linear DNA, which the PCR products are within the

range.

Table 4: Recommended agarose gel percentages for resolution of linear DNA

Recommended % agarose Optimum resolution for linear DNA

0.5 1,000 – 30,000bp

0.7 800 - 12,000bp

1.0 500 – 10,000bp

1.2 400 – 7,000bp

1.5 200 – 3,000bp

2.0 50 – 2,000bp

(Adapted from: https://worldwide.promega.com/resources/pubhub/enotes/what-percentage-

agarose-is-needed-to-sufficiently-resolve-my-dna-sample/).

Step 2: Making and preparing the gel

1. Measure out 100ml of 1X TAE buffer in the conical flask.

2. Transfer the buffer into a DURAN® bottle.

3. Weigh out 2g of agarose powder and pour it into the conical flask.


https://worldwide.promega.com/resources/pubhub/enotes/what-percentage-

4. Fully dissolve the powder by heating the solution in the microwave at full power (avoid

bubbling by checking and swirling the bottle).

Note: Caution HOT! Be careful stirring, eruptive boiling can occur.

5. Let the solution cool down to 60°c by placing it at a water bath.

6. Add DNA gel stain SYBR Safe into the solution.

7. Pour the solution into the gel casting tray with the well comb in place.

Note: Pour slowly to avoid bubbles which will disrupt the gel. Any bubbles can be pushed away

from the well comb or towards the sides/edges of the gel with a pipette tip.

8. Let the gel sit for 30-45 minutes to allow solidification of gel.

Step 3: Loading samples and running an agarose gel:

1. Pull out the comb in the gel carefully.

2. Add 6μl of 6×loading buffer to each of the DNA samples.

3. Fill gel box with 0.5×TAE buffer until the gel is covered.

4. Carefully load 20μl of the samples into the separate well in the gel.

5. Record the order each sample will be loaded on the gel.

6. Place the lid on the gel box, connecting the electrodes.

7. Run the gel at 80-150V for 30-40 minutes.

Note: Black is negative, red is positive. (The DNA is negatively charged and will run towards the

positive electrode.) Always Run to Red.

it should not exceed 5 volts/cm between electrodes!

8. Check to make sure the current is running through the buffer by looking for bubbles forming

on each electrode.

9. Check to make sure that the current is running in the correct direction by observing the

movement of the blue loading dye – this will take a couple of minutes (it will run in the same

direction as the DNA).

10. Turn OFF power, disconnect the electrodes from the power source, and then carefully

remove the gel from the gel box.

11. Using Ingenius syngene bioimaging (UV box) to visualize the DNA fragments.

(Adapted from: https://www.addgene.org/plasmid-protocols/gel-electrophoresis/).


Appendix E: RT-PCR

The amount of fluorescence emission is proportional to the synthesized DNA, as shown in figure

7. Quantification cycle (Cq) is the the number of cycles needed for the fluorescent signal to pass

through the threshold. For good replicate, the difference of Cq values should not exceed 0.3

cycles. The amount of cDNA in different tissues can be calculated from Cq value. There are

three phases in PCR amplication curve: baseline, exponential and plateau. However, only in

exponential phase, quantification of transcription expression of BKγ subunits in different smooth

muscle is possible (Caister Academic Press 2013).

Figure 7: PCR amplication curve (Caister Academic Press 2013).

1. Normalize the primer concentrations and mix gene-specific forward and reverse primer pair.

Each primer (forward or reverse) concentration in the mixture is 5 pmol/μl.

2. Set up the experiment and the following PCR program on ABI Prism SDS 7000. Do not click

on the dissociation protocol if you want to check the PCR result by agarose gel. Save a copy


of the setup file and delete all PCR cycles (used for later dissociation curve analysis). Please

note the extension steps are slightly different from described in our paper.

1. 50℃ for 2 min, 1 cycle

2. 95℃ for 10 min, 1 cycle

3. 95℃ for 15 s -> 60℃ for 30 s -> 72 ℃ for 30 s, 40 cycles

4. 72℃ 10 min, 1 cycle

3. A real-time PCR reaction mixture can be either 50μl or 25μl. Prepare the following

mixture in each optical tube.

