international journal for parasitology - um...

International Journal for Parasitology 42 (2012) 1025–1036

Contents lists available at SciVerse ScienceDirect

International Journal for Parasitology

journal homepage: www.elsevier .com/locate / i jpara

A new type F Wolbachia from Splendidofilariinae (Onchocercidae) supportsthe recent emergence of this supergroup q

Emilie Lefoulon a, Laurent Gavotte b, Kerstin Junker c, Michela Barbuto d, Shigehiko Uni e,Frederic Landmann f, Sauli Laaksonen g, Susanna Saari g, Sven Nikander g, Sueli de Souza Lima h,Maurizio Casiraghi d, Odile Bain a,⇑, Coralie Martin a,⇑a UMR 7245 MCAM MNHN CNRS & UMR 7205 OSEB MNHN CNRS, Muséum National d’Histoire Naturelle, 61 Rue Buffon, CP52, 75231 Paris Cedex 05, Franceb UMR 5554 ISEM CNRS, Université Montpellier 2, Place Eugène Bataillon, 34095 Montpellier, Francec ARC-Onderstepoort Veterinary Institute, Private Bag X05, Onderstepoort 0110, South Africad Dipartimento di Biotecnologie e Bioscienze, Università degli Studi di Milano Bicocca, Piazza della Scienza 2, 20126 Milano, Italye Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur, Malaysiaf Department of Molecular, Cell and Developmental Biology, University of California Santa Cruz, CA, USAg Faculty of Veterinary Medicine, University of Helsinki, P.O. Box 66, FI-00014 Helsinki, Finlandh Departamento de Zoologia, Instituto de Ciências Biologicas e Geociências, Univisersidade Federal de Juiz de Fora, Minas Geraes, Brazil

a r t i c l e i n f o a b s t r a c t

Article history:Received 5 June 2012Received in revised form 30 August 2012Accepted 3 September 2012Available online 4 October 2012

Keywords:OnchocercidaeWolbachiaSupergroup FSymbiosisPhylogenyTissue localization

0020-7519/$36.00 � 2012 Australian Society for Parahttp://dx.doi.org/10.1016/j.ijpara.2012.09.004

q Nucleotide sequence data reported in this paper arAccession Nos. JQ888262–JQ888344.⇑ Corresponding authors. Tel.: +33 1 40793497x96;

E-mail addresses: [email protected] (O. Bain), cmartin

Wolbachia are vertically transmitted endosymbiotic bacteria of arthropods and onchocercid nematodes. Itis commonly accepted that they co-evolved with their filarial hosts, and have secondarily been lost insome species. However, most of the data on the Wolbachia/Onchocercidae relationship have been derivedfrom studies on two subfamilies, the Dirofilariinae and the Onchocercinae, which harbour parasites ofhumans and domestic animals. Within the last few years, analyses of more diverse material have sug-gested that some groups of Onchocercidae do not have Wolbachia, such as recently studied Splendidofi-lariinae from birds. This study takes advantage of the analysis of additional Splendidofilariinae,Rumenfilaria andersoni from a Finnish reindeer and Madathamugadia hiepei from a South African gecko,using PCR, immunohistochemical staining and whole-mount fluorescent analysis to detect Wolbachiaand describe its strains. A DNA barcoding approach and phylogenetic analyses were used to investigatethe symbiosis between Wolbachia and the Onchocercidae. A new supergroup F Wolbachia was demon-strated in M. hiepei, representing the first filarial nematode harbouring Wolbachia described in anon-mammalian host. In the adult, Wolbachia infects the female germline but not the hypodermis, andintestinal cells are also infected. The phylogenetic analyses confirmed a recent emergence of supergroupF. They also suggested several events of horizontal transmission between nematodes and arthropods inthis supergroup, and the existence of different metabolic interactions between the filarial nematodesand their symbionts.

� 2012 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

1. Introduction

Wolbachia are mainly known as intracellular bacteria of arthro-pods, inducing several reproductive phenotypes that benefit thetransmission of the bacteria (Anderson and Karr, 2001). Wolbachiahave also been found in the Onchocercidae, a family of nematodes,including agents of human diseases, e.g. lymphatic filariases andonchocerciasis (Sironi et al., 1995; Bandi et al., 1998). To date,Wolbachia have not been identified in any other nematode groups

sitology Inc. Published by Elsevier

e available in GenBank under

fax: +33 1 [email protected] (C. Martin).

(Bordenstein et al., 2003; Duron and Gavotte, 2007), although theirpresence was suggested in Radopholus similis, a plant-parasiticnematode (Haegeman et al., 2009). Filarial Wolbachia are usuallyfound in the female reproductive apparatus and in the hypodermis(Brattig et al., 2001; Kramer et al., 2003; Landmann et al., 2010;Fischer et al., 2011). The endosymbiont is thought to be mutualisticand ubiquitous in Onchocercidae and to provide essential metabo-lites to the filariae (Foster et al., 2005; Fenn and Blaxter, 2006;Strübing et al., 2010). Wolbachia are classified in supergroups: A,B, E, H, I and K are commonly found in arthropods (Werren et al.,1995; Bordenstein and Rosengaus, 2005; Lo et al., 2007; Roset al., 2009) while C, D and J are limited to filariae (Casiraghiet al., 2005; Ros et al., 2009; Ferri et al., 2011). Interestingly, thesupergroup F encompasses arthropod and filarial hosts (Lo et al.,2002; Keiser et al., 2008; Ferri et al., 2011).

Ltd. All rights reserved.

http://dx.doi.org/10.1016/j.ijpara.2012.09.004

mailto:[email protected]

mailto:[email protected]


http://www.sciencedirect.com/science/journal/00207519

http://www.elsevier.com/locate/ijpara

1026 E. Lefoulon et al. / International Journal for Parasitology 42 (2012) 1025–1036

Based on the traditional morphological and biological data (Bainet al., 2008; Anderson and Bain, 2009; Ferri et al., 2011), theso-called primitive Onchocercidae, such as the sub-familiesWaltonellinae and Oswaldofilariinae, have no Wolbachia. Untilnow, Wolbachia have been identified only in two of the eightonchocercid subfamilies, i.e. Onchocercinae and Dirofilariinae,with 27 positive species out of 55 examined (Bandi et al., 1998;Casiraghi et al., 2004; Ferri et al., 2011). Until recently, it has beensuggested that the association between Wolbachia and nematodeswas established following a single infection within the lineageleading to the Onchocercinae/Dirofilariinae, and that negativespecies in these subfamilies represent secondary losses (Bandiet al., 1998; Casiraghi et al., 2004). The secondary loss hypothesisof Wolbachia is supported by the identification of Wolbachia-likegene sequences in filarial host genomes of species which do notharbour Wolbachia, such as Acanthocheilonema viteae and Oncho-cerca flexuosa (McNulty et al., 2010). It has also been suggested thata congruency exists between Wolbachia and the filarial host phy-logenies (Bandi et al., 1998). This picture is no longer accurate,since Wolbachia of supergroup F are found in both arthropodsand Onchocercidae. In addition, there is no congruence betweenWolbachia of supergroup F and their filarial hosts, Mansonella(Cutifilaria) perforata and Cercopithifilaria japonica (Ferri et al.,2011). Taken together, these data show that supergroup F wasacquired by filariae independently of supergroups C and D.

