icar networking project on “application of microorganisms

Indian Council of Agricultural ResearchNATIONAL BUREAU OF AGRICULTURALLY

IMPORTANT MICROORGANISMS

Understanding and conserving our national heritage of agriculturally impor tant microorganisms

je°^erÙe ke=âef<e GheÙeesieer met#cepeerJe yÙetjesYeejleerÙe ke=âef<e DevegmebOeeve heefj<eo

Annual Report 2010-11Jeeef<e&keâ ØeefleJesove 2010-11

Nodal Centre of AMAAS

ICAR Networking Project on “Application of Microorganisms inAgriculture and Allied Sectors”

Published by

Dilip K. AroraNational Coordinator AMAAS and Director, NBAIM, Mau

Compiled & Edited by

Alok K. SrivastavaSenior Scientist, NBAIM, MauSudheer KumarSenior Scientist, NBAIM, MauD. P. SinghSenior Scientist, NBAIM, MauMahesh S. YandigeriSenior Scientist, NBAIM, MauRenuSenior Scientist, NBAIM, Mau

Secretarial Assistance

Rakesh KumarManish Kumar JainAnchal Kumar Srivastava

Copyright © All rights reserved. No part of this report shall be reproduced or transmitted in any form by

print, microfilm or any other means without written permission of the Director, NBAIM

Contents

Diversity analysis of Bacillus and Bacillus-derived genera in the Indo-Gangetic plains of India

Development of diagnostic kit (PCR based) for the identification of soil microbe (Bacillus and Pseudomonas)

Diversity analysis of microbes in extreme conditions

Diversity of actinomycetes from Indo-gangetic plain

Mapping, assessment of the geographical distribution and in vitro conservation of agriculturally important microorganisms for the Western Ghats of India

Diversity of agriculturally important microorganisms in the Western Ghats of Kerala

Isolation, purification, identification and molecular assessment of microbial diversity from selected districts of Indo – Gangetic Plain

Agriculturally important microorganisms from soils of rice-based cropping system from agro-ecological zones of east coast of India

Microbial diversity analysis from different brackishwater system of East Coast of India

Isolation of microorganisms from fermented dairy foods and sequencing of 16S rDNA for strain identification.

Strengthening, authentication and exploitation of mushroom biodiversity at the National Mushroom Repository for Human welfare

Exploring bacterial diversity in Kutch eco-region of gujarat for agricultural and industrial applications

Isolation and characterization of Flavobacterium species from fish and aquatic environment

Exploration and screening of rainfed ecosystem microbial diversity

Diversity of diazotrophic bacteria in arid zone soil under extreme environments

PI : Dilip K. AroraNational Bureau of Agriculturally Important Microorganisms, Mau


PI : Dilip K. AroraCo-PI :National Bureau of Agriculturally Important Microorganisms, Mau

Alok K. Srivastava, Sudheer Kumar, Mahesh Yandigeri

PI : Dilip K. AroraCo-PI : Mahesh YandigeriNational Bureau of Agriculturally Important Microorganisms, Mau

PI : Dr. A. R. AlagawadiCo-PI : P. U. Krishnaraj, K. S. Jagadeesh, R. Vasudeva Department of Agricultural Microbiology, UAS, Dharwad

PI : D. GirijaCo-PI : Sally K. Mathew, K. Surendra GopalKerala Agricultural University, Kerala

PI : L. C. RaiDepartment of Botany, Banaras Hindu University, Varanasi

PI : T. K. AdhyaCo-PI : T. K. DangarCentral Rice Research Institute, Cuttack

PI : T. C. SantiagoCo-PIs : N. Kalaimani, S. V. AlavandiCentral Institute of Brackishwater Aquaculture, Chennai

PI : Dinesh KumarNational Bureau of Animal Genetic Resources, Near GT Road, Karnal-132001

PI : R. C. UpadhyayNational Research Centre for Mushroom, Solan, H. P.

PI : K. K. PalCo PIs : R. DeyDirectorate of Groundnut Research, Junagadh, Gujarat

PI : Gaurav RathoreNational Bureau of Fish Genetic Resources, Lucknow

PI : Kiran SinghMaulana Azad National Institute of Technology, Bhopal

PI : Rajesh GeraCo PI : Kamlesh Kukreja Department of Microbiology, CCSHAU, Hisar, Haryana

Preface

Executive Summary

AMAAS : Themes

1.

2.

3.

Project wise Significant Achievements for the Year 2010-11

Theme : Microbial Diversity and Identification

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

1

2

4

7

7

8

8

11

12

13

14

16

17

18

20

21

22

23

Biodiversity, characterization and conservation of cyanobacteria of Indo-Burma Biodiversity hotspots (NE Zone of India) for harnessing of value added products

Exploitation of plant growth promoting rhizobacteria for sustainable agriculture

Exploration and screening of fungal diversity in North-East India and their applications in agriculture

Exploration of plant pathogenic and antagonistic microbial resources associated with vegetable and spice crops of Andaman and Nicobar Islands

Mapping, assessment of geographical distribution and in vitro conservation of agriculturally important microorganisms of the Western Ghats

Isolation and characterization of microorganisms from fresh water ecosystems

Diversity analysis of diazotrophic bacteria from wheat cropping system of different agroclimatic zones of Punjab

Microbial diversity and identification: fish microbes

Diversity, genetic improvement and cultivation of the medicinal mushroom Reishi (Ganoderma lucidum)

Diversity of lactic acid bacteria in fermented food and dairy products from food and dairy units located in Southern Rajasthan

Development of a library of putative probionts from freshwater environment belonging to the group lactic acid bacteria for application in freshwater aquaculture system

PI : O. N. TiwariCo PI : Sunil S. ThoratInstitute of Bioresources and Sustainable Development, Imphal, Manipur

PI : Ashok KumarCo PIs : M. B. Tyagi, R. P. SinhaSchool of Biotechnology, Banaras Hindu University, Varanasi

PI : Bhim Pratap SinghDepartment of Biotechnology, Mizoram University, Aizawl, Mizoram

PI : Krishna KumarCentral Agricultural Research Institute, Port Blair, Andaman & Nicobar Islands

PI : D. RadhakrishnaCo-PI : B. C. MalleshaUniversity of Agricultural Sciences, GKVK, Bangalore

PI : N. K. MaitiCo-PI : Sri Prakash MohantyCentral Institute of Freshwater Aquaculture, Bhubaneswar, Orissa

PI : S. K. GosalCo-PIs : G. S. Saroa, Yogesh VikalPunjab Agricultural University, Ludhiana, Punjab

PI : Imelda JosephCentral Marine Fisheries Research Institute, Ernakulam, Cochin, Kerala

PI : R.D. RaiCo-PI : Ranjeet Ranjan KumarDivision of Biochemistry, Indian Agricultural Research Institute, New Delhi

PI : R. SrinivasanCo PIs : P. Subramanian, N. S. RathoreCollege of Dairy and Food Science Technology, Maharana Pratap University of Agriculture and Technology, Udaipur, Rajasthan

PI : Sri Prakash MohantyCo PI : N. K. MaitiCentral Institute of Freshwater Aquaculture, Bhubaneswar, Orissa

Exploration and screening of bacteria diversity in North-East India and its potential application in biocontrol

Collection, identification and characterization of microbial diversity of North Bengal

PI : Ratul SaikiaCo PI : T. C. BoraBiotechnology Division, North East Institute of Science & Technology (CSIR), Jorhat, Assam

PI : B. N. ChakrabortyCo PI : U. ChakrabortyUniversity of North Bengal, Darjeeling, West Bengal

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

25

25

27

29

30

31

32

33

34

35

36

38

38

39

Exploration, collection and characterization of some agriculturally important biocontrol agents suitable for disease management

Evaluation of endophytic fungus for growth promotion and biocontrol

PI : Dilip K. AroraCo-PIs : Alok K. Srivastava, Sudheer KumarNational Bureau of Agriculturally Important Microorganisms, Mau

PI : Alok K. Srivastava Co-PI : Sudheer KumarNational Bureau of Agriculturally Important Microorganisms, Mau

Theme :Nutrient Management, Biocontrol and PGPR

33.

34.

35.

41

42

43

Exploration and screening of microbial diversity of Bihar and their potential application

PI : V. K. ShahiCo PIs : Dayaram, Subodh K. SinhaRajendra Agricultural University, Samastipur, Bihar

Biocontrol of soil borne plant pathogen and growth promotion in vegetable crops

PI : Sudheer KumarCo PI : Alok K. SrivastavaNational Bureau of Agriculturally Important Microorganisms, Mau

Development of a cold tolerant phosphate solubilizing cacterial (PSB) inoculant

Development and application of PGPR formulations for growth Improvement and disease suppression in coconut and cocoa

Microbial control of insect pests

Developing PGPR consortia for enhanced crop and soil productivity of rice -wheat cropping system

Structural and functional dynamics of the microbial isolates in biogeochemical cycling of C, N, P and S in rice ecosystem

Nutrient dynamics and carbon sequestration in plant mycorrhizal systems

Harnessing agriculturally beneficial microorganisms for production and protection of sorghum and rice

Important diseases and pests of sunflower, safflower and castor

Isolation, identification, evaluation and exploitation of microorganisms for management of important plant pathogens and having PGPR potential for vegetable crops

Bioprospecting for viticulturally important microorganisms

Isolation and development of plant growth promoting organisms from high biodiversity region for tropical tuber crops

Development of a library putative probionts from marine environment belonging to the genus Pseudomonas,

Micrococcus and Bacillus for application in mariculture systems

Plant growth promoting rhizobacteria (PGPR) for chickpea and pigeonpea

Microbial phosphorus transformations in inland open waters

PI : Pankaj K. MishraCo PI : K. JeevanandanVivekananda Parvatiya Krishi Anusandhan Sansthan, Almora

PI : M. AnandarajCo PI : R. Dinesh, A. Kumar, N. K. Leela Indian Institute of Spices Research, Calicut, Kerala

PI : George V. ThomasCo PIs : Alka Gupta, Murali Gopal, R. Chandra MohananCentral Plantation Crops Research Institute, Kudlu P.O., Kasaragod, Kerala

PI : B. RamanujamCo PI : S. Sriram National Bureau of Agriculturally Important Insects, Bangalore

PI : LataCo PI : Radha PrasannaIndian Agricultural Research Institute, New Delhi

PI : T. K. AdhyaCo PI : P. BhattacharyyaCentral Rice Research Institute, Cuttack

PI : K. S. SubramanianCo PI : M. ThangarajuTamil Nadu Agricultural University, Coimbatore

PI : S. GopalakrishnanCo PI : G. V. Ranga RaoInternational Crops Research Institute for Semi-Arid Tropics, Patancheru, A. P.

PI : R. D. Prasad Co PIs : M. A. Raoof, M. Santha Lakshmi Prasad, P. S. Vimala Devi Directorate of Oilseeds Research, Rajendranagar, Hyderabad

PI : M. LoganathanCo PIs : S. Saha, A. B. RaiIndian Institute of Vegetable Research, Varanasi

PI : Indu S. Sawant Co PI : S. D. SawantNational Research Centre for Grapes, Pune

PI : M. L. JeevaCo PI : Susan John K., R. S. Misra, S. S. VeenaCentral Tuber Crops Research Institute, Sreekariyam, Thiruvananthapuram

PI : K. K. VijayanCo PIs : Subhadeep Ghosh, Kajal ChakrabortyCentral Marine Fisheries Research Institute, Cochin, Kerala

PI : Mohan SinghCo PI : R. G. ChaudharyIndian Institute of Pulses Research, Kanpur

PI : Sanjib Kumar MannaCo PIs : Srikanta Samanta Central Inland Fisheries Research Institute (ICAR), Barrackpore, Kolkata

Application of AIMs for nutrient management & plant growth promotion in rainfed agro-ecosystems

PI : Suseelendra Desai Co PI : Minakshi GroverCentral Research Institute for Dryland Agriculture, Hyderabad

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

53.

44

45

46

47

49

50

52

53

55

56

57

58

59

60

62

63

64

65

Isolation, identification, evaluation and exploitation of PGPR for spices

Improving yields and nutrient uptake of selected crops through microbial inoculants in vertisols of Central India

PI : D. L. N. RaoCo PI : M. C. MannaIndian Institute of Soil Science, Nabi Bagh, Bhopal

Basic and applied investigations on endophytic microorganisms in horticultural crops

PI : P. ThomasCo PI : M. Krishna ReddyIndian Institute of Horticultural Research, Bangalore

Harnessing arbuscular mycorrrhizae for biofertilization in horticultural crops

PI : George V. ThomasCo PIs : Alka Gupta, Murali Gopal, R. ChandraMohanan, Alok K. Srivastva, S. K. Singh, V. B.

Patel, Anil K. Sharma, Sukhada Mohandas, V. V. Sulladmat, P. Panneerselvam, R. Thangavelu, K. K. Kumar, Rajesh Kumar

Central Plantation Crops Research Institute, Kasaragod, Kerala

Assessing structural and functional shifts in soil microbial communities of paper mill effluent contaminated soils and utilization of microflora for crop growth promotion in these soil

Bioremediation of polycyclic aromatic hydrocarbons (PAH) through microbial consortia

Genotyping and isolation of sphingomonads from HCH contaminated agricultural soils and theirapplication in bioremediation

Refinement in indoor compost technology for white button mushroom using thermophilic organisms

Optimization of parameters for utilization of paddy straw, kinnow pulp and pea pods for production of cellulases, ethanol and feed supplements

Bioremediation of commonly used pesticides in tropical rice ecosystem

Development of bacterial consortia for bio-processing agricultural wastes and bioremediation of aquaculture effluents

Microbial bioremediation of wastewater for heavy metals

Bioremediation of effluents from shrimp farms

Assessment of nisin production in selected strains of LAB and market acceptability

Fermented products from fruits, vegetables and Cereals

Utilization of fruit processing waste for obtaining value added products through fermentation

PI : Dilip K. AroraCo PI : K.K. MeenaNational Bureau of Agriculturally Important Microorganisms, Mau

PI : LataCo PI : Anju Arora, Shashi Bala SinghIndian Agricultural Research Institute, New Delhi

PI : Rup LalDepartment of Zoology, University of Delhi, Delhi

PI : B. VijayDirectorate of Mushroom Research, Chambaghat, Solan

PI : H. S. OberoiCo PIs : V. K. Bhargav, Pranita JaiswalCentral Institute of Post- Harvest Engineering and Technology, Ludhiana

PI : T. K. AdhyaCo PI : T. K. DangarCentral Rice Research Institute, Cuttack

PI : C. S. PurushothamanCo PIs : P. K. Pandey, A. VennilaCentral Institute of Fisheries Education, Mumbai

PI : P. K. Joshi Co-PI : L. BatraCentral Soil Salinity Research Institute, Karnal

PI : S. V. AlavandiCo PIs : T. C. Santiago, N. Kalaimani, K. K. VijayanCentral Institute of Brackishwater Aquaculture, Chennai

PI : Sudhir SinghCo PI : Major SinghIndian Institute of Vegetable Research, Varanasi

PI : S. GunasekaranCo PIs : R. Murugesan, K. Vijila, S. KarthikeyanTamil Nadu Agricultural University, Coimbatore

PI : Neelima GargCo PI : M. Muthukumar Central Institute for Subtropical Horticulture, Lucknow

Theme : Microbial Management of Agrowaste, Bioremediation, Microbes in Post Harvest and Processing

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

65.

66.

69

70

71

72

73

75

77

78

79

80

82

83

Development of microbial consortium for alleviation of salt and drought stress for growth and yield of wheat

PI : Dilip K. AroraCo- PI : Kamlesh Kumar MeenaNational Bureau of Agriculturally Important Microorganisms, Mau

Theme: Microbial Management of Abiotic Stress

67.

68.

69.

86

87

88

54. 67

Utilization of actinomycetes to alleviate salt and drought stress in cereal crops

PI : Mahesh YandigeriCo- PI : Kamlesh Kumar MeenaNational Bureau of Agriculturally Important Microorganisms, Mau

Isolation, inventorization and field assessment of agriculturally important microorganisms in the stress ecosystems of Karnataka

PI : A. R. AlagawadiCo PIs : P. U. Krishnaraj, K. S. Jagadeesh, S. G. PatilUniversity of Agricultural Sciences, Dharwad

Complete genome sequencing of Mesorhizobium ciceri Ca 181

Genomic studies of uncultivated N fixing communities from 2

Uttarakhand

Structural Genomics of Mesorhizobium ciceri Ca 181

Genome analysis of the nitrogen-fixing symbiotic bacteriam Mesorhizobium ciceri

Functional genomic analysis of plant growth promoting rhizobacteria (PGPR) fluorescent Pseudomonads

Structural Genomics of Mesorhizobium ciceri Ca181

Mining for genes involved in the production of fungicidal compounds in Anabaena strains

LPSomics : Characterization of lipolysaccharide (LPS) biosynthetic gene clusters in xanthomonad pathogens of plants

Cloning and characterization of insecticidal crystal protein (cry)

gene from the local isolates of Bacillus thuringiensis

PI : Dilip K. AroraCo- PI : Alok K. SrivastavaNational Bureau of Agriculturally Important Microorganisms, Mau

PI : Reeta GoelG. B. Pant University of Agri. and Tech., Pantnagar

PI : Major SinghIndian Institute of Vegetable Research, Varanasi

PI : K.V.BhatCo PI : A. B. Gaikwad, Rakesh SinghNBPGR, Pusa Campus, New Delhi

PI : P. GunasekharanCo PI : K. ManoharanMadurai Kamaraj University, Madurai

PI : N. K. SinghCo PI : KanikaNational Research Centre on Plant Biotechnology, New Delhi

PI : Radha PrasannaCo PI : N. K. SinghIndian Agricultural Research Institute, New Delhi

PI : Ramesh V. SontiCo PI : Hitendra Kumar PatelCentre for Cellular and Molecular Biology, Hyderabad

PI : R. AsokanCo PI : Pious ThomasIndian Institute of Horticultural Research, Bangalore

Theme: Microbial Genomics

72.

73.

74.

75.

76.

77.

78.

79.

80.

93

94

95

96

97

98

99

100

101

Microbial Genomic Resource Repository

Theme: Human Resource Development

PI : Dilip K. AroraCo PIs : Alok K. Srivastava, Sudheer Kumar, Mahesh Yandigeri, K. K. Meena

National Bureau of Agriculturally Important Microorganisms, Mau

Theme: Microbial Genomic Resource Repository

Development of microorganism consortium to alleviate abiotic stresses like drought, high temperature and salinity in millets

Development of a bacterial consortium to alleviate cold stress

PI : Minakshi GroverCo PI : S. K. YadavCentral Research Institute for Dryland Agriculture, Santoshnagar, Hyderabad


70.

71.

81.

82.

83.

90

91

103

105PI : Dilip K. AroraNational Bureau of Agriculturally Important Microorganisms, Mau

Name of the PIs working at different AMAAS Centers

Name of the Institute/ Project Directorate/ SAU Coordinating the Project

107

10884.

Of all the necessities of the human being, access to food has

remained central to every civilization. Ensuring the sufficient

production of food for all has remained one of the major

challenges before the farmers, scientists, policymakers and all the

stakeholders in the country in the twenty first century. The major

efforts during the past few decades are made in the development

of new high yielding crop varieties with enhanced disease and

pest resistance, greater drought and salt tolerance and better

nutritional value through the introduction of desirable traits

either by conventional breeding or genetic modification. These

efforts have remained focus on breeding of superior genotypes

and optimization of production technology. Even in these days of

modernization in the field of agricultural sciences, what is less

appreciated and less well understood is the pervasive influence

that other microbes have on plant health and growth in enhancing

stress tolerance, providing disease resistance, aiding nutrient

availability and uptake to the soil and promoting biodiversity. A

greater understanding of how plants and soil microbes live

together and benefit each other can therefore, provide new

strategies to improve plant productivity while helping to protect

the environment and maintain global biodiversity.

as many of them are the key players in the

improvement of the ecosystem while many are the causal agents

of serious plant diseases which further lower crop production

and food quality.

Besides

all the important services microbial communities provide, their

role has largely been ignored in the near past.

Microorganisms can play a pivotal role in solving many of

the problems of modern agriculture and can be equally beneficial

for human health, food, environment and poverty alleviation.

They are vital living components of the biodiversity on the earth

that can contribute to valued ecological services and economics of

any country

They are fundamentally important for

ecosystem functioning, nutrient recycling, breaking down

complex animal and plant residues in the soil and thus releasing

essential nutrients for plant growth. They form beneficial

mutualistic relationships with various plants, for example,

nitrogen-fixing rhizobia with leguminous plants and mycorrhiza

with forest trees. They can be harnessed for producing valuable

drugs, being used as biocontrol agents for pests and pathogens as

well as in breaking-down and detoxification of wastes. Microbes

are therefore, a key living component crucial for the ecological

harmony, ecosystem function, agricultural sustainability,

environmental wellness and human and livestock health.

This is why the task

of identification, characterization and judicious exploitation of

microbial diversity and its long-term conservation and

preservation should be the national priority for any country for

creation of sound health, wealth and societal goodness.

Microbial communities, being the most vital part of the

ecosystem function, should be managed very carefully. In nature,

microbes exist in diverse communities in the soil, air and water

1

and with and within (endosymbiotic conditions) plants. Even

with the most modern scientific approaches, we are able to

explore only <1% of the total existing microbial population on the

earth and rest is still a great challenge for us. Within this known

population, huge number of microbes are of agricultural

importance and their role beneath the soil and with the plants can

not be ignored. A first hand great task therefore, is to conserve and

make the native communities flourish in agro-ecosystem by

making the agricultural practices favourable for their growth and

proliferation which can only be done at the farmer's level who are

the major stakeholders. The conservation and management of

microbial communities in the soils is a biggest challenge before all

the stakeholders i.e. the scientists, extension workers and farmers.

This cannot be achieved without a proper well managed plan

regarding the cropping patterns, application of farm inputs and

knowledge about the native population and methods to

regenerate native microbial population. On the other hands,

scientific efforts are also required to find out and explore as much

possible microbes from the nature as can be, identify and

characterize their potentialities in agriculture and finally

conserving them for the future needs because, once lost from a

habitat, a microbe cannot again be reinstated in the natural soil.

Culture collections and genomic repositories are therefore, are

going to play a major role in conserving the most vital, tiny, often

unseen, silent but most productive living natural entities e.g. the

microbes.

“Application of Microorganisms in Agriculture and Allied

Sectors” (AMAAS) is among the most enthusiastic project of

ICAR that has initiated and strengthened the R&D efforts on

various microbe-based technologies for increasing crop

production, enhancing agrowaste usage, managing abiotic

stresses, controlling important insect pests and post harvest of

crops biologically and conserving and maintaining the real

natural wealth of the soils and other habitats i.e. the microbes.

During the past 4 years, it has also strengthened and diversified

research in the area of microbial diversity & identification,

genomics, microbial genomic repository and human resource

development in the country.

I would like to extend my sincere thanks to Dr. S. Ayyappan,

Secretary (DARE) and Director General (ICAR), Dr. S. K. Dutta,

DDG (CS) and Dr T. P Rajendran, ADG (PP) for their consistence

encouragement and valuable guidance in shaping this network

project. My sincere appreciations are also to all the Principal

Investigators and Co-investigators working at different centers

because of their outstanding efforts in making this project a big

success. The funding for this project by the Council (ICAR) is

being duly acknowledged.

Prof. Dilip K. AroraNational Coordinator AMAAS Project

Preface

AMAAS - Annual Report 2010-11

Executive Summary

Microbial communities in agriculture have very wide range

of roles to play in ecosystem management and sustainable crop

production. Their potentials can be as wide as plant health

promotion, soil nutritional balance, ecosystem function to control

of biotic and abiotic stresses increased nutrients availability and

acceleration of decomposition of organic materials and

bioremediation in order to improve crop production and

maintain sound environment for crop production. Microbial

communities also contribute in sustainable agriculture and rural

livelihood in direct or indirect manner because their presence is a

positive indicator and index of soil health and ecosystem

wellbeing. Environmental stresses such as heavy metals,

hazardous agrochemicals in the soils and water decrease

microbial diversity and therefore, contribute in structural changes

of microbial communities. In the rhizosphere, microbial

communities are reported to alleviate the salinity or drought

stress by different mechanisms and protect plants from injury,

and insect and pathogenic attack.

Majority of microbes are also associated with plants and

animals, not only as pathogens but as associative organisms as

well that mutually benefit each other. Such associations are under

strict scientific investigation in these days to get answers about

significance of the multitrophic interactions with plants and

animals and survival and performance under a given ecological

niche. The kind of interactions within the microbes and their hosts

and non-hosts and within the biotic communities and abiotic

components represent a classical ecological relationship

constitutes the basis of cooperative and constitutive livelihood in

the natures that leads to benefits in many cases but to losses in

others. The associations of microbes with the hosts and other

habitats are critical determinants for many issues related to the

quality of the ecological success, impact of environment, global

climate change, production of greenhouse gases, quality of

human, plant and animal health, and finally loss or gain in

agricultural productivity and food.

Microorganisms have great potentials to degrade and

detoxify synthetic chemicals contaminants like petroleum

products, xenobiotics including PAHs and PCBs, pesticides,

heavy metals and are therefore, utilized in bioremediation and

cleaning environmental pollution. Their ability to withstand

high-end biotic and abiotic stresses successfully as compared to

plants has made them an excellent source for various genes that

can be used to develop transgenic crop plants. The enormous

functional diversity lying with the microbes across the country

needs to be deciphered and utilized to interweave microbes in

agriculture and allied sectors. It is therefore, necessary to explore,

preserve, conserve and utilize the unique microbial flora in the

country that has fulfilled with the emergence of a centrally funded

project AMAAS for fulfilling food and nutritional needs, clean

environment and improved soil health for sustainable

production.

Microbial genomics nowadays is the backbone of every

molecular research and development programs and is an

emerging field that tends to uncover many unknown facts hidden

in the biological systems and potential applications of unseen

living majority. Great success of genome sequencing can be

witnessed from the day to day update of the knowledge on

microbial genomics that has allowed to open other avenues where

we can derive genomic information from the multitudes of

uncultivable prokaryotic species and complex microbial

populations that exist in nature. The identification of new genes

from indigenous microbes will help in development of transgenic

crops tolerant to abiotic and biotic stress.

Enormous efforts in biotechnological intervention to effect

genetic enhancement have necessitated the provision of genes,

promoters, markers, libraries in the form of DNA sequences. With

the need for provision of DNA material for molecular genetic

research, Genomic Resources Banks have valid reasons for

existence. A common repository enables researchers to access

genomic resources generated at any laboratory to facilitate

efficient use of these resources in agricultural research. The

resources in question include (i) BAC, YAC, PAC clone set from

sequencing projects; (ii) a collection of vectors contributed by

researchers; (iii) promoter DNA-fragments fused to the reporter

genes; (iv) RFLP probes for various bacteria; (v) cDNA libraries;

(vi) EST libraries; (vii) expression plasmids including binary

vectors; (viii) cloned DNA from microbes. These may also include

resources procured from external sources through mutually

agreed benefit sharing mechanisms. The Microbial Genomic

Resource Centre is created to assemble, manage as well as

generate the basic resources to meet the requirements of

anticipatory transgenic research programmes in microbes.

The major objectives of the Network project are:

· Deciphering the structural and functional diversity of

agriculturally important microorganisms and to develop

“microbial map” of the country.

· Improving nutrient use efficiency through microbial

interventions for sustainable crop production and

maintenance of soil health.

· Characterization of plant growth promoting rhizobacteria

and to develop bioconsortium for enhanced growth and

yield of important crop plants.

· Formulation of microbe or microbe-based preparations for

biocontrol of phytopathogens, insect pests and weeds.

· Development of microbe-based technologies for agrowaste

management and biodegradation for sustainable crop

production.

· Harnessing microbial activities for bioremediation of organic

and inorganic environmental pollutants.


2

· Management of abiotic stresses using microorganisms.

· Development of microbe mediated processes for product

development and value addition in agriculture.

· Diagnostic kits for the identification of important plant

pathogens, fish and animal pathogens.

· Post harvest technology for the important fish species of

India.

· Diversity of ruminanat microorganisms and their utilization.

· Unraveling microbial genomics for its utilization in

agriculture and industry.

· Collection of DNA materials from microorganisms and other

relevant organisms which result from the various molecular

research programmes.

· Acquisition of gene constructs from various sources.

· Value addition to the genomic resources.

· Characterization, validation and conservation of microbial

genomic resources.

· Production/multiplication and quality control for

distribution.

· Exchange of the genomic resources under a material transfer

agreement (MTA).

· Development of a user friendly web-based information

system for microbial genomic resources.

· Human resource development in microbe conservation and

utilization.

1. Microbial diversity and identification

2. Nutrient management, PGPR and biocontrol

3. Agrowaste management, bioremediation and microbes in

post harvest & processing

4. Microbial management of abiotic stress

5. Microbial genomics

6. Microbial Genomic Resource Repository

7. Human Resource Development

The network project has 7 components:

3

AMAAS : Themes

Theme 1: Microbial Diversity and Identification

General Objectives of the theme “Microbial Diversity and Identification”

1. Microbial diversity analysis from various ecoregions/exotic

environments.

2. Identification of microorganisms using conventional and

molecular techniques.

3. Application of some important microbes in agriculture and

allied sectors for enhancing food productivity.

Sub-Thematic Areas in the Microbial Diversity and Identification Component

1. Analysis of microbial diversity in terrestrial ecosystem.

2. Diversity in aquatic ecosystem.

3. Diversity in fermented dairy products.

4. Diagnostic kits for plant pathogens, soil microbes, fish

microbes and animal microbes.

Sub Theme I: Microbial diversity in terrestrial ecosystem

Objectives

1. Western Himalayas, cold arid-eco-region.

2. Western plain, Kachchh and part of Kathiawar peninsula, hot

arid eco-region.

3. Karnataka plateau (Rayalaseema as inclusion), hot arid with

deep loamy and clayey mixed red and black soils, low to

medium awc and lgp 60-90 days.

4. Northern plain and central highlands including Aravallis,

hot semi-arid eco-region.

5. Central highlands (Malwa), Gujrat plain and Kathiawar

peninsuala, semi-arid eco region.

6. Deccan plateau, hot semi-arid eco-region.

7. Deccan plateau (Telangana) and Eastern Ghats, hot semi-arid

eco-region.

8. Eastern Ghats and Tamilnadu uplands and Deccan

(Karnataka) plateau, hot semi-arid eco-region.

9. Northern plain, hot subhumid (dry) eco-region.

10. Central highlands (Malwa and Bundelkhand), hot subhumid

(dry) eco-region.

11. Moderately to gently sloping Chattisgarh/Mahanadi basin,

hot moist/dry subhumid transitional with deep loamy to

clayey red and yellow soils, medium awc lgp 150-180 days.

12. Eastern plateau (Chhotanagpur) and Eastern Ghats, hot

subhumid eco-region.

13. Eastern plain, hot subhumid (moist) eco-region.

14. Western Himalaya, warm subhumid (to humid with

inclusion of perhumid) eco-region.

15. Assam and Bengal plain, hot subhumid to humid (inclusion

of perhumid) eco-region.

16. Eastern Himalayas, warm perhumid eco-region.

17. North Eastern hills (Purvanchal), warm perhumid eco-

region.

18. Eastern coastal plain, hot subhumid to semi-arid eco-region.

19. Western Ghats and coastal plain, hot humid-per humid eco-

region.

20. Islands of Andaman-Nicobar and Lakshadweep, hot humid

to perhumid island eco-region.

Sub Theme II: Microbial diversity in aquatic ecosystem

Objectives

1. To study the culturable microbial diversity of aquatic

animals from different aquaculture systems.

2. To screen, characterize, identify microorganisms from

diverse aquatic environments such as sea, high altitude lakes

and other water bodies with properties such as salinity

tolerance, cold tolerance, decomposition of resistant organic

material as a source of novel genes and compounds.

3. To isolate, characterize and document microbes for

bioremediation of pesticides, heavy metal contamination

and organic load in aquatic environment.

Sub Theme III: Microbial diversity of dairy products

Objectives

1. Microbial diversity in Indian fermented dairy foods (Dahi,

Lassi, Shrikhand, Misthi, Dahi and Cheese).

2. Molecular typing of new isolates/ available NCDC cultures.

3. Screening of microorganisms for novel probiotic/functional

properties and their application.

Sub Theme IV: Diagnostic kits for plant pathogens and soil microbes

Objectives

1. To isolate, characterize, evaluate plant pathogens

(Phytophthora, Fusarium) soil microbes (Bacillus), animal

microbes and fish microbes.

2. To study the genetic diversity of microbes obtained from

different crops.

3. To develop rapid diagnostic kits for plant pathogens, soil,

animal and fish microbes.

General Objectives of the Sub Theme: Nutrient Management

1. To study the culturable microbial diversity of soils from

different agro-ecological sub-regions, production systems

and land use practices, including stressed ecosystems.

2. To characterize the isolated microorganisms for their

nutrient mobilization (N, P, Micronutrients).

3. To evaluate establishment of strains, particularly in mixed

cropping systems and select strains for multiple crops and

geographical locations.

4. To standardize methods for mass multiplication and identify

appropriate delivery systems and improve the formulations,

quality, shelf life of the above bio-agents with superior

delivery systems.

5. To carry out multi-location testing for evaluation of the

promising formulations.

6. To make multiple-repositories of isolated strains of

microorganisms.

Theme 2: Nutrient Management, PGPR, Antagonists, Biocontrol Agent and Disease Management


4

General Objectives of the Sub Theme: Plant Growth Promoting Rhizobacteria

1. To isolate, characterize, evaluate and utilize rhizobacteria

and their primary and secondary metabolites specific for

growth promotion and pathogen suppression.

2. To assess the ecological plasticity of strains particularly in

mixed cropping systems and identification of strains for

multiple crops and geographical locations.

3. To study the rhizobacteria mediated induced systemic

resistance in crop and adopting this for crop management.

4. To study the mechanism of rhizobacteria induced growth

promotion in crop plants.

5. To develop bioconsortium of geographically, phenotypically

and genotypically distinct rhizobacterial strains and

standardize methods for mass multiplication and develop

appropriate delivery systems.

General Objectives of the Sub Theme: Antagonists, Biocontrol Agent and Disease Management

1. To isolate and characterize antagonistic organisms from

diverse ago-climatic/cropping systems in India for pest and

disease management.

2. To screen potential isolates against major soil/ seed/air

borne plant pathogens, nematodes and insect pests of

important crops.

3. To identify strains with broad host range or specific to a

group of plant pathogens and insect pests and develop

improved strains by molecular interventions.

4. To study of different mechanisms like biochemical and

molecular interaction between promising antagonists

against pathogens/pests.

5. To develop formulations suitable for various delivery

systems and their evaluation against target pests.

6. To establish mass production facility for identified bioagents.

General Objectives of sub theme: Microbial Management of Agro waste

1. Isolation, identification and characterization of

microorganisms from various selected agro, industrial and

urban wastes.

2. Development of microbial consortia for rapid degradation

and effective utilization of selected waste.

3. Production of value added products like bio-fuels, enzymes

and mushroom using selected agro, urban and industrial

wastes.

4. To assess the impact of organicwaste application in

agriculture on shifts in soil microbial community structure

and function in relation to soil physiochemical properties.

General Objectives of sub theme: Bioremediation

1. Develop an understanding of the structural and functional

diversity analysis of microbial communities and their

dynamics in response to normal environmental variation

and novel anthropogenic stresses.

2. Determine the biochemical mechanisms, including

enzymatic pathways, involved in aerobic and anaerobic

degradation of pollutants.

3. Expand understanding of microbial genetics as a basis for

enhancing the capabilities of microorganisms to degrade

Theme 3: Microbial Management of Agro waste, Bioremediation, Microbes in Post Harvest and Processing

pollutants.