50μl PCR reaction mixture 25μl PCR reaction mixture

SYBR Green Mix (2x) 25μl 12.5μl

cDNA 0.5μl 0.2μl

primer pair mix (5 pmol/μl

each primer)

2μl 1μl

H2O 22.5μl 11.3μl

3. After PCR is finished, remove the tubes from the machine.

4. Put the tubes back in SDS 7000 and perform dissociation curve analysis with the saved copy

of the setup file.

5. Analyze the real-time PCR result with the SDS 7000 software. Check to see if there is any

bimodal dissociation curve or abnormal amplification plot.

(Adapted From: https://www.google.ie/url?

sa=t&rct=j&q=&esrc=s&source=web&cd=3&cad=rja&uact=8&ved=0ahUKEwip6fuclMDJAh

VC7Q4KHZRiCw0QFggrMAI&url=https%3A%2F%2Fwww.rochester.edu%2FCollege

%2FBIO%2Flabs%2FWerrenLab%2FWerrenLab-WolbachiaWorkshops_files

%2FGelElectrophoresis.doc&usg=AFQjCNE7V0ITBdzA09N6evREa_YzT2NaDA&sig2=Ntsn

KvB9-ijT1h9SrT_SiQ).

Troubleshooting guide


https://www.google.ie/url?sa=t&rct=j&q=&esrc=s&source=web&cd=3&cad=rja&uact=8&ved=0ahUKEwip6fuclMDJAhVC7Q4KHZRiCw0QFggrMAI&url=https%3A%2F%2Fwww.rochester.edu%2FCollege%2FBIO%2Flabs%2FWerrenLab%2FWerrenLab-WolbachiaWorkshops_files%2FGelElectrophoresis.doc&usg=AFQjCNE7V0ITBdzA09N6evREa_YzT2NaDA&sig2=NtsnKvB9-ijT1h9SrT_SiQ



Available from: http://www.sigmaaldrich.com/technical-documents/protocols/biology/sybr-

green-qpcr.html

Appendix F: Material safety data sheet (MSDS)

Table 5: Links of the MSDS of chemical reagents that will be used

No

.

Chemicals Links

1 RNAlater®

solution

https://www.thermofisher.com/order/catalog/product/AM7020

2 TRIzol®

reagent

https://tools.lifetechnologies.com/content/sfs/msds/2012/15596026_MTR-

NALT_EN.pdf

3 Chloroform http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?

country=IE&language=en&productNumber=288306&brand=SIAL&Page

ToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog

%2Fproduct%2Fsial%2F288306%3Flang%3Den

4 Isopropanol https://www.google.ie/url?

sa=t&rct=j&q=&esrc=s&source=web&cd=8&cad=rja&uact=8&sqi=2&v

ed=0ahUKEwjzz5WE7s7QAhWrAMAKHU2pDUAQFghHMAc&url=htt

p%3A%2F%2Fairgas.com%2Fmsds

%2F001105.pdf&usg=AFQjCNFx2y9-

USL7Pz2PLqg_coZQRvn34Q&sig2=u-

wpWM7qOCC0KP3inBDUvg&bvm=bv.139782543,d.ZGg

5 75% Ethanol http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?

country=IE&language=en&productNumber=458600&brand=SIAL&Page

ToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog


%2Fproduct%2Fsial%2F458600%3Flang%3Den

6 10X PCR

buffer

http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?

country=IE&language=en&productNumber=P2192&brand=SIGMA&Pag

eToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog

%2Fsearch%3Fterm%3DMgCl2%26interface%3DAll_JA%26N

%3D0%2B%26mode%3Dpartialmax%26lang%3Den%26region%3DIE

%26focus%3Dproduct

7 50mM MgCl2 http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?