The present study focused on a particular subfamily of Oncho-cercidae, the Splendidofilariinae, which, based on morphologicaland biological criteria (Bain et al., 2008; Anderson and Bain,2009), is considered to be a derived subfamily, similar to theOnchocercinae. Interestingly, its host range includes mammals,birds and lizards. Until now, only two splendidofilariine specieshad been analysed and appeared not to be infected with Wolbachi-a: an Aproctella sp. (Ferri et al., 2011) and Chandlerella quiscali(McNulty et al., 2012), both parasites of birds. We screened onespecies parasitic in mammals, Rumenfilaria andersoni, and one par-asitic in saurians, Madathamugadia hiepei. Unexpectedly, the filariafrom geckos harboured Wolbachia. Its strain was determined to be-long to supergroup F and its localization in the host’s tissues was

Table 1Primers and PCR programs used in this study.

Organism Gene Primers

Designation Sequence (50–30)

Filarial nematodes 12S rDNA 12SF/ GTTCCAGAATAATCGGCTA12SdegR ATTGACGGATGRTTTGTACC

coxI COIintF/ TGA TTG GTG GTT TTG GTA ACOIintR ATA AGT ACG AGT ATC AAT ATC99f/ TTGTAGCCTGCTATGGTATAACT994r GAATAGGTATGATTTTCATGT

Wolbachia 16S rDNA 16SWolbF/ GAAGATAATGACGGTACTCAC16SWolbR3 GTCACTGATCCCACTTTAAATAAC16SPO/ AAGAGTTTGATCCTGGCTCAG16SWolbR3 GTCACTGATCCCACTTTAAATAACW-Ef/ CAGACGGGTGAGTAATGYATAGW-Er TATCACTGGCAGTTTCCTTAAAG

dnaA dnaA2F/ ACAATTGGTTATATCAGCTGdnaA2R TACATAGCTATTTGYCTTGG

ftsZ ftsZF1/ ATYATGGARCATATAAARGATAGftsZR1 TCRAGYAATGGATTRGATAT

groEL WgroF1/ GGTGAGCAGTTGCAAGAAGCWgroRev1 AGATCTTCCATCTTGATTCC

CoxA coxAF1/ TTGGRGCRATYAACTTTATAGcoxAR1 CTAAAGACTTTKACRCCAGT

fbpA fbpAF1/ GCTGCTCCRCTTGGYWTGATfbpAR1 CCRCCAGARAAAAYYACTATTC

Step 1: initial denaturation; Step 2: denaturation; Step 3: annealing; Step 4: elongatReferences: (1) Casiraghi et al. (2004), (2) O’Neill et al. (1992), (3) Werren and Windsor

unusual as it was present in intestinal cells but absent in the lateralchords. The updated phylogeny of Wolbachia supports the recentemergence of the supergroup F.

2. Materials and methods

2.1. Material studied

All experimental procedures and ethical approvals compliedwith the relevant national ethical bodies. Geckos were collectedat Medunsa, South Africa, by veterinarians and no permits werenecessary. Reindeer were killed in slaughter houses in accordancewith the conservation and control policies of the Finnish FoodSafety Authority, Finland.

Rumenfilaria andersoni is a parasite of the reindeer, Rangifer tar-andus. The specimens studied were recovered from lymphatic ves-sels collected from reindeer in slaughter houses of Kuusamo(Finland), and identified by Laaksonen et al. (2010). Madathamug-adia hiepei parasitizes the gecko Chondrodactylus (=Pachydactylus)turneri (Hering-Hagenbeck et al., 2000). The specimens were recov-ered from the mesentery and identified by K. Junker and O. Bain(ARC-Onderstepoort Veterinary Institute, South Africa; MuséumNational d’Histoire Naturelle, France). For both of these filariae,new molecular sequences were generated (Supplementary TablesS1 and S2).

Complementary molecular analyses, in addition to publishedsequences, were performed on Onchocerca suzukii, a parasite ofthe Japanese serow, Nemorhaedus crispus, from Japan and on Litom-osoides sigmodontis, an experimental strain maintained in Merionesunguiculatus at the Muséum National d’Histoire Naturelle (Paris,France). Japanese serows were killed by hunters who have a permitto kill wild animals in accordance with the conservation and con-trol policies of the Ministry of the Environment of Japan.

Filariae were fixed and kept in absolute ethanol for molecularanalysis and in 2% formalin for immunohistochemical staining.The anterior and posterior parts of worms were used for morpho-logical studies and the median part for molecular analyses.

Thermal profile Ref.

Product size (bp) Step 1 Step 2 Step 3 N

�C s �C s �C s

650 94 45 50 45 72 90 40 1

450 94 45 52 45 72 90 40 1

895 94 30 60 30 72 120 5 294 30 50 30 72 120 35

1014 94 30 60 30 72 120 5 194 30 50 30 72 120 3594 30 60 30 72 120 5 194 30 50 30 72 120 35

1025 95 120 64 60 72 120 2 395 30 64 60 72 120 35

350 94 30 50 45 72 90 40 4

524 94 30 54 45 72 90 40 5

94 45 60 45 72 80 5 494 45 55 45 72 80 34

487 94 30 54 45 72 90 40 5

509 94 30 59 45 72 90 40 5

ion; Step 5: final elongation; �C: temperature; s: duration; n: number of cycles., 2000, (4) Casiraghi et al. (2005), (5) Baldo et al. (2006a,b).

E. Lefoulon et al. / International Journal for Parasitology 42 (2012) 1025–1036 1027

2.2. Molecular screening

The identification of filarial species was based on their mor-phology and confirmed by cytochrome oxidase subunit I (coxI)and 12S rDNA gene analyses. Filarial DNA was extracted usingthe QIAamp kit (Qiagen, France). PCRs were performed using thenematode-specific primer sets COIintF/COIintR and 12SF/12SR(Table 1) (Casiraghi et al., 2004).

The presence of Wolbachia was determined by PCR screening ofthe 16S rDNA gene as described by Casiraghi et al. (2004) (Table 1).Initially, PCRs were done using the primer set 99f/994r (O’Neillet al., 1992), specific to Wolbachia supergroups A and B, and theprimer set 16SWolbF/16SWolbR3, specific to Wolbachia super-groups A–D (Casiraghi et al., 2001). When PCR results werenegative under the above conditions, the sensitivity of the PCRscreening was tested using nested-PCR. The first PCR was per-formed using the general eubacterial primer 16SPO, paired withthe specific primer 16SWolbR3 (Casiraghi et al., 2001). For the sec-ond PCR, the internal primer set W-EF/W-Er was used (Werren andWindsor, 2000). If PCRs remained negative, the specificity of thePCR screening was tested using the primer set 16SPO/16SWolbR3and varying the following two parameters: MgCl2 concentration(2/3/4 mM) and annealing temperatures (60 ± 5 �C). When theamplification of 16S rDNA sequences indicated the presence ofWolbachia, additional genes were amplified: dnaA, coxA, fbpA, ftsZand groEL (Table 1) (Casiraghi et al., 2005; Baldo et al., 2006b). PCRswere performed in a final volume of 20 ll [1� buffer (containing1.5 mM MgCl2, Eppendorf™), 0.2 mM of each dNTP, 1 lM of eachprimer, 0.5 U of Taq DNA Polymerase (Eppendorf™)] under theconditions listed in Table 1. PCR products were purified using theQiaquick� PCR Purification Kit (Qiagen, France) and directly se-quenced using ABI technology. All new sequences were depositedin the GenBank Data Library (Supplementary Table S2).