4. Conduct microcosm/mesocosm studies of new

bioremediation techniques to determine in a cost-effective

manner whether they are likely to work in the field, and

establish dedicated sites where long-term field research on

bioremediation technologies can be conducted.

5. Develop, test, and evaluate innovative biotechnologies, such

as biosensors, for monitoring bioremediation in situ; models

for the biological processes at work in bioremediation and

reliable, uniform methods for assessing the efficacy of

bioremediation technologies; establish a culture collection

for bioremediation purposes.

General Objectives of sub theme: Microbes in Post Harvest & Processing

1. Development of fermented products from fruits, vegetables

and cereals.

2. Value addition of pulses, millets and horticultural produces

through microbial fermentation

3. Biopreservation of vegetables for extension of shelf life and

control of spoilage in processed products.

4. Assessment of microbial contamination and safety of

agricultural produce.

General Objectives of the theme: Microbial management of abiotic stress

1. Isolation of microorganisms from rhizotic zones of cereal

crops (wheat and millets) grown under stress conditions of

salt, drought and extreme temperatures.

2. Selection of bacteria capable of growing under stress

conditions of salt, drought and extreme temperatures.

3. Evaluation of the selected organisms in the rhizosphere of

wheat and millets (phytotron studies).

4. Biochemical characterization of selected microorganisms.

5. Development of consortium of microorganisms that can

alleviate the effect of drought, salinity and extreme

temperature.

6. Field evaluation of consortium of microorganisms for

improvement of wheat, rice and millets under stress

conditions.

Sub themes in Microbial Genomics

1. Structural Genomics

2. Functional Genomics

Sub theme: Structural Genomics:

Genome analysis of the nitrogen-fixing symbiotic bacterium Mesorhizobium ciceri.

Overall Objective of structural genomics

1. Complete genome sequencing of Mesorhizobium ciceri strain

Ca181 with genome size of 8Mb.

Overall Objective of functional genomics

1. Isolation of genes and their alleles for abiotic and biotic stress

tolerance from isolates of Pseudomonas flourescens,

Arthrobacter globiformis, marine bacteria and through

metagenomes.

2. Sequence determination of the isolated genes.

3. Functional validation of selected alleles in microbes and

model plants.

Theme 4: Management of Abiotic Stress

Theme 5: Microbial Genomics

5


Theme 6: Microbial Genomic Resource Repository

Mandate of MGRR Network will be as follows:

1. To coordinate assemblage, conservation, quality control and

validation of the microbial genomic resources to facilitate

their optimal exploitation and utilization.

2. To act as a single window system for import and exchange of

microbial genomic resources and facilitate protection of

related IPR issues.

3. To conduct and promote basic, strategic, applied and

anticipatory research for development and management of

microbial genomic resources.

The major objectives of the proposed MGRR Network:

1. Collection of DNA materials from microorganisms and other

relevant organisms which result from various molecular

genetics and genomics research programmes.

2. Acquisition of gene constructs from various sources.

3. Value addition to the genomic resources.

4. Characterization, validation and conservation of microbial

genomic resources.

5. Production/multiplication and quality control for

distribution.

6. Exchange of the genomic resources under a material transfer

agreement (MTA).

7. Development of a user friendly web-based information

system for microbial genomic resources.

8. Human resource development.

Objectives:

1. To train scientists/researchers/technicians/farmers for the

exploration and application of microorganisms in

agriculture.

Theme 7: Human Resource Development


6

Project wise Significant Achievements for the Year 2010-11

Diversity analysis of Bacillus and Bacillus-derived genera in the Indo-Gangetic plains of India


Rationale

The country's most productive Indo-Gangetic Alluvial Plain,

covers one-forth (86 mha) of the total area and produces three-

forth of the total food grains, especially rice-wheat. During the last

four decades, the wheat production has no doubt increased 6

times and that of rice 2.5 times, but the present scenario suggests

declining trend in rice as well as wheat productivity. The objective

of the present investigation was to understand the

microbiological reasons for the decline in the agricultural

productivity and species richness of Bacillus in this region.

Objectives

· To isolate and characterize the soil microbes (Bacillus).

· Biochemical characterization of the isolates with respect to

the PGP traits.

· Molecular characterization including ARDRA with three

restriction enzymes.

· Sequencing of the isolates.

Significant Achievements

· A total of 245 isolates were Bacillus from the soils of Trans

(Punjab) and Central IGP (U.P) regions. These isolates were

screened for various PGP traits i.e., Indole Acetic Acid

production (IAA), phosphate solubilization and siderophore

production.

· 20.5% of the isolates from Central IGP region were found to

produce siderophores, whereas from Trans IGP region, a

total of 22.5% isolates showed siderophores production.

· IAA production without any precursors was observed for

both Central and Trans IGP regions. 74% and 52% of the

isolates from Kanpur and Saharanpur regions (Central IGP)

showed IAA production. Higher quantity of IAA ranging

from 1200µg/mg to 600 µg/mg of protein was recorded;

whereas, from Punjab region (Trans IGP) only 16% isolates

were IAA producers.

· 8% and 20% phosphate solubilizing Bacillus from

Saharanpur and Kanpur belt (Central IGP) were recorded

respectively. Punjab region showed only 6% of the isolates as

phosphate solubilizers.

· Molecular characterization of Central and Trans IGP region

isolates by using PRA analysis of 16S rRNA with three

restriction enzymes showed great diversity among the

isolates in IGP regions. On the basis of the hypothesis given

earlier (previous annual report), we predict that the large

number of the isolates are Bacillus-derived genera.

· Some of the isolates from the major cluster have been

sequenced and they have been identified as Lysinibacills

fusiformis (EU430993.1), Paucisalibacillus globulus

(EU430986.1), Brevibacillus parabrevis, Bacillus humi, Bacillus

clausii, Bacillus farraginis, Bacillus arbutinivorans, Pontibacillus

sp., Bacillus casamancensis, Bacillus oleronius (EU430987),

Bacillus circulans (EU430989).

Conclusion

In this region we have found that, though there is a great

diversity among the isolates isolates having insignificant PGP

activity dominate. This dominance is more in Trans IGP region

where the use of chemical fertilizer was more than the Central IGP

region.

RFLP analysis of 16S rDNA with AluI and Hae IIIrestriction enzymes respectively.

Development of diagnostic kit (PCR based) for the identification of soil microbe (Bacillus and Pseudomonas)


Rationale

The genus Bacillus is a large, heterogeneous group of Gram

positive, aerobic, endospore forming, rod shaped bacteria.

Several approaches based on phenotypic or genotypic characters

have been proposed to classify Bacillus sp. Further

characterization at the genotypic and phenotypic levels of

selected Bacillus species have led to the creation of several new

genera like Alicyclobacillus, Paenibacillus, Brevibacillus,

7


Theme: Microbial Diversity and IdentificationTheme: Microbial Diversity and Identification

Alignment of 16S rDNA sequences of Bacillus, Bacillusderived genera and Bacillus related genera.

Dot Blot hybridization of designed probe for the identification0of Bacillus (at 64.4 C, probe showed hybridization signal for Bacillus

16S rDNA samples and negative results with Pseudomonas andfungal samples).

Virgibacillus, Geobacillus, Filobacillus, Jeotgalibacillus,

Aneurinibacillus, Gracibacillus and Marinibacillus. There are more

than 200 species of Bacillus and it is difficult to identify the species

of Bacillus on morphological, cultural and biochemical methods.

Diagnostics based on molecular techniques could be employed to

distinguish Bacillus species and Bacillus derived genera.

Objectives

· To isolate and characterize the soil microbes (Bacillus and

Pseudomonas)

· To develop rapid diagnostic kits for identification of soil

microbes.


· Amplification of 220 bp region of 16S rDNA with nested

primer pair followed by sequencing helped in the

identification of Bacillus species and Bacillus derived genera.

· Small hypervariable region contain all the information for

delineation of the species.

· Complete 16S rDNA and 220 bp fragment were amplified

from 20 different species of Bacillus. All the sequences were

BLAST searched and identical identity of the species was

obtained from either sequencing complete or partial

sequencing.

· Another approach was also used to design the probe for

identification of genus Bacillus. An oligonucleotide probe for

identification of genus Bacillus was designed from the

internal conserved regions of 16S rDNA following alignment

of 16S rDNA sequences of Bacillus, Bacillus derived genera

and Bacillus related genera. The probe is non-radioactively

labeled and is validated for its sensitivity and specificity.

Conclusion

An oligonucleotide 50 mer probe were designed for the

identification of genus Bacillus from the internal conserved

regions of 16S rDNA following alignment of 16S rDNA sequences

of Bacillus, Bacillus derived genera and Bacillus related genera. The

probe is non-radioactively labeled and is validated with 0annealing temperature of 64.4 C, the probe showed hybridization

signal for Bacillus 16S rDNA samples and negative results with

Pseudomonas and fungal samples.

Papers published from AMAAS work

S. Vardhan, R. Kaushik, A. K. Saxena, D. K. Arora, 2010.

Restriction analysis and partial sequencing of the 16S rRNA gene

as index for rapid identification of Bacillus species. Antonie van

Leeuwenhoek. DOI 10.1007/s10482-010-9487-4.

Diversity analysis of microbes in extreme conditions

PI : Dilip K. AroraCo-PI :National Bureau of Agriculturally Important Microorganisms, Mau

Alok K. Srivastava, Sudheer Kumar, Mahesh Yandigeri

Rationale

Microbial diversity encompasses a spectrum of microscopic

organisms including bacteria, fungi, algae and protozoa. An

estimated 50 percent of all living protoplasm on Earth is

microbial. There may be 1.5 million species of fungi yet only 5%

are described; as many as one million species of bacteria may exist,

but only about 5000 have been described in the last century. A

gram of typical soil contains about billion bacteria, but only 1

percent can be successfully grown (cultured) in the laboratory.

Fewer than 5% of all microbial species have been discovered and

named – even less is known about the diversity within those

species. India is the home of billions of microbes, many of which

are found nowhere else in the world. Microorganisms represent

the richest gamut of molecular and chemical diversity in nature,

as they comprise the most diverse forms of life. Over the period of

time, they abound in all kind of habitats viz., with extreme of pH,

salinity and water stress, temperature etc. Interest in the

exploration of microbial diversity has been spurred by the fact

that microbes are essential for life since they perform numerous

functions essential for the biosphere that includes nutrient cycling

and environment detoxification. In India it is even more relevant

due to our enormous wealth of available biodiversity. Therefore

continued research is needed to describe and protect the

unexplored resources for the preservation of natural ecosystems

and future benefits of mankind.


8

Objectives

· Survey and collection of soil and water samples from

extreme climates.

· Isolation of microorganisms employing different media and

screening for high or low temperature tolerance, salt

tolerance, acidic or alkaline pH.

· To look for the production of enzymes protease, amylase,

xylanases and cellulases.

· Molecular characterization of bacteria through PCR

amplification of ribosomal genes, (16S r DNA and 16-23S

rDNA).

· DNA sequencing and identification of novel extremophilic

microorganisms.


· Aerobic, thrermophilic bacteria were isolated and

characterized from water and sediment samples collected

from, Yumthang and Yumesamdong hot spring India having

pH 6.5.

· The total number of microorganisms in the sediment and 3 −1water samples was found to be 2x10 cfu ml .

· 53 morphotypes selected, all could grow at temperature 45°C

and 11 at 65°C.

· Combined dendrogram based on ARDRA analysis revealed

the existence of 22 clusters among the isolates.

· A total of 53 thermophilic bacteria (growing at 45–65°C)

exhibiting distinct colony characteristics were isolated,

pur i f ied and subjected for fur ther molecular

characterization. PCR amplification followed by restriction

analysis of 16S rDNA gene, clustered the isolates into 22

groups. All these isolates were grouped into five different

classes: β-Proteobacteria, Firmicutes and Actinobacteria.

· Extracellular enzyme activity of all the isolates was assayed

and it was observed that out of 22 representative strains, 12

showed one or more enzyme activity (protease, amylase, ° °cellulase and xylanase) either at 45 C and (or) 65 C.

Conclusion

Yumthang and Yumesamdong hot springs are located in the

state of Sikkim, India. Amongst samples, water samples showed

higher TVC as compared to sediment samples. The isolates

possessed varies enzyme activities and displayed higher

structural and functional diversity. Thus these isolates will find

their utility in agricultural or industrial view point. Their

diversity will be a tool to identify novel isolate in the near future.


· Harmesh Sahay, Surendra Singh, Rajeev Kaushik, Anil K.

Saxena & Dilip K. Arora (2010).Characterization of

halophilic bacteria from environmental samples of Pulicat

brackish water lake, India (Accepted in Biologia).

Seminar, Symposia and Conferences attended

· Harmesh Sahay, Surendra Singh Anil K. Saxena and D.K.

Arora (2011) Diversity assessment and industrial application

of thermophilic bacteria from Manikaran Hot spring, India

Poster presentation in the symposium on "Genomics and

Biodiversity" at CCMB as part of 15th ADNAT Convention

from 23-25th February 2011.

· Harmesh Sahay, R. Kaushik, S. Singh, A. K. Saxena, D.K.

Arora (2010) Culturable Diversity of Psychrophilic Bacteria

from Gurudongmar lake, India International Conference on

Aquatic Microbiology (Status, Challenges and

Opportunities) at CAS in Marine Biology, Faculty of Marine

Sciences, Annamalai University, Parangipettai during

September 2 – 4, 2010.

Neighbor-joining tree showing the phylogenetic relationships between culturable bacterial 16S rRNA gene sequences from Yumthang and Yumesamdong hot spring and closely related sequences from the GenBank database.

Diversity of actinomycetes from Indo-gangetic plain

PI : Dilip K. AroraCo-PI : Mahesh YandigeriNational Bureau of Agriculturally Important Microorganisms, Mau

Rationale

Majority of the actinomycetes are free living, saprophytic

bacteria found widely distributed in soil, water and with plants as

colonizers. Actinomycetes can be isolated from soil, water and

plant material. In soil, they are involved in the decomposition and

mineralization cycles with the production of extracellular

enzymes such as cellulases, chitinases, and lignin peroxidases.

Many species of actinomycteres produce a wide variety of

secondary metabolites, including antihelminthic compounds,

antitumour agents and antibiotics which have been exploited in

medicine and agriculture to cure various ailments. In India,

Indogangetic plain (IGP) is considered to be most fertile ecoregion

with wheat-rice cropping system being most prevalent. However,

over the years there has been decline in fertility and productivity

in these plains. Microbes are known to influence the crop

rhizosphere by production of various metabolites and nutrients.

9


Hence, this project has been formulated to isolate, utilize and

conserve actinomycetes diversity of IGP in order to exploit the

actinomycetes for sustainable agriculture.

Objectives

· Isolation, characterization and identification of

actinomycetes from Indo-gangetic plains.

· Molecular analysis of actinomycetes diversity in

Indogangetic plains.

· Functional characterization of isolated strains using

BIOLOG microbial identification system and conventional

biochemical methods.


· A total of 238 colonies of Streptomycetes were isolated from

different regions of IGP, among which 145 isolates showing

wide variation in the colony morphology were chosen for

further studies. The population count of Streptomycetes -2 -2 -1varied from 14×10 to 32 ×10 g soil .

· Genus Streptomyces was tentatively identified by the

morphological characterization using aerial mycelial colour,

substrate mycelial colour, pigments, and spore chain

arrangements such as rectiflexibles (RF), retinaculaparti

(RA), or straight chain (Scanning Electron Microscopy).

· PGP activity of all the isolates revealed that a total of 57.2%

were ammonia producers, 8% siderophore producers and

34.4% of phosphate solubilizers. All Streptomycetes isolates

were assayed for salinity tolerance (2, 4, 6, and 8% NaCl),

antimicrobial assay (>15 mm inhibition zone) against

Macrophomina phaseolina, Rhizoctonia solani, Fusarium ciceri

and Bacillus subtilis.

· A total of 40 isolates were chosen as representatives based on

RFLP clustering at >70% similarity level. Identification was

based on percentage similarity (>97% compared NCBI) & by

BLAST homology. Further phylogenetic analysis of 40

representatives was carried out for their similarity to known

actinobacteria aligned together with the sequences available

in public databases (Genbank, NCBI).

· Among the representative isolates, N53 although showed

96% sequence similarity to S. albogriseolus and may be a new

species of Streptomycetes. Morphological as well biochemical

characterization of N53 isolate when compared with type

strain S. albogriseolus (DSM 40003), did not reveal significant

differences.

Conclusion

In conclusion, these results provided further evidence that

species diversity of actinobacteria is higher in Indo-Gangetic

Plains of India. Also, these had promising potential for plant

growth promoting attributes. The culturable Streptomycetes,

isolated from IGP regions in the India were clustered into three

groups. The isolation of culturable actinobacteria has contributed

to our knowledge of diversity and population structure of

actinoacteria from India's most fertile regions and further

increased the information of actinobacteria available for the plant

growth promoting attributes. Further isolate N53 from this study

seemed to be new species and needs to be validated by

DNA–DNA hybridization, (%) GC content as well as FAME

analysis for its identification up to species level.


· Arvind K. Yadav, Alok K. Srivastava, Mahesh S. Yandigeri,

Sudhanshu K. Kashyap, Dinesh R. Modi and Dilip K. Arora

(2010) Characterization of indigenous copper-resistant

Streptomycetes from chickpea (Cicer arietinum L.) fields,

Annals of Microbiology 60: 605-614.

· Nityanand Malviya, Arvind K. Yadav, Mahesh S. Yandigeri

and Dilip K. Arora (2010)Diversity of culturable

Streptomycetes from wheat cropping system of fertile

regions of Indo-Gangetic Plains, India. World Journal of

Microbiology and Biotechnology. DOI 10.1007/s11274-010-

0612-3.

· Arvind K. Yadav, S. Vardhan, Rakesh Kumar, Nityanand

Malviya, D.R. Modi, A.K.Srivastava, A.K. Saxena and Arora

D.K. (2010) Thermostable α-amylase: Purification,

Production and Optimization from Streptomyces spp.

Procedings of National Academy of Sciences, Section B, Volume

80, Part III.

Books

· Mahesh S. Yandigeri, Dilip K. Arora and Arvind K. Yadav

(2010) 'Synoptical Keys for Identification of Streptomyces

Genera' published by National Bureau of Agriculturally

Important Microorganisms (NBAIM), Kushmaur, Mau Nath

Bhanjan (U.P.), India (ISBN: 978-81-909892-0-6).


10

Scanning Electron Microscopy (SEM) of actinobacterial isolates isolated from IGP, India, showing variations in spore chain morphology.

NJ phylogenetic tree of full 16S rRNA sequences from selected isolates.

Book Chapters

· Mahesh Yandigeri, Sukumar Mesapogu, Arvind Yadav and

D. K. Arora (2010). Microbial Culture Banks: Custodian of

Real Natural Wealth. In: Souvenir of National Conference on

Biodiversity, Development and Poverty Alleviation on the ndoccasion of International Day for Biological Diversity (22

May 2010), H. B. Singh, R.J. Srivastava, D. P. Singh, B. K.

Sarma and R.K. Dubey (Eds.), Uttar Pradesh State

Biodiversity Board, Lucknow, pp. 34-39.


· Nityanand M., Yadav A. K., Divya S., Shrivastava P.,

Yandigeri M.S. and Arora D.K (2010). Genotypic diversity of

actinomycetes from Indogangetic plain of India. In:

International Conference on Aquatic Microbiology (Status,

Challenges and Opportunities) to be held at CAS in Marine

Biology, Faculty of Marine Sciences, Annamalai University,

Parangipettai during September 2 – 4, 2010, Book of

Abstracts, p. 117.

· Yadav A. K., Nityanand M., Divya S., Yandigeri M.S., Modi

D. R. and Arora D.K. (2010). Genotypic diversity of

actinobacteria from subglacial Himalayan psychrophillic

lake (Pangong), India. In: International Conference on

Aquatic Microbiology (Status, Challenges and

Opportunities) held at CAS in Marine Biology, Faculty of

Marine Sciences, Annamalai University, Parangipettai

during September 2 – 4, 2010, Book of Abstracts, pp.117-118.

Mapping, assessment of the geographical distribution and in vitro conservation of agriculturallyimportant microorganisms for the Western Ghats of India

PI : Dr. A. R. AlagawadiCo-PI : P. U. Krishnaraj, K. S. Jagadeesh, R. Vasudeva Department of Agricultural Microbiology, UAS, Dharwad

Rationale

Biological diversity is of fundamental importance to the

functioning of all natural and human-engineered ecosystems.

Microorganisms play central role in the ecosystem functioning,

biogeochemical cycling and biodegradation etc. Hotspots are

recognized on the basis of the presence of greatest number of

endemic species. Therefore, at the global level hotspots are the

areas of high conservation priority because if unique species are

lost they can never be replaced. The two major hotspots in the

present scenario of India's biodiversity are the Western Ghats and

the North-eastern region. The Western Ghats are known to be

tectonically active and an uplifted region. It has been reported that

approximately 17% of a set of 2500 species are likely to be

microbial in this region. The high biodiversity of this region

therefore, may be due to large nutrients the volcanism brought in,

the relatively higher thermal gradients along this belt and widely

varying elevations.

Exploration, evaluation and exploitation of microbial

diversity are essential for scientific, industrial and social

development. In India, it is even more relevant due to our

enormous wealth of available biodiversity. The vast microbial

diversity of the natural world, combined with ingenious methods

to access the diversity, can provide us with a bountiful source of

new and valuable products. Therefore, continued research is

needed to describe and protect the unexplored resources for the

preservation of natural ecosystems and the future benefit of

mankind.

Objectives

· I so la t ion , enumerat ion , charac ter iza t ion , and

inventorization of AIMs (N fixers, P-solubilizers, VAM, 2

PGPRs, fluorescent pseudomonads, chitin decomposers,

cellulose and lignin degraders) along the Western Ghats and

identification of potential isolates.

· Assessing the geographical distribution and developing

thematic maps for the above groups of organisms.

· Assessing the functional potentials of each group of

organisms for use in agriculture and the molecular diversity

of a key selected species.

· Setting up the culture bank of the potential isolates under

each group and deposit with the NBAIM.

· Setting up the Western Ghats region specific data base on the

population and diversity of AIMs.


· During April 2010 to March 2011, 54 grids (12.5 km x 12.5 km,

each grid) in the central Western Ghats were covered for

sampling with an achievement of almost 90% of the targeted

area for the year.

· A total of 375 samples including 54 composite soil samples,

177 root samples of 73 plant species, 55 leaf samples, 13 leaf

litter samples, 15 decaying wood samples, 35 mushroom

samples, and 26 termite mound samples were collected and

used for isolation of AIMs.

· The total number of isolates obtained from these samples is

1143 including 310 Azotobacter, 88 Azospirillum, 287

Beijerinckia, 188 phospahte solubilizers, 92 lignin degraders,

134 fluorescent pseudomonads and 44 pink pigmented

facultative methylotrophs (PPFM). All the isolates have been

purified and preserved for further analyses.

· Based on morphological, biochemical and physiological

characteristics of 335 fluorescent pseudomonads, 116 were

tentatively identified as Pseudomonas fluorescens, 20 as P.

cichori, 39 as P. putida and 160 as P. aeruginosa. Similarly, out

of 94 PSB isolates 40 belonged to Pseudomonas, 13 to Bacillus, 8

each to Alcaligens and Enterococcus, 6 to Acetobacter, 4 to

Gluconobacter, 3 each to Aminobacter and Rhizomonas, 2 each to

Acenitobacter and Phenylobacterium and one each to

Acetobacterium, Azomonas, Flavomonas, Flavobacterium and Xanthomonas.

· Based on the results of 16S rDNA sequencing and its

Nucleotide-nucleotide BLAST (blastn) analysis, out of 18

isolates analyzed, 4 showed closest affiliation to A.

chroococcum; 1 to A. vinelandii; 2 each to Enterobacter cloacae

and E. ludwigii, 1 each to Pseudomonas fluorescens,

Pseudomonas sp., Bacillus subtilis, Novasphingobium sp.,

Enterobacter aerogenes, Serratia sp., Pantoea agglumerans,

Acinetobacter baumanii and Kluyvera cryocrescens. All the 18

11


Grids for sampling forisolation of AIM's

Isolation of Lignin degradingfungi on Phenyl red (PR) medium

Antifungal activity of fluorescent pseudomonadisolates on different fungal pathogens

sequences were deposited to NCBI using Sequin software

and Accession numbers issued were HQ153105 to HQ153114

and JF513187 to JF513194. These AIMs have been deposited

with NBAIM.

· The amount of N fixed by 473 nitrogen fixers has been 2

quantified. While Azotobacter isolates fixed 7.72 to 29.75 mg

N, Azospirillum isolates fixed 6.86 to 13.15 mg and Beijerinckia

isolates fixed 2.9 to 11.7 mg N/g carbon source utilized.

· Out of 2632 isolates (111 Azospirillum, 1131 Azotobacter, 459

PSB and 157 fluorescent pseudomonads) tested for IAA and

GA production, 821 (76 Azospirillum, 373 Azotobacter, 162

Beijerinckia, 134 PSB and 76 fluorescent pseudomonads) were

found to produce both IAA and GA. The amounts of IAA

and GA produced by the AIMs ranged from 0.2 to 51.8 mg

and 0.5 to 318.4 μg/ L broth.

· 210 PSB isolates were examined for their ability to solubilize

TCP. They showed TCP solubilization in the range of 1.13 –

18.76%. Out of 72 fluorescent pseudomonads 21 showed TCP

solubilization which was in the range of 0.83 – 4.12%.

· The inhibitory activity of 204 fluorescent pseudomonads

against five fungal plant pathogens viz., Alternaria carthami,

Fusarium oxysporum f. sp. carthami, Sclerotium rolfsii,

Rhizoctonia bataticola and Pyricularia oryzae was also tested

under in vitro conditions. Out of 204 isolates, 46 inhibited all

the five pathogens; 34 inhibited 4 pathogens; 25 isolates

inhibited 3 pathogens; 29 isolates inhibited 2 pathogens.

· Out of 200 lignin degrading fungi tested for ligninase

isoenzyme activity, four isolates were found to produce

higher amounts of both poly phenol oxidase (PPO) and

laccase enzymes and one isolate showed higher activity for

PPO as well as Mn-peroxidase.

Conclusion

Collection of samples from the central Western ghat regions

of Karnataka gave an ample opportunity to isolate more and more

diverse group of microorganisms of agricultural importance.

Looking at the functional diversity of the isolates, some of them

were found to fix higher amounts of N , higher P-solubilization 2

activity, PGPS production, production of lignin degrading

enzymes and biocontrol activity. From this study, it can be

concluded that, isolates obtained were more and more diverse in

terms of their functions and identity which in turn reflects the

diversity of the central Western Ghat regions of Karnataka.


Alagawadi, A.R., Lande, A., Kadawadkar, S., Sunkad, S.,

Doddagoudar, C.K. and Krishnaraj, P.U. (2011), Agriculturally

important traits of fluorescent pseudomonads of Western ghats.

National symposium on “Microbial Diversity and its Applications in

Agriculture, Industry and Health” held at ICAR complex for Goa thfrom 4-5 March 2011. pp.29.

Diversity of agriculturally important microorganisms in the Western Ghats of Kerala

PI : D. GirijaCo-PI : Sally K. Mathew, K. Surendra GopalKerala Agricultural University, Kerala

Rationale

Western Ghat region is one of the hot spots of biodiversity.

Diversity has been well documented in the case of plants and

small animals. However, the microbial diversity has not been

systematically assessed. Large amount of diversity is expected in

this region because of the undisturbed nature. Tools for

identification include conventional methods like morphological,

cultural and biochemical characterization and also molecular

methods like 16S rRNA sequencing. The diversity among each

group of microorganism is assessed by advanced molecular tools

like Rep-PCR. This even helps to document the diversity within

each species. A thematic map will developed at the end of the

project, which will depict this diversity. The project will finally

help the nation to assess the diversity of agriculturally important

microorganisms and to conserve this diversity.

Objectives

· Isolation, enumeration & characterization of AIMs (N fixers, 2

P-solubilizers, fluorescent pseudomonads, Trichoderma,

chitin, cellulose & lignin degraders) in the Western Ghats of

Kerala.

· Assess geographical distribution and develop thematic maps

for AIMs.

· Assess functional potentials of each group of organism for

use in agriculture.

· Set up culture bank of potential isolates & deposit with the

NBAIM.

· Set up database on the population and diversity of AIMs in

the Western Ghats.


12


· Soil and leaf samples from 18 grids Aryankavu, Achan Kovil

and thenmala forest range of Kollam district and Nilambur

range of Malappuram district.

· A total of 35 N fixing bacteria, 85 P-solubilizers, 9 P.

fluorescens, 25 cellulose degraders, 19 lignin degraders and 9

Trichoderma and 8 P solubilising fungi were isolated.

· Twenty two endophytes, 14 phylloplane bacteria and 5

phylloplane fungi were isolated.

· P solubilisation ranged from 30µg/ml to 120µg/ml. The

maximum amount of soluble P (120 µg/ml) was in the case of

Bacillus sp. and this was also supported by pH drop in the

broth in 20 days.

· 12 P solubilising and 3 N fixing bacterial isolates produced

IAA. K2P3 produced a maximum of 62.0µg/ml, 14 P

solubilising and 3 N fixing isolates produced siderophore, 19

isolates are good ammonifiers.

· Five P solubilising isolates were found to produce cellulose,

nine isolates degrade lignin and produce clear zones, Five

isolates degrade both lignin and cellulose in in vitro.

· 5 P solubilising and 7 N fixing bacterial isolates could

produce protease

· Seven cellulose degrading bacterial isolates solubilize

inorganic phosphate in vitro.

· 17 isolates degrade lignin also. Four P. fluorescens isolate

Cellulose Degrading Bacteria P solubiliser bacteria

solubilise inorganic P and 2 isolates produce IAA.

· Endophytic and phyllosphere bacteria exhibited

antagonistic activity against plant pathogen. Ten bacterial

isolateswere efficient against Rhizoctonia solani, three isolates

against Xanthomonas campestris, and nine against Sclerotium rolfsi.

· 26 isolates identified by 16S rRNA sequencing & deposited in

NCBI.

Conclusion:

The surveyed area exhibited a great diversity of AIMs. The

bacterial isolates obtained in this region showed multibeneficial

characteristics and the bacteria producing IAA showed P

solubilisation activity also. The endophytic and phylloplane

bacterial isolates exhibited very good antagonistic activity against

plant pathogenic microbes. Isolated some very good lignin and

cellulose degrading bacterial isolates obtained could be exploited

for agro waste management. Some of the tested isolates could

exhibit more than three or four beneficial traits, which may

promote plant growth directly or indirectly and the identification

of the best isolates is in progress.


· National Symposium on Waste management: Experiences

and strategies at college of Horticulture, Kerala Agricultural

University, Thrissur from 5-7, January 2011.st· 51 Annual Conference of the Association of Microbiologist

of India at Ranchi from December 14-17, 2010.

Isolation, purification, identification and molecular assessment of microbial diversity from selecteddistricts of Indo – Gangetic Plain

PI : L. C. RaiDepartment of Botany, Banaras Hindu University, Varanasi

Rationale

Cyanobacteria are the first photoautotrophs that have been

attracting attention of the scientific community due to their

evolutionary significance and nitrogen fixing ability. The

importance of these organisms increases in areas with paddy as

the staple diet, as they are important contributors to the nitrogen

economy of the rice fields. This prokaryotic group is also known to

help in preventing soil erosion and maintaining the water holding

capacity of the soil. It is one of the least available nutrient and

becoming the major limiting factor for crop productivity,

especially in the lowland acidic and alkaline soils of India. To

overcome the phosphorus limitation farmers are overusing

chemical fertilizers but the available phosphorus (~80%) of these

fertilizers is also getting precipitated soon after application and

thereby contributing negative impacts on to soil microflora,

leading to distortion of the soil nutritional balance. As a

consequence of frequent chemical fertilizer use and weathering of

rocks, soils contain considerable amount of insoluble phosphorus,

unavailable to the plants. Phosphate solubilizing microorganisms

are the better options to increase the phosphorus availability in an

eco-friendly manner. Phosphate solubilzing bacteria (PSBs) are

not only making locked phosphorus availability but also enhance

the crop productivity and plant growth. However, both

biodiversity conservation and the taxonomy of these important

13


microbes still need to be worked out. The rationale behind this

project is to explore the cyanobacterial and PSBs diversity using

16S RNA gene as a molecular marker and to conserve them. The

paddy fields of Indo-Gangetic plain spanning Eastern UP and

Western Bihar are being targeted for sample collection,

cyanobacterial diversity assessment and soil analysis.

Objective

· Survey and collection of soil and cyanobacterial samples

from selected districts of Indo-Gangetic plain like Chandauli,

Mirzapur, Varanasi, Allahabad, Ghazipur, Ballia, Arrah, and

Patna over different time frames and study of selected

physicochemical properties of these soil samples.

· Isolation, purification, and molecular characterization of

nitrogen fixing cyanobacteria and phosphate solubilizing

bacteria from the collected samples.

· Assessment of biodiversity of N -fixing cyanobacteria and 2

phosphate solubilizing bacteria from different soil types

using molecular techniques.

· Deposition of characterized/ identified organisms to

NBAIM.


· A total of ten nitrogen fixing cyanobacteria have been

isolated, purified and identified as Nostoc sp. LCRNK6,

Nostoc sp. LCRNK9, Calothrix sp. LCRNK10, Nostoc sp.

LCRNK11, Calothrix sp. LCRNK12, Calothrix sp. LCRNK13,

Tolypothrix sp. LCRNK14, Tolypothrix sp. LCRNK15, Nostoc

sp. LCRNK16 and Nostoc sp. LCRNK17. Their partial 16S

rDNA sequences have been deposited in the GenBank

database.

16S rRNA gene profiling of the amplified metagenome on denaturing gradient polyacrylamide gel.

· A total of twenty five phosphate solubilizing bacteria were

isolated, purified and characterized from different soils

samples. All these isolates were identified by 16S rRNA gene

sequence comparison and their sequences were submitted in

the GenBank database. Further all isolates were

characterized for quantitative phosphate solubilization on

NBRIP medium at 30°C and initial pH 7.0. The quantitative

estimation of phosphate solubilization showed that Pantoea

sp. has the highest capacity of phosphate solubilization.

· Culture independent analysis of phosphate solubilzing

bacterial biodiversity was initiated using denaturing

gradient gel electrophoresis. The total metagenome

extracted from the six soil samples was purified and

amplified using GC clamped 16S rRNA gene primers. The

amplified metagenome profiling was carried out on 40-60%

denaturing concentration of polyacrylamide gel. The bands

showing difference in mobility were marked with arrows

and excised for further amplification and then sequencing.

· Excised DGGE bands were reamplified purified and are

under process of sequencing.

· Culture independent cynabacterial diversity was also

assessed using DGGE and 40 bands were excised,

reamplified and sequenced. Their sequences have been

submitted in the GenBank database.

Conclusion

Results obtained from this study suggest that Nostoc was the

dominant cyanobacterium in the studied paddy fields whereas

Enterobacter and Acinetobacter sp. were dominant phosphate

solubilizers in the paddy fields. Further from the intensity of

DGGE bands it is evident that only selected bacteria play major

role in phosphate solubilization.


· Kumar, A., Bhargava, P. and Rai, L. C. (2010) Isolation and

molecular characterization of phosphate solubilizing

Enterobacter and Exiguobacterium species from paddy fields of

Eastern Uttar Pradesh, India. African Journal of Microbiology

Research 4, 820-829.


· International Symposium on Phycol. Res., Botany, Banaras

Hindu University, Varanasi, 25-27 Feb, 2010.