country=IE&language=en&productNumber=M8266&brand=SIGMA&Pa

geToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog

%2Fsearch%3Fterm%3DMgCl2%26interface%3DAll_JA%26N

%3D0%2B%26mode%3Dpartialmax%26lang%3Den%26region%3DIE

%26focus%3Dproduct

8 10mM dNTP

mix

http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?

country=IE&language=en&productNumber=D7295&brand=SIGMA&Pa


%2Fproduct%2Fsigma%2Fd7295%3Flang%3Den

9 Random

primers

https://tools.thermofisher.com/content/sfs/msds/2013/48190011_MTR-

EULT_BE.pdf

10 SuperScriptTM

II Reverse

Transcriptase

https://tools.thermofisher.com/content/sfs/msds/2012/91681_MTR-

EULT_BE.pdf

11 5X first strand

buffer

http://msdsdigital.com/5x-first-strand-buffer-msds

12 0.1M DTT https://tools.thermofisher.com/content/sfs/msds/2014/VNR086X_MTR-

EUVN_BE.pdf

13 RNase https://tools.thermofisher.com/content/sfs/msds/2013/12091021_MTR-

EULT_BE.pdf

14 Taq DNA http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?


polymerase country=IE&language=en&productNumber=D1806&brand=SIGMA&Pa


%2Fproduct%2Fsigma%2Fd1806%3Flang%3Den

15 TAE buffer http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?

country=IE&language=en&productNumber=T4573&brand=SIGMA&Pag

eToGoToURL=http%3A%2F%2Fwww.sigmaaldrich.com%2Fcatalog

%2Fproduct%2Fsigma%2Ft4573%3Flang%3Den

16 SYBR Safe®

DNA gel stain

ttps://tools.lifetechnologies.com/content/sfs/msds/2012/S33100_MTR-

NALT_EN.pdf

17 Agarose http://www.sigmaaldrich.com/MSDS/MSDS/DisplayMSDSPage.do?

country=IE&language=en&productNumber=A9539&brand=SIGMA&Pa


%2Fproduct%2Fsigma%2Fa9539%3Flang%3Den

18 SYBR®

Green Master

Mix

https://www.thermofisher.com/order/catalog/product/4309155


Appendix G: Biological and chemical agents risk assessment

DKIT School of Nursing and Applied Science Chemical Agents Risk Assessment.___________________________________________________________________

1. Location: Smooth Muscle Research Centre

2. Assessment carried out by: Jia Yi Heng

3. Date: 5 th December 2016

4. Short description of the process involving the use of the chemical(s) – The project will be

performed over 10 weeks time and each session will take approximately 3 hours. Hazardous chemicals that are

listed below will be used for each session. Additional hours for the project may be necessary if required. The full

details of the procedure have been attached in plan of work (appendix B, C, D and E).

Tick which category of process is involved;

- Preparation for laboratory practical

- Laboratory practical

- 4th year project - Postgraduate research

5. Hazardous Chemical Agents to be used Amount Physical Form1) TRIzol® reagent 1ml liquid


2) Chloroform 200μl liquid

3) Isopropanol 200μl liquid

4) 75% Ethanol 1ml liquid

5) DTT 2μl liquid

6) TAE buffer 500ml liquid

7) Agarose 2g powder

8) SYBR Safe® DNA gel stain 10μl liquid

6. Person Exposed to Risk

Students Employees Public Contractors Visitors

7. Indicate Hazard Classification (for all chemicals used)

Explosive: □ Oxidising: ⑥ Extremely Flammable: □Highly Flammable: ②③⑥ Flammable: ⑧ Very Toxic: ① Toxic: ②③⑤⑧