2.3. Immunohistochemical staining of worm sections

Immunohistochemical staining was done according to Krameret al. (2003) and Ferri et al. (2011). A rabbit polyclonal antiserumraised against the Wolbachia Surface Protein (WSP) of Wolbachiafrom Brugia pahangi was used to stain 4 lm paraffin sections offilarial species placed on Silane coated glass slides (3-aminpropyltriethoxysilane). Negative controls were carried outby omitting the primary antibody. The laboratory strain of L. sigm-odontis, shown to harbour Wolbachia in previous studies (Casiraghiet al., 2004; Ferri et al., 2011), was used as a positive control. Inaddition, transverse sections were stained with H&E and analysedby light microscopy (Nikon, BH-2) for the identification of anatom-ical structures.

2.4. Whole-mount fluorescent analysis

Specimens of M. hiepei (Supplementary Table S1) were cut witha razor blade to expose the different tissues to RNAse A (1 mg/mL,Sigma, USA) in rotating tubes overnight at 4 �C. They were rinsed inPBS, and incubated with a fluorochrome-conjugated phalloidin(atto-Phalloidin, Fluka, USA, at 10 nM) overnight to stain F-actin,followed by a propidium iodide (Molecular Probes�, 1.0 mg/mLsolution) incubation for DNA staining for 20 min in PBS (1:50),and a 5 min wash. Tissues were mounted in Vectashield (VectorLaboratories, USA) (Landmann et al., 2010). Confocal microscopefluorescent images were captured on an inverted photoscope(DMIRB; Leitz) equipped with a laser confocal imaging system(TCS SP2; Leica) using an HCX PL APO 1.4 NA 63 oil objective(Leica) at room temperature.

2.5. Filarial coxI and 12S rDNA gene analyses

A DNA barcoding approach based on the coxI marker was usedto discriminate between species. A set of 129 specimens was ana-lysed. This included 111 specimens, representing 51 onchocercidspecies, for which molecular data were extracted from GenBank(Supplementary Table S2), and 18 specimens, belonging to twospecies, for which cox1 sequence data were generated for the firsttime (Supplementary Tables S1 and S2). The filarial coxI sequenceswere aligned in ClustalX2 (Larkin et al., 2007); Ascaris lumbricoides,Contracaecum rudolphii and Heterakis isolonche were used as out-groups (Supplementary Table S3). CoxI sequence divergences weredetermined using the Kimura 2-parameter (K2P) distance model(Kimura, 1980) through Mega 5.01 software (Tamura et al.,2011). Subsequently, divergence comparisons were conducted onthree levels: intraspecific, intrageneric and intrafamilial. JModel-Test (Posada, 2008) was used to select the optimal evolution modelby evaluating the selected parameters using the Akaike Informa-tion Criterion (AIC). A corrected version of the AIC (AICc) was usedbecause the sample size (n) was too small when compared with thenumber of parameters (K) (n/K < 40). Selected models are listed inSupplementary Table S4. The Maximum Likelihood (ML) phylo-gram based on the coxI sequence data was reconstructed withphyML version 2.4.4 (Guindon and Gascuel, 2003). In the sameway, an analysis based on the 12S rDNA sequences was performed.The known 12S rDNA sequences of 127 specimens, spanning 49onchocercid species (extracted from GenBank; SupplementaryTable S2) were analysed together with the newly generated onesof R. andersoni and M. hiepei (Supplementary Tables S1 and S2),and were aligned in ClustalX2 (Larkin et al., 2007); the three out-group taxa were Thelazia callipaeda, Thelazia gulosa and Heliconemalongissimum (Supplementary Table S3). The ML phylogram derivedfrom the 12S rDNA sequence data was created with PhyML version2.4.4 (Guindon and Gascuel, 2003). The robustness of nodes wasassessed with 500 bootstrap replicates.

2.6. Recombination analysis

Recombination events were analysed using the RDP3 betarecombination detection program (Martin et al., 2010), whichincludes the following methods: RDP (Martin and Rybicki, 2000),MaxChi (Smith, 1992), Chimaera (Posada and Crandall, 2001),SiScan (Gibbs et al., 2000) and 3Seq (Boni et al., 2007).

2.7. Phylogenetic reconstruction

The new Wolbachia 16S rDNA, dnaA, groEL, ftsZ, coxA and fbpAsequences were aligned with sequences available in GenBank (Sup-plementary Tables S2 and S5) using ClustalX2 (Larkin et al., 2007).Concatenated alignments were generated with and without thefollowing outgroup taxa: Anaplasma marginale strain St. Maries,Anaplasma phagocytophilum strain HZ and Ehrlichia ruminantiumstrain Welgevonden (Supplementary Table S3). The ML analyseswere performed with PhyML version 2.4.4 (Guindon and Gascuel,2003), and the robustness of nodes was assessed with 500 boost-strap replicates. In addition, the concatenated alignments wereanalysed by Bayesian (B) Inference using MrBayes 3.0 (Ronquistand Huelsenbeck, 2003). A single run was performed, using fivemillions steps with two chains with tree sampling every 1,000 gen-erations; the first 250 points were discarded as burn-in and Poster-ior Probabilities were calculated from these post-burning trees.Furthermore, the sequence divergences between Wolbachia strainswithin the same supergroup were calculated using the K2P dis-tance model (Kimura, 1980) through Mega 5.01 software (Tamuraet al., 2011).

Fig. 1. DNA barcoding of Onchocercidae based on mitochondrial cytochrome oxidase subunit I (coxI) sequences. (A) Maximum likelihood (ML) phylogram derived from thecoxI sequences from 129 onchocercid specimens (representing 51 species), and three outgroup taxa. Numbers at specific nodes indicate the degree of bootstrap support(estimated from 500 replicates) when P70%. Heterakis isolonche, Contracaecum rudolphii and Ascaris lumbricoides were used as outgroups; coxI sequences were obtained fromGenBank, except those from Rumenfilaria andersoni and Madathamugadia hiepei. The number (where >1) of studied individuals per species is given in brackets. When severalindividuals are analysed for one species, the diversity is shown by a triangle. The onchocercid subfamilies are indicated on the right of the tree; ONC., Onchocercidae; DIR.,Dirofilariinae; SPL., Splendidofilariinae; SET., Setariinae; WAL., Waltonellinae; OSW., Oswaldofilariinae. Mansonella (Tetrapetalonema) atelensis⁄ is the subspecies M. (T.)atelensis amazonae (B–D) Comparison of nucleotide sequence divergences in the coxI gene among 51 onchocercid species. Pairwise comparisons between 129 coxI sequencesare separated into three categories: (B) differences between individuals of the same species, (C) differences between individuals in the same genus without includingintraspecific differences, and (D) differences between individuals in the same family without including intraspecific or intrageneric differences. Thresholds of geneticdivergence were previously established at 4.8% (Ferri et al., 2009).