· International Symposium on Soil Metagenomics,

Braunschwing, Germany, 8-10th Dec, 2010.

· International Symposium on Recent Advances in Cross-

disciplinary Microbiology: Avenues and Challenges, Dept.

of Biotechnology, BIT, Mesra, Ranchi, 14-17 Dec, 2010.

Agriculturally important microorganisms from soils of rice-based cropping system from agro-ecological zonesof east coast of India

PI : T. K. AdhyaCo-PI : T. K. DangarCentral Rice Research Institute, Cuttack

Rationale

Studying microbial community structures in soil systems is

virtually very difficult. Several cultivation studies to characterize

bacterial inhabitants of rice paddy soils have been performed.

However, it is not clear how successful such studies have been in

characterizing bacterial communities. It has been estimated that

the portion of microbial diversity that has been obtained in pure

culture by conventional plating methods, amounts to only 0.1 to

1% of the total diversity. Similarly, attempts to cultivate the


14

bacteria in soils typically yield culturable cell numbers that are

less than 5% (usually less than 1%) of the total microscopically

countable cell numbers. It is easier to deal with enrichment

cultures selected for fast-growing bacteria with high growth

yields and also for the bacteria that are best adapted to the growth

medium used for cultivation. Unfortunately, this presents a

skewed picture of the microbial diversity as that from the

naturally existing. Such inadequacies have favored the use of

cultivation-independent molecular approaches to investigate the

microbial diversity in natural ecosystems. Efforts have been made

to combine both molecular and cultivation techniques to

investigate the numerically dominant members of the bacterial

community in anoxic rice soils. Thus, while use of different

analytical techniques is still in the initial evaluation and

assessment stage for defining the microbial diversity of flooded

rice soils, it is becoming increasingly clear that a combinational

approach using traditional cultivation techniques, biochemical

approaches and molecular applications will help in unraveling

the complexity of microbial dynamics and succession of flooded

rice soils.

Objectives

· I so la t ion , character izat ion , ident i f i ca t ion and

inventorization of agriculturally important microorganisms

in pure culture from soils of different agro-ecological zones

of east coast of India.

· Explore and quantify the microbial diversity in soils and crop

rhizosphere in rice-based cropping system by cultivation-

based, proteogram and total DNA finger-printing analyses.

· Phylotyping of the isolated microbial species and

investigation on the molecular diversity through soil

(metagenomic) DNA analysis.

· Study the structural dynamicity of the microbial community

in the rice ecosystem by analysis of diversity indices.

· Characterization of functional diversity with reference to

growth promoting hormone and toxin production.


· Seven hundred thirty three bacteria were isolated from ten

soil samples of Arunpur, Chilika, Haripur, Humma,

Indrakhi (Orissa), Kalipatnam, K.P. Palem, Gondhi,

Shankaraguptam and Undi (Andhra Pradesh) using

different media.

· Out of which, 186 isolates produced IAA, 41 isolates

solubilized P and 70 isolates utilizing ACC as a sole source of

nitrogen.

· IAA production capability of isolates ranged between 18.71--1362.96 µM ml . The isolates from Indrakhi produced more

-1IAA i.e. 67.09-362.96 µM ml .

· The range of ACC deaminase activity was 76.80-1903.94 nM -1 -1α-ketobutyrate mg h . Higher ACC deaminase producing

bacteria was isolated from the Arunpur rice field soil.-1· Forty-two isolates which produce >50 µM ml IAA and 34

ACC deaminase were tested for ammonia, siderophore and

HCN production, P-solubilization and N fixation. 2

Siderophore, ammonia and HCN were produced by 28, 24

and 22 strains, respectively; 22 isolates solubilized P and 31

isolates fixed nitrogen.

· Ten isolates having multiple PGPR activities like IAA

production, ACC deaminase activity, siderophore and HCN

production were selected for further study. The isolates

tolerated 7-12% NaCl, growth temperature was 25-35°C and

pH5-7. Biochemically the organisms were highly variable.

· Ten isolates having both IAA and ACC deaminase activity

were selected for root elongation assay. Root lengths of

treated rice seedlings are 30–120% more than that of the

untreated seedlings. Chlorophyll a and b contents of the

treated seedlings also increased significantly over the

untreated seedlings.

· Three strains AR-ACC3, ANR-ACC2 and ANR-ACC3

having most promising effect in root elongation assay were

identified based on 16S rDNA sequencing for identification

and phylogeny as AR-ACC2 was most similar to

Microbacterium sp. K6-01; EF612295 and ANR-ACC2 was

most similar to Agromyces sp. 28-4; EU363710.

· Fifty-eight Bt isolates were bioassayed along with two

formulations against rice leaf folder (Cnaphalocrocis

medinalis) in the field during rabi and kharif seasons. Eight 6indigenous isolates were effective having LC 3.162 x 10 - 50

9 1.259 x 10 spore-crystals/ml. Three isolates were more 6 7 effective (LC about 3x10 - 5x10 spore-crystals/ml) than the 50

8 9 formulations (LC about3x10 - 10 spore-crystals/ml).50

· The 16S rRNA sequence identified most of the isolates as Bacillus thuringiensis.

· Sixteen Bt isolates showed intrinsic salt tolerant and grew in

presence of up to 18% NaCl. SOD, catalase, proline and

amino acids imparted intrinsic osmotic and anoxic stress

tolerance to the organisms.

· The cry and cyt genes of 16 Bt isolates were amplified with

different primers viz. cjl1/cjl2, cj4/cj5, v(-)/v(+), gral-

Growth enhancement oftreated seedlings.

Vigour of treated seedlings Enhanced root growth oftreated seedlings.

15


nem(d)/gral-nem(r), gral-cyt(d)/gral-cyt(r), cry1AC1/cry1AC2,

cry3Aa1/cry3Aa2 and cry10Aa1/cry 10 Aa2.

· The cjl 1/cjl 2 primed amplicon sizes of TB 163, 263, 264, 266,

267 and 271 were 0.263, 0.368, 0.395, 0.474, 0.526 and 0.684 bp,

respectively. The cj4/cj5 primed amplicons were 0.039 and

0.020 bp of the TB 262 and 270, respectively. The TB 262, 263,

265, 266, 270 isolates possessed the v(-)/v(+) primed

sequences of 2.00, 2.00, 1.972, 1.945, 1.918 bp sizes,

respectively.

· The TB 261 genome had the gral-nem (d)/gral-nem(r) primed

location which produced 0.976 bp amplicons.

· The isolates TB 163, 261, 265, 268, 269, 270 and 272 possessed

the gral-cyt (d)/d gral-cyt (r) recognized dna which produced

the amplicons of 1.108, 1.108, 1.305, 1.043, 1.239, 1.217 and

1.418 bp, respectively.

· The genome of the isolates TB 160, 261, 262, 263, 264, 265, 266

and 270 could be amplified by cry1AC1/cry1AC2 primers.

· The isolates cry3Aa1/cry3Aa2 and cry10Aa1/cry 10 Aa2

primers produced different sizes of amplicons.

Conclusion:

Ten isolates isolated from Orrisa having both IAA and ACC

deaminase activity were selected for root elongation assay. Root

lengths of treated rice seedlings are 30–120% more than that of the

untreated seedlings. Chlorophyll a and b contents of the treated

seedlings also increased significantly over the untreated

seedlings. The 16S rRNA sequence identified most of the isolates

as Bacillus thuringiensis. The isolates cry3Aa1/cry3Aa2 and

cry10Aa1/cry 10 Aa2 primers produced different sizes of

amplicons.


· Dangar T.K., Babu Y.K., Das J. (2010). Population dynamics

of soil microbes and diversity of Bacillus thuringiensis in

agricultural and botanic garden soils of India. African Journal

of Biotechnology 9, 496-501.


· Dangar TK, Das J and Adhya TK (2009). Diversity of Bacillus

thuringiensis in coastal saline rice soils. 7th Pacific Rim

conference on the biotechnology of Bacillus thuringiensis and

its environmental impact. 25-29 November 2009, NASC

complex, New Delhi, India. Abstract no. SI2710, p.12.

· Das J, Dangar TK and Adhya TK (2009). Functional diversity

and virulence of indigenous Bt against the rice leaf folder,

Cnaphalocrocis medinalis. National Conference on

Biodiversity Conservation and Management of thBioresources. 28-29 October, Department of Zoology,

Andhra University, Visakhapatnam, p.125, Abstract no. 92.

· Das J, Dangar TK and Adhya TK (2009). Evaluation for the cry

and cyt genes of Bacillus thuringiensis effective against the rice

pests. National Conference on Pest Biodiversity in Rice and

their Management under changed climate. 15-16 December

2009, CRRI, Cuttack, Orissa, India. Abs no. 18.

· Das J, Dangar TK. and Adhya TK (2009). Diversity and

distribution of cry/cyt genes of indigenous Bacillus ththuringiensis. 50 Annual Conference. Association of

microbiologists of India. 15-18 December 2009, NCL, Pune. p.

27, Abstract no. GM-182.

· Bal, H.B. and Adhya, T.K. (2009) Growth hormone

producing rhizobacteria from flooded rice fields of Orissa. In thProceedings 50 Annual Conference, Association of

Microbiologists of India, National Chemical Laboratory,

Pune, India.

Microbial diversity analysis from different brackishwater system of East Coast of India

PI : T. C. SantiagoCo-PIs : N. Kalaimani, S. V. AlavandiCentral Institute of Brackishwater Aquaculture, Chennai

Rationale

Brackishwater ecosystem is one of the ecosystems which

abound in microbial diversity. It harbors a diverse microbial

world, having diverse biological properties of its own. No

systematic approach has been made so far to collect and identify

the genetic diversity of these organisms from this milieu. This

project aims at addressing this issue by collecting the microbes

from different brackishwater ecosystems such as mangroves,

estuaries, salt pans, aquaculture environment and sundarban

areas of the country. This project will help in generating data on

the genetic molecular properties of these microbes and

identifying their biodiversity. This project will also help to

identify microbes with novel properties for example

bioremediation of polluted environment, probiotic properties to

control pathogenic bacteria etc. It is also envisaged that this

project will help in identifying various novel metabolites

exhibiting antibiotic and anti cancer properties which are of

significance in human health. Novel genes such as salt tolerant

genes, drought resistant genes which are of great significance to

agriculture can be isolated. This project will help in cataloguing

the bacteria with their genetic and molecular properties which

will protect the microbial biodiversity from bio piracy.

Objectives

· To isolate bacteria, actinomycetes and fungi from different

brackish water system of east coast of India

· Identification of the microbes isolated from different

brackish water ecosystem.

· To screen the economically important microbes, bioactive

microbes with special reference to antagonistic activity/

useful metabolites, from the microbial stock

· To evaluate and optimize the production parameters of the

economically important microbes

· To isolate economically important genes from the isolated

microbial stock.

· To standardize the expression of the economically important

genes using different vector systems.

· To establish a repository of these microbes with bioactive

potential for ex situ conservation of microbial biodiversity

and future biotechnological applications.


· The isochorismate isomerase gene was amplified from Vibrio


16

alginolyticus and cloned in to pET32A vector system and

transformed in to E.coli DH5α. Over expressed by induction

of 1mM IPTG and over expressed proteins were confirmed

by SDS PAGE. Isochorismate isomerase, converts chorismic

acid to salicylic acid. Salicylic acid is a naturally occurring

plant metabolite that induces pathogenesis-related (PR)

proteins and triggers the systemic acquired response (SAR).

· The herbicide-resistant gene phosphoshikimate

carboxyvinyl trasnsferase was amplified from Vibrio

alginolyticus. The resulting 1281bp PCR purified fragments

was cloned in to pET32A vector system and transformed in to

E.coli DH5α.The recombinant plasmid was transformed into

E.coli BL21 expression host and was over expressed by

induction with 1mM IPTG.

· The complete ORF of α amylase gene was amplified from

Vibrio alginolyticus The total gene consists of 1380 bp. The

resulting 1380bp PCR purified fragment was then digested

with BamHI and Hind III and cloned in to pET32A vector

system and transformed in to E.coli DH5α. Amylase isolated

from bacteria, fungi, are used in textile industry as softening

agents for starched clothes its also used in bread making and

to break down complex sugars such as starch (found in flour)

into simple sugars.

· The complete ORF of lipase gene was amplified cloned and

expressed from Chromobacterium violaceum. The recombinant

protein was purified using Ni affinity column

chromatography. Lipase activity was estimation using

analyzer by quantitative kinetic determination method at

different parameters like various pH and temperature.

· The complete ORF of azurin gene was amplified from Vibrio

alginolyticus. The resulting 440bp PCR purified fragments

were cloned in to pET32A vector system and transformed in

to E.coli DH5α. The recombinant plasmid was transformed

into E.coli BL21 expression host and was over expressed by

induction with 1mM IPTG. The preliminary antiviral and

antitumor activity were studied.

· A total of 42 brackish water samples were analyzed for the

presence of Salmonella typhi and 14 samples were positive,

which indicates the high prevalence of salmonella. All the

isolates were conformed using biochemical and molecular

sero-typing a multiplex PCR method targeting four genes.

All the isolates were also confirmed with specific antisera

Molecular characterization of the isolates was done using

ERIC PCR and analysed using DNA Finger printing

software.

Conclusion

From non-pathogenic Vibrio alginolyticus which is

abundantly found in brackish water ecosystem. Agriculturally

important genes that impart herbicide resistant and pathogen

resistance to plants have been identified and the proteins have

been expressed. This study reveals that microbes present in

brackish water ecosystem can be exploited for betterment of

agriculture. The preliminary studies have shown that azurin

protein expressed by V. alginolyticus can be used for controlling

viruses that affect shrimp aquculture. 14 isolates of Salmonella

typhi have been grouped in to two major clusters with 60%

similarity.Similarity of ERIC-PCR fingerprints among S. typhi

strains isolated from widely separated geographical regions

revealed existence of a limited number of clonal groups. This is the

first study in India to use ERIC PCR for molecular

characterization Salmonella typhi from brackish water.

Seminar, Symposia and Conferences attended:

Ramakrishnan S, Singaravel R, Santiago T.C, Kalaimani N,

Alavandi S.V and Rajan J.J.S (2011) Prevalence And Molecular

Typing Of Vibrio Harveyi From Brackishwater Ecosystems of India

Proc: National seminar on recent trends in biological sciences.21-

22 Feb 2011.University of Madras. Chennai.

.

Isolation of microorganisms from fermented dairy foods and sequencing of 16S rDNA for strain identification.

PI : Dinesh KumarNational Bureau of Animal Genetic Resources, Near GT Road, Karnal-132001

Rationale

Fermented dairy foods such as cheese and curd have got global

nutritional values. India famous for its diverse language and food

habit has got a unique collection of indigenous dairy fermented

foods. In fermentation of such dairy foods Non Starter Lactic Acid

Bacteria (NSLAB) population play a great role to provide them a

decent aroma, flavour and texture. Lactic acid Bacteria population

present in such dairy foods is highly diverse. Microbial diversity

of such indigenous fermented dairy foods deserves attention,

identification and characterization of microbial populations from

such Dairy fermented foods prepared in India have not been

explored thus study is required to explore new dairy and

agriculture important microbes, characterize, classify and

preserve them for their bioprospecting. Hence the current study

has been focused on such dairy foods from different area of India

and study there microbial diversity.

Objectives

· To isolate microorganisms from fermented dairy foods.

· To characterize microorganisms on technological and

taxonomic parameters.

· To sequencing 16SrDNA for species identification.

17



· The present study in year (2010-2011) was undertaken in

order to explore new strains of lactic acid bacteria involved in

fermentation of buffalo milk curd collected from Chilika

which has got a unique long shelf life. Its reported that it can

remain up to 7 days at room temperature.

· In current study Indigenous curd sample prepared from

buffalo milk were collected from Chilika (19°43′N 85°19′E)

region of Orissa.

· Chemical analysis of curd samples showed acidity of curd

significantly high 1.08 % lactic acid, pH 3.87 and sour in taste

and thicker in consistency.

· Whereas chemical study of milk shows pH: 6.59, Acidity: 0.09

% lactic acid, fat: 8.6 %, protein: 3.9%. Thicker consistency of

curd may be contributed by high fat content of the milk.

· Lactic acid bacteria were found to proliferate in curd sample 5 giving microbial count of 1.7 to 2.2 X 10 CFU/g of curd.

· By shelf life studies, it was found that the quality of curd

retained up to seven days which was clear by microbiological

analysis of curd in intervals.

· A total of 64 microbial isolates were isolated and from curd

and milk sample out of 64 isolates 18 were Lactobacillus, 13

Leuconostoc, 12 Lactococcus, 9 Streptococcus, and 12 Yeast.

· These tentative isolates were identified by phenotypic and

genotypic methods.

· Biochemical characterization, especially sugar fermentation

pattern was used as a phenotypic method for identification of

isolates.

· All Lactobacillus isolates were confirmed to be lactobacillus

by genus specific PCR with specific primer (Dubernet et al.,

2002). Lactococcus isolates identified on the basis of

biochemical tests were confirmed by PCR using gadB gene

targeted primers. Streptococcus thermophillus were

confirmed by PCR using Lac Z gene targeted PCR.

· Sequencing of 16S rRNA gene sequence was performed for

all these isolates.

· All cultures isolated and characterized have been preserved.

Conclusion

Curd sample collected from Chilika (Orissa) was found to

have better shelf life than normal curd. A diverse population of

microbes were screened from the curd sample consisting of Yeast,

Lactobacillus, Lactococcus, Leuconostoc and Streptococcus. These

isolates can be used as starter for making curd with better shelf

life.


Nanda DK, Tomar SK, Singh R, Mal G, Singh P, Arora DK,

Joshi BK, Kumar D (2011) Phenotypic and genotypic

characterization of Lactobacilli isolated from Camel Cheese

produced in India. International Journal of Dairy Technology (Wiley

Blackwell) Accepted.

Strengthening, authentication and exploitation of mushroom biodiversity at the National Mushroom Repositoryfor Human welfare

PI : R. C. UpadhyayNational Research Centre for Mushroom, Solan, H. P.

Rationale

India with a varied agro climate is endowed with a rich

fungal flora occurring in the hills, plains, deserts and costal

ecosystem of our country. Most of the earlier work on Indian fungi

has been concentrated on microfungi, particularly those causing

plant diseases. On fleshy fungi whatever work has been done by

earlier mycologists laid their emphasis only on taxonomic aspects.

In the changed scenario when the fleshy fungi are being exploited

for commercial cultivation, extraction of pharmaceuticals,

antibiotics, bioremediation and extraction of enzymes for

industries and applications of mycorrhizic fungi for afforestation,

it has become very much essential to make a concerted and

coordinated efforts at the national level to properly collect,

identify, culture and conserve these fast depleting national wealth


18

not only in the form of dead herbarium specimens but as living

cultures in a national repository, where they may be scientifically

catalogued, classified, characterized using modern molecular

methods like RAPD, ITS and isozymes. These fungi will be

conserved for long durations and attempts will be made for

artificial domestication of unexploited mushrooms species. The

wealth of fleshy fungi collected and conserved under the project

will not only help to preserve and conserve the vast fungal

biodiversity of our country but will also make available to

researcher, industrialists and farmers for diversification of newer

mushroom species for cultivation, extraction of pharmaceuticals

and antibiotics, waste recycling and applications in establishing

forest seedlings in barren areas.

Objectives

· Collection of wild mushrooms from Jharkhand, Tripura,

Rajasthan and Himachal Pradesh.

· To obtain mycelial cultures from the collected specimens and

culture conservation in the Gene Bank of DMR, Solan and at

NBAIM, Mau.

· Complete description and identification of the specimens

using microscopic studies.

· Isolation of DNA from interesting specimens and molecular

studies especially ITS.

· Artificial domestication of unexploited indigenous wild

edible mushroom species.

· Screening of cultures for their different types of enzyme

production.


· During the surveys in the rainy season of 2010, total 111 wild

mushroom specimens were collected. In these collections we

found ectomycorrhizic, saprophytic, edible and some

medicinally important mushrooms from different forest

areas of, Jodhpur (Rajasthan), Ranchi (Jharkhand) Agartala

(Tripura) and Himachal Pradesh i.e., Khada Pathar, Chail,

Kufri, Narkanda .

· Important species include Leucocoprinus, Leucoagaricus,

Schizostoma, Limacella, Leucopaxillus, four spp. of

Termitomyces, Amanita pantherina, A. vaginatae etc.

· All the specimens are under identification upto species level.

· Efforts were made to isolate the culture of each specimen

immediately on different mycological media namely, Potato

Dextrose Agar & Malt Extract agar medium (2%) but only 60

cultures could be isolated. Remaining specimens were

mycorrhizic in nature and were difficult to culture. Plates

were incubated at 25°C for 6-10 days. Cultures were

examined for their purity and pure cultures so obtained were

stored at 4°C and in liquid paraffin.

· A new edible mushroom species i.e., Macrocybe giganteum

which is a tropical species, was successfully domesticated on

pasteurized wheat straw.

· Two wild mushroom strains Bjerkandera adusta and Lentinus

squarrosulus were selected for ligninolytic enzyme study.

· AAO is the main oxidases enzyme in B. adusta while laccase

plays important role in L. squarrosulus. MnP is the main

peroxidase enzyme in both varieties while LiP was not of

much significant.

· A new species of Limacella and Leucocprinus were collected

from Himachal pradesh which on examination seems to be a

new world record. The detailed molecular and anatomical

studies are in progress. Edible Termitomyces spp. (3 spp.),

Russulla sp. and Boletus species were collected from Ranchi.

· A new edible mushroom species ie Macrocybe giganteum

which is a tropical species, was successfully domesticated on

pasteurized wheat straw.

· Sixteen DNA sequences of Cantharellus spp have been

deposited in the NCBI which incldes five new species for the

world.

Conclusion

The project is aimed at collecting, identifying and storing

higher fungi in a number of states in India some of these fungi

have a commercial value because they can be cultivated and sold

on the local markets. At present mushroom growers in

developing countries need reliable cultures and spawn to

inoculate the substrate in their family type business. The

availablity of well managed (national or local) germplasm

collections is of great importance, both commercially and socially.

Also institutes that manage the germplasm collections may play

an important role in the maintenance of cultures, and

dissemination of knowledge. Since the project also aims at studies

on best methods for conservation and on the related problem of

genetic stability of species and strains. There is a great potential in

India to find new wild mushroom species so far not recorded from

the world.


· Deepika Kumari, R.C. Upadhyay and M. S. Reddy (2009).

New records of family Cantharellacae from India. Mushroom

Research 18(2): 47-50.

· Upadhyay, R.C. and Manjeet Singh (2010). Production of

edible mushrooms. In Karl Esser (ed.) Mycota – Industrial

A p p l i c a t i o n s X . S p r i n g e r P u b l i c a t i o n p p .

79-97.

· Astha Tripathi, R.C. Upadhyay and Surendra Singh (2010).

Variability in phenol tolerance by coremia forming Pleurotus

spp. on solid medium. Mushroom Research 19(1): 9-15.

19



Biodegradation of cbhlorophenols by white-rot fungi: A

review. Flora and Fauna 16(2): 157-165.


Nutritional composition of eighteen different wild

Cantharellus mushrooms collected from North-Western

Himalayan region of India. Food Science and Technology

International (Press).


Antioxidant Activity of three species of Wild Mushroom

Cantharellus Collected from North-Western Himalaya, India.

International Journal of Agriculture & Biology. (Press).


Mineralization of mono-nitrophenols by Bjerkandera adusta

and Lentinus squarrosulus and their extracellular ligninolytic

enzymes. Journal of Basic Microbiology (Accepted).

Exploring bacterial diversity in Kutch eco-region of gujarat for agricultural and industrial applications

PI : K. K. PalCo PIs : R. DeyDirectorate of Groundnut Research, Junagadh, Gujarat

Rationale

The emerging issues of salinity, high temperature and

degradation of soil quality warrant management strategies to

preserve microbial diversity and to exploit the existing diversity

for enhancing crop productivity. The Kutch ecoregion of Gujarat

remains a source of novel organisms and genes thereof of

agricultural, industrial, pharmaceutical and therapeutic usage for

the microbiologists to explore due to prevalence of diverse harsh

environmental conditions like extreme temperatures, salinity,

and drought. Great diversity is also observed in the soil types and

the crops grown in the area. Thus, Kutch ecoregion is a hot spot of

diverse microbial population, especially the extremophiles,

which is relatively unexplored. Therefore, studying the microbial

diversity in this ecoregion for exploiting their use in agricultural,

industrial, and pharmaceutical industries is of utmost

importance.

The present project aims at exhaustive surveys, isolations,

identifications, molecular diversity, bioprospecting and

conserving the microbial diversity from various niches for

multiple societal benefits. Besides, the project envisages

identifying future strategies in developing efficient biofertilizer

packages for existing crops of Kutch ecoregion.

Objectives

· Survey, isolation and characterisation of important bacteria

and archaebacteria from salt affected areas and salterns of

Kutch eco-region of Gujarat

· Identification of potent salt tolerant strains of bacteria

suitable for groundnut cultivation in salt affected areas of

Kutch eco-region

· To study the diversity of representative groups of salt

tolerant bacteria obtained from salt affected areas and

salterns of Kutch eco-region

· Exploring source of novel gene(s), if any, of agricultural and

industrial importance from diverse extremophiles with

special emphasis on biocontrol, salt tolerance, bioactive

peptides, industrial enzymes, etc.

· Mapping, cataloguing, and preservation of isolated and

identified bacteria in National Repository.


· Quantified plant growth promoting traits of important

PGPR isolates. Quantification of phosphate solubilization

and IAA production indicated that Enterobacter sp. R29 and

Pantoea dispersa R5 were most potent in tri-calcium

thphosphate solubilization after 9 day of incubation and

solubilized 29.97 and 34.22 mg of phosphorus/mg protein

and there was decrease in pH of the medium from 7.2 in

control to 4.99 and 4.33, respectively.

· To ascertain the presence of novel genus and species among

the 23 different isolates of archaea of the tentative genera

Halorubrum, Haloferax, Haloarcula, Natrinema and Haloarcheon

studied so far, patterns of total intracellular proteins, polar

lipids, GC content, electron microscopy and minimum

requirements of NaCl for initation of growth have been

studied. The minimum NaCl requirement for growth of the

present pool of archaea was 10%. The intracellular anions

and cations accumulated during the growth of these archaea,

from 10% NaCl to 35% NaCl were determined in Ion

Chromatograph. It was found that with increase in NaCl

concentration, there was gradual increase in accumulation of

both NaCl and KCl with molar ratio of K: Na from 1:1 in

lower concentration of osmolarity to 4:1 at the highest

osmolarity.

· Identified 16 archaea on the basis of near complete 16S rDNA

sequencing into the possible genus of Haloferax, Natrinema,

Halorubrum, Haloarcula and unidentified Haloarcheon species

and thus possibility of obtaining new genus and species was

found as similarity with the existing 16S rDNA ranged

between 95-99%. The phylogenetic relationship, studied on

the basis of new 16S rDNA sequence data, divided the 16

isolates into 5 major clusters and 10 sub-clusters.

· The diversity of the archaea present at saturated NaCl

concentration (35%) has been determined. A separate cluster

has been identified for the present isolates among the

existing database of genus and species of archaea at NCBI.

· New nodulating and nitrogen fixing organisms have been

identified as Enterobacter sp. R29 and Pantoea dispersa R5 by

near complete 16S rDNAs (1486 bp) sequences.

· DGGE conditions optimized for studying the different

microbial community in the natural and man-made salt pans

at saturated NaCl conditions.

· DDRT-PCR conditions optimized for isolation of transcripts

responsible for imparting tolerance to NaCl at different level

of osmolarity in Haloferax volcanii H1.

· Application of salt tolerant fluorescent pseudomonads and

Pantoea dispersa has been found to alleviate salt stress in

plants by modulating enzymes involved in reducing the


20

impact of reactive oxygen species in groundnut.

Application of salt tolerant fluorescent pseudomonads and

Pantoea dispersa has been found to alleviate salt stress in plants by

modulating enzymes involved in reducing the impact of reactive

oxygen species in groundnut.

Conclusion


Thomas, M., Pal, K. K., Dey, R., and Dave, S. R. (2010).

Biodiversity of Extreme Haloarchaea in Salterns of the Little and thGreater Rann of Kachchh in India. 8 International Congress on

thExtremophiles held at Azores, Portugal from 12-16 September,

2010.

Phylogenetic relationship of the present archaea with the known genera and species of archaea.

Phylogenetic relationship among 16 archaebacteria generated using near complete 16S rDNAsequencing.

Isolation and characterization of Flavobacterium species from fish and aquatic environment

PI : Gaurav RathoreNational Bureau of Fish Genetic Resources, Lucknow

Rationale

Bacterial diversity screening is an active area of research as it

provides inexhaustible data, which can be used for the purpose of

developing products for the pharmaceutical, agricultural,

chemical processing and industrial markets. Knowledge on the

biodiversity of crucial aquatic ecological areas would yield a

better understanding of their community composition, spatial

relationship among organisms, nature of the operating

biochemical cycles and the mechanism of the existing energy

balance. These would provide a framework for the conservation

and sustainable development of ecosystems. Till date very limited

and isolated efforts were made to tapping of microbial diversity

and identification of aquatic environment. Flavobacterium spp. is

an important genus that is widely distributed in soil and

freshwater habitats where they decompose organic matter.

Several species are pathogenic to freshwater fish (F. columnare, F.

psychrophilum, F. branchiophilum) or isolated from diseased

freshwater fish (F. johnsonie, F. hydatis, F. succinicans). Members of

Flavobacterium are important producers of extracellular proteases

as virulence factors and several enzymes that hydrolyse casein

and gelatin. They also have the ability to degrade polysaccarides

such as starch, pectin, chitin, laminarin, alginate, xylan, carboxy

methyl cellulose and are also agarolytic. Some species can

degrade complex acid polysaccharides such as chondroitin

sulphate and hyaluronic acid. Therefore, isolation and

characterization of Flavobacterium spp. is important for fish

disease diagnosis and health management. The aim of this study

was to isolate and characterize the Flavobacterium species and

other related yellow pigmented bacteria from fish, sediment and

pond water sample. All these samples were directly associated to

each other and would provide information for prevention of fish

diseases and help in health management. These species can be

utilized for other applications in agriculture and allied sector.

Objectives

· To isolate and characterize Flavobacterium species and related

microbes by conventional methods from diverse aquatic

ecosystem.

· To assess the diversity of Flavobacterium species and related

microbes by molecular methods.

· To develop sensitive and rapid method for detection of

Flavobacterium species by PCR.

· To identify and discriminate the Flavobacterium species

through fingerprinting techniques.


· Isolation of Flavobacterium columnare: A total 32 fish

samples showing disease symptoms were collected from

different fish farms and processed for bacterial isolation. All

the tested fish had gross lesions resembling columnaris

disease. Skin swabs were streaked aseptically or dilutions of

homogenized tissue were plated on cytophaga agar plates

containing 5μg/ml neomycin sulfate and 200 units/ml of

21


0polymixin B. The plates were incubated at 25 C for 3-4 days to

obtain visible bacterial growth. Yellow to green colonies with

entire or rhizoid edges were selected for purification. The

purified isolates were initially subjected to Gram's staining,

catalase, oxidase, motility and O-F tests, and later to Griffin

method of screening for identification of F. columnare.

· F. columnare was isolated from the diseased Catla catla sample

and presumptive identification has been carried out basis of

five characteristics as described by Griffin (1992). The

colonies on Cytophaga agar were pale yellow, spreading

with rhizoid margins. The biochemical results indicate that

the isolate was flexirubin positive, congo red positive,

resistant to neomycin resistant, gelatinase positive and

chondroitinase positive.

· DNA isolation from F. columnare was done by the method

described by Marmur et al. (1961). Amplification of 16S

rRNA was done by universal primers to obtain approx 1500

bp amplicon. The PCR product was eluted from the gel and

cloned into cloning vector pTZ 57RT by TA cloning method.

· The cloned plasmid was sequenced using M13 primers to

obtain approx 1500 bp nucleotide sequence. The sequence

chromatogram was analysed by Bioedit software and the

resulting consensus sequences (~1500 bp) were compared

with those available in RDP 10 database by use of the SEQ

MATCH programme to determine 16S rRNA gene sequence

similarities with its nearest neighbors. The results revealed

identity of the isolate was approx 98% with Flavobacterium

columnare strain EK 28 (AB016515) and LP8 (Genbank

Accession No.AB015480).

· Amplification of Intergenic Spacer Region (ISR) of F.

columnare was done using primers (FIFPB5 and 23RR) to

obtain a PCR product size of ~750 bp. The PCR product was

eluted from the gel and cloned into cloning vector pTZ 57RT

by TA cloning method. The cloned plasmid was sequenced

using M13 primers to obtain approx 750 bp nucleotide

sequences. The sequence chromatogram was analysed by

Bioedit software and the resulting consensus sequences

(~750 bp) were compared with BLAST programme in NCBI

to determine ISR sequence similarities with its nearest

neighbors. The results revealed identity of the isolate was

more than 99% with Flavobacterium columnare strain EK 28

(AB016515) and LP8 (Genbank Accession No.AB015480).

Based on our biochemical and sequencing results, the isolate

has been confirmed to be F. columnare.

· Work was initiated on study of metagenomics from

sediments of fishponds. A total of 16 attempts were carried

out to isolate community DNA through commercially

available soil DNA isolation kit (Himedia). DNA was

successfully isolated from all the samples, however

amplification of eubacterial 16S rRNA was achieved only in

eight samples using universal eubacterial primers.

· Isolation of Protease producing bacteria from aquatic

environment: A total of 56 bacterial isolates collected from

different fish farms were screened for protease production

on skimmed milk agar plates. Out of these, nine isolates 0 0 0showed protease activity at 4 C, 20 C and 37 C. The protease

activity of these isolates was quantified and expressed in

units. These isolates were subjected to molecular

identification by 16S rDNA sequencing. The results showed

that the isolates belonged to genus i.e. Bacillus, Aeromonas and

Pseudomonas. Out the three, Bacillus group showed

maximum activity (14 units) followed by Aeromonas (8 units) 0at 37 C.

Conclusion

Flavobacterium columnare is an important pathogen causing

columnaris disease in fish. Cultivation of F. columnare is a difficult,

uncertain and time-consuming method from diseased fish. This

is because, columnaris disease is an epidermal disease and when

the cultivation is made from surfaces of diseased fish,

contamination can rarely be avoided. Therefore competitive and

opportunistic bacteria growing on the agar plate can inhibit the

growth of F. columnare. F. columnare was successfully isolated

from diseased fish Catla catla showing bacterial gill infection.

Presumptive identification was carried out on the basis of

biochemical characterization as well as molecular identification

through 16S rDNA sequencing. This isolate could serve as a

candidate for developing diagnostics or development of vaccine.

Exploration and screening of rainfed ecosystem microbial diversity

PI : Kiran SinghMaulana Azad National Institute of Technology, Bhopal

Rationale

Microbial diversity study has extensive use in estimating

phenotypic and genotypic diversity of phosphate solubilizing

and free living nitrogen fixing rhizobacteria of agricultural

importance. This study employed the combination of several

methodologies to examine genetic relationships among specific

groups of bacteria and to characterize strains at the species level

using molecular biotyping techniques. The 16S or small subunit

ribosomal RNA gene is useful for estimating evolutionary

relationships among bacteria because it is slowly evolved and the

gene product is both universally essential and functionally

conserved. The study provides a different level of perspective to

interpret the phenotypic and genotypic variations among

different species of bacteria and also provide phylogenetic

relativity. Soil microbial diversity is an important index of

agricultural productivity.

Objectives

· The DNA primers corresponding to naturally occurring

sequences of isolated bacteria's such as REP, ERIC, and BOX

elements will be used to demonstrate genetic relatedness and

their diversity in a variety of ecosystem.