Harmful: ①② Irritant: ①② Sensitiser: □

Corrosive: ①⑧ Carcinogen: ③⑧ Mutagen: □ Teratogen: ②

Hazardous to the environment: ① ② ③ ④8. Potential routes of exposure

Inhalation: ①②③④⑤⑥⑦⑧ Skin Contact: ①②③④⑤⑥⑦⑧

Ingestion: ①②③④⑤⑥⑦⑧ Sharps: □

9. Control measures to ensure safe use of chemicals

9.1. PPE Required: Lab Coat: ①②③④⑤⑥⑦⑧ Safety Glasses: ①②③④⑤⑥⑦⑧

Safety Goggles: ①②③④⑤⑥⑦⑧ Face Shield: ②③Gloves: ①②③④⑤⑥⑦⑧ (indicate type)_Nitrile rubber_____


9.2. Engineering Controls: Fume Hood: Local exhaust ventilation ①②③⑧

Special storage arrangements : As per MSDS

9.3. Emergency Response(a)Fire (consult relevant MSDS for further information)

①②③④⑤⑥⑦⑧Suitable extinguishing media: Dry chemical, Carbon dioxide (CO2), Water spray, or alcohol-

resistant foam.

①②③④⑤⑥⑦⑧Advice for firefighters: Wear self-contained breathing apparatus for firefighting if necessary

(b)First Aid (consult relevant MSDS for further information)An MSDS must accompany all victims of exposure when seeking medical advice. Always consult an MSDS following an exposure to a

hazardous agent. ①②③④⑤⑥⑦⑧ Skin contact: Wash off immediately with soap and plenty of water while removing all

contaminated clothes and shoes. Call a physician immediately. ①②③④⑤⑥⑦⑧ Eye contact: Rinse cautiously with water for several minutes. Remove contact

lenses, if present and easy to do. Continue rinsing. Rinse immediately with plenty

of water, also under the eyelids, for at least 15 minutes. Call a physician

immediately. ①②③④⑤⑥⑦⑧ Ingestion: Call a physician or poison control center immediately. Rinse mouth. Do not induce

vomiting without medical advice. Never give anything by mouth to an unconscious

person I①②③④⑤⑥⑦⑧ nhalation: Remove to fresh air. Call a physician or poison control center immediately.

(c)Spill Response (consult relevant MSDS for further information)

① ② ⑤⑧ Soak up with inert absorbent material and neutralize with it. Pick up and transfer to properly labeled

containers

③ Collect with an electrically protected vacuum cleaner or by wet-brushing and place in container for disposal

according to local regulations

9.4. Further Risk Control Measures required isolation of ignition sources; use of warning signage; the use of additional safety equipment;

implementation of safe handling , transport and storage arrangements; availability of appropriate first aid equipment / antidotes,


exclusion zones

no lone working

overnight experiment permission

information to contractors servicing or repairing equipment

information to cleaners

other(describe)

Expand on any issues ticked above.

Isolation of ignition sources

① Toxic gas, Sulphur oxides, Hydrogen cyanide (hydrocyanic acid), Carbon oxides, Nitrogen oxides.

② Carbon oxides, Hydrogen chloride gas

③④ Carbon oxides

Use of warning signage Danger sign①②③ Warning sign⑧

Implementation of safe handling

①②③④⑤⑥⑦⑧ Avoid contact with skin and eyes. Avoid inhalation of vapour or mist.

Transport and storage arrangements Store in cool and well-ventilated place. Avoid from sunlight.①②③④⑤⑥⑦⑧Keep away from sources of ignition①Ensure adequate ventilation, especially in confined areas.⑧

1) TRIzol® reagent

Initial Risk Rating (without any control measures)


Probability : 2 x Severity 2 = Risk Factor 4

KEY

PROBABILITY SEVERITY RISK FACTOR

Probable 3 Critical 3 1-3 Low Risk

Possible 2 Serious 2 4 Medium Risk

Unlikely 1 Minor 1 6-9 High Risk

Risk Factor = Probability x Severity

Risk Reduction Rating (after controls introduced)

2) Chloroform



3) Isopropanol






KEY








KEY







4) 75% Ethanol



6) TAE buffer





KEY








KEY







7) Agarose



8) SYBR Safe® DNA gel stain





KEY








KEY







Review annually (including Safety Data Sheets) and revise if necessary.


jia yi_heng plan 2016

Documents