2.8. Multi Locus Sequence Typing (MLST) analyses

A MLST approach was chosen for a data set including 18 Wolba-chia strains (Supplementary Tables S2 and S5). Identical DNA se-quences at a given locus between strains were arbitrarily codedwith the same allele number (i.e. each allele or haplotype has a un-ique identifier), following MLST conventions (Urwin and Maiden,2003). Each unique allelic profile was assigned a Sequence Typeor ST (a unique series of allele, or haplotype, identifiers). MLST datawere used to construct a dendrogram by cluster analysis using theunweighted pair group method with arithmetic mean (UPGMA) inthe ClonalFrame software package (Didelot and Falush, 2007). AConsensus MLST tree was built from combined data from threeindependent runs with 75% majority rule consensus for inferencerelatedness (the program was run with 50,000 burn-in iterationsfollowed by 50,000 subsequent iterations).

2.9. Accession numbers

All new sequences generated in this study were deposited inGenBank (http://www.ncbi.nlm.nih.gov/genbank) under the Acces-sion Nos.: JQ888262–JQ888279 for coxI, JQ888280–JQ888297 for12S rDNA, JQ888298–JQ888305 for 16S rDNA, JQ888306–JQ888311 for coxA, JQ888312–JQ888322 for dnaA, JQ888323–JQ888332 for ftsZ, JQ888333–JQ888338 for groEL andJQ888339–JQ888344 for fbpA (Supplementary Table S2).

3. Results

3.1. Validation of the systematics of Onchocercidae by coxI and 12SrDNA sequences analysis

The coxI divergence threshold value to discriminate betweenonchocercid species was previously established at 4.8% (Ferriet al., 2009). In the present study, the mean coxI nucleotide dis-tance observed within species was 0.5% (Fig. 1B) while the meancoxI nucleotide distance between species was 9.4% (Fig. 1C) andthe mean coxI nucleotide distance between genera was 17.8%(Fig. 1D). No divergence in the coxI sequences was observed withinthe seven samples morphologically identified as R. andersoni andthe 11 samples morphologically identified as M. hiepei, respec-tively. The 18% average divergence in coxI sequences of these twospecies from other onchocercid genera confirmed that they are dis-tinct genera (Fig. 1A and D).

The analysis based on 12S rDNA sequences showed M. hiepei tobe close to R. andersoni (bootstrap value: 89) (Fig. 2). However, athird species belonging to the Splendidofilariinae, Aproctella sp.,did not group with the former two species. The 12S rDNA phylo-gram presented numerous unresolved nodes. Nevertheless it sug-gests the presence of two sister groups: Oswaldofilariinae,Waltonellinae and Setariinae on the one hand, and species of theSplendidofilariinae, Dirofilariinae and Onchocercinae on the otherhand (bootstrap value: 76) (Fig. 2).

3.2. Detection and localization of Wolbachia in Madathamugadiahiepei and its absence in Rumenfilaria andersoni

None of the seven specimens of R. andersoni were infected withWolbachia, neither by PCR screening of the 16S rDNA gene, nor bystaining of WSP antibody (Fig. 3A). In contrast, all 11 samples ofM. hiepei tested positive for the symbiont. In addition to the 16SrDNA gene, another five Wolbachia genes (dnaA, groEL, ftsZ, coxAand fbpA) were amplified. Whole-mount fluorescence analysiswas used to determine Wolbachia localization in the host.Wolbachia were present in different developmental stages of M.

hiepei: in every single blastomere in young embryos (Fig. 3C), inlate embryos (Fig. 3D), and in adult females (Fig. 3E–H). In adultworms, Wolbachia were observed in the ovaries (Fig. 3B and E)and in the cells of the intestinal wall (Fig. 3B and H), but wereabsent from the hypodermal lateral chord (Fig. 3B, F and G).

3.3. Identification of the Wolbachia supergroup in Madathamugadiahiepei and updated phylogeny of Wolbachia

Five genes were used to compare the position of Wolbachia fromM. hiepei with other Wolbachia strains in filarial as well as arthro-pod hosts (Supplementary Tables S2, S3 and S6): 16S rDNA, groEL,ftsZ, dnaA and coxA. The analysis of the concatenation of these fivegenes was based on a data set including 31 Wolbachia strains(Figs. 4 and 5). While no events of recombination were found with-in four of the studied genes, some were detected in groEL. Two hadoccurred between supergroups A and B, as described previously(Baldo et al., 2006a). In addition, two more recombination eventswere detected: (i) recombination between the groEL gene ofWolbachia infecting both Brugia spp. and Litomosoides spp., andthat of Wolbachia infecting Drosophila melanogaster (pmax = 8.10�3

MaxChi and Chimaera algorithms); (ii) recombination betweenthe groEL gene of Wolbachia infecting Dirofilaria spp. and that ofO. suzukii (pmax = 1.10�3 – MaxChi, Chimaera and 3seq algorithms).However, the groEL gene was not removed from the concatenateddata set, since the Wolbachia phylogeny based on this gene alone,presented a topology similar to the remaining single-genephylogenies (Supplementary Figs. S1–S6).

Two phylogenies were produced: an unrooted (Fig. 4) and arooted tree (Fig. 5), using ML and B inferences. The two trees placedWolbachia from M. hiepei into supergroup F [Unrooted: Bootstrapvalue (Bo): 100 and Posterior Probability (PP): 1; Rooted: Bo: 98and PP: 1] (Figs. 4 and 5). It is interesting to note that the internalbranch topology within supergroup F was poorly supported, withthe exception of Wolbachia from M. hiepei which are close to Wol-bachia from C. japonica (Unrooted: Bo: 93 and PP: 0.99; Rooted: Bo:94 and PP:0.98). The rooted tree showed two sister groups: oneclade composed of Wolbachia belonging to supergroups A, B, Hand E, and a second clade composed of Wolbachia belonging tosupergroups D, I, J, C and F (Bo: 90, PP: 1). Supergroup F was placedas sister taxon to supergroups C, J and I (Bo: 76, PP: 1). Regardingthe position of Wolbachia from M. hiepei, the topology was similarto the unrooted tree, and was also consistent with the phylogeniesobtained for each gene separately (16S rDNA, groEL, ftsZ, dnaA, coxAor fbpA) as shown in Supplementary Figs. S1–S6.

Using the MLST analysis, Wolbachia from M. hiepei specimensclustered together and remained separate from supergroups A, B,C, D, H and J (Fig. 6).

The percentages of gene divergence in Wolbachia were 4.03%and 2.20% in supergroups C and D, respectively (Table 2). In super-group F, this percentage was 1.52%, thus closer to the ones ob-served in Wolbachia of supergroups B (1.50%) and A (0.43%).

4. Discussion

The present study describes a new supergroup F Wolbachia froma filaria infecting saurians, and proposes an updated molecularphylogenetic analysis of these endosymbionts in Onchocercidae(Figs. 4 and 5). The results highlight a recent emergence of super-group F and suggest events of horizontal transmission betweennematodes and arthropods. They shed new light on the origin ofinfection in Onchocercidae and suggest different metabolic rela-tionships between the two partners.

The position of supergroup F in comparison to other Wolbachiasupergroups was addressed. Rooting of the tree positioned the

http://www.ncbi.nlm.nih.gov/genbank

Fig. 2. Maximum likelihood (ML) phylogram derived from the 12S rDNA sequences from onchocercid specimens. One hundred and twenty-seven onchocercid specimens(representing 49 species) and three outgroup taxa were used for this analysis. Numbers at specific nodes indicate the degree of bootstrap support (estimated from 500replicates) when P70%. Heterakis isolonche, Contracaecum rudolphii and Ascaris lumbricoides were used as outgroups. The 12S rDNA sequences were obtained from GenBank,except those from species marked in bold on the phylogram. The number (where >1) of studied individuals per species is indicated in brackets. When several individuals areanalysed for one species, the diversity is shown by a triangle. The onchocercid subfamilies are indicated on the right of the tree.