· The detection of these effective microbial strains from

various other soil microbes will be helpful for farmers and

scientist to formulate effective microbial management

strategies and evaluation of genetically improved microbial

strains in field validation.

· The formulation of methods used for direct extraction and


22

purification of DNA from soil/ infected plant parts together

with PCR amplification of the DNA.

· To monitor survival of microbial strain will be performed,

which cannot be detected by any conventional technique.


· Soil samples were collected from rhizospheric region of plant

like

different districts of Madhya Pradesh.

· On the basis of biochemical reaction strains of bacteria are

confirmed as P. aeroginosa, P. putida, P. flourosence and P.

streuzi and their phosphorus solubilization capacity were

studied.

· DNA isolation of 50 Pseudomonas isolates was done by

modified Murmur method (Murmur, 1963 ) with slight

modification and estimation of DNA was done by obtaining

the ratio of absorbance at 260 nm/280nm

· Melting temperature (Tm) (Jain 1998) and % of G+C (Rapley

1998) of Pseudomonas isolates was calculated.

· Genetic diversity of 50 Pseudomonas isolates was done by

16SrDNA-RFLP PCR,RAPD PCR and REP PCR. Restriction

enzyme digestion of the amplified 16SrDNA was done by 5

restriction enzymes namely Alu I, Taq I, Mob I, Hae III and

Hind III.

· RAPD analysis of Pseudomonas isolates was done by using 5

different RAPD primers OPK 20, OPK 10, OPK11, OPK15

and OPK13.

· REP PCR of all the Pseudomonas isolates was done with REP

Universal primer.

· The RFLP pattern, RAPD and REP profile of each isolate was

evaluated and data matrix is generated and dendrogram was

Glycine max, Cicer arietinum, Trigonella foenum graecum,

Cajanus cajan from

constructed using NTSYS PC software package (Rohlf, 1990).

· Ten strains of genus Azotobacter were isolated from Jabalpur,

Sehore, Raisen, Ujjain, Indore, Hoshangabad, Guna &

Bhopal districts of M.P., which are biochemically

characterized.

· Identification upto species level was done by adding

selective compound to liquid Jensen medium. (1). For A.

vinelandii L-Rhamnose, ethylene glycol, erythritol of D-

arabitol as C-source Alternatively 1.0% Na-benzoate or 0.1%

phenol are used to inhibit the growth of other species of

Azotobacter. (2). For A. beijerinckii – L-tartrate, o-

hydroxybenzoate, D-glucuronate or D-galactouronate and

pH of 6 favours the growth of this species. (3). A. chroococcum

is the most common species and needs no special

enrichment.

· Genetic diversity of 10 Azotobacter isolates was analyzed by

16S rDNA-PCR Using universal primers.

Conclusion

Fifty strains confirmed as Pseudomonas sp. were used for

microbial diversity study after biochemical characterization. The

size of DNA fragments using REP-PCR primer range between 200

to 1000 bp. The digestion of 16S rDNA with Hae III showed bands

between 200-800bp. Ten strains were confirmed as Azotobacter sp.

after biochemical characterization. After isolation of genomic

DNA, genotyping of the isolates was done by using molecular

method (16S rDNA). The isolated strains expressed pattern of

banding on 2% agarose gel using 16S rDNA -PCR method with

universal primers.


National Conference at Maulana Azad National Institute of

Technology, Bhopal, Nov, 2010.

Diversity of diazotrophic bacteria in arid zone soil under extreme environments

PI : Rajesh GeraCo PI : Kamlesh Kukreja Department of Microbiology, CCSHAU, Hisar, Haryana

Rationale

Soil bacterial communities and the soil processes mediated

by bacteria are critical for ecosytem functioning and productivity

in arid lands. There is an urgent need to integrate the soil bacterial

community into our understanding of ecosystem interactions at a

scale relevant to the whole-plant, between-plant, and ecosystem

levels. Nitrogen and water are the two most limiting resources in

arid under rainfed ecosystem. Soil bacteria are responsible for all

nitrogen fixation in the soil, and they play essential roles in

nitrogen cycling in soil crusts and plant rhizospheres Nitrogen is

the limiting nutrient for crop growth in most developing

countries. Exploitation of biological N Fixation offers a unique 2

opportunity to harness nitrogen from the air. The promotion of

low-input agriculture over the last decades has sparked a great

interest in soil microorganisms able to increase soil fertility or to

stimulate plant nutrition and/or health. Knowledge of the

diazotrophic community structure and population dynamics

responsible for nitrogen fixation is important for agricultural

applications as well as for understanding the ecosystem

processes. The microorganisms associated with arid zone

cropping systems are well adapted to stress conditions.

Introduction of microorganisms which are not adapted to these

stress conditions fail to establish and do not survive giving little

benefits to host. Study on microbial diversity in different cropping

systems will identify the new genotypes suitable for different

hosts, soil type, management practices and cropping systems.

This will help to develop better bio-inoculants for arid zone crops.

Objectives

· To study the soil microbial diversity of nitrogen fixing

bacteria under extreme environments (high temperature,

low moisture, low nutrients and high salt concentration).

· To characterize the isolates for agriculturally useful traits like

nitrogen fixation, growth hormone production and as fungal

antagonists.

· To characterize the symbiotic nitrogen fixers for nodulation

and nitrogen fixation properties.

· To identify the specific populations associated with abiotic

variables and functions.


· Thirty four different isolates growing on Malate (7), Burk's

(7), Nfb (8), Doberiner (8) and LGI (4) media from 10 districts

23


of Haryana showing important traits like ammonia

excretion, IAA & siderophore production and P-

solubilization from each phylogenetic group were tested for

plant growth parameters in cotton and pearl millet under pot

house condition vis-à-vis reference strain, Azotobacter

chroococcum (HT 54).

· Seven isolates (BK-2, MDb-15, LGI-4, LGI-19, NFB-22,

MNFB-23 and MNFB-24) isolated from arid and semi-arid

zones of Haryana and showing better performance in cotton

& pearl millet were identified as Sinorhizobium, Rhizobium

sp . , Agrobacter ium tumefac i ens , Rhizob ium e t l i ,

Stenotrophomonas maltophilia, Ralstonia sp. and Leptothrix

cholodnii, respectively, on the basis of partial 16SrDNA.

· Fifteen more soil samples mainly covering Panipat, Jind,

Karnal and Kurukshetra districts were subjected to viable

counts of diazotrophs varied from 5.30-7.40, 5.60-6.50, 6.30-

7.11, 7.30-8.78 and 5.90-7.70 log cfu/g soil on Malate,

Burk's, Doberiner, Nfb and LGI, media, respectively. The 89

new morphotypes thus obtained from the above 15 different

soil samples, out of which 27, 14, 17, 25 and 6 morphotypes

belonged to Malate, Burk's, Doberiner, Nfb and LGI media,

respectively and were added to already exiting 291

morphotypes.

· These morphotypes were also characterized for ammonia

excretion, IAA production, P-solubilization and siderophore

production.

· A total of 26 soil samples with EC varying from 1.04 to 21.00 -1dSm were collected from salt affected areas of Haryana at

the depth of 0-15; 15-30 cms and also from weed rhizosphere

growing on these saline soils.

· The viable counts of diazotrophs varied from 4.36-7.91, 3.07-

6.70, 3.20-6.23 and 3.28-6.17 log cfu/g soil on Soil extract,

Malate, Jensen's and Burk's media, respectively. A total of

234 morphotypes were obtained on the above media.

· The genomic DNA of all these morphotypes was isolated by

CTAB method and was amplified for nifH gene by using

degenerative primers, nifH for (5' – TAY GGN AAR GGN

GGH ATY GGY ATC -3') and nifH rev (5'- ATR TTR TTN

GCN GCR TAV ABB GCC ATC AT -3'). The amplified

product was of ~420 bp.

· The ARDRA analysis on the basis of different morphotypes

isolated from soils with varied EC (1-5, 6-10, 11-15 or 16-21 -1dSm ) growing on different media showed wide diversity

and divergence among these started at 70 or 71 per cent

similarity coefficient. However, increase in salinity resulted

in decrease in viable counts and thereby diversify among

themselves.

· The isolates from each phylogenetic group were

characterized for Gram staining, IAA production, P-

solubilization, ammonia excretion, NaCl tolerance and were

identified on the basis of partial 16S rDNA gene sequencing.

Most of the isolates showed 99-100% similarity with Agrobacterium, Sinorhizobium, Pseudomonas, Ensifer,

Rhizobium , Baci l lus , Paenibaci l lus , Streptomyces ,

Microbacterium, Stenotrophomonas species.

· The promising diazotrophs isolated from salt affected soil

showing 5 to 10% NaCl tolerance are submitted to NBAIM

centre.

· A total of 106 soil samples were collected from different arid

and semi arid zones of Haryana to study the diversity of

rhizobia nodulating Vicia faba. Sixty four rhizobial isolates

were isolated on YEMA medium from various soil samples

using trap plant Vicia faba.

· The genomic DNA of these isolates was amplified for nodC

and nifH gene using nodCF and nodCI and 19F and 407R nifH

gene primers, respectively. Although all the 64 isolates

showed nodC gene amplification, while only 50 isolates

showed nifH gene amplification.

Conclusion

Seven isolates ( BK-2, MDb-15, LGI-4, LGI-19, NFB-22,

MNFB-23 and MNFB-24) from arid and semi-arid zones of

Haryana showed better performance in both cotton & pearl millet

were identified as Sinorhizobium, Rhizobium sp., Agrobacterium tumefaciens, Rhizobium etli, Stenotrophomonas maltophilia, Ralstonia

sp. and Leptothrix cholodnii, respectively, on the basis of partial 16S

rDNA gene. Promising diazotrophs isolated from salt affected

soils showing 5 to 10% NaCl tolerance were characterized for

Gram staining, IAA production, P- solubilization and ammonia

excretion and were identified on the basis of partial 16S rDNA

gene sequencing. Most of the isolates showed 99-100% similarity

with Agrobacterium, Sinorhizobium, Pseudomonas, Ensifer,

Rhizobium, Bacillus, Paenibacillus, Streptomyces, Microbacterium,

Stenotrophomonas species and are also submitted to NBAIM

centre.


· Rajesh Gera, Meenu Walia, R.C. Anand and Sneh Goyal

(2010). Microbial Diversity of Nitrogen Fixing Bacteria in

Arid and Semi-Arid Zones of Haryana Soil. Paper presented stin 51 Annual Conference of AMI-2010 held at BIT, Mesra,

Ranchi, India from Dec. 14-17, 2010.

Isolation of Rhizobium nodulating Vicia faba using trap plant from the arid and semiarid zones of Haryana.


24

Exploration and screening of microbial diversity of Bihar and their potential application

PI : V. K. ShahiCo PIs : Dayaram, Subodh K. SinhaRajendra Agricultural University, Samastipur, Bihar

Rationale

The diversity status of microorganism may be defined in

terms of variations in morphological, physiological and genetic

characteristics apart from habitat diversity. Microbial diversity is

fundamental to maintenance and conservation of genetic

resources. As we explore into different environments, the richness

of microbial diversity becomes more evident and it becomes

imperative to estimate, record ,and conserve the microbial

diversity. This will not only reveal the structural and functional

diversity of microorganism and develop microbial map of region

but also help to use genetic resources of the microbial world for

sustainable agriculture.

Objectives

· Collection, identification and conservation of agriculturally

important microbes from different agro-climatic zone of

Bihar.

· Characterization of germplasm to ensure broad-spectrum

genetic variability.

· Evaluation of potential strains for their use and development

of technology for mass multiplication.


· 90 soil samples were collected from Begusarai, Bhagalpur,

Lakhisarai, Gopalganj, Siwan and Munger districts of Bihar.

· 50 Rhizobium, 25 PSB and 31 Azotobacter strains were isolated

and their identification and characterization was done by

morphological and biochemical traits.

· Higher population density of Rhizobium was observed in

Bakla field in Munger and Begusarai districts. In Bhagalpur,

Lakhisarai & Gopalganj maximum population density of

Rhizobium was found in Lentil field. Maximum CFU of

Azotobacter and PSB were generally shown in Maize field.

· All Rhizobium isolates show the production of amylase,

cellulase, catalase and oxidase enzymes and found gelatinase

negative.

· Rhizobium, Azotobacter and PSB were screened for their plant

growth promoting traits like Indole Acetic Acid (IAA)

production and siderophore production. 83.2% of Rhizobium

isolates showed Indole acetic acid production while 100%

isolates of Azotobacter and PSB showed Indole acetic acid

production. 75% isolates of PSB and 15.5% of rhizobium

showed siderophore production. None of the Azotobacter

isolates recorded siderophore production.

Conclusion

A good number of Rhizobium (50), PSB (25) and Azotobacter

(31) strains were isolated and characterization was done by

morphological and biochemical traits. Out of these, only 83.2% of

Rhizobium isolates showed Indole acetic acid production while

100% isolates of Azotobacter and PSB show Indole acetic acid

production. 75% isolates of PSB and 15.5% of rhizobium show

siderophore production. None of the Azotobacter isolates showed

siderophore production in future they are used as plant growth

promoting rhizobacteria (PGPR).

Papers published from AMAAS work:

· Suchi Smita, Subodh K. Sinha, Dayaram and V.K. Shahi

(2010). Molecular Diversity of Rhizobia Strains Isolated from

Different Areas of Bihar. RAU J. Research (Accepted).


· Shahi V. K., Dayaram and Punya (2010): Morphological and

Biochemical characterization of Rhizobia. (Abstract).

International consortium of Biologist. p-64.

Exploration and screening of bacteria diversity in North-East India and its potential application in biocontrol

PI : Ratul SaikiaCo PI : T. C. BoraBiotechnology Division, North East Institute of Science & Technology (CSIR), Jorhat, Assam

Rationale

North Eastern Region of India is known for its rich

biodiversity and its un-tapped bioresources has been identified as

the Indo-Burma Mega Hot Spot by Conservation International.

Therefore, existence of agriculturally and industrially potential

microbial strains with diverse genetic resources cannot be ruled

out. It is well recognized that the diversity of microbial

communities in North-Eastern region remains unexplored and

uncharacterized. Very little has been done on exploration of these

vast genetic resources, not only to enrich the national gene pool,

but also to explore it for gainful purposes in the field of industrial,

agricultural and pharmaceutical sectors. Therefore, exploitation

of vast potentialities of rare, endemic and untapped microflora of

this region is much promising and very important also. The

microbes are identified as vital resources for extraction of newer

and important molecules of agricultural utility and also for

expression of new gene. Therefore, a systemic exploration,

exploitation, characterization and conservation of culturable and

unculturable microbial diversity in NE India will open up a new

opportunity to explore the vast potentialities of endemic

microflora of this hot zone (NE region) and also to preserve as a

precious asset of rare genetic resources of the country.

Objectives

· Collection of environmental samples (soil, water, plant,

decomposed matter etc) from different habitant of North-

East states of India.

· Isolation, purification and preservation of bacteria.

· Bacterial data base development for future uses.

· Screening of bacterial isolates for biocontrol.

25


Protease assay in skimmilk agar plate

Fig. Phylogenetic tree of bacteria isolated from rhinodung based on 16S rDNA sequence.

· Characterization of potential isolates and diversity analysis.


· During the year (2010-11), soil and water samples were

collected from Barapani, Shillong (average latitude 1,496 m,

locates at 25 57 N, 91 88 E

Cherrapunji (25°30 N 91°70 E; altitute

26°75 N

94°22 E)

· A total of 100 bacteria and 87 Streptomyces sp. from soil

samples from Meghalaya were isolated. Out of the 87

º ' º ' ), Mawsynram (25º 18' N, 91º 35' E ,

altitude 1,400 m, annual rainfall 11,872 mm; temperature o11 C ) and ' ' 1484 m,

o rainfall 11,777 mm, temperature 10 C ) of Meghalaya and

also from few area of Brahmaputra river bank like –Dhodang

chapori, Bahbari and Garumara of Jorhat district ( '

' and Gibbon Wild Life Sanctury, Jorhat, Assam.

Streptomyces spp. 34 isolates were positive for protease

production.

· Fifty Streptomyces spp. isolated from Tawang were

investigated for antifungal activity against Fusarium

oxysporum and 5 isolates were found positive. Sequencing of

16S rDNA of these Streptomyces was done and sequences to

be submited to NCBI-Gene Bank.

· Out of the 50 isolates of Streptomyces spp. of Tawang three

showed chitinase gene amplification (Family 18 bacterial

glycosyl hydrolase). Characterization of the gene under

study. Moreover, two isolates showed keratin degrading

ability in chicken feather medium.

· Fifty fluorescent pseudomonads were screened for protease

production and 10 of them found to be positive and

produced alkaline protease. The eight highly protease

producing isolates were identified as Pseudomonas aeruginosa

by sequencing of 16S rDNA (NCBI accession no. HQ007938

to HQ007945). The molecular mass of the purified enzyme

was 32 kDa. The enzyme activity was inhibited by EDTA

established as their metallo-protease nature and the activity 2+ 2+ +of the enzymes were inhibited by Zn , Cu and Ni .

· We have submitted 24 bacterial 16S rDNA sequences to the

NCBI-Gene Bank (HM038234 to HM038237 and HM345959

to HM345971) which were isolated earlier from rhino's dung

of Kaziranga National Park, Assam. Out of these, two

bacterial strains viz., Achromobacter sp. KRD9 and Providencia

sp. KRD23 were positive in protease assay.

Conclusion

A good number of bacterial isolates have been screened for

antimicrobial activity and protease production assay, only very

few bacterial strains were found to be positive and some of them

showed antagonistic activity.


· R. Saikia, R. Sarma, A. Yadav, T. C. Bora, (2011) Genetic and

functional diversity among the antagonistic potential

fluorescent pseudomonads isolated from tea rhizosphere.

Current Microbiology, 62:434–444.

· R. Saikia, D. K. Gogoi, S. Majumder, A. Yadav, R. K. Sarma, T.

C. Bora, B. K. Gogoi (2010). Brevibacillus laterosporus strain

BPM3, a potential biocontrol agent isolated from a natural

hot water spring of Assam, India. Microbiological Research.

(online publish first).

· R. Debnath, R. K. Sarma, R. Saikia, T. C. Bora (2010).

Microbial diversity and bioprospecting. National Seminar on

Medicinal & Microbe Diversity & their Pharmaceuticals. 19-

21 Dec. 2010, Tezpur University, Tezpur, India. Pp. 27-33.


· First Indian Biodiversity Congress (IBC 2010) organized by

CISSA and Kerala University, Thiruvananthapuram from th st27 to 31 December 2010.


26

Collection, identification and characterization of microbial diversity of North Bengal

PI : B. N. ChakrabortyCo PI : U. ChakrabortyUniversity of North Bengal, Darjeeling, West Bengal

Rationale

Diverse microorganisms are essential to a sustainable biosphere.

Microbial diversity is the key to human survival and economic

well being and provides a huge reservoir of resources, which we

can utilize for our benefit. Therefore, continued research is needed

to describe and protect the unexplored resources for the

preservation of natural ecosystems and the future benefit of

mankind. India has a very enviable biodiversity. However, work

on microbial diversity has been limited and almost little or no

work has been done on the microbial diversity of the North-

Eastern Region. Hence a detailed study including mapping of

microbial diversity in the diverse regions of North East region is

very essential and needs to be incorporated in the study of overall

microbial diversity of India.

Objectives

· Isolation of microorganisms (fungi, bacteria and

actinomycetes) from soil (forest, agricultural and riverine)

and plant roots of six districts of North Bengal (Darjeeling,

Jalpaiguri, Cooch Behar, Uttar Dinajpur, Dakshin Dinajpur

and Malda).

· Screening of the isolates for their utilization as bioprotector

and biofertilizer.

· Extraction of Genomic DNA, molecular diversity analysis,

PCR-RFLP analysis of SSU rDNA for identification.


· Soil samples collected from rhizosphere of Cinnamomum o ocassia (N24 42'26.30'' E88 21'20'20.30”) , Citrus reticulata

o o(27 02'43.17”N 88 28'04.69”E) , Hevea brasiliensis o o(N26 42'57.23'' E88 21'24'39”) and Cucurbita moschata

o o(27 07'14.40''N 88 06'18.70''E) of Darjeeling districts of North

Bengal yielded 103 bacterial isolates, 22 fungal isolates.

Among them 15 isolates were phosphate solubilizers; 26

were chitin degraders whereas 10 showed siderophore

production; 26 showed protease activities; 31 showed

amylase activities and 5 isolates showed antifungal

activities.

· PCR amplification of rDNA gene of eight isolates of

Cordyceps sp. (a parasitic macro fungus) collected from oDarjeeling hills (N26 31'27.13' - E 87-59'-88.53') using ITS

s p e c i f i c u n i v e r s a l p r i m e r p a i r s I T S 1 -

C T G T A G G T G A A C C T G C G G a n d I T S 4 -

TCCTCCGCTTATTGATATGC yielded 400-800bp products.

Genetic relatedness among these isolates and other

saprophytic macro fungi when analyzed with four random

primers (BAS-359, OPA-4, OPD-6 and OPA1) showed

genetic diversity among the isolates with the formation of

two clusters. A total of 22 reproducible and scorable

polymorphic bands ranging from approximately 100bp to

2000bp were generated with these four primers, while

primer BAS-359 scored highest bands. Analysis of

dendrogram revealed that similarity coefficient ranged from

0.34 – 0.86.

· Biochemical characterization and scanning electron

microscopy of 11 isolates of Non-Streptomyces

Actinomycetes (NSA) were done. These isolates showed

antagonistic reaction against fungal pathogens (Sclerotium

rolfsii, Fusarium graminearum, Fusarium oxysporum and

Rhizoctonia solani) in dual culture and enhanced growth

promotion of Glycine max and Cicer arietinum.

· PCR amplification of rDNA gene of seven selected isolates

of Trichoderma collected from the rhizosphere of Citrus o oreticulata (27 02'43.17”N 88 28'04.69”E) and Cucurbita

o omoschata (27 07'14.40''N 88 06'18.70''E) of high altitude region

of Darjeeling hills which showed antagonistic reactions

against phytopathogens (Thanatephorus cucumeries,

Rhizoctonia solani, Fusarium solani, Sclerotium rolfsi, and

Macrophomina phaseolina ) using ITS specific universal primer

pairs ITS1- 5'GCGGAAGGATCATTACTGAG 3' and ITS-4 -

5' GGGTATCCCTACCTG ATCCG 3' yielded 600 bp

product and their PCR products were sequenced and

identified by BLASTn as T. harzianum, T. asperellum and T.

erinaceum and their phylogenetic diversity analysed using

MEGA4.1 software. These seven gene sequences of

Trichoderma isolates have been deposited (HQ265418,

HQ334993, HQ334994, HQ334995, HQ334996, HQ334997,

GQ995194) to the National Center for Biotechnology

Information (NCBI) GeneBank.

· Multiple sequence alignment of nineteen 18S rDNA gene

sequences of Trichoderma isolates (T. harzianum, T. asperellum

and T. erinaceum) was carried out in BIO EDIT software.

There were quite a number of gaps that were introduced

within the ITS-4 region which were closely related. The

evolutionary history was inferred using the UPGMA method

as well as the evolutionary distances were computed using

the Maximum Composite Likelihood method.

· DGGE analyses of 18S rDNA (320 bp with GC clamp) of

eight isolates of T. harzianum and seven isolates of phosphate

solubilizing fungi (PSF) were carried out by ampliflying the

region with the forward primer containing GC clamp at NS1

(5'-GTAGTCATATGCTTGTCTC-3') and GCfung (5'-

C G C C C G C C G C G C C C C G

CGCCCGGCCCGCCGCCCCCGCCCCATTCCCCG TTAC

CCGTTG-3'). Distinct band was formed for these isolates;

however separate bands formed in the gel was due to their

G+C variation in their ITS region of rDNA.

· Immunological formats of T. harzianum (NAIMCC-F-01965)

was developed for screening of biocontrol agent(s) directly

from soil using dot immunobinding assay, western blotting

and indirect immunofluorescence.

· A new potential plant growth promoting rhizobacteria

(PGPR) identified as Bacillus altitudinis (BRHS/P 22) isolated

from rice rhizosphere showed in vitro antagonistic activity

against Sclerotium rolfsii and Rhizoctonia solani. 16S rDNA

gene sequence (1352bp) has been deposited to Genebank

(Acc. No. HQ849482). This isolate also showed growth

promoting activity and plant (Phaseolus vulgaris) health

improvement in the field condition.

27


Conclusion

A total of 103 bacterial isolates, 22 fungal isolates were

isolated from hill regions of Darjeeling. Among them 15 isolates

were phosphate solubilizers; 26 were chitin degraders whereas 10

showed siderophore production; 26 showed protease activities;

31 showed amylase activities and 5 isolates showed antifungal

activities. PCR amplified products of ITS region of genomic DNA

have been obtained by specific primers for identification of

microorganisms followed by DGGE analysis. Diversity of

selected PSFs, BCAs, bacteria and actinomycetes with different

RAPD markers have been analysed. rDNA gene sequence of

BCAs deposited to the National Center for Biotechnology

Information (NCBI) GeneBank and phylogenetic diversity have

been studied using bioinformatics tools.


· Chakraborty, B.N, Chakraborty, U., Saha, A, Dey, P.L and

Sunar, K. (2010) Evaluation of phosphate solubilizer from

soil of North Bengal and their diversity analysis. World

Journal of Agricultural Science 6 (2): 195-200

· Chakraborty, B.N, Chakraborty, U., Saha, A, Dey, P.L and

Sunar, K. (2010) Molecular characterization of Trichoderma

viride and Trichoderma harzianum isolated from soils of North

Bengal based on rDNA markers and analysis of their PCR-

RAPD profiles. Global Journal of Biochemistry and Biotechnology

5 (1): 55-61

· Chakraborty, B.N., Chakraborty, U., Dey, P.L.and Sunar, K.

(2010) Phylogenetic relationship of Trichoderma isolates of

North Bengal based on sequence analysis of ITS region of

rDNA Journal of Applied Science and Research 6(10):1477-1482.

· Chakraborty, B.N., Dey, P.L., Shankar, R., Adhikari, J. and

Lama, D. (2010) Genetic relatedness between some

saprophytic and parasitic macrofungi of Darjeeling hills.

NBU Journal of Plant Sciences,4 : 77-80

· Chakraborty, B.N., Chakraborty, U., Rai, K., Allay, S. and

Dey, P.L. (2011) Molecular detection of fungal pathogens of

Citrus reticulata grown in Darjeeling hills and their

management. Acta Horticulturae (In Press).

· Chakraborty, B.N., Chakraborty, U., Sunar,K. and Dey, P.L.

(2011) RAPD profile and rDNA sequence analysis of

Talaromyces flavus and Trichoderma species. Indian Jounrnal of

Biotechnology [In press].


· National training on “Microbial identification and gene mining:

A bioinformatic approach” organized by NBAIM during

September, 01-10, 2010.

· National Symposium on, “Microbial diversity and Bio-

Prospecting” and North Zone Meet of Indian Society of

Mycology and Plant Pathology (ISMPP) organized by

Deparment of Botany, University of Jammu, during October

29-30, 2010

· International Conference on “Genomic Sciences-Recent

trends”, VII convention of Biotech Research Society, INDIA

(BRSI) and Indo-Italian Workshop on Industrial and

Pharmaceutical Biotechnology (IIWIPB) , organized by

Madhurai Kamraj University, during November 12-14,2010nd· 32 Annual Conference and Symposium on “Innovations in

Plant Pathology, Research and Human Resource Development”

organized by Junagarh Agricultural University and ISMPP,

during November 24-26, 2010.

· National Symposium on “Molecular Approaches for

Management of Fungal diseases of Crop Plants” organized by

Indian Institute of Horticultural Research, Bangalore, during

December 27 – 30, 2010

· International Conference on “Plant Science in Post Genomic

Era” organized by School of Life Sciences, Sambalpur

University, Orissa and The Society for Plant Physiology and

Biochemistry, New delhi during February 17-19, 2011.

Fig. Multiple sequence alignment of rDNA gene sequence [GU324073] of Talaromyces flavus (NAIMCC-F-01948) was also carried out with ex-type gene sequences obtained from NCBI gene bank using BIO EDIT software.


28

Biodiversity, characterization and conservation of cyanobacteria of Indo-Burma Biodiversity hotspots (NE Zoneof India) for harnessing of value added products

PI : O. N. TiwariCo PI : Sunil S. ThoratInstitute of Bioresources and Sustainable Development, Imphal, Manipur

Rationale

The North East region (Arunachal Pradesh, Assam,

Meghalaya, Manipur, Mizoram, Nagaland, Sikkim and Tripura)

of India forms a distinctive part of the Indo Burma biodiversity thhotspot which ranks the 6 among the 34 biodiversity hotspots of

the world and is a prime one among the two identified for the

Indian sub continent. The region also falls in the bio geographic tri

junction of the India, the Himalaya and the oriental landmass.

Cyanobacteria are oxygenic photosynthetic prokaryotes

possessing the ability to synthesize Chlorophyll-a. On the basis

the most recent 16S rDNA sequence analysis, cyanobacteria are

closely related to the Gram negative bacteria. Cyanobacteria

occurs and predominant in the vast array of habitats by its several

general characters and other special adaptive features. Many

species tolerate a great range of environmental conditions,

including extremes that usually or often exclude eukaryotic algae.

It is presumed that cyanobacteria evolved in the Precambrian well

before the Paleozoic boundary, and this is borne out by the

existence of microfossils of the middle and late Proterozoic that

are nearly identical morphologically to some living

cyanobacteria. Order Oscillatoriales of class cyanobacteria are

filamentous cyanobacteria without heterocysts and akinetes. The

genera of the oscillatoriales are traditionally distinguished from

one another primarily on the basis of presence or absence of

sheath. In addition to type of sheaths, the appearance of the

filament, false branching, and the colour of cells (pigments) have

been used as generic characters. At the species level, the cell size,

constrictions at the cross walls, cellular inclusions (granulations)

and cell shape (especially of the terminal cells of the trichomes)

have been the main taxonomic criteria by the traditional method.

Cells which synthesize chlorophylls invariably accumulate

carotenoids also, which apparently exert a protective effect on the

green pigment. Structurally they are in the form of a polyene chain

which is sometimes terminated by rings. Carotenoids occur as

isomers, namely all Trans, 9-cis, 13-cis, 5-cis forms have important

functions in photosynthesis, nutrition, and protection against

photooxidative damage. β- carotene is the major carotenoid in

cyanobacteria. Since carotenoids are non-toxic, they are desirables

coloring agents in the food industry as well as vitamin A

precursors. Most of the carotenoids commercially available are

chemically synthesized but there is increasing demand for natural

carotenoids as nutritional supplements because synthetic

carotenoids are dominated by trans β-carotene and natural forms

have more cis forms. Furthermore, carotenoids are frequently

used in dietary additives for poultry and aquaculture farming.

Products of carotenoid degradation such as ionones, damascones

and damascenones are also important fragrance chemicals that

are used extensively in the perfumes and fragrance industry.

Objectives

· Survey and isolation of cyanobacteria from different

ecological habitats of NE region of India (Manipur,

Meghalaya, Tripura, Nagaland, Mizoram, Arunachal

Pradesh, Assam).

· Cataloguing and Identification of potential strains for

natural pigments and biofertilizer.

· Development of optimized protocol for enhanced

production of natural pigments.


· Fifty (50) cyanobacterial strains belonging to 16 genera were

isolated from different ecological habitats of Arunachal

Pradesh, India were screened and identified for biochemical

characterization for Chl-a, phycobiliproteins (phycocyanin,

phycoerythrin and allo-phycoerythrin) and carotenoids for

value additions.

· Ten cultures selected are further undergone for detailed

taxonomical characterization and evaluation of the pigments

and ammonia excretion were conducted.

Conclusion

Fifty (50) isolates biochemically characterized, the following

have been selected for extensive characterization on the basis of

better performance during course of investigation i.e. For Chl-a:

Anabaena fuellebornii BTA 87: (19.49 µg/ml); Plectonema sp.BTA

287: (18.05 µg/ml); Westiellopsis prolifica BTA 253: (10.63µg/ml).

For Carotenoid: Scytonema malaviyensis BTA 186: (69.16µg/ml);

Anabaena fuellebornii BTA 87: (63.11µg/ml); Nostoc utermohli BTA

210: (59.45 µg/ml). For Phycoerythrin: Anabaena sp. BTA 125:

(152.34 µg/ml); Anabaena variabilis BTA 69: (132.05 µg/ml);

Anabaena naviculoides. BTA 61: (102.49µg/ml). For Phycocyanin:

Anabaena fuellebornii BTA 87: (197.83 µg/ml); Lyngbya truncicola

BTA 184: (151.00 µg/ml); Anabaena doliolum BTA 99: (142.78

µg/ml). For Allo-phycocyanin: Anabaena fuellebornii BTA 87:

(94.51 µg/ml); Anabaena doliolum BTA 99: (57.03 µg/ml); Lyngbya

truncicola BTA 184: (53.20 µg/ml). Ten selected cultures from the

Plectonema nostocorumHigh chlorophyll-a content

Anabaena fuelleborniiHigh carotenoids content

Phormidium bohneri High phycocyanin content

Nostoc spongiaeformeHigh allo-phycocyanin content

29


fresh water repository at IBSD, Imphal were taxonomically

characterized based on their morphology and habitats which

were collected from different ecological habitats of NE region of

India. Out of the ten cultures, Plectonema nostocorum BTA158 th (Chl-a =5.72 µg/ml of 30 day) Anabaena fuellebornii BTA125

th th(Carotenoid = 59.29 µg/ml 30 day; PE =152.34 µg/ml 30 day),

Phormidium bohneri BTA183 (PC=206.14 µg/ml of 15th day), thNostoc spongiaeforme BTA131 (APC=84.73µg/ml of 15 day),

Phormidium tenue BTA138 (144.75 µg/ml ammonia excretion of th30 day) were found to be the potential candidates for natural

dyes and for biofertilizers.


· S. Deepa Devi, Oinam, Gunapati, Indrama Devi, Th., Oinam,

Avijeet Singh, Tiwari, O.N. and Sharma, G.D. (2010): Ecology

and Biodiversity of Cyanobacteria. Assam University Journal

of Science and Technology: Biological and Environmental

Sciences Vol. 5. N.1: 6-13.

· Tiwari, O.N., Oinam, Gunapati and S. Deepa Devi (2010):

Development of potential starter culture of cyanobacterial

Biofertilizer to the terraced rice culture with special emphasis

of North east region of India. Assam University Journal of

Science and Technology: Biological and Environmental

sciences Vol. 6. N.1: 7-12.

· S. Deepa Devi, Thingujam Indrama & Tiwari, O.N. (2010):

Biodiversity analysis and reproductive cultural behaviour of

cyanobacteria of North east region of India having acidic

properties. Jour. of Plant Repro. Biol 2: pp.127-135.

· Oinam, Gunapati, Ojit Singh, K., and Tiwari, O.N. (2010): On

account of morphological and biochemical characterization

of some heterocystous cyanobacteria (nostocalean) of NE

Region of India falling under Indo-Burma biodiversity

hotspots towards having acidic properties. Biosci. Biotech.

Res. Comm. Vol. (3) No. (1): 26-32.

Exploitation of plant growth promoting rhizobacteria for sustainable agriculture

PI : Ashok KumarCo PIs : M. B. Tyagi, R. P. SinhaSchool of Biotechnology, Banaras Hindu University, Varanasi

Objectives

· Screening and isolation of diazotrophic bacteria from

Northern Plain especially from rhizospheric soils.

· Assessment of metabolic diversity among various

rhizospheric diazotrophic bacteria for plant growth

promoting ability such as N fixation, ammonia excretion, 2

IAA and siderophore production and P solubilization.