Fig. 3. Wolbachia immunostaining in two genera of the subfamily Splendidofilariinae, Rumenfilaria and Madathamugadia. (A and B) Sections stained with a rabbit polyclonalantiserum against Wolbachia Surface Protein (WSP) of Brugia pahangi Wolbachia WSP antibody (Wol-Bp-WSP, dilution 1:2,000). (A) Absence of Wolbachia in an oblique sectionof a Rumenfilaria andersoni female. (B) Presence of Wolbachia in a transverse section of a Madathamugadia hiepei female. (C–H) Whole-mount fluorescent analysis of Wolbachiain females of M. hiepei stained with propidium iodide for DNA (red) and phalloidin for actin (green). (C) Presence of Wolbachia (small red dots) in each single blastomere (largered nuclei) in young embryos, (D) Late embryo of M. hiepei (h: head) with only a few Wolbachia (small red dots, white arrows), (E) Ovaries with large numbers of Wolbachia(small red dots), (F) Hypodermal lateral chord of a specimen of M. hiepei without Wolbachia, (G) Hypodermal lateral chord between muscle quadrants of a specimen of M.hiepei without Wolbachia. The median row of nuclei represents the ‘‘lateral hypodermis’’, at the equator on the chord, (H) Intestinal wall cells with large numbers of Wolbachia(small red dots, white arrows). Legend: I, intestine; U, uterus; c, cuticle; h, hypodermal lateral chords; m, muscles. Scale bar = 50 lm (A and B), 5 lm (C, D and H), 10 lm (E–G).


clusters of supergroups C + D + I + J + F and A + H + E as equal sistergroups, both of which are derived relative to supergroup B (Fig. 5).The rooting of the phylogenetic tree of Wolbachia is controversialdue to the use of distant outgroups (Bordenstein et al., 2009). Nev-ertheless, the current analysis seems robust because no differencesin tree topology appear between the rooted and unrooted trees(Figs. 4 and 5), nor between one-to-one gene analyses (Supplemen-tary Figs. S1–S6) and the concatenated analyses. Until now, a fewrooted trees have been proposed but these were based on differentparameters. A phylogeny was established based on 42 protein-coding genes but no Wolbachia of supergroup F were studied (Fennet al., 2006). Indeed, only five Wolbachia strains (wAna, wSim,wMel, wBm, wOvo) were used, due to the need to sequence com-plete genomes in order to obtain these 42 protein-coding genes.Later, a study based on 21 protein-coding genes from 18 Wolbachia

strains was published which included two supergroup F Wolbachiastrains (Bordenstein et al., 2009). However, only supergroup FWolbachia from arthropods were analysed. More recently, aphylogeny of 40 Wolbachia strains based on the 16S rDNA genewas produced (Ferri et al., 2011). Although a polytomy wasobserved among the various Wolbachia supergroups, this studywas based on the largest diversity of Wolbachia from Onchocerci-dae thus far, and included seven strains belonging to supergroupF. Here, five genes of 31 Wolbachia strains, six of which belong tosupergroup F, were analysed. Altogether and as previouslysuggested (Bain et al., 2008; Ferri et al., 2011), our data supportthe recent emergence of supergroup F.

The composition of supergroup F is atypical since its strains in-fect both arthropods and filarial nematodes. Horizontal transmis-sion is suggested because the distribution of Wolbachia does not

Fig. 4. Unrooted phylogeny of Wolbachia based on concatenated datasets of 16S rDNA, groEL, ftsZ, dnaA and coxA sequences. The total length of datasets is approximately3,000 bp. The topology was inferred using Maximum Likelihood (ML) and Bayesian (B) inference. Nodes are associated with two values: above, ML bootstrap values estimatedfrom 500 replicates; below, Bayesian posterior probabilities based on one run of 5 million generations. Bootstrap values <70% are not shown. Wolbachia supergroups (A–H)were identified according to Werren et al. (1995), Bandi et al. (1998), Lo et al. (2002), Ros et al. (2009). The sequences were obtained from GenBank except those from speciesidentified with an arrow on the phylogram. The scale bar indicates the distance in substitutions per nucleotide. wb, Wolbachia.


appear to be dichotomous between Onchocercidae and arthropods.Indeed, Wolbachia from M. (C.) perforata, an onchocercine ofJapanese deer, did not cluster with supergroup F Wolbachia fromother filariae (Figs. 4 and 5). Furthermore, the evolutionaryrelationships between the Wolbachia of supergroup F are not deter-mined by their geographical distribution: Wolbachia from C. japon-ica, an onchocercine of Japanese black bears, is closely related tothat of M. hiepei, a splendidofilariine of a South African gecko (Figs.4 and 5). These similar evolutionary patterns between apparentlyisolated Wolbachia in supergroup F may be explained by threehypotheses: (i) horizontal transmission of Wolbachia may haveoccurred between nematodes and arthropods, (ii) the speciationof supergroup F is very recent and thus there is not enough geneticdivergence to discriminate between the different Wolbachia as-signed to this supergroup and (iii) the phylogenetic resolutionbased on the six genes studied (16S rDNA/ftsZ/groEL/dnaA/coxA/fbpA) is not sufficient to discriminate between the strains of super-group F. Indeed, the genetic divergence within Wolbachia of super-group F is lower than that observed within supergroups C and Dwhich infect filarial nematodes only, and close to that seen withinsupergroups B and A (Table 2), in which horizontal transmission

events among hosts are well documented (Werren et al., 1995;Vavre et al., 1999; Shoemaker et al., 2002). Thus, this low geneticdivergence within supergroup F Wolbachia supports the hypothesisthat horizontal transmission has occurred between Onchocercidaeand arthropods. The mechanisms facilitating these transfers be-tween hosts are as yet unknown, but suggest a mandatory contactbetween Onchocercidae and arthropods. One could also argue thatother microorganisms may be involved in horizontal transmission.

The detection of Wolbachia in M. hiepei provides the first evi-dence of Wolbachia infection in filarial parasites of saurians, specif-ically in the subfamily Splendidofilariinae. This sheds new light onthe origin of infection in Onchocercidae. Indeed, M. hiepei is thefirst Wolbachia strain isolated from a filaria from a saurian host;all previously reported infections were detected in mammalianfilarial hosts. To date, the presence of Wolbachia has been investi-gated in three other species of Splendidofilariinae: Aproctella sp.(Ferri et al., 2011) and Chandlerella quiscali (McNulty et al., 2012),both parasites of birds, and R. andersoni from reindeer. None ofthem were infected with Wolbachia. Absence of Wolbachia wasfound in three other subfamilies of Onchocercidae: Setariinae,Oswaldofilariinae, Waltonellinae, from ungulates, saurians and

Fig. 5. Rooted phylogeny of Wolbachia based on concatenated datasets of 16S rDNA, groEL, ftsZ, dnaA and coxA sequences. The total length of data sets is approximately3,000 bp. The tree is rooted with Anaplasma marginale, Anaplasma phagocytophilum and Ehrlichia ruminantium as outgroups. The topology was inferred using MaximumLikelihood (ML) and Bayesian (B) inference. Nodes are associated with two values: above, ML bootstrap values estimated from 500 replicates; below, Bayesian posteriorprobabilities based on one run of 5 million generations. Bootstrap values <70% are not shown. Wolbachia supergroups (A–H) were identified according to Werren et al. (1995),Bandi et al. (1998), Lo et al. (2002), Ros et al. (2009). Sequences were obtained from GenBank except those from species indicated with an arrow on the phylogram. The scalebar indicates the distance in substitutions per nucleotide. wb, Wolbachia.


anurans, respectively. These are considered primitive when com-pared with the subfamilies Dirofilariinae, Onchocercinae andSplendidofilariinae (Bain et al., 2008; Anderson and Bain, 2009).Therefore, the absence of Wolbachia infection might represent anancestral trait and could indicate a recent acquisition of the bacte-ria. Taking into account the newly described presence in a

splendidofilariine host, acquisition of Wolbachia could have oc-curred: (i) once in the lineage leading to the Onchocercidae, withsubsequent losses in several species belonging to a number of gen-era, i.e. Loa, Foleyella, Acanthocheilonema, Onchocerca, Litomosoides,Cercopithifilaria, Rumenfilaria, Aproctella and Chandlerella (Bandiet al., 1998; Casiraghi et al., 2001, 2004; Ferri et al., 2011; McNulty

Fig. 6. Dendogram of Wolbachia based on the Multilocus Sequence Typing (MLST) allele profile of 16S rDNA, groEL, ftsZ, dnaA and coxA sequences. The tree was constructed bycluster analysis using the unweighted pair group method with arithmetic mean (UPGMA). Wolbachia supergroups (A–H) were identified according to Werren et al. (1995),Bandi et al. (1998), Lo et al. (2002), Ros et al. (2009). Sequences were obtained from GenBank except those from species indicated with an arrow on the phylogram. wb,Wolbachia.

Table 2Estimation of genetic divergence over sequence pairs within supergroups ofWolbachia.

16SrDNA(%)

ftsZ(%)

dnaA(%)

groEL(%)

coxA(%)

Concatenation(%)

Supergroup A 0.31 0.42 0 1.04 1.13 0.43Supergroup B 1.85 1.55 4.62 0.74 4.84 1.50Supergroup C 1.35 7.91 5.45 5.70 6.79 4.03Supergroup D 1.37 2.48 5.35 4.01 7.01 2.20Supergroup F 0.68 2.69 4.27 2.18 2.01 1.54

The percentages of base substitution per site from averaging over all sequence pairswithin each Wolbachia of the same supergroup are shown. Analysis of the five genesand concatenation were based on the Kimura 2-parameter model.


et al., 2012), or (ii) several times in the evolutionary history of theOnchocercidae. Since the first hypothesis would necessitate multi-ple secondary losses of Wolbachia, the second hypothesis appearsmore likely. Indeed, the presence of supergroup F Wolbachia, bothin Splendidofilariinae and Onchocercinae, suggests that transmis-sion might have occurred independently from an ancestral hostswitch. To give weight to one of these hypotheses, a robust phylog-eny of Onchocercidae is essential. The coxI and 12S rDNA geneanalyses are relatively good markers to discriminate between

onchocercid species but they do not allow high-resolution of theinternal nodes describing the evolutionary history of the Oncho-cercidae (Figs. 1A and 2). On-going work is focusing on the additionof genes which might prove more informative.

The in-host localization of Wolbachia from M. hiepei was foundto be unusual, and suggests different segregation patterns duringembryogenesis and perhaps specific metabolic pathways. Interest-ingly, Wolbachia infects the intestinal cells of M. hiepei (Fig. 3H),but not the hypodermal lateral chords (Fig. 3F and G). A similar dis-tribution was observed in M. (C.) perforata, an Onchocercinae thatalso harbours supergroup F Wolbachia (Ferri et al., 2011) but notconfirmed in supergroup F Wolbachia from a second onchocercine,C. japonica (Ferri et al., 2011). In most filariae, Wolbachia is locatedin the lateral chords, although at very low densities in some spe-cies, such as Loxodontofilaria caprini or Onchocerca dewittei japonica(Ferri et al., 2011). A recent analysis has shown that Wolbachia ofsupergroups C and D follow the same pattern of embryonic segre-gation, starting with mitotic asymmetric segregation to reach asubset of hypodermal cells (Landmann et al., 2010, 2012). Fromthere, Wolbachia could invade the ovary and subsequently thegermline (Fischer et al., 2011; Landmann et al., 2012). It was sug-gested that the presence of Wolbachia in the hypodermal cells oftheir filarial hosts may represent an ancestral somatic tissue-pref-erence, reflecting their mechanism of horizontal transmission(Landmann et al., 2012). Hence, the absence of Wolbachia in the


lateral hypodermis, combined with its presence in the intestinalcells, as found in M. hiepei, could reflect a different tropism of thebacteria in its hosts and raises the question of symbiont segrega-tion during embryogenesis.

Finally, regarding the relationships between supergroup F Wol-bachia and their filariae, a study on Mansonella (Esslingeria) perstanshighlighted a mutualistic association, as in supergroups C and D(Hoerauf et al., 2008), because the elimination of Wolbachia byantibiotic chemotherapy resulted in retarded growth and sterilityof females (Hoerauf et al., 2003; Coulibaly et al., 2009). Untilnow, the analysis of the two available complete genomes of Wolba-chia from Brugia malayi and Onchocerca ochengi suggested that thesymbiont could contribute to riboflavin and/or haem biosynthesis(Foster et al., 2005; Strübing et al., 2010; Darby et al., 2012). Inthe bedbug Cimex lectularius, elimination of supergroup F Wolba-chia can be counteracted by oral supplementation of B vitamins,underlying an essential role of the symbiont for host nutrition(Hosokawa et al., 2010).

To conclude, the present analyses and emerging features sug-gest complex evolutionary dynamics of Wolbachia in filarial nema-todes. This in turn suggests the existence of different methods ofinteraction between the filariae and their symbionts.

Acknowledgments

We thank Emma Ward (native English speaker) for proofread-ing the manuscript. This work was supported by European Com-munity Grants FP7-HEALTH-2010-243121 and MNHN ATMMicroorganisms and ATM Barcoding. The funders had no role instudy design, data collection and analysis, decision to publish, orpreparation of the manuscript. The authors have declared that nocompeting interests exist.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.ijpara.2012.09.004.

References

Anderson, C.L., Karr, T.L., 2001. Wolbachia: evolutionary novelty in a rickettsialbacteria. BMC Evol. Biol. 1, 10.

Anderson, R.C., Bain, O., 2009. Spirurida. Diplotriaenoidea Aproctoidea andFilarioidea. In: Anderson, R.C., Chabaud, A.G., Willmott, S. (Eds.), Keys to theNematode Parasites of Vertebrates: Archival Volume. CAB International,Wallingford, UK, pp. 391–448.

Bain, O., Casiraghi, M., Martin, C., Uni, S., 2008. The nematode Filarioidea: criticalanalysis linking molecular and traditional approaches. Parasite 15, 342–348.

Baldo, L., Bordenstein, S., Wernegreen, J.J., Werren, J.H., 2006a. Widespreadrecombination throughout Wolbachia genomes. Mol. Biol. Evol. 23, 437–449.