· Molecular diversity analysis employing various molecular

biological techniques.

· 16S rDNA amplification and sequencing for identification of

selected important isolates.

· Selection of most efficient strain having combination of all

the beneficial characters for use as PGPR.


· Cyanide production by PGPR appears to be added feature

and such isolates may be exploited as biocontrol agent.

· Community studies based on DGGE showed significant

diversity in bacterial populations in the rhizospheric soils of

same site in different seasons although bacterial profile

showed close homology to the samples collected in the same

season from a selected site.

· Estimation of in situ nitrogenase activity and IAA production

demonstrated that inoculated or the native isolates present in

the rhizosphere indeed act as plant growth promoting agent.

Estimation of IAA production in situ seems to be a novel

finding and needs detailed study.

· Nine isolates namely, VA8S1, VB4S6, C7S2, J2S5, MK11S3,

M2S3, GS8S5, MK11S2 and V1S7 showed excellent ACC

deaminase activity and could be exploited to manage the

ethylene stress, provided that they establish colonization in

rhizosphere of crop plants.

· Altogether 65 efficient isolates have been fully characterized

and identified by full length (8) and partial (57) sequencing of

16S rDNA.

· Based on sequencing results isolates such as Acinetobacter sp.

(VA2S2) and Cronobacter turicensis (M2S10) seem to be new

additions to the existing literature on rhizospheric bacteria

from North India.

Conclusion

Cyanide producing PGPR were used as biocontrol agent in

present study. Out of 65, only 9 isolates namely, VA8S1, VB4S6,

C7S2, J2S5, MK11S3, M2S3, GS8S5, MK11S2 and V1S7 were

showed excellent ACC deaminase activity and could be exploited

to manage the ethylene stress, provided that they establish

colonization in rhizosphere of crop plants. Based on sequencing

results isolates such as Acinetobacter sp. (VA2S2) and Cronobacter

turicensis (M2S10) seem to be new additions to the existing

literature on rhizospheric bacteria from North India.


30

Exploration and screening of fungal diversity in North-East India and their applications in agriculture

PI : Bhim Pratap SinghDepartment of Biotechnology, Mizoram University, Aizawl, Mizoram

Rationale

North East India, an important part of the Indo-Myanmar

biodiversity hotspot, supports some of the biologically richest

areas in the world, which affords it recognition as an area of global

importance. Today, the forest cover in this region is merely one

third of its geographical area, and the rate of habitat loss here is of

serious concern. Despite its importance, this region has remained

poorly explored, and all evidence suggests much of the region's

diversity is being lost without even being recorded. A serious

problem that hinders effective prioritisation and evaluation for

site-specific conservation attention is the lack of baseline

biological data. Till now, very limited and isolated efforts were

made to tapping of microbial diversity, identification, evaluation,

molecular characterization, bioprospecting and conserving them

for various applications from North-Eastern region of India. So, it

need to be explored, investigated and exploited the potential of

fungal population which are not only beautiful but also selfless.

Moreover, this area is yet to be explored for fungal potential. Due

to richness of microbial diversity, the microbes are identified as

vital resources for extraction of newer and important molecules of

agricultural utility and also for expression of new gene. Therefore,

a systemic exploration, exploitation, characterization and

conservation of culturable and unculturable microbial diversity in

NE India will open up a new opportunity to explore the vast

potentialities of endemic microflora of this hot zone (NE region)

and also to preserve as a precious asset of rare genetic resources of

the country.

Objectives

· Collection of environmental samples (soil, water, plant,

decomposed matter etc) from different habitts of North-

Eastern States of India.

· Morphological and biochemical characterization

(siderophore production, phosphate solubilisation,

extracellular enzyme production like amylase, protease,

chitinase, pectinase etc of isolated fungal isolates).

· Molecular identification of potential isolates by using ITS

and ITS-RFLP.

· Phylogenetic relationship analysis based on IGS and some

important metabolic genes like Translation Elongation

factors (TEF), endo phosphogalactsidase (endo-PG), beta-

tubulin etc.

· Development of methods for the mass formulation of

efficient isolates.


· Different environmental samples were collected from

different places of eight districts of Mizoram (Kolasib,

Aizawl, Mamit, Champhai, Serchip, Saiha, Lunglei, and

Lawngtlai) and all sample vials are being maintaining at 4°C.

· On the basis of morphological characters, a total 559 isolates

were selected from eight districts of Mizoram by using six

different media.

· Isolates were screened for the for phosphate solubilization

ability by using the specific medium. Out of 400 isolates

screened, 110 isolates showed phosphate solubilization with

varying zone diameter.

· Amplification of Internal Transcribed Spacers (ITS) was

carried out for the identification of fungi by using universal

primers.

· In total, 14 identified cultures have been deposited in

NBAIM culture collection, 31 sequences of ITS region have

been submitted to NCBI GenBank (HQ596902-HQ596925

and HQ658111-HQ658117).

· Amplification of IGS and some important metabolic genes

like Translation Elongation factors (TEF), endo

phosphogalactsidase (endo-PG), beta-tubulin is being

carried out from of the isolated organisms

· Sampling is completed from Assam.

Conclusion

In total 559 isolates were isolated from all the eight districts

of Mizoram. All isolates have been screened for the ability to

solubilise phosphorous. Molecular characterization by using

various genes is underway for the identification of isolated fungal

isolates. All the photographs of fungal isolates are kept in

digitized format. Identified cultures are being maintained on

slants and in mineral oil.


· S. Kanakala, C. Lalmingmawia, Bhim Pratap Singh.

Exploration and Characterization of Culturable Fungal Spp.

From Mizoram State of North-East India –at national

symposium on “Molecular Approaches for Management of

Fungal Diseases of Crop Plants” at Indian Institute of

Horticulture Research. December 2010.

· Mr Kanakala, SRF, attended National training program on

“Microbial identification and Gene Mining: A bioinformatics

Approach” from September 1-10, 2010, at NBAIM, MAU, U.P.

View of a sample collection site. P-Solubilisation efficiency. ITS-RFLP pattern of some of the isolates.

31


Exploration of plant pathogenic and antagonistic microbial resources associated with vegetableand spice crops of Andaman and Nicobar Islands

PI : Krishna KumarCentral Agricultural Research Institute, Port Blair, Andaman & Nicobar Islands

Rationale

Microorganisms constitute a huge and almost unexplained

reservoir of resources likely to provide innovative applications

useful to man. Because of its richness in overall species diversity,

India is recognized as one of the 12 mega diversity regions of the

world. Besides the recognized hot spots like Western Ghats and

Northeastern hill region in India, is endowed with other rich

biodiversity locales like Andaman and Nicobar Islands abode to

large unexplored microbial diversity. Therefore, existence of

agriculturally and industrially potential microbial strains with

diverse genetic resources cannot be ruled out in these regions. The

systemic exploration, exploitation, characterization and

conservation of culturable microbial diversity in Andaman and

Nicobar Islands, India will open up a new opportunity to explore

the vast potentialities of resident microflora of these regions and

also to preserve as a precious asset of rare genetic resources of the

country.

Objectives

· To isolate and characterize phyllosphere and soil borne plant

pathogens associated with vegetable crops and spices from

coastal agro-ecosystems of Andaman and Nicobar islands.

· To isolate and characterize antagonists (Pseudomonas spp.,

Bacillus spp. and Trichoderma spp.) associated with

rhizosphere of spices and vegetable crops.

· To evaluate in vitro the isolated antagonistic microorganisms

for their biocontrol and plant growth promoting properties.

· Molecular characterization and diversity analysis of isolated

plant pathogens and antagonistic microorganisms.


· A total of 22 Trichoderma spp isolated from Middle and North

Andaman and Hut Bay (6º to 14ºN and 92º to 94ºE) Islands

were characterized based on cultural, morphological and

antagonistic properties.

· Based on the cultural and morphological characterization the

isolates were classified into three section viz., Trichoderma

(clade: Rufa and Pachybasium A), Pachybasium B (clade:

Pachybasioides, Lutea, Virens and Lixii/Cataptron) and

Section Longibrachiatum. Under section Trichoderma three

species were identified as T. atroviride (5 nos), T. konigii (1), T.

hamatum (1). Under Pachybasium B Section six species were

identified as T. minutisporum (1), T. polysporum (1), T.

brevicompactum (1), T. virens (4), T. crassum (1) and T.

harzianum (1).

· In vitro antagonistic potential of Trichoderma spp showed

activity against R. solani (27.0%), Macrophomina sp (22.0%), S.

rolfsii (50.0%) and Fusarium sp (36.0%), respectively. Among

the isolates T. longibrachiatum and T. virens showed statically

good antagonistic activity against any of the three pathogens

tested.

· A total of 102 isolates were recovered from the site of Active

Volcano (Barren Island) (12º17'40.1 N; 93º50'54.5 E). These

isolates were studied for antagonistic, PGP, salt tolerance

and thermo-tolerant properties.

· Results revealed 10.8% isolates were grown up to 25% NaCl

(w/v) concentration and isolates BAN52, BAN88, BAN96

and BAN100 grown up to 30% NaCl (w/v) concentration,

20.6% of the isolates were showed thermotolerant properties

grown at 72ºC four isolates viz., BAN53, BAN74, BAN76 and

BAN92 were grown at 82ºC whereas, BAN53 was grown at

92ºC. In PGP, hydrolytic enzymes properties the isolates

showed positive to results to IAA (57.8%), siderophore

production (55.9%), phosphate solubilization (33.3%),

protease (41.2%), cellulase (23.5%), amylase (41.2%) and

lipase (25.5%), respectively.

· In antagonistic properties the isolates showed antagonistic

activity against S. rolfsii (14.7%), R. solani (19.6%) and

Macrophomina sp (29.4%). A total of 21 isolates (20.6%) were

showed all four properties viz., Antagonistic, PGP, salt

tolerant and thermo-tolerant properties. These isolates could

be used as bioinoculants in the extreme environments.

· Classical staining and biochemical properties showed most

of the isolates were belonged to Gram positive and belonged

to genus Bacillus spp. Further identification and confirmation

with Biolog and 16S rRNA gene sequence is in the process.

· Total 114 isolates from Middle and North Andaman Islands

were screened in vitro for their Plant Growth Promoting

(PGP) traits and hydrolytic enzymes.

· Isolates showed positive results to IAA (50.8%), phosphate

solubilization (58.6%) and siderophore (95.6%). All isolates

showed ammonia production whereas none of the isolates

showed HCN production. These isolates also produced cell

Barren Island(Active Volcano)

Antagonistic potential ofactive volcano isolates

Cellulase production byrhizobacteria


32

wall degrading enzyme; amylase (63.7%), cellulase (51.7%),

lipase (22.4%), pectinase (13.1%), chitinase (26.7%) and

protease (81.8%) on agar plate method.

· The potential isolates were identified by using physiological

and biochemical method using Himedia kit and belonged to

the genus Pseudomonas sp., Enterobacter sp., and Bacillus sp.

Conclusion:

A total of 218 bacterial isolates and 22 Trichoderma isolates

were screened for antagonistic, plant growth promoting

properties and hydrolytic enzymes properties, showed only very

few bacterial strains have all the properties together. In this study

we also observed few bacterial isolates could tolerate up to 30%

NaCl (w/v) and more than 80ºC. We have stored the bacterial

isolates having novel properties.


· Krishna Kumar, N. Amaresan, Someshwar Bhagat, K.

Madhuri and R.C. Srivastava. 2010. Isolation and

characterization of rhizobacteria associated with coastal

agricultural ecosystem of rhizosphere soils of cultivated

vegetable crops. World Journal of Microbiology and

Biotechnology (DOI 10.1007/s11274-010-0616-z).


Madhuri, P. Udayaraj and R.C. Srivastava. 2010. Genetic and

physiological relatedness of antagonistic Trichoderma isolates

against soil borne plant pathogenic fungi. Archives of

P h y t o p a t h o l o g y a n d P l a n t P r o t e c t i o n ( D O I

10.1080/03235408.2010.505362).


Madhuri and R.C. Srivastava. 2010. Unreported species of

Trichoderma isolated from tropical regions of Andaman and

Nicobar Islands in India. Journal of Mycology and Plant

Pathology. 40(3): 314-321.

· Krishna Kumar, Someshwar Bhagat, K. Madhuri, N.

Amaresan and R.C. Srivastava. 2010. Morphological and

Molecular Characterization of Colletotrichum species causing

Anthracnose disease in Bay Islands, India. Journal of Mycology

and Plant Pathology. 40(3): 322-330.

· Krishna Kumar, K. Madhuri N. Amaresan, Someshwar

Bhagat and R.C. Srivastava. 2010. First report of leaf

anthracnose caused by Colletotrichum gloeosporioides on egg

plant in Andaman and Nicobar Islands. Journal of Mycology

and Plant Pathology. 40(3): 464-466.


Madhuri and R.C. Srivastava. 2010. In vitro antagonistic

properties of some Trichoderma spp against root rot and foliar

pathogens. Indian Journal of Microbiology (Accepted-

Manuscript No. INJM-D-10-00171).

Seminar, Symposia and Conferences attendedth· 9 National Symposium on Crop Health Management for

Sustainable Agri-horticultural Cropping System held at

Central Agricultural Research Institute, Port Blair from 17-

19, Feb 2011.

Mapping, assessment of geographical distribution and in vitro conservation of agriculturally importantmicroorganisms of the Western Ghats

PI : D. RadhakrishnaCo-PI : B. C. MalleshaUniversity of Agricultural Sciences, GKVK, Bangalore

Rationale

The research work on microbial diversity and Identification

of Western Ghats has been carried out in the forest area situated in othe central region extending over the area 13.038 N latitude to

o10.883 N latitude, which includes the districts of Hassan, Kodagu,

Dakshinakannada and Chikmagalur. The grid system used for

soil sample collections from the forest regions. The grid, each of

6km area, covering districts of Hassan, Kodagu, Chikmagalur and

Dakshina Kannada forests. During this year forest soil samples

and other degrading wood samples were collected from different

forest regions covering Western Ghats of Kodagu district have

been surveyed and nearly 160 soil samples including decaying

wood and litter have been collected from different talukas.

Microorganisms have been isolated from these samples. Soil

microbial functional diversity determined based on the functional

properties namely, Lignin degrading microorganisms, Cellulose

degraders-Bacteria & Fungi, Chitin degraders, Vesicular

Arbuscular Mycorrhizae, phosphate solubilization, Fluorescent

pseudomonads. All the microbial isolates were evaluated for

there efficiency for different functional properties mainly,

nitrogen fixation, Phosphate solubilization, Plant growth

promotion biocontrol through plant bioassay and in vitro

analyses.

Objectives:

· Isolation, enumeration, characterization and inventorization

of AIM. (N fixers, P-solubilizers, VAM, PGPRs, fluorescent 2

pseudomonads, chitin decomposers, cellulose and lignin

degraders) along the central regions of Western Ghats in

Karnataka).

· Assess the geographical distribution and developing

thematic maps for the above groups of organisms.

· Assess the functional potentials of each group of organisms

for use in agriculture.

· Set up the culture bank of the potential isolates under each

group and deposit with the NBAIM.

· Set up the Western Ghats region specific database on the

population and diversity of AIMs.


• Samplings were done in different land use patterns of Hassan

forest region.

• Sixteen isolates of actinomycetes have been purified from

• Two bacterial isolates SAPSB1 and AEB1 that showed

efficient phosphate solubilisation activity on Pikovskaya's

Agar isolated and have been subjected to preliminary

characterization.

33


Kenknight's Agar medium from rhizosphere soils of forest

plants.

• Higher density of actinomycetes was observed due to high

humus content.

• Nitrogen fixing bacteria showed different bacteria based on

the morphology which needs molecular confirmation about

the isolates .

• Quantitative variations observed with different media used,

reflecting the diverse population or media utilization.

• A lignocellulolytic basidiomycetous fungi was isolated from

decaying wood. These fungi grown in laboratory failed to

produce fruiting bodies on any of the substrates.

• Thirteen distinct yeast colony morphotypes were isolated

from phylloplanes of A. occidentale, M. indica and S.

kathalekanensis .

• In total 121 is isolates of nitrogen fixing bacteria, 84

Pseudomonads, 56 phosphate solubilising bacteria, 20 lignocellulose fungi, 10 actinomyceces, 12 Trichoderma sp., and 20 yeast have been conserved and preserved.

Conclusion

Microbial diversity in the kodagu forest area showed varied

distribution depending on the forest type. Bacterial and fungal

population was maximum in evergreen forests than the

deciduous type. Bacterial population showed different

morphotypes from the same sample when different carbon

sources used. Fungal extracts when applied to soil showed

stimulatory effect on beneficial soil microorganisms. Yeast

population characterized and its functional properties studied for

further applications. Degradative properties of the efficient

decomposing fungi assayed for utilization of phenols. And also

cellulose and pectins. Comparitive degradation potentials of

white rot fungal isolates determined by comparison of phenol

content released.

Map showing the locationof sampling sites

Morphotypes of nitrogen fixing bacteria

Fungal isolate HE2F efficientlignocellulolytic from forest litter

Isolation and characterization of microorganisms from fresh water ecosystems

PI : N. K. MaitiCo-PI : Sri Prakash MohantyCentral Institute of Freshwater Aquaculture, Bhubaneswar, Orissa

Rationale

The unit of biodiversity is the species, which may be defined

as “a group of related organisms that is distinguished from similar

groups by a constellation of significant genotypic, phenotypic and

ecological characteristics.” The living organisms which are

components of the Earth's biodiversity can be harnessed, to

produce or modify products or undertake specific tasks or

processes that are commonly beneficial to human society, or

generate useful substances. Today, a variety of microorganisms

are used in different industrial applications as producers of

antibiotics, enzymes, food colorings, flavorings, organic acids and

vitamins. The discovery of a new potential industrial application

of a microorganism depends to a large extent upon the discovery

of new types of microorganisms and their metabolites. Therefore,

by focusing on the isolation and screening of new and rare

bacteria and fungi the possibilities of discovering new products

can be increased. Antibiotics and microbial enzymes are very

important products of microorganisms. Most commercial

antibiotics are produced either by fungi or by bacteria. Also, the

microbial enzymes are mainly focused on production processes in

the food industry, on production of washing powders and

detergents, and applications in the textile manufacture. Also,

many other important applications include organic synthesis,

medical diagnostics and research activities. Various enzymes

produced by the microorganisms are lipases, proteases, α-

amylases, ligninases, cellulases, hemicellulases, etc., find a wide

scale application in different aspects of industrial microbiology.

Freshwater ecosystems represent a unique ecosystem and may

harbor novel microbial flora. Microorganisms present in soil play

an important role in nutrient solubilization, mobilization and

recycling. They have wide potentialities by controlling soil-borne

pathogens, increasing nutrients availability and accelerating

decomposition of organic materials, and are anticipated to

increase fish production as well as maintain sound environments

for fish production. Microorganisms have the ability to rapidly

adapt to varied environmental conditions and utilize new

substances they encounter as their sole source of carbon and

energy. The aim of the project is to understand microbial


34

Orissa map showing sample (.)collection sites.

MspI digestion of 16S-rDNA PCR product ofammonia oxidizing bacteria.

Ammonia oxidising activity of bacterialisolates after 24 h incubation.

diversity in natural habitat.

Objectives

· To assess the microbial diversity from freshwater ecosystem.

· To assess the functional diversity of microorganisms isolated

from freshwater ecosystem.

· To find out the correlation between phenotypic and genomic

characteristics.

· To evaluate the comparative efficacy of molecular tests to

study the diversity of microorganisms.


· A total of 110 bacteria were isolated with different functional

types.-3· Load of different functional types were: Amylase- 1.2x10 to

-4 -3 -4 -31.4x10 , Cellulase-0.2x10 to 1.7x10 , Xylanase- 5x10 to -3 -3 -3 -3 -1.4x10 , Lecithinase- 2x10 to 6x10 , Protease-0.4x10 to 2x10

3 -3 -5, Zinc, Lead, Arsenic, Cobalt- 2.4x10 to 1.2x10 .

— 24 bacterial isolates showed resistance to 0.5mM methyl

parathion out of which 9 isolates degrade p-nitrophenol, a by

product of methyl parathion degradation pathway and

produces nitrite from p-nitrophenol.

— Kinetics of enzyme endoglucanase of three strains of Bacillus

subtilis was studied.

— Endoglucanase gene of three isolates of Bacillus subtilis were

cloned and sequenced in order to find out correlation

between gene sequence and enzyme activity.

— Twenty one ammonia oxidizing bacteria like P. aeruginosa,

Citrobacter spp., Morganella morganii, P. fluorescens, Alcaligens

feacilis and Prividencia vermicola were isolated, of which five

were having terminal denitrification activity, which reduces

nitrate to nitrite. In addition, these isolates were also positive

for cellulase, lipase, protease and phophatase and also grow

in presence of arsenate and arsenite.

— The enzymes associated with ammonia oxidation were

estimated and the all isolates were found to express

ammonium monooxygenase, nitrite reductase and nitrate

reductase enzymes in ammonium nitrate medium at

elevated level as compared to control.

— Genotyping of ammonia oxidizing bacteria were carried out

by16S PCR-RFLP.

— Nitrite reductase AMO genes were detected in the ammonia

oxidizing isolates by PCR.

— A total 40 arsenic resistant bacteria were isolated of which 39

isolates showed growth upto 200 mM of arsenate where as

in arsenite 18 isolates showed growth upto 100mM.

— In redox transformation assay 17 isolates reduced arsenate

and two isolates caused both reduction and oxidation.

— Reductase gene was identified in 21 isolates by PCR.

— From hot spring Bacillus licheniformis, Brevibacillus

limnophilus, Klebsiella pneumoniae. Paenibacillus popillae.

Leclercia spp., Pseudomonas aeruginosa were isolated which 0produce proteases and celluase enzymes at 45-55 C.

— 16S r DNA of 61 bacteria have been sequenced.

Conclusion

In freshwater ecosystems wide varieties of functional types

were present. The predominant functional types are multiple

heavy metal resistant bacteria, although other types were present

but their abundance are less. Nine methyl parathion degrading

bacteria which degrade methylparathion to nitrate are probably

promising candidates for bioremediation of pesticides. Higher

endoglucanase activity of Bacillus subtilis depends on presence of

certain amino acids in the gene. Several bacteria were isolated

from hot spring which grows in arsenate upto the concentration of

200Mm.

Diversity analysis of diazotrophic bacteria from wheat cropping system of different agroclimaticzones of Punjab

PI : S. K. GosalCo-PIs : G. S. Saroa, Yogesh VikalPunjab Agricultural University, Ludhiana, Punjab

Objectives

· To study the taxonomical and functional diversity for

diazotrophs in different agroclimatic regions of Punjab for

sustainable agriculture.

· Conservat ion of microbial divers i ty for their

commercial/genetically exploitation in future.


· A total of 180 diazotrophs were isolated from different

35


agroclimatic regions. Fifty-five diazotrophs out of 180

isolates were found to solubilize phosphorus showing dual

activity.

· Forty eight isolates were found to be positive for Nif H in

Central Plain and twenty six from Flood plain region, using

two different Nif H primers (Nif H1 and Nif H2).

· At 40% similarity coefficient the isolates belonging to Central

plain region and flood plain region were grouped into two

major clusters and further in subgroups indicating that

genetic diversity exists for diazotrophic isolates in different

region of Punjab.

· Cultures were identified on partial 16S rRNA gene

sequencing and were identified as Stenotrophomonas

maltophilia, Bacillus amyloliquifaciens, Bacillus circulans,

Pseudomonas aeruginosa, Paenibacillus sp., Paenibacillus panacisoli, Azotobacter vinelandii, Paenibacillus amyloliticus,

Pseudomonas putida, and Bacillus subtilis.

· Paenibacillus amyloliticus was isolated from soil having pH 5.3

and higher ammonical nitrogen as 110 mg/kg whereas

Azotobacter vinelandii and Pseudomonas putida were isolated

from soil having high ammonical nitrogen 119 mg/kg.

· Identified cultures were tested for PGP activity under glass

house conditions using maize as host and Bacillus subtilis was

found to be the best in terms of plant growth parameters and

Pseudomonas putida in terms of nitrogen uptake.

Conclusion

A total of 180 diazotrophs were isolated from different

agroclimatic regions. Fifty-five diazotrophs out of 180 isolates

were found to solubilize phosphorus showing dual activity.

Cultures were identified on partial 16S rRNA gene sequencing

and were identified as Stenotrophomonas maltophilia, Bacillus

amyloliquifaciens, Bacillus circulans, Pseudomonas aeruginosa,

Paenibacillus sp., Paenibacillus panacisoli, Azotobacter vinelandii,

Paenibacillus amyloliticus, Pseudomonas putida, and Bacillus subtilis.

Paenibacillus amyloliticus was isolated from soil having pH 5.3 and

higher ammonical nitrogen as 110 mg/kg whereas Azotobacter

vinelandii and Pseudomonas putida were isolated from soil having

high ammonical nitrogen 119 mg/kg.

Pot experiment under glass houseconditions using maize as host.

PCR amplification using(a) Nif H1 (b) Nif H2 primers.

Phylogenetic tree of identifiedbacterial cultures.

Microbial diversity and identification: fish microbes

PI : Imelda JosephCentral Marine Fisheries Research Institute, Ernakulam, Cochin, Kerala

Rationale:

Prokaryotic microorganisms compromise a large portion of

the organic biomass of the world's ocean and play an important

role in essential biogeochemical cycles and food webs in this

ecosystem. In particular surface colonization by microorganisms

is ubiquitous in marine systems with a large proportion of

microbes occurring as complex communities. Often the negative

impacts of microorganisms on humanity occur at surfaces- be it

the surfaces of seafood (fish, oysters etc.) or fouling of ships' hulls.

However, despite their importance, comparatively little is known

about the phylogenetic composition of this complex microbial

population and the functional roles of their members. Living

surfaces are ideal system in which to explore colonization by

microorganisms because eukaryotes are subject to a constant

bombardment from the millions of microbial cells typically found

in a milliliter of seawater. Alternatively, disease-causing microbes

might already be present on fishes and their surroundings. So a

survey and analysis of bacteria associated with marine fish give an

indication of the environmental condition like water quality, feed

availability, productivity etc, or the presence of pathogens, which

may cause havoc to the system or to the consumers. Also many

associated bacterial strains find wide application in agriculture

and allied sectors based on their biochemical/ physiological

characteristics.

Objective:

· To screen bacterial groups from selected marine fish and

shellfish.

· To identify the selected groups by physiological and

biochemical tests.

· To identify microorganisms using ribosomal RNA gene

sequences.

· To develop 16S group probes for assessing the diversity of

bacterial groups.

Significant Achievements:

· Sample collection: Healthy live marine fish and shrimp

samples were collected from Karwar (N- 13°05.722'; E-

079°48.658') and Mangalore regions (N- 12°51.232'; E- 074°

50.012' & N- 13°20.808'; E- 074°42.083') of Karnataka,

Bhimavaram (N- 16°23.094'; E- 081°37.440') and

Visakhapatnam (N- 17° 41'42”; E- 083° 18'06”), Andhra

Pradesh and from Kochi, Kerala.


36

Pigmented skin isolates fromMugil cephalus and Johnius sp.

Penicillin sensitivity (22 mm dia) expressed byan isolate from Liza macrolepis.

· Phenotypic characterization has been completed for 16

bacterial strains isolated from Malabar thryssa Thryssa

malabarica, Jew fish Nibea solado, Seven-finger threadfin

Polynemus heptadactylus, and Small-scale tongue sole

Cynoglossus microlepis from Calicut, Kerala. Vibrio spp. was

the dominant strain on skin, gills and viscera of the fishes.

Apart from Vibrio spp., the other isolates found in the viscera

were Pseudomonas and Staphylococcus spp.

· Phenotypic characterization for 43 bacterial strains from false

trevally Lactarius lactarius, Pugnose pony fish Secutor

insidiator, Croaker fish Johnius spp., Bloch's gizzard shad

Nematalosa nasus and Indian pompano Trachinotus mookalee,

from Site 1 at Karwar has been completed. Pseudomonas spp.

was the dominant isolate in the skin gills and viscera. Gills

also harboured Arthrobacter, Bacillus, Enterobacteriaceae ,

Microcoocus and Vibrio spp. Other isolates from the viscera

were Aeromonas, Arthrobacter and Vibrio spp.

· Phenotypic characterization completed for 5 bacterial strains

from large scale mullet Liza macrolepis, from Kochi, Kerala.

Bacillus spp. was the dominant strain on skin, gills and

viscera of the fish. Apart from Bacillus spp., the isolate found

in the skin was Micrococcus spp. and that in the gills was

Arthrobacter spp.

· Phenotypic characterization completed for 12 bacterial

strains, isolated from the skin, gills and gut of Milk fish

Chanos chanos and Mozambique tilapia Tilapia mossambica, 2

strains from the gut of live white-leg shrimp Litopeneaus

vannamei from Bhimavaram, Andhra Pradesh. Skin and gills

of the fishes harboured Pseudomonas and Arthrobacter spp.,

whereas isolate found in the viscera was Acinetobacter spp.

Enterobacteriaceae spp. was the only visceral isolate from

white-leg shrimp.

· Phenotypic characterization completed for 38 bacterial

strains, isolated from the skin, gills and gut of Silver ribbon

fish Lepturacanthus savala, Monocle bream Parascolopsis

aspinosa, Whipfin mojjara Gerres filamentosus, Indian scad

Decapterus russeli and Dusky finned bull's eye Priacanthus

hamrur, and for 5 bacterial strains from the gut of prawns,

Kadal shrimp Metapenaeus dobsoni and Speckled shrimp M.

monoceros from Site 1 at Mangalore. Micrococcus and

Pseudomonas spp. were the dominant strains on the skin and

gills. Other isolates on gill were Acinetobacter, Arthrobacter

and Moraxella spp. Viscera was dominated by Arthrobacter

spp. and other isolates were Micrococcus and Pseudomonas

spp. Acinetobacter and Bacillus spp. were the visceral isolates

of speckled shrimp and that of Kadal shrimp was

Pseudomonas spp.

· Phenotypic characterization has been completed for 31

bacterial strains, isolated from Red-filament threadfin bream

Nemipterus mesoprian, Flat-head grey mullet Mugil cephalus,

Croaker fish Johnius sp. and Lutkei's half-beak Hemiramphus

lutkei collected live from Site 2 at Mangalore. Pseudomonas

and Acinetobacter spp. were the dominant isolates of skin,

gills and viscera. Other isolates include Micrococcus spp. on

skin, Lactobacillus spp. on gills and Arthrobacter spp. in the

viscera.

· Twenty five bacterial cultures comprising halophilic,

pigmented, alkaliphilic, and heat tolerant strains were

identified using 16S rRNA sequence analysis.

· Eight bacterial cultures of different functional properties

were submitted to the nodal centre (NBAIM) along with their

passport data.

· Work in progress includes isolation of bacteria from

Visakhapatnam (AP) samples.

Conclusion:

During 2010-11, a total of 152 bacterial strains have been

isolated, of which 145 strains were from 21 marine finfish species

and 7 from 3 shrimp species. Study on functional diversity of the

bacterial isolates from different marine fishes and shrimp have

shown many of them to be halophilic, alkaliphilic, heat tolerant,

pigmented or fluorescent. Molecular characterization of 25 strains

having distinct functional properties was done and 8 different

strains along with their passport data have been submitted to

NBAIM culture collection.


· Susmitha, V., Imelda-Joseph and Anu-Mathew, 2011.

Isolation and characterization of extremely halophilic

bacteria Halomonas aquamarina and Halomonas marina from

trigger fish Abalistes spp. Presented in the International

Conference, Asian Pacific Aquaculture- 2011 at Kochi (17-20

January, 2011), Abstract No: 485.

· Anu-Mathew, Imelda-Joseph and Susmitha, V. 2011.

Characterization of Pseudomonads isolated from Indian

pompano Trachinotus mookalee. Presented in the International

Conference, Asian Pacific Aquaculture- 2011 at Kochi (17-20

January, 2011), Abstract No: 339.

37


Diversity, genetic improvement and cultivation of the medicinal mushroom Reishi (Ganoderma lucidum)

PI : R.D. RaiCo-PI : Ranjeet Ranjan KumarDivision of Biochemistry, Indian Agricultural Research Institute, New Delhi

Rationale

Reish or Ling Zhi (Ganoderma lucidum) is therapeutically as

well as commercially the most important mushroom of the world;

global trade of this mushroom and its products has crossed 3bn $

mark and annual trade in India has been estimated at Rs. 500

crore. China with 70% share in the global trade has almost a

monopoly over this mushroom. With a view to exploiting this

mushroom for health as well as financial benefits, it was thought

important by the Indian Council of Agricultural Research to

develop technology for its production and a breakthrough in this

direction was achieved at the National Research Centre for

Mushroom, Solan. However, need was felt to strengthen the

program with respect to collecting, identifying and exploiting the

indigenous Ganoderma lucidum strains and small beginning was

made by launching a sub project on this mushroom, in the theme

Microbial Diversity of the ambitious AMAAS project of ICAR,

being coordinated by the NBAIM Mau. More than 100 species

have been described in the genus Ganoderma but with the latest

molecular tools about 30 species have been selected to be true ; rest

turned out to be synonyms. But academically, therapeutically as

well as commercially, Ganoderma lucidum is most important and

to the extent that even other species (G. tsugae, G. sinense) are

produced and marketed as G. lucidum. In view of the above, the

project aims at collecting, identifying and exploiting the

indigenous G. lucidum strains only; India, a predominantly

tropical and sub-topical country is rich in the Ganoderma

germplasm. Besides microbial diversity, refinement and

improvement in its production technology and understanding

the molecular mechanisms of its growth and fruiting have also

been proposed to be addressed to which may lead to finding

superior indigenous G. lucidum strains with respect to the health

and commercial benefits.

Objectives

· Molecular characterization of newly collected strains

· Preliminary yield trials

· Isolation of SSIs for genetic improvement from selected high

yielding strains

· Improvement in production technology – newer substrates,

supplements and improved cultural practices

Significant achievements

· One hundred and five specimens of Ganoderma spp. were

collected from Delhi,Haryana,Chandigarh and Himachal

Pradesh, out of which 25 yielded positive mycelium culture

· One highly sporulating strain was most significant collection

– Ganoderma spores are highly prized and have very big

market

· Five cultures were molecularly identified as G.lucidum based

on sequencing of 5.8s r DNA

· One strain turned out to be a true Ganoderma tsugae

· Oil palm bunch waste and coconut leaf rachis were found to

be the best substrates for the production of extracellular

degradative enzymes viz. laccase, lignin peroxidase (LiP), ++ Mn peroxidase (MnP) by G. lucidum

· Newer substrates namely sawdust of Jamun and Mahua

were tried for cultivation of G. lucidum but the yields were

significantly lower than that on mango sawdust

· However, no significant progress could be achieved in

germinating the spores of G. lucidum - addition of succinate

proved futile but presoaking (10h) followed by boiling (2

min) gave encouraging results.

Conclusion

North India is also a significant area for finding true

Ganoderma lucidum. Some very shining and highly sporulating

strains of G lucidum were collected. Mango sawdust + wheat bran

were the best substrates for production of G. lucidum. Coconut leaf

rachis and Oil palm bunch were also found to be the promising

substrates but the technology of their use needs further

investigation. Above mentioned substrates were found superior

for production of lignin modifying enzymes, namely laccase, ++lignin peroxidase and Mn peroxidase.