Baldo, L., Dunning Hotopp, J.C., Jolley, K.A., Bordenstein, S.R., Biber, S.A., Choudhury,R.R., Hayashi, C., Maiden, M.C., Tettelin, H., Werren, J.H., 2006b. Multilocussequence typing system for the endosymbiont Wolbachia pipientis. Appl.Environ. Microbiol. 72, 7098–7110.

Bandi, C., Anderson, T.J., Genchi, C., Blaxter, M.L., 1998. Phylogeny of Wolbachia infilarial nematodes. Proc. R. Soc. 265, 2407–2413.

Boni, M.F., Posada, D., Feldman, M.W., 2007. An exact nonparametric method forinferring mosaic structure in sequence triplets. Genetics 176, 1035–1047.

Bordenstein, S., Rosengaus, R.B., 2005. Discovery of a novel Wolbachia super groupin Isoptera. Curr. Microbiol. 51, 393–398.

Bordenstein, S.R., Fitch, D.H., Werren, J.H., 2003. Absence of Wolbachia in nonfilariidnematodes. J. Nematol. 35, 266–270.

Bordenstein, S.R., Paraskevopoulos, C., Dunning Hotopp, J.C., Sapountzis, P., Lo, N.,Bandi, C., Tettelin, H., Werren, J.H., Bourtzis, K., 2009. Parasitism and mutualismin Wolbachia: what the phylogenomic trees can and cannot say. Mol. Biol. Evol.26, 231–241.

Brattig, N.W., Buttner, D.W., Hoerauf, A., 2001. Neutrophil accumulation aroundOnchocerca worms and chemotaxis of neutrophils are dependent on Wolbachiaendobacteria. Microbes Infect. 3, 439–446.

Casiraghi, M., Anderson, T.J., Bandi, C., Bazzocchi, C., Genchi, C., 2001. A phylogeneticanalysis of filarial nematodes: comparison with the phylogeny of Wolbachiaendosymbionts. Parasitology 122 (Pt 1), 93–103.

Casiraghi, M., Bain, O., Guerrero, R., Martin, C., Pocacqua, V., Gardner, S.L.,Franceschi, A., Bandi, C., 2004. Mapping the presence of Wolbachia pipientis onthe phylogeny of filarial nematodes: evidence for symbiont loss duringevolution. Int. J. Parasitol. 34, 191–203.

Casiraghi, M., Bordenstein, S.R., Baldo, L., Lo, N., Beninati, T., Wernegreen, J.J.,Werren, J.H., Bandi, C., 2005. Phylogeny of Wolbachia pipientis based on gltA,groEL and ftsZ gene sequences: clustering of arthropod and nematodesymbionts in the F supergroup, and evidence for further diversity in theWolbachia tree. Microbiology 151, 4015–4022.

Coulibaly, Y.I., Dembele, B., Diallo, A.A., Lipner, E.M., Doumbia, S.S., Coulibaly, S.Y.,Konate, S., Diallo, D.A., Yalcouye, D., Kubofcik, J., Doumbo, O.K., Traore, A.K.,Keita, A.D., Fay, M.P., Traore, S.F., Nutman, T.B., Klion, A.D., 2009. A randomizedtrial of doxycycline for Mansonella perstans infection. N. Engl. J. Med. 361, 1448–1458.

Darby, A.C., Armstrong, S.D., Bah, G.S., Kaur, G., Hughes, M.A., Kay, S.M., Koldkjaer, P.,Radford, A.D., Blaxter, M.L., Tanya, V.N., Trees, A.J., Cordaux, R., Wastling, J.M.,Makepeace, B.L., 2012. Analysis of gene expression from the Wolbachia genomeof a filarial nematode supports both metabolic and defensive roles within thesymbiosis. Genome Res. http://dx.doi.org/10.1242/bio.2012737.

Didelot, X., Falush, D., 2007. Inference of bacterial microevolution using multilocussequence data. Genetics 175, 1251–1266.

Duron, O., Gavotte, L., 2007. Absence of Wolbachia in nonfilariid worms parasitizingarthropods. Curr. Microbiol. 55, 193–197.

Fenn, K., Blaxter, M., 2006. Wolbachia genomes: revealing the biology of parasitismand mutualism. Trends Parasitol. 22, 60–65.

Fenn, K., Conlon, C., Jones, M., Quail, M.A., Holroyd, N.E., Parkhill, J., Blaxter, M.,2006. Phylogenetic relationships of the Wolbachia of nematodes andarthropods. PLoS Pathog. 2, e94.

Ferri, E., Bain, O., Barbuto, M., Martin, C., Lo, N., Uni, S., Landmann, F., Baccei, S.G.,Guerrero, R., de Souza Lima, S., Bandi, C., Wanji, S., Diagne, M., Casiraghi, M.,2011. New insights into the evolution of Wolbachia infections in filarialnematodes inferred from a large range of screened species. PLoS One 6, e20843.

Ferri, E., Barbuto, M., Bain, O., Galimberti, A., Uni, S., Guerrero, R., Ferte, H., Bandi, C.,Martin, C., Casiraghi, M., 2009. Integrated taxonomy: traditional approach andDNA barcoding for the identification of filarioid worms and related parasites(Nematoda). Front. Zool. 6, 1.

Fischer, K., Beatty, W.L., Jiang, D., Weil, G.J., Fischer, P.U., 2011. Tissue and stage-specific distribution of Wolbachia in Brugia malayi. PLoS. Negl. Trop. Dis. 5,e1174.

Foster, J., Ganatra, M., Kamal, I., Ware, J., Makarova, K., Ivanova, N., Bhattacharyya,A., Kapatral, V., Kumar, S., Posfai, J., Vincze, T., Ingram, J., Moran, L., Lapidus, A.,Omelchenko, M., Kyrpides, N., Ghedin, E., Wang, S., Goltsman, E., Joukov, V.,Ostrovskaya, O., Tsukerman, K., Mazur, M., Comb, D., Koonin, E., Slatko, B., 2005.The Wolbachia genome of Brugia malayi: endosymbiont evolution within ahuman pathogenic nematode. PLoS Biol. 3, e121.

Gibbs, M.J., Armstrong, J.S., Gibbs, A.J., 2000. Sister-scanning: a Monte Carloprocedure for assessing signals in recombinant sequences. Bioinformatics 16,573–582.

Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimatelarge phylogenies by maximum likelihood. Syst. Biol. 52, 696–704.

Haegeman, A., Vanholme, B., Jacob, J., Vandekerckhove, T.T., Claeys, M., Borgonie,G., Gheysen, G., 2009. An endosymbiotic bacterium in a plant-parasiticnematode: member of a new Wolbachia supergroup. Int. J. Parasitol. 39,1045–1054.

Hering-Hagenbeck, S., Boomker, J., Petit, G., Killick-Kendrick, M., Bain, O., 2000.Description of Madathamugadia hiepei n. sp. (nematoda: Splendidofilariinae),a parasite of a South African gecko, and its development in laboratory bredPhlebotomus dubosqi (Diptera: Psychodidae). Syst. Parasitol. 47, 207–213.