Paper published from AMAAS work:

· Rai, RD and Kumar, RR. (2011). Dynamic production of the

lignolytic enzymes during various stages of mycelial growth,

fruiting and development of Ganoderma lucidum. Int. J. Med

Mushroom (in press)

· Kumar Satish, Sharma, VP and Rai, RD (2009). Lassioderma

serricone Fabricius pest of dried Ganoderma spp. Mushroom

Res. 18(2): 91-92

Development of a library of putative probionts from freshwater environment belonging to the group lactic acidbacteria for application in freshwater aquaculture system

PI : Sri Prakash MohantyCo PI : N. K. MaitiCentral Institute of Freshwater Aquaculture, Bhubaneswar, Orissa

Rationale

Fish diseases are one of the major problems in the

aquaculture industry. Although vaccines are being developed

and commercially produced, there are limitations in using them

as a regular disease control measure. Unlike terrestrial animals,

there are inherent difficulties in vaccination of aquatic animals

like fish. The use of antibiotics to cure bacterial infection and

prevent fish mortality in aquaculture is becoming limited as

pathogens develop resistance to the drugs administered. Again,

beneficial bacterial flora are killed or inhibited by antibiotic

administration/application in ponds/water bodies, leading to

the felt necessity of finding alternate disease prevention methods


38

such as exploring the use of non pathogenic bacteria as probiotic

agents. The use of commercial probiotics in fish and its efficacy

has been under scanner. Different investigators have reported

with various degree of success and failure on the use of such

probiotics as a formidable alternate to general vaccination. Hence,

there is possibility in finding native probiotics from

fish/freshwater aquaculture systems and employing them as fish

probiotics, as they are expected to well adapt the fish intestinal

environment and exhibit their action. Hence, the investigations

are being carried out with specific objectives, which will have

practical field utility, once the isolates are characterized and tested

under controlled conditions.

Objectives

· To isolate and identify Lactic acid bacteria (LAB) from

freshwater aquaculture system.

· To authenticate LAB isolates as potential probiotics through

controlled wet laboratory experimentations.


· Freshwater fish samples of Indian Major Carps were

collected from organized as well as unorganized aquaculture

sectors.

· Method was standardized for the isolation of lactic acid

bacteria from fish intestinal samples.

· 17 intestine samples were analyzed and 15 isolates were

presumed to be lactic acid bacteria.

· 16S partial rDNA sequencing was done for all 15 isolates and

six isolates were found belonging to the genus Lactobacillus

and one to genus Pediococcus.

Conclusion

The original title approved 'Development of a library of

Putative Probionts from marine environment belonging to the

genus Pseudomonas, Micrococcus and Bacillus for application in

marine system' was under review as CIFA, Bhubaneswar is a

Freshwater Aquaculture Research Institute. Consequently, the

title was modified as 'Development of a library of Putative

Probionts from Freshwater environment belonging to the group

Lactic acid bacteria for application in freshwater aquaculture

system' during the last review meeting in August 2010. Further

isolation of lactic acid bacteria from fish intestine are on and after

identifying, characterizing and putting them to different tests,

strains will be submitted to NBAIM.


· Undergone Overseas training for three months to Auburn

University, Alabama, USA from 11 October 2010 to 10

Janvary 2011.

Diversity of lactic acid bacteria in fermented food and dairy products from food and dairy units located inSouthern Rajasthan

PI : R. SrinivasanCo PIs : P. Subramanian, N. S. RathoreCollege of Dairy and Food Science Technology, Maharana Pratap University of Agriculture and Technology, Udaipur, Rajasthan

Rationale

Rajasthan is India's largest state with population of 56 million

and a density of 165 persons per sq. kms. The state is characterized

by diverse terrain ranging from desert and semi-arid regions of

western Rajasthan to the greener belts east of the Aravalis and the

hilly tribal tracts in the south-east. More than 60 percent of the

state's area is desert with sparsely distributed population.

Agriculture is dependent on rainfall and failure of monsoon

causes severe drought and scarcity conditions. After agriculture,

cattle and other livestock are the most important sources of

livelihood in the state, especially for the poor. In the western

regions of the state, with limited farming potential, livestock

provides livelihood security. Animal husbandry is a more stable

source of livelihood than farming since it is less affected by failure

of rains than is agriculture. Animal husbandry contributes over

13% to the gross domestic product. Rajasthan with the highest

livestock population in India contributes nearly 40% of wool

production and 10% of all milk production in the country.

Rajasthan is being the third largest milk producing state in India.

It is with this background this study is being carried to obtain the

diversity of Lactic acid bacteria from southern parts of Rajasthan.

Objectives

· Survey and Isolation of Lactic Acid Bacteria (LAB) from

fermented food and dairy products from different food and

dairy units located at southern parts of Rajasthan.

· Characterization of the isolates using biochemical and

molecular methods.

· Identification of LAB up to species level using 16S rDNA

amplification and sequencing.

· Preservation of the cultures isolated and characterized and

submission to culture collection.

· Screening of the isolates for the production of bacteriocins

(like nisin, etc.) and other antimicrobial substances.

· Testing for their effect on different spoilage organisms

obtained from culture collection.

· Testing for their role in food preservation and

characterization of the selected isolates' antibacterial

compounds.

· Production of nisin and/or other antimicrobial compounds

at laboratory scale to study for scaling up purpose.


· Three survey works have been conducted to cover the entire

region of southern Rajasthan covering the latitude ranging

from 23º 30' N to 25º 56' N and longitude ranging from 71º 25'

E to 76º 33' E.

· A total of 675 samples like milk, curd, buttermilk were

collected from different possible sources viz., cow, buffalo,

goat, sheep, camel from various dairy units, individual

farmer's households.

· A total of 470 Lactic acid bacterial (LAB) isolates were

isolated by using selective media MRS and M17 at different

39


Morphological studies: SEMview of Lactobacillus.

Screening for bacteriocin activityby LAB isolates

PCR amplification of 16S rDNAof LAB isolates

incubation temperatures viz., 30º, 37º and 45º C so as to obtain

all possible LAB isolates available from the samples.

· Biochemical characterization of LAB isolates was done for all

LAB isolates and tentatively identified up to species level

· Molecular characterization of LAB isolates viz. isolation of

genomic DNA, PCR amplification of 16S rDNA gene and

restriction of amplified DNA products using various

restriction enzymes viz. HaeIII, HindII, EcoRI and sequencing

16S rDNA gene of selected isolates is being carried out.

· Screening for bacteriocin production by the LAB isolates

against food spoilage/pathogenic organisms like

Staphylococcus aureus and Micrococcus luteus was done and 40

out of 470 isolates screened were showing antibacterial

activity.

· Five among 40 bacteriocin positive isolates were further

studied for their chemical nature (protein) to confirm the

antibacterial factor as bacteriocin, and tolerance to high

temperature up to 100ºC.

· A total of 60 yeast isolates which can utilize lactose were also

isolated by using selective medium.

· Yeast isolates were screened for their protease (rennin like

enzyme) production by curdling without acid production

and 9 isolates were found positive.

· Characterization of lactose utilizing yeast isolates is being

carried out using ITS amplification and restriction analysis.

Conclusion

A diverse lactic acid bacteria were isolated from fermented

food and dairy products from all possible sources like milk, butter

milk, curd from cow, buffalo, goat, sheep and camel.

Identification based on 16S rDNA revealed significant diversity

among lactic acid bacteria. Biochemical analysis revealed

bacteriocin production by majority of isolates. Which can be

utilised further to prevent food spoilage by pathogenic

organisms. Many yesat have potential in food industries because

of advantages of curdling of milk without acid production.


Participated in International Conference on 'Aquatic

Microbiology (Status, Challenges and Opportunities)' held on

September 2-4, 2010 at CAS in Marine Biology, Faculty of Marine

Sciences, Annamalai University, Parangipettai.


40

Theme :Nutrient Management, Biocontrol and PGPR

Exploration, collection and characterization of some agriculturally important biocontrol agents suitable fordisease management

PI : D. K. AroraCo-PIs : Alok K. Srivastava, Sudheer KumarNational Bureau of Agriculturally Important Microorganisms, Mau

Rationale

Bacillus spp. is the best-characterized antagonistic bacterial

genus, and has become a paradigm organism of Gram-positive

bacteria. Bacillus spp. has many characteristics as an excellent

biocontrol agent, including the production of structurally diverse

antibiotics, formation of viable spores, promotion of plant

growth, and an ubiquitous presence in soil. Some of the well

documented characteristics of Bacillus spp. related to soil fertility

and plant nutrition optimization are the production of bacterial

phytohormones and/or the solubilization of mineral phosphates.

Additionally, strains of Bacillus have also paramount advantages

over other biocontrol bacteria in several manners such as they are

mostly soil inhabitants, capable of sporulation, easy to cultivate,

has long shelf life and some strains have been shown to increase

yields of various crops. The study of genotypic and phenotypic

diversity of Bacillus spp. and their plant growth-promoting

potential is important not only for understanding their ecological

role in the rhizosphere and the interaction with plants, but also for

a number of biotechnological applications. Moreover, there is

very limited knowledge regarding the biological suppression of

soilborne pathogens affecting chickpea by the application of

PGPR in India.

Objectives

· Selection of antagonists for pathogens (Fusarium spp.).

· Screening and selection of potential antagonistic isolates for

important field crops.

· Characterization of active principle responsible for

antagonisms.

· Dosage standardization and delivery system.

· Determination of shelf-life of formulations.

· Mass multiplication of antagonists.

· Field evaluation of potent bio control agents.


· A total 480 bacterial strains were obtained from the

rhizosphere of different crops from Indogangetic plain

regions (Mau, Varanasi, Lucknow and Kanpur) of India. All

the strains were tested against three plant pathogenic fungi

viz., Fusarium oxysporum f sp. ciceri (FOC race1) Fusarium

solani (FS) and Macrophomina phaseolina (MP) Out of them,

only fourteen bacterial strains (B-CK11, B-ML26, B-PV53, B-

CL94, B-PL125, B-MV146, B-WM77, B-MM208, B-WV249, B-

CV280, B-CM331, B-CL392, B-PK413 and B-PM444) showed

significant inhibitory effect on mycelial growth (>5mm

diameter) against all the three plant pathogenic fungi.

Similarly, culture filtrates of Bacillus spp. inhibited radial

colony growth of FOC race 1, FS and MP at varying degrees.

Strain B-CM331, B-TM444, and B-WM177 were the most

efficient antagonists and showed 38.33, 37.03 and 36.80 mm

inhibition zone against FOC race 1, respectively. Similar

trends were observed with other two pathogens. All potent

antagonistic bacteria viz. B-CK11, B-PV53, B-PL125, B-

WM177, B-MM208, B-CM331, B-PK413 and B-PM444 were

selected on the basis of this test for greenhouse evaluation

against chickpea wilt.

· The cluster analysis based on pair-wise coefficient similarity

with UPGMA of BOX-PCR resulted into seven distinct

Phylogenetic analysis of antagonistic strains of Bacillus based on nucleotide sequence of 16S rDNA.

41


Evaluation of endophytic fungus for growth promotion and biocontrol

PI : Alok K. Srivastava Co-PI : Sudheer KumarNational Bureau of Agriculturally Important Microorganisms, Mau

genomic clusters and at 80% similarity coefficient generated

eight distinct BOX profiles.

· Based on 16S rRNA gene partial sequencing, similarity

values above 97% suggested that all strains viz. Lysinibacillus

fusiformis (B-CK11, B-CL9 and B-MV146), Lysinibacillus spp.

(B-ML26, B-WV249, and BRL392), Bacillus cereus (B-PV53 and

B-CV280), B. subtillus (B-RM 177, B-CM331 and B-TM444), B.

thuringiensis (B-TK433) and Bacillus spp. (B-PL125, B-

MM208) belongs to genus Bacillus and Bacillus derived

genera. Partial 16S rRNA gene sequences of the strains were

submitted to NCBI GeneBank under the code RSNPB 1 -14

and the following accessions were obtained: HM588141-154.

Conclusion

Bacillus strains with their multifunctional properties will

magnetize researchers in the field of biofertilization and

biological control. Present investigation revealed the genotypic

and functional diversity of Bacillus strains with innate potential of

mineralizing phosphate, plant growth promoting traits and

biocontrol properties. Knowledge generated on biodiversity of

Bacillus strains will be useful to design strategies to use these

strains as bioinoculants for the effective management of soilborne

pathogen affecting chickpea under field conditions.

Rationale

Endophytic fungi, residing almost ubiquitously inside the

fresh healthy tissue of plants, have been accepted as a big but

nearly untapped microbial reservoir that can be expected to

provide a wide variety of structurally unique and/or biologically

potent natural products. Fungal endophytes live within their host

plants without causing any apparent disease symptoms (Bacon et

al., 2000; Promputtha et al., 2005; Wang et al., 2005). Vegetable

crops constitute the main nutrient resources for more than two-

fifth of world's population providing food security to the growing

human population. Vegetable plants are attacked by many

diseases such as damping-off, wilt, root-rot disease caused by

various phytopathogens, which result in low yield and quality of

the crop (Kamath, 1982). Application of chemical fertilizer to

control the disease is not only very much effective, but also

hazardous to environment. In search for effective strategy for

disease management biological control is an eco-friendly

substitution to chemical fertilizers.

Objectives

· Isolation of endophytic fungus.

· Identification and characterization of endophytic fungus.

· Molecular characterization of endophytic fungus.

· Determine endophytic microbial diversity.


· Plant parts namely leaves and root from different vegetable

crops were collected from the field and examined for the

isolation of endophytic fungi.

· Total 110 isolates of endophytic fungi were isolated from

different plants from Indo-gangetic plains. The isolates were

maintained at 28±2°C.

· The isolates were characterized on the basis of morphology,

growth characteristics and production of various metabolites

including IAA, siderophore, ammonia, and HCN.

· The variability within the ITS amplified regions is being

investigated by restricting this fragment with restriction

enzyme MboI. However, no substantial polymorphic pattern

among the isolates was found by in ITS region with this

restriction enzyme on 2.5% agarose.

· The 550 bp ITS product of 12 isolates were further purified

and sequenced on ABI cycle sequencing using Sanger's

sequencing technique. The sequence was aligned using

BLASTn for identification and submitted to NCBI database.

· Enzymatic study of the identified endophytic cultures from

Indogangatic plain was carried out for protein assay, β

endoglucanase assay, proteinase and chitinase estimation.

· Endophytic cultures were checked for their ability to

enhance plant growth and biocontrol in tomato plant under

of pot experiment studies.

· After one month, plants were uprooted for measurement of

root length, shoot length, fresh and dry weight of shoot and

root for assessing the plant growth promotion in presence of

endophyte.

· Studies were carried out to establish endophytic nature of

fungi using plant leaves

Conclusion:

All endophytic cultures were isolated and identified by 18S

rRNA sequencing. All identified isolates have been characterized

on the basis of hydrolytic enzyme and they shows ability to

promote the plant growth in the greenhouse evaluation.


42

Biocontrol of soil borne plant pathogen and growth promotion in vegetable crops

PI : Sudheer KumarCo PI : Alok K. SrivastavaNational Bureau of Agriculturally Important Microorganisms, Mau

Rationale

Among soil borne plant pathogen, fungi are considered

important plant pathogens, particularly members of the genera

Fusarium and Rhizoctonia which as they to infect a wide range of

vegetable crops including tomato, potato, cucumber, etc. The

control of these diseases is a big challenge as they form the

resistant structures like spores. At present, main focus is on the

exploitation of bacteria as biocontrol agent (BCAs) for the control

of these pathogens and reduce the use of chemical agents. These

PGPBs (plant growth promoting bacteria) colonize rhizosphere

and produce certain signaling molecules and sometime provoke

induce systemic resistance at the time of fungal invasion. So,

BCAs have disease control tendency with the growth promotion

in crops. The most commonly used antagonistic bacteria are

Bacillus and Pseudomonas species. Among them B. subtilis and B.

amyloliquefaciens are reported as potent biocontrol agents and

growth promoter in vegetable crop system.

Objective

· Isolation, identification and characterization of bacterial

biocontrol agents.

· Study the rhizospheric competence and factors affecting it.

· Isolation of signaling molecules involved in bacterial

biocontrol-pathogen interaction.

· Development of consortia of efficient isolates.


· Soil samples were collected from salt affected soil of IGP

region viz Lucknow, Kanpur, Allahabad, Mau and Varanasi.

Isolation of bacteria from soil samples was done by using

standard methods. A total of 150 bacteria were isolated and

evaluated against Fusarium oxysporum f. sp. lycopersici and

Rhizoctonia solani and a total of 38 antagonists were

identified.

· The bacterial isolates were also characterized for biochemical

traits like cellulose, siderophore, ammonia, HCN and

chitinase production. Molecular profiling and antibiotic

susceptibility tests were also carried out. In vitro

compatibility test showed compatibility among B-3, B-14, B-

101 and P-2 strains. HPLC chromatogram of bacterial

–pathogen interaction showed a vital role of B.subtilis as

biocontrol agent. Strain B-14 and B-101 having tendency for

forming biofilm were tested by EPS (Exopolysaccharide)

production and biofilm quantification by standard method.

Significant effect of biocontrol agent was also tested by

growth promotion and effective root colonization in

vegetable plants.

Conclusion

The strain B-14 and B-101 showed good biocontrol potential

with the rapid growth promotion in tomato. These isolates can be

formulated as consortia to control fungal pathogen at primary

level.

Biochemical profiling of isolates.

0

10

20

30

40

50

60

70

Chitinase , 7

Ammonia , 63

HCN , 14

Cellulose (CMC assay)

, 64

Siderophore , 32

Protease, 62

Sample Area (IGP region).

43


Improving yields and nutrient uptake of selected crops through microbial inoculants in vertisols of Central India

PI : D. L. N. RaoCo PI : M. C. MannaIndian Institute of Soil Science, Nabi Bagh, Bhopal

Rationale

Research on microorganisms in vertisols, that have

improved nutrient cycling and plant growth promoting ability,

and are as well able to proliferate under low nutrient conditions,

withstand thermal, moisture and osmotic stresses are meager.

Soybean is the major crop but average grain yields of farmers are

only 1 t/ha. Rhizobial populations are low and there is no

information on the competitiveness of inoculant strains. Thus,

there is an enormous scope for developing effective, competitive

and `hardy' microbial consortia for improving nutrient bio-

availability and yields of crops under farmers field situations in

central India, particularly in Madhya Pradesh.

Objectives

· To study the culturable microbial diversity of vertisols for

selection of promising rhizobial and plant growth promoting

rhizobacterial strains for soybean, chickpea and wheat.

· To develop the best consortia of rhizosphere competent and

compatible strains of N fixers, P solubilizers, PGPR and PGP-

B for inoculation of above crops.

· To study the microbial interactions in the crop rhizosphere in

relation to CNP transformations and bio-availability of

nutrients.

· To test the best performing combination of inoculants for

soybean, chickpea and wheat in farmers fields.

· To make multiple-repositories of the elite strains of

microorganisms.


· A complete database of the most promising PGPR (50) and

rhizobia (58) for growth promotion of soybean, chickpea and

wheat in vertisols was prepared.

· 15 elite PGPR strains increased the soybean yield by 18% and

10 elite rhizobial strains increased the grain yield of soybean

by 15% in vertisol field in second year field trials.

· Based on 16S rDNA analysis, 23 PGPR were identified and

gene sequences deposited with NCBI.

· Early report of Lysinibacillus fusiformis as PGPR.

· New report of Dyella marensis as PGPR.

· First isolation of Staphylococcus succinus from soil and report

as PGPR.

· 5 PGPR were antagonistic to all three pathogenic fungi

studied viz., Fusarium oxysporium, Scelrotium rolfsii and

Rhizoctonia bataticola. Based on 16S rDNA homology these

were identified as Bacillus amyloliquefaciens, B. subtilis (3 no.)

and B. licheniformis. They showed early promise for checking

Fusarium wilt in ̀ sick plots' in vertisol field.

· 10 oligotrophic bacteria from rhizosphere soils and composts

identified that could survive in double distilled water for one

year. They belonged mostly to Bacillus sp. were as effective

as other PGPR for soybean, chickpea and wheat in vertisols.

· Diversity analysis of chickpea rhizobia in vertisols showed

that they fell into 3 clusters at 54 % level of similarity.

Diversity analysis based on utilization of carbohydrate

sources was more discriminatory as compared to Intrinsic

Antibiotic Resistance (IAR). The most effective strains (83%)

fell in the major cluster.

· The chickpea growing soils of Madhya Pradesh had

sufficient population of native rhizobia (MPN 1600- 4100

cells/g soil) showing the need for identifying competitive

strains from among the local isolates.

· Three effective rhizobial strains identified for chickpea in

vertisols that can increase yields by 25-40% and fix 32-52

kg/ha., of additional N over native rhizobia.

· Inoculation of Rhizobium and PGPR resulted in significant

increase in nodulation and yield of chickpea along with

improved soil health as evident from increased population of

free living, heterotrophic N fixers and acid phosphatase

activity in soil.

· Bradyrhizobium japonicum ISR-33 and PGPR-Bacillus

megaterium ISP-3 were supplied for mass production to

JNKVV Biofertilizer production centre, Jabalpur. 6,06,6766

inoculant packets were prepared with these strains and

supplied all over Madhya Pradesh since 2009.

Conclusion

Lysinibacillus fusiformis was the best performing PGPR for all

three crops viz., soybean, chickpea and wheat. Oligotrophic PGPR

belonged mostly to Bacillus sp. and were as effective as

copiotrophs for promoting plant growth. Rhizobial diversity

analysis based on utilization of carbohydrate sources was more

discriminatory as compared to intrinsic antibiotic resistance. The

chickpea growing vertisols had sufficient population of native

rhizobia showing the need for identifying competitive strains

from among the local isolates. Inoculation of Rhizobium and PGPR

besides improving nodulation and yield of chickpea, also

improved soil health as evident from increased population of free

living, heterotrophic N fixers and acid phosphatase activity in

soil.


· Saxena, Megha, B. Saxena and Rao, D.L.N. (2010) Diversity of

oligotrophic plant growth promoting rhizobacteria in

vertisols. Presented at the 75th Annual Convention of Indian

Society of Soil Science, Bhopal, Nov. 14-17, 2010.

· Ansari, Parveen. G. and Rao, D.L.N. (2010) Diversity of

Chickpea Rhizobia in Vertisols of Central India. Presented at

the 75th Annual Convention of Indian Society of Soil Science,

Bhopal, Nov. 14-17, 2010.

· Ansari, Parveen. G. and Rao, D.L.N. (2010) Diversity of

Soybean Rhizobia in Indian Soils. Presented at the 51st

Association of Microbiologists of India Conference, Ranchi,

Dec. 14-17, 2010.

· Aparna, K., Rao, D.L.N. and Manna, M.C. (2010) Rhizobium

and PGPR inoculation influences soil microbial processes in

chickpea rhizosphere. Presented at the 75th Annual

Convention of Indian Society of Soil Science, Bhopal, Nov.

14-17, 2010.


44

Application of AIMs for nutrient management & plant growth promotion in rainfed agro-ecosystems

PI : Suseelendra Desai Co PI : Minakshi GroverCentral Research Institute for Dryland Agriculture, Hyderabad

Rationale

The project is significant for rainfed agriculture as majority of

farmers growing rainfed crops use very little external nutrients in

view of the poor socio-economic base. The potential of

microorganisms to fill this gap has not been adequately

researched in the past. This critical gap can be bridged through a

well defined and focused technical programme which harnesses

the immense biodiversity of AIMS in rainfed agro ecosystem,

evaluate them and develop products based on consortium of

useful organisms. These products not only contribute to enhanced

nutrient availability and reduce cost of cultivation for the farmers,

but also can give a fillip to organic farming in rainfed areas which

is growing rapidly. Microbial products are key inputs in organic

production of crops, horticulture, agro-forestry and live stock

farming.

Objectives

· To study the culturable microbial diversity of soils from

different agro-ecological sub regions, production systems

and land use practices, including stressed ecosystems.

· To characterize the isolated microorganisms for their

nutrient mobilization (N, P micronutrients).

· To evaluate the establishment of isolates, particularly in

mixed cropping systems and select isolates for multiple

crops and geographical locations.

· To standardize methods for mass multiplication and identify

appropriate delivery systems and improve the formulations,

quality, shelf life of the above bio-agents with superior

delivery systems.

· To carry out multi-location testing for evaluation of the

promising formulations. To make multiple-repositories of

isolated isolates of microorganisms.


· B17 & B38 were superior to other strains (best among the

previous studies P1, P22, P28, P67, B38, B53, B93 & B105) in

the plant growth promotion of pigeonpea in field.

· P1 & P35 were superior to other strains (best among the

previous studies P22, P23, P17, B22, B39, B73, B87 & B98) in

the plant growth promotion of sorghum in field.

· B105+P17+Rhizobium formulation has shown good growth

promotion of pigeonpea in pots, when compared to

individual inoculations.

· B87+P17+Azospirillum formulation has shown good growth

promotion of sorghum in pots, when compared to single and

dual inoculations.

· Preliminary observation of low superoxide dismutase (SOD)

in P33 inoculated maize seedlings revealed that these plants

have low zinc deficiency due to higher uptake of zinc by ZSB

(P29, B61).

· B87, B105 & P17 were compatible with urea (1%, 2%, 5%),

murate of potash (1%, 2%, 5%), di-ammonium phosphate

(1%) and single super phosphate (1%).

· B87 & P17 were compatible with 2% di-ammonium

phosphate.

· P17 was compatible with fungicide Carbendazim 50%WP-

1%, Mancozeb 75% WP- 0.5%, Metaxyl 35% WP- 1%, Copper

oxy chloride 50% WP-0.5% and Captan 50% WP – 0.5%.

· B87 & B105 were compatable with fungicide Carbendazim

50%WP-0.25%, Mancozeb 75% WP- 0.25%, Metaxyl 35% WP-

0.75%, Copper oxy chloride 50% WP-0.25% and Captan 50%

WP – 0.75%.

Conclusion

Potential strains of Pseudomonas and Bacillus with plant

growth promoting ability and tolerance to chemical fertilizers and

fungicides have been identified under this sub-project and they

could be exploited as bioinoculants for enhanced yields of

sorghum and pigeonpea.


· Praveen Kumar, G., Suseelendra Desai, Gopal Reddy and

B.Venkateswarlu (2011). Development of Talc Formulation

of a Drought Tolerant Pseudomonas putida strain for Plant

Growth Promotion and Integrated Nutrient Management in

Rainfed Crops of India Poster presented at 98th Indian

Science Congress, SRM University, Chennai, Jan 3-7, 2011.

· Praveen Kumar G., Kishore N., Mir Hassan Ahmed SK.,

Abdul Rasul, Suseelendra Desai, Gopal Reddy and

Venkateswarlu B. (2010). Evaluation of Fluorescent

Pseudomonas spp. with Single and Multiple PGPR Traits for

Plant Growth Promotion of Sorghum in Combination with

AM fungi. In: “Plant Growth Promotion by Rhizobacteria for

Sustainable Agriculture.” Scientific Publishers, New Delhi,

India. pp: 293-299, ISBN: 978-81-7233-660-8.

· Mir Hassan Ahmed SK., Suseelendra Desai, Venkateswar

Rao L., Praveen Kumar G., and Venkateswarlu B. (2010).

Evaluation of Bacillus spp. from rainfed agro-ecosystems for

plant growth promotion of Sorghum and Pigeonpea. In:

“Plant Growth Promotion by Rhizobacteria for Sustainable

Agriculture.” Scientific Publishers, New Delhi, India. pp: 71-

74, ISBN: 978-81-7233-660-8.Plant growth promotion of pigenpea, sorghum by

Pseudomonas strains and Bacillus strains.

45


Development of a cold tolerant phosphate solubilizing cacterial (PSB) inoculant


Rationale

Phosphorus is an essential plant nutrient making up 0.2% of

the plant dry weight. But insoluble phosphates that are not

available to the plant or microorganisms comprise nearly 95 to 99

percent of the total phosphates in the soil. Hence biologically

mediated solubilization of the insoluble phosphates holds the key

to meeting the P nutrition of crops. The soils of hilly regions of

Uttarakhand state are generally acidic in reaction with low native

P and high phosphorus fixing capacity, leading to low

productivity of major crops. During winters snowfall is quite

common in the upper reaches and the ground remains frozen for

varying periods. Due to this the soil temperature also dips and O averages from 2 to 10 C depending on the location. Such

extremities of temperature are deleterious to the survival and

functioning of most introduced mesophilic microorganisms.

Most of the PSB inoculants that have been developed so far are

from the plains where such extremities of temperature

(atmospheric and soil) do not exist. Therefore, it is imperative to

develop a PSB inoculant that would suit the environmental

conditions prevailing in the hills with major focus on cold

tolerance, since this largely determines the survival and function

of the inoculant.

Objectives

· To isolate PSB cultures from the rhizosphere of various hill

crops and screen them under in vitro cold conditions (4 and O 15 C) for their P solubilizing ability.

· To develop comprehensive biomarkers for the quality

control and field detection of the elite PSB strains.

· To evaluate various locally available low cost organic raw

material for use as a carrier material for the PSB inoculant,

and identify a suitable combination of efficient PSB culture(s)

and carrier material.

· To evaluate the performance of the PSB inoculant with

graded levels of P fertilization in select winter crops.

· To conduct large scale field demonstrations with the

developed bioinoculant and commercialize the developed

technology.


· Locally available, accessible and inexpensive carrier material

[Kadiya (talc stone), deodar and cedarwood sawdust] were

used to develop a formulation, showed log CFU ranging

from 7.40 to 7.30, whereas, the standard carrier materials (Ca-

alginate beads, purified talc, charcoal and charcoal + soil)

showed log CFU in the range of 8.51 to 7.60 under

refrigerated and non- refrigerated condition after six months.

· Five promising Pseudomonas strains were subjected for rock

phosphate solubilization at three different temperature (4, o15, 28 C) and Pseudomonas strain CS11RP1 showed

maximum P solubilization (40.3 ppm) at 15ºC under shaking

condition.

· All the fourteen Pseudomonas strains showed the presence of

pqqC (568 bp) & pqqE (900bp) gene that play a major role in P

solubilization using glucose dehydrogenase metabolic

pathway.

· Three Pseudomonas spp. [Pseudomonas sp. CS11RP1,

Pseudomonas fragi CS11RH4, Pseudomonas poae NS12RH2(1)]

were evaluated with graded P level in lentil and all the strains

showed root colonization in the range of 6.1-7.4 log CFU at 60

DAS under pot condition.

· Eight bacterial consortium developed from five elite cold

tolerant P solubilizing strains were evaluated under pot

condition and significantly enhanced nutrient content (N, P,

K) of wheat (VL Gehun 804) upto 1.61, 1.26 and 1.64 folds

respectively at 60 DAS.

· In lentil, all the individual Pseudomonas strains in the

consortium showed root colonization in the range of 6.0 – 7.6

log cfu after 60 DAS.

· Inoculation with bacterial consortium significantly

enhanced nutrient parameters (shoot dry weight, shoot

length and root length by 2 folds, 1.3 folds & 1.65 folds,

respectively) and cold stress response (phenolics, proline,

starch, EC & relative water content) after 60 DAS under field

condition.

· In field condition four bacterial consortium enhanced P

content of wheat (VL Gehun 804) in the range of 11.1 to 33.3%

in stover and 17.2 to 31.0% in seed and significantly increased

wheat yield 16.9 to 39.4% over the uninoculated control.

· At various locations of Himachal Pradesh two potent

bacteria (RT5RP2 & RT6RP) showed significant increase in

yield of wheat (4.0-13.0%) & pea (26.6 -28.2%)

· On the basis of 16S rDNA sequencing strain CS RH was 11 4

identified as Pseudomonas fragi (GU220068) and was

deposited at NBAIM, Mau culture collection.

Conclusion

The standard and locally available low cost carrier material

were evaluated for the development of a carrier based

formulation and the shelf life of the bacterial inoculant was higher

in the Ca-alginate beads, purified talc, charcoal and charcoal + soil

after six months. The consortium was developed with the best

compatible cold tolerant Pseudomonas spp. and they were

evaluated on wheat and lentil under green house/field

condition. Bacterial consortia enhanced the nutrient uptake,

growth parameters, cold stress response and yield. A trial with

two potent cold tolerant P solubilizing bacteria (RT5RP2 &

RT6RP) were evaluated at various locations of Himachal Pradesh

showed significant enhacement in yield of wheat and pea. Thus,

the best consortium can be popularized among the farmers after

extensive multiple field trials.


· Govindan Selvakumar, Piyush Joshi, Preeti Suyal, Pankaj K.

Mishra, Gopal. K. Joshi, Jaideep K. Bisht, Jagdish C. Bhatt and

Hari S. Gupta (2010). Pseudomonas lurida M2RH3 (MTCC

9245) a psychrotolerant bacterium from the Uttarakhand

Himalayas solubilizes phosphorus and promotes plant

growth at low temperature. World Journal of Microbiology &

Technology, DOI 10.1007/s11274-010-0559-4 (Online

published).

· Selvakumar, G., S.Kundu, Piyush Joshi, Sehar Nazim,


46

Isolation, identification, evaluation and exploitation of PGPR for spices

PI : M. AnandarajCo PI : R. Dinesh, A. Kumar, N. K. Leela Indian Institute of Spices Research, Calicut, Kerala

Rationale

One of the key factors which determine the success of bio-

mobilization of nutrients vis-à-vis growth promotion and yield of

crops is the efficiency and ecological fitness of the microbial

inoculants employed. No single strain isolated in wild form

would have all the traits required for satisfactory growth

promotion and biological control. A strain with multiple benefits

to crops plants by their growth promoting capacity and disease

suppressive ability seldom exists in soil. Alternative to this

paradox is the development of a consortium of compatible

microbial agents where each of the agriculturally important traits

is contributed by individual strains for overall crop management

through a single formulation. Such a formulation would solve the

problems of inconsistency in the field performance of microbial

inoculants due to lack of the ecological fitness of the organism

employed. A formulation of consortium with strains obtained

from varying agro-ecological regions would be preferred to

formulation with single strains. Such a rhizobacterial community

based formulation is expected to perform better than single

rhizobacterium based formulation for crop management. The aim

of the present project is to collect different native isolates of

rhizobacteria from black pepper and ginger growing areas and

study their role in plant growth promotion coupled with disease

control in comparison with the existing rhizobacterial strains used

in PGPR network.

Objectives

· Isolation, characterization, evaluation of microbes for

nutrition mobilization, growth promotion and biological

control.

· Screening isolates for the desirable characters.

· Studies on compatibility and ecological fitness and

development of consortium.

· Studies on rhizobacteria mediated induced systemic.

· Studies on mechanism of rhizobacteria mediated growth

promotion in crop plants.

Identification of Phosphate solubilizing gene (pqqC and pqqE) in cold tolerant bacterial strain.

A.D.Gupta and H.S.Gupta (2010). Growth promotion of

wheat seedlings by Exiguobacterium acetylicum 1P (MTCC

8707) a cold tolerant bacterial strain from the Uttarakhand

Himalayas. Indian Journal of Microbiology. 50: 50-56.


· Pankaj K. Mishra, Piyush Joshi, Preeti Suyal, G. Selvakumar,

J. K. Bisht and J.C. Bhatt (2010). Solubilization of inorganic

phosphate and plant growth promotion by Psychrotolerant

Pseudomonad from Uttarakhand Himalayas. 5th

Uttarakhand State Science Congress, Doon University,

Dehradun, Uttarakhand, 10-11th Nov, 2010.

· Pankaj K Mishra, Preeti Suyal, Piyush Joshi, K. Jeevanandan,

G K Joshi, J K Bisht1, J C Bhatt (2010). Performance

Evaluation of Psychrotolerant Mineral 'P' Solubilizing

Bacterial Consortia in Wheat Rhizosphere. 51st Annual

Conference of AMI, BITS Ranchi, Jharkhand,14-17 Dec,2010.


· In vivo evaluation of Rhizobacteria – Ginger: To confirm the

earlier result obtained from 2009-2010 study, the green house

evaluation of selected rhizobacterial strains were done in

ginger, for both biocontrol and growth promotion.

· Evaluation of strains for Biocontrol: A pot experiment with

six treatments and two replications (three pots) were

conducted at IISR, Chelavoor. Treatments included three

selected strains (GRB 35- Bacillus amyloliquifaciens, GRB 68-

Serratia marcesens and IISR 51-Pseudomonas) along with a

bactericide – Streptomycin and a fungicide - Metalaxyl

mancozeb and a control. Out of the two sets of experiment,

one set was for evaluation against Ralstonia and another for

Pythium. Ginger rhizomes were treated with 1% starch 10 -1solution containing bacterial suspensions (~ x 10 CFU mL )

for one hour, shade dried for 24 hours and planted @ two

rhizomes (25 g) per pot. The booster dose of rhizobacteria

was applied at three regular intervals, 30, 60 and 90 days after thplanting (DAP). The sprouting count was recorded on 30

DAP. Both the strains recorded more than 85% sprouting.

The pathogen was inoculated after one month of planting.

The disease incidence was recorded till 90 DAP. The

rhizobacterial strains, GRB 35 and GRB 68 recorded

significantly less disease incidence when compared to

control.

· Based on the field experiment conducted during 2009-2010,

Bacillus amyloliquifaciens (GRB 35) and Serratia marcescens

(GRB 68) were found to be effective for disease control and

plant growth promotion. A field experiment using these two

effective strains were repeated in IISR experimental farm at

Peruvannamuzhi with six treatments and two replications

(six bed replication). The treatments included two efficient

strains (GRB 35 and GRB 68), and an existing biocontrol

strain from IISR repository (IISR 51), two chemical control

(bactericide and fungicide) and an absolute control. Ginger

47


Effect of rhizobacteria on sprouting in ginger. Disease percentage in ginger.

rhizomes were treated with rhizobacteria as mentioned

above and planted. The booster dose of rhizobacteria was

applied thrice during 30, 60 and 90 DAP. Sprouting was

recorded on 45 DAP and disease incidence was recording at

regular intervals. Both the isolates (GRB 35 and GRB 68)

recorded more than 75% sprouting compared to control. Soft

rot incidence was also significantly less (<10%) compared to

control. Ginger rhizome yield was recorded after the eighth

month. The rhizobacterial treatment recorded significantly

higher yield than control.

· A green house trial using variety Panniyur-1 of black pepper

was conducted using rhizobacterial strains in comparison

with Trichoderma harzianum (P26). The experiment was

conducted in a randomized complete block design with nine

treatments and six replications including an absolute control

and chemical control. Treatments included three

rhizobacterial isolates (BRB 21-Burkholderia, BRB 28-

Pseudomonas aeruginosa and BRB 49- Serratia marcescens),

promising isolates of Pseudomonas (IISR 6) and one

Trichoderma harzianum (P26) and their consortium (IISR 6 + P

26). The chemical treatment included metalaxyl-mancozeb @ -1

1.25g L . The growth parameters were recorded at monthly

intervals.

· A green house experiment on black pepper was conducted to

evaluate the selected strains for nutrient mobilization.

· The field efficacy of seven rhizobacterial isolates and three

other promising isolates are under evaluation for growth

promotion and biocontrol in the field. It is done in a complete

randomized block design containing 11 treatments with 15

replications at IISR Experimental Farm, Peruvannamuzhi.

The treatments include BRB 21, BRB 28, BRB 49, BRB 3, BRB

13, BRB 23, IISR 6 and a promising isolate T. harzianum (P 26)

along with a chemical control (Metalaxyl-mancozeb @

1.25g/L) and an absolute control. The growth parameters are

recorded at regular intervals.

· The antibiotic and biosurfactant production of the putative

isolates were tested to study the mechanism of biological

control. The bioassay of extracted antibiotics was performed

on PDA and King's B against various pathogens viz., Phytophthora capsici, Pythium myriotylum, Ralstonia

solanacearum, Colletotrichum and Aspergillus flauvs. The

selected isolates include GRB 35, GRB 68, GRB 70, BRB 3, BRB

13, and BRB 49. Cut shoot assay was performed with single

nodded cuttings of black pepper variety Karimunda to study

the inhibitory effect of the extract on P.capsici.

Conclusion

The rhizobacterial strains GRB 68(Serratia marcescens) and

GRB 35(Bacillus amyloliquefaciens) from ginger were found to

enhance the sprouting of rhizomes besides reducing the soft rot

and bacterial wilt in ginger. Three rhizobacterial isolates (BRB 3,

BRB 13 and BRB 23) from black pepper with different

combinations of NPK was found to promote the growth in black

pepper plants. These isolates have significantly enhanced the

levels of mineral N, Bray P and exchangeable K in soils. The

results on growth parameters revealed that the treatments 100% N

+ 100% P + 100% K+ BRB 3 and 100% N + 100% P + 100% K+ BRB

13 showed maximum height followed by 100% N + 100% P + 75%

K + BRB 3. Antibiotic obtained from GRB 68 was found to inhibit

Phytophthora capsici, Pythium myriotylum and Ralstonia

solanacearum.


Bini, Y K, M. Anandaraj, A. Kumar R. Aravind and R.

Dinesh (2010). Isolation and characterization of rhizobacteria

from ginger (Zingiber officinale Rosc.) for biocontrol and growth

promotion. In: Indian Phytopathological Society (Southern Zone)

Symposium on “Changing plant disease scenario in relation to

climate change”, 28-29 October, IISR, Calicut.


48

Development and application of PGPR formulations for growth Improvement and diseasesuppression in coconut and cocoa

PI : George V. ThomasCo PIs : Alka Gupta, Murali Gopal, R. Chandra MohananCentral Plantation Crops Research Institute, Kudlu P.O., Kasaragod, Kerala

Rationale

As there is enough evidence to confirm that coconut and

cocoa soils and roots favour the development of a highly diverse

beneficial microflora, carrying out a meticulous research under

the ICAR Network Project on AMAAS will lead to development

of critical microbial based technology that could improve the soil

health and fertility, suppress the undesirable pathogens, develop

strong immunity in plants leading to improved crop production

and protection of coconut and cacao. Based on the experience of

successful isolation of effective strains of diazotrophs, phosphate-

solubilizing microbes, PGPR's and the response obtained to

inoculation of biofertilizers, it could be predicted that commercial

viability of biofertilizers for coconut and cacao will be a reality in

the near future. The data on higher incidence of beneficial

microbes at lower doses of chemical fertilizers and in mixed

cropping and mixed farming systems should enable researchers

to make recommendations to farmers to derive maximum benefits

from biosources of nutrients by making alterations in agronomic

practices. Based on the experience on the incidence of high

diversity of new diazotrophs in root regions of coconut palm, it

would be worthwhile to undertake microbial community study at

molecular level. This should reveal the incidence of much higher

microbial biodiversity in these unique cropping systems, which

are dominating the coastal and in-land ecosystem. Intensification

of research efforts in this important area and developing PGPR

technology to achieve sustainability in plantation crops and

perennial based cropping systems is an important thrust area of

research. The PGPR associations, diversity and their impact on

the growth and productivity need to be understood to develop

effective biofertilizer formulations for field application. It is

imperative to identify a single organism or a group of organisms

(consortia) with broad spectrum of activities including plant

growth promotion and disease suppression in view of the

magnitude of biotic stress faced by the crops in real field

situations. In-depth studies on PGPRs with respect to their role

in nutrient management, survival bio-control potential and

persistence are needed for exploiting them in the perennial based

cropping systems. Synergistic growth effects could be derived by

the combined inoculation of function specific bacteria including

PGPRs, diazotrophs and P-mobilisers. Biofertilizer inoculants

when combined with organic inputs can deliver additional

benefits in terms of higher rate of survival and persistence of

bioinoculants in soil. Root (wilt) disease of coconut is a major

constraint affecting the productivity of coconut in Kerala, the

premier coconut growing state in the country. Leaf rot disease

appears super imposed on root (wilt) diseased palms. Application

of PGPR assumes greater significance in the biological control of

this disease. The overall rationale and significance of the project

therefore aims at harnessing the potential of agriculturally

important microorganisms available in plenty in the coconut and

cacao cropping systems for improving the crop production

capacity of these important plantation crops in an ecologically

sustainable manner acceptable to the farmers through the

development of low cost eco-technology.

Objectives

· To characterize PGPRs (rhizosphere soil dwelling and

endophytic) associated with coconut and cocoa grown in

different agro-climatic conditions

· To screen and select efficient rhizobacterial strains

possessing beneficial traits like production of IAA, HCN,

nitrogen fixation and phosphate solubilization.

· Development of mass multiplication techniques and

consortia formulations of compatible microorganisms.

· To evaluate the selected strains for growth promotion of

coconut and cocoa seedlings.

· To evaluate the biocontrol potential of the PGPR against stem

bleeding disease of coconut caused by Thielaviopsis paradoxa

and Phytophthora diseases of coconut and cocoa.

· To develop the PGPR based biofertilizer technology with

appropriate quality control measures.


· Experiments to study the growth promotion effects of 19

selected isolates were conducted in coconut and cocoa

seedlings. Statistically significant increase (significance at P

=0.05) over the control was observed in most of the growth

parameters. B. megaterium TSB 16 and B. megaterium TEB 2

isolated from the rhizosphere and roots of coconut palms,

respectively, growing in the Tumkur region of Karnataka

and endophytic Bacillus sp. HEB 10 obtained from HDMSCS,

CPCRI, Kerala were found to be the best plant growth

promoters in coconut seedlings. B. cereus ASB 3, isolated

from the rhizosphere of cocoa growing in Ambajipetta,

Andhra Pradesh, endophytic B. subtilis VEB 4 obtained from

Bacillus sp. VEB 17 Bacillus sp. CSB 8 B. subtilis PEB 2 Bacillus sp. CEB 9

49


Vittal, Karnataka and rhizospheric B. subtilis CSB16, from

Coimbatore, Tamil Nadu were found to be the best plant

growth promoters in cocoa seedlings.

· Detailed studies of the plant growth promotion mechanisms

of all the 43 PGPRs were done. Among the 22 potent coconut

PGPRs, Bacillus sp. RSB 14 recorded the highest β - 1, 3-

glucanase activity (600 µg glu/min/mg protein) and

chitinase activity (135 µg NAG/h/mg protein). The

maximum production of salicylic acid was detected in P.

putida KnSF 208 (29.6 µg/ ml) and was found to be one of the

best phosphate solubilizer (164.7 μg/ml). Among the 21

selected cocoa PGPRs, B. licheniformis KGEB 16 exhibited

maximum P-solubilization (163.34µg/ml), B. subtilis PEB 2

recorded the highest chitinase activity (424.7µg NAG/h/mg

protein), B. subtilis ASB 12 recorded the highest β - 1, 3-

glucanase activity (89.36 µg glu/min/mg protein) and the

maximum production of salicylic acid was detected in

Pseudomonas sp. KGSF 20 (24.34µg/ ml).

· Experiments to study the stress responses of the selected

PGPR (22 coconut and 21 cocoa isolates) indicated that

Bacillus cereus ESB 15 isolated from the rhizosphere of 0coconut could tolerate a maximum temperature of 60 C and

NaCl concentration of 12 % when incorporated in Trypticase

Soy Agar (TSA) medium. Another Bacillus sp. RSB 14 from

coconut rhizosphere tolerated 12% NaCl concentration.

Serratia marcescens KiSII, isolated from rhizosphere of

coconut from Kidu, Karnataka could tolerate pH in the range

from 4.2 to 9.0 and P. putida KnSF 208, a rhizospheric isolate

of coconut from Kunnamkai, Kerala could tolerate pH from

5.2 to 9.0.

· Five Bacillus subtilis isolates (CSB 8, KGEB 10, PEB 2, PEB4

and VEB 17) from cocoa rhizosphere could tolerate a 0maximum temperature of 60 C and were able to grow on

TSA medium amended with 12% NaCl. Three Bacillus spp.

(B. subtilis CSB 16, B. subtilis CEB 9 and Bacillus sp. PS2 VEB 4)

from cocoa showed intrinsic resistance to 12% of NaCl in

TSA. The cocoa PGPR isolates Pseudomonas putida KDSF 23

and Pseudomonas sp. KDSF 7, isolated from Kidu, Karnataka

exhibited pH tolerance from 5.2 to 9.0.

Conclusion

A good no. of PGPR (43) were isolated from coconut and

cocoa seedlings. Only five Bacillus subtilis isolates (CSB 8, KGEB

10, PEB 2, PEB4 and VEB 17) from cocoa rhizosphere could 0tolerate a maximum temperature of 60 C and were able to grow

on TSA medium amended with 12% NaCl. Three Bacillus spp. (B.

subtilis CSB 16, B. subtilis CEB 9 and Bacillus sp. PS2 VEB 4) from

cocoa showed intrinsic resistance to 12% of NaCl in TSA. The

cocoa PGPR isolates Pseudomonas putida KDSF 23 and

Pseudomonas sp. KDSF 7, isolated from Kidu, Karnataka exhibited

pH tolerance ranging from 5.2 to 9.0.


· Litty Thomas, Alka Gupta, Murali Gopal, Priya George and

George V. Thomas. 2010. Plant growth promoting potential

of Bacillus spp. isolated from the rhizosphere of cocoa

(Theobroma cacao L.). Journal of Plantation Crops, 38 (2): 97-104.


· Murali Gopal, Litty Thomas, Alka Gupta, Priya George and

George V. Thomas. 2011. Plant growth promoting

rhizobacteria (PGPR) for growth improvement in cocoa.

Paper presented during the Seminar on 'Strategies for

enhancing productivity of cocoa', CPCRI, RS, Vittal, Jan. 28-

29, 2011.

· Litty Thomas, Alka Gupta, Murali Gopal, Priya George and

George V. Thomas. 2010. Efficacy of rhizosphere Bacillus spp.

for growth promotion in Theobroma cacao L. seedlings. In thproceedings of the 19 Biennial symposium on plantation

crops PLACROSYM XIX, RRII, Kottayam, 7 -10 December

2010. pp. 143 -144.

· Priya George, Alka Gupta, Murali Gopal, Litty Thomas and

George V. Thomas. 2010. Screening and evaluation of

phosphate solubilizers from diverse group of bacteria

isolated from rhizosphere and roots of coconut palms (Cocos

nucifera L.) growing in different states of India. In

proceedings of International conference on “Coconut

Biodiversity for Prosperity”, CPCRI, Kasaragod, 25 – 28

October, 2010. pp.103.

· Priya George, Alka Gupta, Murali Gopal, Litty Thomas and

George V. Thomas. 2010. Plant growth promoting potential

of Serratia marcescens KiS II and Enterobacter cloacae RNF 267

isolated from the rhizosphere of coconut palm (Cocos nucifera

L.). In proceedings of International conference on “Coconut

Biodiversity for Prosperity”, CPCRI, Kasaragod, 25 – 28

October, 2010. pp. 83- 84.

Microbial control of insect pests

PI : B. RamanujamCo PI : S. Sriram National Bureau of Agriculturally Important Insects, Bangalore

Rationale

The project also envisage a good collection of germplasm of

entomofungal pathogens, which can be used for screening against

sucking pests of vegetables like, whiteflies, aphids, thrips, mealy

bugs, causing extensive damage to the crops. For control of

sucking insects, entomopathogenic fungi are the most

appropriate microbial bioagents as they infect the insects directly

by contact and do not require ingestion for infection. The chemical

insecticides sprays are not cost effective and also eliminate the

beneficial parasites and predators from these cropping systems.

Identifying promising candidate fungi against sucking pests,

development of mass production techniques for promising

candidate fungi, development of data bases of strains of

entomopathogenic and establishing culture repository of these

fungi are the main objectives of this project.

Objectives

· Germplasm collection of entomogenous fungi from insect

hosts for control of sucking pests of vegetable crops and


50

Conidia in rice grains Harvested dry conidia Formulated spores in oil Emulsion

depositing of these fungi in NBAIM, Mau.

· Screening and identification of potential isolates of

entomogenous fungi against sucking pests of vegetable

crops (laboratory bioassay, glass house studies).

· Molecular characterization of promising isolates of

entomogenous fungi.

· Development of efficient mass production and formulation

techniques including oil-based formulations of promising

isolates of entomogenous fungi.


· Twenty one isolates of entomofungal pathogens belonging

to Beauveria bassiana (7 isolates), Metarhizium ansiopliae (7

isolates), Nomuraea rileyi (3 isolates), Lecanicillium lecanii (2

isolates), Ascheronia aleyrodis (1 isolates) and Paecilomyces

farinosus (1 isolate) were isolated from soils and insect hosts

from Gujarat, Meghalaya, Himachal Pradesh, Kerala and

Karnataka during 2010-11. Cultural and morphological

studies of these 21 isolates were conducted, isolate specific

characters were identified, spore and biomass production

was estimated.

· Bioassay studies conducted with B. bassiana, M. anisopliae and

L. lecanii indicated highest mortality of 35.0% with Bb-60

isolate and highest mycosis of 13.33% with Bb-56 isolate.

· The chitinolytic activity of 60 isolates of B. bassiana, 33 isolates

of M. anisopliae and 31 isolates of L. lecanii was studied by

subjecting the partially purified proteins from these isolates

to chitinolytic activity and measuring the release of reducing

saccharides from colloidal chitin spectrophotometricaly at

582 nm (A ). Highest chytinolytic activity was observed 582

with Bb-5a, Ma-4 and Vl-7 isolates.

· The toxic effects of partially purified toxic proteins of 60

isolates of B. bassiana and 35 isolates of M. anisopliae were

studied on first instar larvae of Spodoptera litura by diet

incorporation method at 1, 2.5 and 5% concentrations. The

highest mortality of 51% was observed with Ma-4 isolate.

· In order to develop oil formulations of promising isolates of

B. bassiana and M. anisopliae, nineteen combinations of oil

formulations were prepared with eight vegetable oils, four

emulsifiers and one stabilizer. The conidial germination (%)

of B. bassiana (Bb-5a) and M. anisopliae (Ma-4) was assessed

after 24 and 48 hrs of storage in the different oil formulations.

Among the 19 oil formulations tested, Soybean oil EAO,

Mineral oil EAO, Groundnut oil EAO and Sunflower oil EAO

showed higher conidial germination of B. bassiana (81-97% at

48 hrs) and M. anisopliae (85-94% at 48 hrs).

· Safety of twelve promising isolates of B. bassiana, M.

anisopliae and L. lecanii to the natural enemies of Aphis

craccivora viz., Micromus timidus and Cheilomenes

sexmaculata was tested by bioassay and found to be safe to

these predators, as no mycosis was observed on them

· Molecular characterization of 57 isolates Beauveria bassiana, 3

isolates of B. brongniartii, 35 isolates of Metarhizium ansipliae,

31 isolates of Lecanicillium lecanii and 6 isolates of Paecilomyces

spp. has been characterized by ITS sequencing and

phylogenetic analyses based on the neighbor-joining (NJ)

method. On the basis of BLAST analysis of the Internal

Transcribed Spacer (ITS), the ITS region of 57 isolates of B.

bassiana are similar to the sequence of the reference fungi, B.

bassiana (ARSEF 8150, 8170 and 8187), 3 isolates were

grouped with B. brongniartii (ARSEF2633 and 1070) (Fig.5).

The ITS region of 19 isolates of M. anisopliae were similar to

sequence of the reference fungi, M. anisopliae Var. anisopliae

(ARSEF442) and 16 isolates sequence were grouped with the

reference fungi M. anisopliae (ARSEF794, ART2455 and

KS0806). Among the 31 Lecanicillium isolates, the ITS region

of 15 isolates were similar to sequence of the reference fungi,

Lecanicillium lecanii (ARSEF 5491, 5126, 4065 and 4025), 2

isolates sequence were grouped with the reference fungi L.

muscarium (ARSEF 2323), 11 isolates were grouped with the

reference fungi L. attenuatum (CBS 170.76), 3 isolates were

grouped with the reference fungi L. longisporium (ARSEF

974). The ITS region of 3 isolates of Paecilomyces were similar

to sequence of reference fungi, Paecilomyces fumosoroseus

(ARSEF 4484, and 3590) and other 3 isolates were similar to

the sequence of reference fungi P. farinosus (SJL0909).

Conclusion

Under this project, 174 isolates of entomofungal pathogens

were isolated from insects and soils from different locations in

Karnataka, Andhra Pradesh, Tamilnadu, Kerala, Assam, West

Bengal, Himachal Pradesh and Gujarat. Studies on cultural

characters and ITS sequence of 60 isolates of B. bassiana, 3 isolates

of B. brongniarii, 35 isolates of M. anisopliae, 15 isolates of

Lecanicillum lecanii, 11 isolates of L. attenuatum, 3 isolates of L.

longisporum, 2 isolates of L. muscarium, 3 isolates of P.fumosoroseus

and 3 isolates of P. farinosous showed considerable variations with

regard to colony morphology, growth rate, spore production and

ITS sequence. Fast and highly sporulating isolates of these fungi

were identified. Based on laboratory bioassay studies, promising

isolates of B. bassiana, M. anisopliae, L. lecanii, P. fumosoroseus were

identified against sucking pests like, Aphis craccivora, Myzus

persicae and Bemisia tabaci. Studies are in progress with regard to

the development of oil formulations of these promising

entomopathogenic fungi and field evaluation.

51


Developing PGPR consortia for enhanced crop and soil productivity of rice -wheat cropping system

PI : LataCo PI : Radha PrasannaIndian Agricultural Research Institute, New Delhi

Rationale

Rice and wheat represent the staple food for millions in our

country and the ecological significance of microorganisms is well

known, since centuries, as the inherent source of sustained

fertility of these soils. Despite the availability of a number of

publications on the role of different microorganisms in

rice/wheat fields, no focused approaches towards understanding

the interactions of the microorganism (native and inoculated)

with the rice/wheat roots or other flora/fauna in the rhizosphere

have been undertaken, for improving the efficiency of inoculants.

A better understanding of the plant-microbe interactions in this

ecological niche will go a long way in improving the efficiency of

these non-polluting inputs as biofertilizers. In recent years,

cyanobacteria have been recognized as valuable partners in plant

growth promoting associations, besides their emerging

importance as biocontrol agents. Cyanobacterial growth in rice

fields is known to play a critical role in the sustenance of fertility of

this ecosystem, and recent publications reveal their significance in

wheat crop. A growing and renewed interest in organic farming,

use of indigenous native technologies and environmental friendly

supplements in agriculture will necessarily lead to the increased

demand for microbial inoculants. The present proposal envisages

evaluating the less explored facets of microorganisms, i.e. tapping

their potential as valuable sources of metabolites and enhancing

their significant role of interactions of various prokaryotes, not

just as diazotrophs but from a wider perspective as valuable

partners in enhancing crop yields through development of plant

growth promoting associations or as biocontrol agents for the

sustainability of the rice-wheat cropping system.

Objectives

· To isolate and screen bacteria/cyanobacteria from the

rhizosphere soil samples of rice and wheat crop.

· To evaluate the effect of the selected set of strains on crop

yields and soil fertility.

· To develop a PGPR consortia for rice and wheat crop.


· Field based evaluation of a set of three cyanobacterial (CW1,

CW2, CW3 for wheat crop and CR1, CR2, CR3 for rice crop)

and three bacterial strains (PW1, PW5, PW7 for wheat crop

and PR3, PR7, PR10 for rice crop) inoculated alone and in

combination (involving a total of 9 for wheat and 8

treatments for rice) were undertaken on the basis of

promising results generated from wheat (Rabi 2009) and Rice

(Kharif 2009).

· A combination of CW1 and PW5 (T7) recorded highest grain

yield and harvest index along with basal application of ½

N+PK as well as microbial parameters followed by PW5 (T6)

in wheat crop (Rabi 2010) Analyses of micronutrients

showed that the treatment involving inoculation of PW5 (T6)

recorded highest value of Zn, besides a threefold increase in

Fe and Cu concentration.

· A combination of PR7, PR3 and CR1 (T7) along with basal

application of 2/3 N+PK, recorded highest grain yield and

plant biomass, as well as microbial parameters followed by

PR3+CR1+CR2 (T8) in rice crop (Kharif 2010).

· Soil microbiological parameters (DHA, FDA, Alkaline

phosphatase and microbial biomass) were observed to be

significantly higher in treatments with various combinations

of PGPR strains as compared to inoculation with individual

strains.

Conclusion

· Field based evaluation of a set of three cyanobacterial and

three bacterial strains inoculated alone and in combination

(including chemical fertilizer controls) revealed the

superiority of these strains in enhancing plant growth and

soil fertility parameters in wheat and rice crop.

· Treatments involving inoculation with both single strain and

multi-strain consortia enhanced wheat grain production,

harvest index, quality and yield, besides savings of N (40-

60Kg N/ha) and micronutrient enrichment.

· This study illustrates the promise of combination of bacterial

and cyanobacterial PGPR strains for effective integrated

nutrient management of wheat and rice crop.


· Nain, L., Rana, A., Joshi, M., Shrikrishna, J.D., Kumar, D.,

Shivay, Y.S., Paul, S. and Prasanna, R. (2010). Evaluation of

synergistic effects of bacterial and cyanobacterial strains as

biofertilizers for wheat. Plant and Soil 331:217-250.

· Mallappa, M., Prasanna, R., Partima, S., Nain, L. and Singh,

R. (2010). Developing PGPR consortia using novel genera-

Providencia and Alcaligenes along with cyanobacteria for

wheat. Archives of Agronomy and Soil Science (In Press).

· Rana, A., Saharan, B., Joshi, M., Prasanna, R., Kumar, K., and

Nain, L. (2011). Identification of multitrait PGPR isolates and

evaluating their potential as inoculants for wheat. Annals of

Microbiology (In Press).


52

Structural and functional dynamics of the microbial isolates in biogeochemical cycling of C, N, P and S in riceecosystem

PI : T. K. AdhyaCo PI : P. BhattacharyyaCentral Rice Research Institute, Cuttack

Rationale

Rice, which plays a pivotal role in the food and nutritional

security of India, is preferentially grown under submerged

conditions due to positive response to modern agricultural

practices and better yield than in upland soils. The predominantly

anaerobic flooded soil conditions bring about alterations in soil

microbial colonization from aerobic conditions of an upland soil

to microaerophilic and facultative anaerobic microflora. These

microorganisms in the rice rhizosphere play an important role in

the biogeochemical cycling of several elements involving both

oxidation and reduction reactions. Thus cycling of C, N, P, S, Fe

and Zn is greatly influenced in the rice rhizosphere thereby

affecting the nutrient turnover for the growing rice crop. Cycling

of methane through production (methanogenesis) and its

oxidation (methanotrophy), cycling of nitrogen through

nitrification and denitrification, and cycling of sulfur through its

reduction and reoxidation are important microbially mediated

transformation in rice rhizosphere. Role of microorganisms in

providing mineral nutrients and transforming organic nutrients

into plant-available forms could be critical, especially in low

fertility ecosystem of tropical rice soils. Apart from influencing

and regulating the rate of organic matter decomposition, they are

inherently involved in N-transformation reactions including N -2

fixation and N-loss, oxidation-reduction processes, precipitation

and mobilization of Fe, clay mineral transformation and

alterations in surface charge characteristics as well as aggregation

in rice soils. These key soil processes affect and redeem nutrient

supply to rice roots, normalize the rhizosphere chemistry and

plant growth. Such interlinked biological functions explain the

dynamic interplay of microbial populations at community levels.

This further underlines the regulatory role played by microbial

communities and signifies the interactive credentials of

independent microbial groups in deriving the nutritional status

for the benefit of the plant.

Objectives

· Isolate agriculturally important microorganisms from rice

soils varying widely in physico-chemical properties.

· Explore and quantify the microbial diversity in rice soils by

cultivation-based, proteogram and total DNA finger-

printing analyses.

· Characterize the functional diversity analysis of the

microbial isolates in the biogeochemical cycling of C, N, P

and S and integrate them in the nutritional management of

rice ecosystem.

· Confirm efficacy of isolated microorganisms for nutrient

acquisition and maintenance of sustainability under rice

cultivation.

· Standardize methods of mass multiplication, improved

formulations and delivery systems particularly for rice

cultivation.


· Thirty three efficient heterotrophic nitrifiers were isolated

from CRRI, Canning, Talchua, Khola, Gupti and Ersama rice

field soils. Three of them viz., CRRI- 12 and CRRI- 14 and

Gupti G-10 have been identified by 16s rDNA sequencing as

Bacillus sp., Lysinibacillus sp. and Bacillus sp., respectively.

· Ten methanotrophs and methylotrophs were isolated from

soil samples of CRRI, Canning, Talchua, Khola, Gupti and

Ersama.

· Three isolates capable of utilizing methanol viz., CRRI- 24,

CRRI-21 and Ers-2 have been identified by 16s rDNA

sequencing as Sinorhizobium sp., Cupriavidus necator and

Sinorhizobium sp., respectively.

· Microbial population, structural and functional diversity in

terms of select enzymatic assay were studied after

application of compost followed by fertilizer (control, 40 kg -1 -1 -1N ha , 80 kg N ha , and 120 kg N ha ).

-1 -1· Microbial diversity was more in 80 kg N ha and 120 kg N ha -1than in control and 40 kg N ha .

· Furthermore, the population of the methanotrophs,

denitrifiers and ammonium oxidizers were more in 80 kg N -1 -1ha in comparison to 120 kg N ha , and the grain yield from

the fields treated with different levels of N fertilizer

increased compared to the control fields.-1· No significant yield difference was observed at 80 kg N ha

-1and 120 kg N ha , respectively suggesting that with proper

nutrient management the yield target of crop production can

be achieved without excessive fertilizer application.

· Dehydrogenase activity was maximum in 120 kg N/ha

treatment at the maximum tillering stage.

· FDA activity was maximum in 80 kg N/ha treatment at the

maximum tillering stage.

· Urease activity was maximum in 80 kg N/ha and 120 kg

N/ha treatment at the grain filling stage.

· Carbon dioxide (CO ) evolution from flooded rice field soils 2

amended with different concentration of nitrogen fertilizer

was estimated.

· Microbial population and diversity was studied in soils of

rice fields treated with different organic fertilizers in eight

combinations viz., farmyard manure (FYM), rice straw (RS),

dhaincha and Azolla at different stages of plant growth.

· Microbial diversity and population of heterotrophic

nitrifiers, free living nitrogen fixers and copiotrophic

bacteria were more in the field treated with 16 kg RS + 100 g

dhaincha, followed by field treated with 12 kg FYM + 100 g

dhaincha.

· At the initial stages of plant growth, microbial population

was more in the fields treated with 24 kg dry FYM and 100 g

dhaincha.

· Minimum microbial diversity and population was observed

in soil samples from fields treated with 12 kg FYM + Azolla

and control field.

· Combination of organic and inorganic fertilizers supported

more growth of nitrifiers, free-living nitrogen fixers,

53


copiotrophs and oligotrophs than exclusively with inorganic

or organic fertilizers.

· Microbial population and diversity was also studied in soil of

rice fields treated with different inorganic fertilizers in eight

combinations viz., farm yard manure (FYM), rice straw (RS),

dhaincha (Sesbania aculeata) and Azolla at different stages of

plant growth.

· Microbial diversity and population were maximum at

panicle initiation and maximum tillering stages of plant

growth.

· Aerobic bacteria, heterotrophic nitrifiers, free living nitrogen

fixers and copiotrophic bacteria were more in the field

treated with RS (5.0 t/ha) + urea (60 kg N/ha), followed by

field treated with RS (2.5 t/ha) + dhaincha (60 kg/ha) and RS

(5.0 t/ha) + urea (30 kg N/ha).

· Oligotrophic bacteria were more in soil samples from fields

treated with urea (60 kg N/ha) and control field.

· Microbial population dynamics was studied at different

stages of plant growth in soil of rice, groundnut, maize, green

gram, cowpea and sesame in four different rotations viz., 1.

groundnut-rice, 2. greengram-rice-maize, 3. sesamum-rice

and 4. cowpea-rice-maize.

· Heterotrophic nitrifiers, free living nitrogen fixers and

copiotrophic bacteria were maximum in rotation 1, followed

by 2, 4 and 3. Rice in succession of groundnut and green gram

showed greater microbial diversity than cowpea and sesame.

· Microbial diversity was more in maize fields planted in

succession to green gram and rice than maize planted after

cowpea and rice.

· In groundnut fields, population of heterotrophic nitrifiers,

free-living nitrogen fixers and copiotrophic bacteria were

maximum at the pegging stage and pod formation stages of

growth.

· In case of green gram and sesame, population of

heterotrophic nitrifiers and free living nitrogen fixers were

maximum at the pod formation stage.

· The population of heterotrophic nitrifiers and free-living

nitrogen fixers were maximum at the sowing stage of cowpea

crop.

· Twenty seven P-solubilizing bacteria were isolated from the

rhizospheric rice soils of Balasore, Ganjam districts and

Chilka and their TCP solubilizing capacities were estimated.

The P-solubilization capacity of the organisms was 22-77

mg/l.

· The P-solubilizing organisms reduced pH of the medium. In

buffered medium, P-solubilization capacity of the bacteria

declined.

· The organisms were motile, Gram negative and catalase

positive rods. Other biochemical characters were variable.

· Except for four isolates, all others grew profusely on the

Jensen's agar plate which confirmed their nitrogen fixing

abilities.

· One isolate (Arunpur 7) tolerated up to 12% and all others

could grow up to 9% NaCl.

· Arunpur 7 isolate was further checked for its P-solubilizing

activity in presence of 12% NaCl. P-solubilization declined

gradually from 3% NaCl and stopped at 15% level.

· All of the twenty seven isolates produced IAA in the

laboratory, and Talsari 6, Talsari 7, Kashphala 7 and Chilika 5

were more efficient.

· Four of the P-solubilizers like Talsari 2, Talsari 3, Talsari 4

and Talsari 6 were efficient siderophore producers which

formed with 6-10 mm discoloration (orange) zones.

· None of the isolates produced HCN.

· The Talsari 4 isolate depicted a mixture of organic acids viz.,

D-gluconic acid, acetic acid, citric acid, maleic acid, malic

acid and tartaric acid in HPLC. Some unknown acids having

R between 2.1- 2.9, 8.1-8.9 and 9.01-9.7 were also detected.T

· In pot experiment, Bacillus megaterium supported growth in

presence of two out of the ten rock phosphates i.e. North

Carolina and Gafsa as the only P source, comparable to that

of single super phosphate (SSP).

· From Gafsa, P-uptake was 62.5% more than SSP at the

panicle initiation stage.

· Shoot and root length also increased significantly in both the

cases.

Conclusion

Thirty three efficient heterotrophic nitrifiers were isolated

from CRRI, Canning, Talchua, Khola, Gupti and Ersama rice field

soils. Three of them viz., CRRI- 12 and CRRI- 14 and Gupti G-10

have been identified by 16s rDNA sequencing as Bacillus sp.,

Lysinibacillus sp. and Bacillus sp., respectively. In pot experiment,

Bacillus megaterium supported growth in presence of two out of

the ten rock phosphates i.e. North Carolina and Gafsa as the only P

source, comparable to that of single super phosphate (SSP). Shoot

and root length also increased significantly in both the cases.

Phylogenetic tree of Isolate CRRI-24 (M3M).


54

Nutrient dynamics and carbon sequestration in plant mycorrhizal systems

PI : K. S. SubramanianCo PI : M. ThangarajuTamil Nadu Agricultural University, Coimbatore

Rationale

Indian soils are highly diverse and exposed to a wide array

of crops, agro-climatic conditions and nutrient deficiencies. The

deficiency of Fe was found to be largest 26% in Sierozem of

Haryana followed by 18% in Tamil Nadu, 12% in Punjab and 8 to

9% in calcareous soil of Gujarat and Uttar Pradesh. Although iron

is an abundant element in most soils, its availability for plants can

be limiting, especially in soils with a basic pH. From an

agricultural point of view, iron deficiency is responsible for severe

losses owing to chlorosis, decreasing the yield and nutritional

value of the crops. Plants have evolved two main strategies to

cope with low iron availability. The first one, used by most plants,

but not by grasses, relies on the reduction of soluble iron (III)

chelates and subsequent uptake of iron (II) by root transporters.