Hoerauf, A., Mand, S., Volkmann, L., Buttner, M., Marfo-Debrekyei, Y., Taylor, M.,Adjei, O., Buttner, D.W., 2003. Doxycycline in the treatment of humanonchocerciasis: kinetics of Wolbachia endobacteria reduction and of inhibitionof embryogenesis in female Onchocerca worms. Microbes Infect. 5, 261–273.

Hoerauf, A., Specht, S., Buttner, M., Pfarr, K., Mand, S., Fimmers, R., Marfo-Debrekyei,Y., Konadu, P., Debrah, A.Y., Bandi, C., Brattig, N., Albers, A., Larbi, J., Batsa, L.,Taylor, M.J., Adjei, O., Buttner, D.W., 2008. Wolbachia endobacteria depletion bydoxycycline as antifilarial therapy has macrofilaricidal activity inonchocerciasis: a randomized placebo-controlled study. Med. Microbiol.Immunol. 197, 295–311.

Hosokawa, T., Koga, R., Kikuchi, Y., Meng, X.Y., Fukatsu, T., 2010. Wolbachia as abacteriocyte-associated nutritional mutualist. Proc. Natl. Acad. Sci. USA 107,769–774.

Keiser, P.B., Coulibaly, Y., Kubofcik, J., Diallo, A.A., Klion, A.D., Traore, S.F., Nutman,T.B., 2008. Molecular identification of Wolbachia from the filarial nematodeMansonella perstans. Mol. Biochem. Parasitol. 160, 123–128.

Kimura, M., 1980. A simple method for estimating evolutionary rates of basesubstitutions through comparative studies of nucleotide sequences. J. Mol. Evol.16, 111–120.

Kramer, L.H., Passeri, B., Corona, S., Simoncini, L., Casiraghi, M., 2003.Immunohistochemical/immunogold detection and distribution of theendosymbiont Wolbachia of Dirofilaria immitis and Brugia pahangi using apolyclonal antiserum raised against WSP (Wolbachia surface protein). Parasitol.Res. 89, 381–386.

Laaksonen, S., Saari, S., Nikander, S., Oksanen, A., Bain, O., 2010. Lymphatic dwellingfilarioid nematodes in reindeer Rangifer tarandus tarandus, (cervidae) in Finland,identified as Rumenfilaria andersoni Lankester & Snider, 1982 (nematoda:Onchocercidae: Splendidofilariinae). Parasite 17, 23–31.



http://dx.doi.org/10.1242/bio.2012737


Landmann, F., Foster, J.M., Slatko, B., Sullivan, W., 2010. Asymmetric Wolbachiasegregation during early Brugia malayi embryogenesis determines itsdistribution in adult host tissues. PLoS. Negl. Trop. Dis. 4, e758.

Landmann, F., Bain, O., Martin, C., Uni, S., Taylor, M.J., Sullivan, W., 2012. Bothasymmetric mitotic segregation and cell-to-cell invasion are required for stablegermline transmission of Wolbachia in filarial nematodes. Biology. http://dx.doi.org/10.1242/bio.2012737.

Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam,H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J.,Higgins, D.G., 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23,2947–2948.

Lo, N., Casiraghi, M., Salati, E., Bazzocchi, C., Bandi, C., 2002. How many Wolbachiasupergroups exist? Mol. Biol. Evol. 19, 341–346.

Lo, N., Paraskevopoulos, C., Bourtzis, K., O’Neill, S.L., Werren, J.H., Bordenstein, S.R.,Bandi, C., 2007. Taxonomic status of the intracellular bacterium Wolbachiapipientis. Int. J. Syst. Evol. Microbiol. 57, 654–657.

Martin, D., Rybicki, E., 2000. RDP: detection of recombination amongst alignedsequences. Bioinformatics 16, 562–563.

Martin, D.P., Lemey, P., Lott, M., Moulton, V., Posada, D., Lefeuvre, P., 2010. RDP3: aflexible and fast computer program for analyzing recombination. Bioinformatics26, 2462–2463.

McNulty, S., Foster, J., Mitreva, M., Dunning Hotopp, J., Martin, J., Fischer, K., Wu, B.,Davis, P., Kumar, S., Brattig, N., Slatko, B., Weil, G., Fischer, P., 2010.Endosymbiont DNA in endobacteria-free filarial nematodes indicates ancienthorizontal genetic transfer. PLoS One 5, e11029.

McNulty, S.N., Fischer, K., Mehus, J.O., Vaughan, J.A., Tkach, V.V., Weil, G.J., Fischer,P.U., 2012. Absence of Wolbachia endobacteria in Chandlerella quiscali, an avianfilarial parasite. J. Parasitol. 98, 382–387.

O’Neill, S.L., Giordano, R., Colbert, A.M., Karr, T.L., Robertson, H.M., 1992. 16SrRNA phylogenetic analysis of the bacterial endosymbionts associated withcytoplasmic incompatibility in insects. Proc. Natl. Acad. Sci. USA 89, 2699–2702.

Posada, D., 2008. JModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25,1253–1256.

Posada, D., Crandall, K.A., 2001. Evaluation of methods for detecting recombinationfrom DNA sequences: computer simulations. Proc. Natl. Acad. Sci. USA 98,13757–13762.

Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inferenceunder mixed models. Bioinformatics 19, 1572–1574.

Ros, V.I., Fleming, V.M., Feil, E.J., Breeuwer, J.A., 2009. How diverse is the genusWolbachia? Multiple-gene sequencing reveals a putatively new Wolbachiasupergroup recovered from spider mites (Acari: Tetranychidae). Appl. Environ.Microbiol. 75, 1036–1043.

Shoemaker, D.D., Machado, C.A., Molbo, D., Werren, J.H., Windsor, D.M., Herre, E.A.,2002. The distribution of Wolbachia in fig wasps: correlations with hostphylogeny, ecology and population structure. Proc. R. Soc. 269, 2257–2267.

Sironi, M., Bandi, C., Sacchi, L., Di Sacco, B., Damiani, G., Genchi, C., 1995. Molecularevidence for a close relative of the arthropod endosymbiont Wolbachia in afilarial worm. Mol. Biochem. Parasitol. 74, 223–227.

Smith, J.M., 1992. Analyzing the mosaic structure of genes. J. Mol. Evol. 34, 126–129.Strübing, U., Lucius, R., Hoerauf, A., Pfarr, K.M., 2010. Mitochondrial genes for heme-

dependent respiratory chain complexes are up-regulated after depletion ofWolbachia from filarial nematodes. Int. J. Parasitol. 40, 1193–1202.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:molecular evolutionary genetics analysis using maximum likelihood,evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28,2731–2739.

Urwin, R., Maiden, M.C., 2003. Multi-locus sequence typing: a tool for globalepidemiology. Trends Microbiol. 11, 479–487.

Vavre, F., Fleury, F., Lepetit, D., Fouillet, P., Bouletreau, M., 1999. Phylogeneticevidence for horizontal transmission of Wolbachia in host–parasitoidassociations. Mol. Biol. Evol. 16, 1711–1723.

Werren, J.H., Windsor, D.M., 2000. Wolbachia infection frequencies in insects:evidence of a global equilibrium? Proc. R. Soc. 267, 1277–1285.

Werren, J.H., Zhang, W., Guo, L.R., 1995. Evolution and phylogeny of Wolbachia:reproductive parasites of arthropods. Proc. R. Soc. 261, 55–63.

http://dx.doi.org/10.1242/bio.2012737

international journal for parasitology - um...

Documents