By contrast, grasses have evolved a mechanism based on the

release of small molecules into the rhizosphere that efficiently

chelates iron (III), the phytosiderophores and subsequent iron

import by uptake of the iron (III) - phytosiderophore complexes

into root cells (Curie et al,. 2001). Iron is essential for chlorophyll

and protein formation, photosynthesis, electron transfer,

oxidation and reduction of nitrates and sulphates and other

enzyme activities. Iron deficiency causes interveinal chlorosis in

newly emerging young leaves due to reduced chlorophyll

synthesis resulting in poor growth and loss in yield. Chlorosis

caused by Fe deficiency is a phenomenon which is often observed

on alkaline soils with high bicarbonate content. Alkaline

conditions inhibit Fe uptake by counteracting the rhizosphere

acidification of the root. Besides high alkalinity, high nitrate levels

in the soil may also promote iron chlorosis (Hellal et. al., 2006).

Arbuscular mycorrhizal (AM) fungi are known to improve the

availability of nutrients especially phosphorus which moves to

the root surface by diffusion. In addition to P nutrition,

mycorrhizal symbiosis enhances absorption of relatively

immobile micronutrients such as Zn, B and Cu. However, it is

unclear whether mycorrhizal colonization is beneficial at varying

intensities of Zn deficiencies.

Objectives

· To examine the nutritional, physiological and biochemical

responses of host plants to mycorrhizal inoculation under

varying levels micronutrients (Zn, Fe) fertilization.

· Dual inoculation of VAM + Gluconacetobacter to promote Zn

nutrition in maize.

· Alleviation of Fe deficiency in Maize.

· To popularize VAM technology through Front Line

Demonstrations.

· Mycorrhizal symbiosis to economize water soluble

fertilizers in Sugarcane under drip-fertigation System.


· Mycorrhizal fungal colonization in maize significantly -1increased soil available Fe (M- 1.9; M+ 2.1 mg kg ) and Zn (M-

-14.16; M+ 4.50 mg kg ) in both calcareous and non-calcareous

soils. -3· Siderophore production in M+ plants (51.4 µmol cm hr)

-3were higher than M- plants (39.5 µmol cm hr) that facilitate

micronutrient availability in rhizosphere soil.

· Mycorrhizas can be used for bioforification of maize grains.

Increased availability of Fe & Zn in soil in combination with

enhanced concentrations in plants assisted M+ plants to

maintain higher micronutrient contents in grains (Fe M- 31.2, -1M+ 35.3; Zn M- 45.1, M+ 52.4 mg kg ).

· Interestingly, maize grains had 10-15% higher Fe & Zn

contents while anti-nutritional factor “phytic acid” had -1decreased (M- 1.13; M+ 1.07 mg g ). Overall, the data suggest

that mycorrhizal fungal inoculation assists in biofortification

in kernels with Fe and Zn besides circumventing the impact

of anti-nutritional factors.

· Dual inoculation of Gluconacetobacter with mycorrhizal

fungus (Glomus intraradices) was significantly increased the

availability of Zn. Water soluble and exchangeable (WSEX)

and organically bound (OC-Zn) zinc fractions were

increased either by combined inoculation or Zn fertilization.

The data suggest dual inoculation can match the crop

requirement of Zn completely.

· A field experiment was initiated to study the role of

mycorrhizal symbiosis to economize water soluble fertilizers

in sugarcane under drip-fertigation system. Treatments

consisted of five levels of water soluble fertilizers (100%,

75%, 50%, 25% RDF in the form of WSF) and one treatment

include 100% RDF in the form of conventional fertilizers and

two mycorrhizal treatments (with or without inoculation of

Glomus intraradices) replicated 4 times in a RBD. Nutritional,

physiological, biochemical, morphological plant parameters

and soil biochemical characteristics will be evaluated.

Conclusion

· Field experiments have unequivocally demonstrated that

mycorrhizal colonization improved the Fe and Zn

nutritional status of plants as a secondary consequence of

physiological, biochemical, nutritional and morphological

changes in the host plants. Overall, the data suggest that

mycorrhizal fungal inoculation assists in biofortification in

kernels with Fe and Zn besides circumventing the impact of

anti-nutritional factors

· Mycorrhiza inoculated maize plants produced grains with

low phytate content with higher phytase activity suggesting

suppression of anti-nutritional factor by the symbiosis

· Mycorrhizal colonization appears to alleviate Fe deficiency

in calcareous soils. The release of organic acids and

rhizosphere acidification favourably increased the Fe

availability.

· Inoculation of gluconacetobacter with mycorrhizal fungus

assists in Zn nutrition of maize.

· Mycorrhizal soil had improved biochemical changes that

favour the availability of Zn. Acid phosphatase activity

increased by 20-40% due to mycorrhizal colonization that

acidify the rhizosphere besides improving the availability of

Zn.


· Subramanian, K.S., and Bharathi, C. 2011. Boron nutrition

and mycorrhizal symbiosis. Poster presented at the

55


“National seminar on Soil Health Improvement for

Enhancing Crop Produtivity. (Page No. 90).

· Subramanian, K.S., Bharathi, C. Vijayakumar, S and

Balakrishnan, N. 2011. Zinc nutrition in maize using

mycorrhizal symbiosis. Poster presented at the “National

seminar on Soil Health Improvement for Enhancing Crop

Productivity. (Page No. 91).

· Subramanian, K.S., and Balakrishnan, N. 2011.

Biofortification of Fe and Zn in maize grain using

mycorrhizal symbiosis. Poster presented at the “National

seminar on Soil Health Improvement for Enhancing Crop

Productivity. (Page No. 92).

· Subramanian, K.S., Vijayakumar, S and Balakrishnan, N.

2011. Dual inoculation of VAM and Glucanoacetobacter to

promote Zn nutrition in maize. Poster presented at the

“National seminar on Soil Health Improvement for

Enhancing Crop Productivity. (Page No. 93).

Harnessing agriculturally beneficial microorganisms for production and protection of sorghum and rice

PI : S. GopalakrishnanCo PI : G. V. Ranga RaoInternational Crops Research Institute for Semi-Arid Tropics, Patancheru, A. P.

Rationale

Interest in biological control of plant pathogens has been

stimulated in recent years by trends in agriculture towards

greater sustainability and public concern about the use of

hazardous pesticides. Microorganisms have the capability to

synthesize many different biologically active secondary

metabolites such as antibiotics, herbicides, pesticides, anti-

parasitic and enzymes like cellulase and xylanase in waste

treatment. Secondary metabolites from microbes, particularly

bacteria and actinomycetes, are known to supress various insects

pests and disease causing plant pathogenic microbes. Among the

bacteria Bacillus thuringiensis (Bt) is the most researched, and

focused on the toxins (cry toxins) its production, and extensively

used for managing many insects. Spinosad (a product of soil

actinomycete Saccharopolyspora spinosa; a mixture of spinosyn A

and spinosyn D as active ingredients) are known to kill many

insects including Helicoverpa armigera and pathogenic fungi

including Aspergillus flavus. Spinosad has become so popular that

it is now widely used by the organic farmers of Europe and

America to control major insect pests and diseases of many fruits

and vegetable crops. Role of actinomycetes in plant growth

promotion and biocontrol are getting new insights as better

alternative for sustainable agriculture production over agro-

chemicals. Microbial rich natural sources like composts and

organic amended rhizosphere soil samples can serve as an

excellent source for isolating novel active actinomycetes. Hence,

in the previous year, in the AMAAS project, 127 actinomycete

cultures were isolated from 27 different herbal compost.

Actinomycetes evaluation was continued this year also against

three plant pathogens of chickpea and sorghum viz., Fusarum

Influence of culture filtrates ofCAI-21, -26 and MMA-32 on FOC.

Influence of culture filtrates ofCAI-21, -26 and MMA-32 on S. rolfsii

When the 80% MeOH fraction was further fractionated, only one fraction (80-3%) was found to inhibit the FOC.

oxysporum f. sp. ciceri (FOC; causing wilt in chickpea), Sclerotium

rolfsi (causing collar rot in chickpea) and Macrophomina phaseolina

(causing charcoal rot in sorghum).

Objectives

· To identify and evaluate beneficial microorganisms in

relevant crop husbandry system(s) involving sorghum and

rice.

· Laboratory evaluation of traditional knowledge

products/protocols involving agriculturally beneficial

microorganisms.

· To submit promising access ions of benef ic ia l

microorganisms to NBAIM, after due evaluation and

characterization (including nomenclature using molecular

techniques).


· Twelve actinomycetes were demonstrated for their

antagonistic potential against FOC in the GH conditions as

well as wilt-sick field conditions.

· All the 12 isolates were identified by 16s rDNA gene

sequence analysis and submitted to NBAIM.

Conclusion

Twelve actinomycetes were demonstrated for their

antagonistic potential against FOC in the GH conditions as well as

wilt sick field conditions. All the 12 isolates were identified by 16s

rDNA gene sequence analysis and submitted to NBAIM.


· Gopalakrishnan S, Humayun P, Kiran BK, Kannan IGK,

Vidhya MS, Deepthi K and Rupela O. (2010). Evaluation of


56

A B BA

Efficacy of PGPR isolate BS2 against Colletotrichum infection in cowpea under field conditions (A: untreated and B: PGPR BS2 treated).

Effect of PGPR consortium (BS2+T2-2) treated (B).

bacteria isolated from rice rhizosphere for biological control

of charcoal rot in sorghum caused by M. phaseolina. World

Journal of Microbiology and Biotechnology DOI 10.1007/s11274-

010-0579-0.

· Gopalakrishnan S, Kannan IGK, Alekhya G, Humayun P,

Meesala SV and Kanala D. (2010). Efficacy of Jatropha,

Annona and Parthenium biowash on Sclerotium rolfsii, FOC

and M. phaseolina pathogens of chickpea and sorghum.

African Journal of Biotechnology 9(47): 8048-8057.

· Gopalakrishnan S, Pande S, Sharma M, Humayun P, Kiran

BK, Sandeep D, Meesala SV and Kanala D. (2010).

Evaluation of actinomycete isolates obtained from herbal

vermicompost for the biological control of Fusarium wilt of

chickpea. Crop Protection (Accepted).

· Gopalakrishnan S. (2010). Factors responsible for higher

yields in SRI. SRI News Letter 2(1): 8-9.

Isolation, identification, evaluation and exploitation of microorganisms for management of importantplant pathogens and having PGPR potential for vegetable crops

PI : M. LoganathanCo PIs : S. Saha, A. B. RaiIndian Institute of Vegetable Research, Varanasi

Rationale

Tomato and cowpea are the important vegetable crops in

India and production of these crops is affected by both abiotic and

biotic factors. Among them, the diseases caused by fungal

pathogens are causing huge yield loss (2-90 %) in the vegetables.

Identification of certain microbes and utilize them for the

management of the diseases will be the suitable solution since

other means of management threatened the environment safety

and human and animal health. Very limited attempts have been

made in India to use of PGPR for the management of vegetable

diseases in India. Hence in this project, a focus was made to

increase the vegetable production and suppress the diseases

through PGPR in turn to maintain ecological balance.

Objective

· Exploitation of rhizospheric microorganisms for disease

suppression and growth promotion.


· Two potential isolates against wilt and collar rot of tomato

were identified as Bacillus amyloliquefaciens -BA1 (earlier

known as chilli 1) and B. subtilis -BS2 (earlier known as chilli

2) based 16S rDNA amplification and sequencing (Acc. No:

HQ021420 and HQ021418).

· In 2010-11, evaluation of potential PGPR against Fusarium

oxysporum f.sp. lycopersici (FOL) in tomato under field

conditions recorded consistent performance of BS2 as it

reduced the disease (56.8 %) and enhanced the yield (25.1 %).

· Among 6 selected PGPR tested against Colletotrichum

infection in cowpea under field conditions, the isolates viz.,

Ba1, Bs2, T2-7 and T2-2 were promising in reducing the leaf

spot infection and promoting the yield.

· Among different combination of consortium with potential

rhizobacterial isolates tested, a consortium partner of Bs2

with T2-2 or T2-7 found effective in reducing the wilt and

enhancing the growth of tomato under green house

conditions.

· Sensitivity/compatibility of selected PGPR isolates to

fungicides showed that all the PGPR isolates were

compatible with wide range of fungicides.

· Significant level of induction of defense related enzymes viz.,

phenylalanine ammonia lyase, peroxidases, polyphenol

oxidases and catalase was observed in PGPR treated plants

challenged with FOL pathogen.

Conclusion

Selected few potential PGPR isolates among 142 having both

growth promotion and disease suppression activities in tomato

and cowpea based on in vitro, greenhouse and field experiments.

These isolates can be further utilized for wide range of vegetable

crops for the effective disease management.


· M. Loganathan, R. Garg, S. Saha and A.B. Rai. 2010. Selection

of antagonist rhizobacteria against soil born pathogens.

Journal of Mycopathological Research 48(1):68-71.

57



· R. Garg, M. Loganathan, S. Saha, T.K. Bag, V.

Venkataravanappa and A.B. Rai. 2010. Non chemical

management of soil borne pathogens of vegetables through

Plant Growth Promoting Rhizobacteria (PGPR). In: National

Seminar on Ecological Strategies to save the Earth and the

Biotic Environment, held by Purvanchal University,

Varanasi, U.P., December 11-12, 2010.

· M. Loganathan, R. Garg, S. Saha, T.K. Bag, V.

Venkataravanappa and A.B. Rai. 2011. Efficient

management of soil borne pathogens of vegetables through

Plant Growth Promoting Rhizobacteria (PGPR). In:

Microbial Diversity and its applications in Health,

Agriculture and Industry held at ICAR Research Complex

for Goa, Mar 4-5, 2011.

Isolation and development of plant growth promoting organisms from high biodiversity region for tropical tuber crops

PI : M. L. JeevaCo PI : Susan John K., R. S. Misra, S. S. VeenaCentral Tuber Crops Research Institute, Sreekariyam, Thiruvananthapuram.

Rationale

The present project envisages the creation of an inventory of

the microbial diversity and to find out the highly potent microbial

strains for nutrient use efficiency (N fi×ers, phosphate solubilizers

and potassium solubilizers) and bio-control (against collar rot of

Amorphophallus) with a view to find its application under field

condition for use as a component of INM for biological nutrition

and as potent bio-control agents for use as a component of IDM. For

this, collection and identification of the most efficient fungal and

bacterial strains suited to tuber crops (cassava, sweet potato and

elephant foot yam) for different agro ecological regions for

different utilizations were envisaged. Application of the efficient

strains and their utilization in large scale for nutrient management

and biocontrol requires characterization, standardization of mass

production techniques and field level e×periments. This study

aims to determine the effects of microorganisms to assess the

productivity with the application of these inputs.

Objectives

· Molecular and physiological characterization of new efficient

isolates of K solubilizers and bio control agents.

· E×ploration of biochemical mechanism of K solubilization

and antagonism of potent strains as bio control agents.

· Standardization of mass multiplication methods of selected

strains

· Study of the compatibility of effective strains of bio fertilizer

and biocontrol agents to apply them in consortium.

· Agronomic evaluation of N, P and K efficiency of the selected

strains along with biocontrol agents in Amorphophallus to

substitute for NPK fertilizers and control of collar rot disease.


· Bioincoculants such as N fi×er (Bacillus cereus), P solubilizer

(Pantoea sp.), K solubilizer (Bacillus subtilis, Pseudomonas

fluorescens and Trichoderma) studied for their plant growth

promoting role (Indole acetic acid production, ammonia

production and hydrogen cyanide production) showed

significant production of Indole acetic acid and ammonia.

Only Pseudomonas fluorescens showed production of

Hydrogen Cyanide

· Effect of various stress conditions (temperature, salt

concentration and pH) on the growth of bioinoculants

revealed that all the bioinoculants could survive a 0temperature up to 50 C, salt concentration up to 2 %, and pH

up to 9. The K solubilizer, Bacillus subtilis showed remarkably

0increased tolerance up to temperature 65 C, pH range of 6-12

and salt conc. of 8%.

· A new P solubilizer has been identified as Bacillus megaterium -1with a solubilization capacity 199 µg g .

· Bioassay of five Trichoderma spp. (Tr8, Tr9, Tr10, Tr11, and

Tr14) selected by direct confrontation assay, to prevent rot

caused by Sclerotium rolfsii in the pseudostem of

Amorphophallus revealed Tr9 as the best isolate for the control

of rot .

· The minimum inhibitory concentration of ethyl acetate

e×tract of 30 day old culture of Tr9 was found to be 1.5µl.

· HPLC profile of the secondary metabolite (crude ethyl acetate

e×tract of culture filtrate) of Tr9 grown in the presence of

autoclaved mycelium and fresh mycelium of Sclerotium rolfsii,

and without any mycelium revealed the significant difference

in production of secondary metabolite with increased

production of certain compounds, reduced production of

some compounds and production of some additional

compounds in presence of mycelium.

· The potent isolate (Tr9) was identified as Hypocrea lixii, which

is the teleomorph of Trichoderma harzianum.

· The possibility of using cassava flesh as one of the cheapest

and easily available raw material for media preparation for

the mass cultivation of K solubilizing bacteria in a short span

of time was explored.

· When cheapest and easily available raw materials such as

cassava thippy, cassava seed oil, cassava leaf powder and

cawdust used for making the carrier based inoculum for the

effective storage of potent biofertilizer and biocontrol agent,

cassava thippy, cassava seed oil and saw dust gave better

survival for the bacteria while sawdust, cassava seed oil and

cassava leaf powder proved best for Trichoderma.

· Statistical analysis of the corm yield data indicated significant

effect of treatments on corm yield of elephant foot yam

wherein application of biofertilizers alone without chemical -1

fertilizers T1(31.768 tha ) was significantly inferior to all other

treatments, which were in turn were on par (NPK).

Conclusion

Characterization of all the bioinoculants on important plant

growth promoting activities showed significant ability in in vitro

conditions and they could also tolerate wide range of stress

conditions. Bioassay of Trichoderma spp. revealed the potent

activity of Tr9 against collar rot & this was identified as Hypocrea


58

lixii, teleomorph of Trichoderma harzianum. The crude metabolite

showed inhibitory activity at a very low concentration &. HPLC

analysis of crude metabolite also indicated the presence of

additional compounds. This study could develop a best mass

multiplication medium for our potent K solubilizing bacteria using

one of the cheapest and easily available raw material cassava flesh.

Experiment for the preparation of effective carrier based inoculum

unveiled the role of cassava seed oil, cassava thippy, cassava leaf

powder and saw dust in upholding the viability of potent

biofertilizer and biocontrol agent. Application of NPK containing

biofertilizers along with Pseudomonas fluorescens and biocontrol

agent, Trichoderma in the Amorphophalus revealed the possibility of

substituting chemical fertilizer to the tune of 25- 75% level of the

recommended dose of N, P and K chemical fertilizer with our

potent bioinoculants.


· Anjanadevi, I.P., Susan John, K., Jeeva, M. L, Misra, R.S, and

Neetha Soma John. 2011. Potassium solubilizing bacteria and

its low cost mass multiplication technique. Abstract in

proceedings of the National Seminar on Climate Change and

Food Security: Challenges and Oppurtunities for Tuber crops” 20-

2 2 J a n u a r y 2 0 1 1 , C T C R I S r e e k a r i y a m ,

Thiruvananthapuram.pp.162

· Neetha Soma John, Anjanadevi, I.P, Jeeva, M.L., Misra, R.S.

and Susan John, K. 2011. Antifungal Potential of Trichoderma

spp. against Sclerotium rolfsii causing Collar Rot in

Amorphophallus: An in vitro Study, Abstract in proceedings of

the National seminar on Climatic Changes and Food Security:

Challenges and Oppurtunities for Tuber crops, 20-22 January

2011, CTCRI, Sreekariyam, Thiruvananthapuram, p. 43.

· Neetha Soma John, Anjanadevi I.P., Jeeva, M.L and Misra, R.

S. 2010. In vitro screening of antagonistic Trichoderma spp.

aganist the major pathogens of tropical crops. National symposium on “Molecular Approaches for Management of Fungal

Diseases of Crop Plants”. 27-30, December, 2010 Indian Institute

of Horticultural Research, Bangalore, p.148.

· Susan John, K., Neetha Soma John and I.P. Anjanadevi (2010).

Agronomic Investigation of new microbial isolates as thbiofertilizers for sweet potato grown in an Ultisol of India. XI

ESA (European Society of agronomy) Congress 'Agro 2010'. 29

August to 3 September 2010 Montpellier, France, p.167.

Seminar, Symposia and Conferences attendedth· XI ESA (European Society of agronomy) Congress 'Agro

2010' Montpellier, France, 29August to 3 September 2010.

· National symposium on “Molecular Approaches for

Management of Fungal Diseases of Crop Plants”, Indian

Institute of Horticultural Research, Bangalore, 27-30,

December, 2010.rd· 23 Kerala Science Congress, Centre for Earth Science,

Thiruvananthapuram, 29 -31 January 2011

· National seminar on Climatic Changes and Food Security:

Challenges and Oppurtunities for Tuber crops, CTCRI,

Thiruvananthapuram, 20-22 January 2011.

· Training course on “National Training on Molecular

Diagnosis for Pathogens Infecting Crop Plants” organised at

CTCRI, Thiruvananthapuram sponsored by NAIP, 16

February to 03 March 2011.

Plant growth promoting rhizobacteria (PGPR) for chickpea and pigeonpea

PI : Mohan SinghCo PI : R. G. ChaudharyIndian Institute of Pulses Research, Kanpur

Rationale

P G P R s a r e m i c r o o r g a n i s m s t h a t c o l o n i z e

rhizosphere/rhizoplane and produce certain bioactive molecules

such as antibiotics, antifungal compounds, siderophores, growth

hormones, etc. and also sometime induce systemic resistance

against number of pathogens. Large numbers of commercial

preparations of such microorganisms have been developed

successfully for different crops. PGPRs for pulses have also been

reported yet this technology has not been perfected for wide scale

adoption. Field responses to inoculation with PGPRs and

Rhizobium produce highly variable increase in crop yields

ranging from 0-40%. The uncertainty about beneficial responses

to inoculation stem out from the limited the understanding of

interaction(s) between PGPRs, Rhizobium, host, phytopathogens

and soils. Multi-strains inocula are proving more beneficial and

reported to produce field responses with greater degree of

confidence. However, this approach needs to be evaluated in

more number of crops and on wider scale.

Objectives

· Screening of microorganisms having potential to improve

nutrient use efficiency, disease suppression, growth and

yield of pigeonpea and chickpea.

· Developing consortium of PGPR for chickpea and

pigeonpea.

· Evaluating the field performance of PGPR consortium on

chickpea and pigeonpea.


· Second year of Field inoculation trial with PGPR strains in

chickpea confirmed that growth response to inoculation was

higher in soil containing higher organic carbon level (0.35%)

compared to low carbon content 0.20%. Majority of PGPR

strains for chickpea belong to Bacillus spp. Three PGPR

strains namely PSB 11, CP-11 and J-7 were Bacillus cereus and

one was identified to be Bacillus spp. One strain (PS 8)

belongs to Enterobacter cloaecea.

· In chickpea, inoculation with efficient strains improved

grain yield by 10 to 30% over uninoculated control.

· Second year of field trail with Pigeonpea UPAS 120, showed

that growth response to inoculation with PGPR was

noticeable only upto 45 days after germination. At harvest,

the grain yield under different treatments of PGPR and

uninoculated control was not different statistically due to

large coefficient of variation in the yield data.

59


Effect of inoculation with PGPR strains on chickpea grain yield under field conditions in soil with different organic carbon content.

Pigeon pea roots endophytes belong to Bacillus cereus and Stenotrophomonas maltophilia These were distinct from the endophyte of chickpea root.

· Isolation of PGPR Strains: Endophytic microorganisms were

isolated from root, stem and leaves of Pigeonpea and

Chickpea using two different media, one N-free semi solid

and 1/10 Nutrient agar. Around 100 strains of different

microorganisms were isolated from different tissues and

media for further characterization.

· Biochemical characterization of endophytes Isolates: Isolated

strains were also subjected to various biochemical

characterization viz., Nitrate Reduction, Catalase & Oxidase,

Starch, Gelatin & Casein hydrolysis, Arginin Degradation,

Tween 80 hydrolysis, and IAA production, HCN

production, siderophore production and ammonia

production and their antagonistic activity with wilt

pathogen of pigeonpea and chickpea.

· Carbon sources utilization of these strains was carried out

using C-source like mannitol, arabinose, xylose, trehalose,

rhamnose, etc.

· Antibiotic profiling against penicillin, tetracycline,

streptomycin, chloroamphinicol, gentamycin and kanamcin, etc.

was carried out to differentiate these strains.

· Microbial Identification using FAME analysis revealed that

Chickpea roots and stem were primarily colonized by

Pseudomonas aeruginosa while chickpea leaves were

colonized by Photorhabdus luminescens as endophytic

microorganism.

· Pigeon pea roots endophytes belong to Bacillus cereus and

Stenotrophomonas maltophilia and were distinct from the

endophyte of chickpea roots.

· Sixteen endophytes were evaluated for their growth

promoting effects in pots filled with vermiculite and soil. Out

of 16 isolates, some efficient isolates were selected for further

testing in pots filled with unsterilized soil (5 kg/pot).

Endophyte showing growth promoting effects greater than

40% as compared to un-inoculated control were selected for

field evaluation in micro-plots.

Conclusion:

Beneficial growth response to inoculation with PGPR strains

belonging to B. creeus was confirmed under field experiment for

two years. Inoculation with PGPR increased grain yield from 10 to

30 % over uninoculated control. Growth response to inoculation

with PGPR depends upon soil organic carbon content. Higher the

organic carbon content greater is the response to inoculation.

Seeds, leaves, stem and roots of both chickpea and pigeonpea are

colonized by different bacteria. These endophytic bacteria were

isolated and characterized for various traits including antibiosis

against wilt pathogen. Chickpea roots and stem were primarily

colonized by Pseudomonas aeruginosa while chickpea leaves were

colonized by Photorhabdus luminescens as endophytic

microorganism. Pigeonpea roots endophytes belonged to Bacillus

cereus and Stenotrophomonas maltophilia and were distinct from the

endophyte of chickpea roots.

Important diseases and pests of sunflower, safflower and castor

PI : R. D. Prasad Co PIs : M. A. Raoof, M. Santha Lakshmi Prasad, P. S. Vimala Devi Directorate of Oilseeds Research, Rajendranagar, Hyderabad

Rationale

Several diseases and pests of castor, sunflower and safflower

limit the production and productivity. The soilborne pathogens

Fusarium oxysporum and its formae speciales, Macrophomina

phaseolina, Sclerotium, Sclerotinia and nematode species like

Rotylenchulus reniformis and foliar pathogens like leaf spots in

sunflower and safflower, Botrytis ricini gray rot of castor are

causing significant economic losses. Insect pests like Helicoverpa

armigera causing significant yield losses in most of the oilseed

crops. To avoid risks associated with use of chemical pesticide

alternate control tactics like biological methods are given

importance these days. Beneficial microbes have potential scope

in the management of biotic stress especially in oilseed crops that

are mostly grown under rainfed dry land conditions by resource

poor farmers. The fungi and bacteria used for control of variety of

plant diseases in India include Trichoderma and Gliocladoim

species, bacteria like Pseudomonas fluorescens and Bacillus spp.

Insect bioagents like Bacillus thuringiensis, Beauveria and

Metarhizium have been identified as potential candidates against

variety of insect pests. The success of biological control lies in


60

selection of a single or consortia of microbes having broad host

range, development of formulations that retain viable

propagules for a year or two and suitable for different delivery

systems and finally timing of application of these biopesticides.

Objectives

· Screening of fungal and bacterial biological control agents in

vitro and in vivo against Botrytis ricini, Alternaria helianthi,

Macrophomina phaseolina, Sclerotium rolfsii, Rhizoctonia solani

and selection of potential agents with good biocontrol traits.

· Development of formulations of consortia of potential agents

for foliar application against selected diseases of castor,

sunflower and safflower and Bt plus Beauveria bassiana

against Helicoverpa armigera and Spodoptera litura larvae.

· Studying shelf life, persistence, phylloplane and rhizosphere

competence of potential formulations.

· Field-testing of the formulations against Botrytis grey rot in

castor, Alternaria blight in sunflower and H. armigera and S.

litura on sunflower crop for determination of the effective

field dose, persistence and safety to parasites/predators.

· To generate data and registration of potential agents for field

use.


· Trichoderma harzianum-Th4d (oil formulation 1ml/l),

Pseudomonas fluorescens-Pf2 (Talc formulation 5g/l) and

consortia oil formulation of Trichoderma harzianum-Th4d +

Trichoderma viride-Tv5 1ml/l were observed to be effective

against Alternaria leaf blight of sunflower and Botrytis grey

rot of castor with maximum disease reduction over pathogen

check (55-65%). Trichoderma harzianum-Th4d (oil formulation

1ml/l), consortium of Trichoderma harzianum-Th4d+

Trichoderma viride-Tv5 (oil formulation 1ml/l) and

Pseudomonas fluorescen-Pf2 (Talc formulation 5gm/l)

resulted in higher yield is 1604, 1634 and 1455 kg/ha,

respectively as compared to pathogen check (798 kg/ha) in

sunflower and 1870, 1880 and 1680kg/ha, respectively as

compared to pathogen check (866 kg/ha) in castor.

· Oil formulation of Trichoderma harzianum-Th4d @ 1ml/l and

consortia of oil formulation viz., Trichoderma harzianum-Th4d

+ Trichoderma viride-Tv5 @ 1ml/l showed better persistence

level of 7.61, 8.45 and 7.89 log cfu even after 15 days of

spraying and bacterial bioagent viz., Pseudomonas fluorescens-

Pf2 sprayed @ 10g/l also showed better persistence levels of

7.47 log cfu on leaves of sunflower. Trichoderma harzianum-

Th4d (oil formulation), consortia of Trichoderma harzianum-

Th4d+Trichoderma viride-Tv5 (oil formulation), and talc

formulation of Pseudomonas fluorescens-Pf2 showed high

population levels of 10.73, 10.71 and 9.45 log cfu, respectively

at 15 days interval on capsules of castor.

· In vivo screening of consortia Trichoderma viride-Tv2+

Trichoderma viride-Tv5, Trichoderma spp-T12 + Trichoderma

spp-T33, Trichoderma viride-Tv2+ Trichoderma harzianum-

Th4d and Trichoderma viride-Tv5+Trichoderma harzianum-

Th4d showed 80-95% reduction of Macrophomina root rot in

safflower.

· Trichoderma oil formulations retained viable propagules

between log cfu 9.91 to 9.54 at 360 days showing very good

shelf life.

· Multi location field trials were conducted at AICRP

sunflower centers at Raichur and Coimbatore. Trichoderma

harzianum- Th4d oil formulation applied at a rate of 1ml/l

showed 57.0% reduction of Alternaria leaf spot whereas

mancozeb recorded 37.0% reduction only under field

conditions at Raichur. At Coimbatore, Trichoderma

harzianum- Th4d @ 1ml/l (Oil formulation) showed 42.0%

disease reduction in Alternaria leaf spot of sunflower

compared to 44.0% reduction obtained with mancozeb at

Coimbatore.

· In field testing at Raichur using combination formulation of

Bt and B. bassiana against capitulum borer H. armigera on

sunflower, the larval incidence was completely lowered by 3

days after spray in plots sprayed with combination

formulation @ 2.5 and 3.0 g/l and spinosad 45 SC @ 1.0 ml/l

Seed Yield from the combination formulation @ 3.0 g/l was

at par with the spinosad treatment with 1208 and 1296 kg/ha

respectively while the yield in control plots was 732 kg/ha.

At Bangalore centre, combination formulation @ 3.0 g/l was

completely free from the larval population with 0.06

larvae/plant in profenofos and 0.1-0.2 larvae/plant in all

other treatments including the insecticide endosulfan. Seed

yield was highest in combination formulation treatments @

3.0 and 2.0 g/l with 2438 and 2344 kg/ha respectively and

lowest at 1736 kg/ha in control plots.

· Determination of LC of combination formulation against 10 50

days old H. armigera larvae: Studies were conducted against

10 days old larvae obtained from first generation culture

from field collected larvae. Combination formulation of Bt

and B. bassiana was superior to Bt used singly resulting in

higher kill of older larvae coupled with improved speed of

kill. (1). LC of combination formulation of Bt and B. bassiana 50

was 260 (containing 96.2 mg Bt) and 133 mg (containing 49.21

mg Bt) per 100 ml at 2 and 3 days after treatment respectively.

(2). LC of Bt alone as well as Bt standard was obtained only 50

at 3 days after treatment with values of 182 and 146 mg/100

ml respectively. The Bt requirement in the combination

formulation was thus lowered by 73 %. (3). Potency of Bt in

the combination formulation increased 3 fold. The potency of

combination formulation was found to be 34,000 IU/mg.

· Quantification of Bt toxin: The quantity of Cry1AC toxin in

the Bt (technical) ranged 0.5 – 0.6 mg/g.

Conclusion

IP disclosure on “PRODUCTION PROCESS FOR

IMPROVED YIELD OF TRICHODERMA HARZIANUM (Th4d)

BIOMASS” submitted to ITMU, DOR for processing and filing

patent. Two technologies viz., oil based formulation of T.

harzianum Th4d and, powder formulation of Pseudomonas

fluorescens Pf2 selected on the basis of their biocontrol potential

against Botrytis grey rot of castor and Alternaria blight of

sunflower are going to be commercialized by ITMU, DOR.

Trichoderma harzianum-Th4d (oil formulation, 1ml/l),

Pseudomonas fluorescens-Pf2 (Talc formulation, 5g/l) and consortia

oil formulation of Trichoderma harzianum-Th4d + Trichoderma

viride-Tv5, 1ml/l were effective against Alternaria leaf blight of

sunflower and Botrytis grey rot of castor with maximum disease

reduction over pathogen check (55-65%) and showed better

persistence. In shelf life studies, Trichoderma spp. oil formulations

retained viable propagules between log cfu 9.91 to 9.54 at 360

days. In field testing of combination formulation of Bt and B.

bassiana against capitulum borer H. armigera on sunflower, at

Raichur, the larval incidence was completely lowered by 3 days

61


Bioprospecting for viticulturally important microorganisms

PI : Indu S. Sawant Co PI : S. D. SawantNational Research Centre for Grapes, Pune

Rationale

Grape (Vitis vinifera) suffers huge losses due downy mildew,

powdery mildew and anthracnose diseases. The first two are

caused by the biotrophic fungii - Plasmopara viticola and Uncinula

necator, respectively, while anthracnose is caused by the

facultative saprophyte Colletotrichum gloeosporioides. Growers

have to rely mainly on fungicides for management of the diseases,

as effective bio-control organisms are not available. Further, the

large number of pesticide sprays given for control of diseases

results in detection of their residues above the maximum

permissible limits (MRLs) at harvest. The aim of this project was to

identify vines with low incidence of the diseases and to isolate the

endophytic, phyllospheric and the rhizospheric micro-organisms

and test them for potential bio-control activity against the three

pathogens, as well as to identify micro-organisms which can be

used as a pre-harvest application for bio-degradation of the

pesticides.

Objectives

· To isolate micro-organisms from grapevines and check their

potential for bio-control of important diseases of grapes.

· To identify micro-organisms with potential for

biodegradation of pesticide residues in grapes.


· The 25 bacterial isolates from total of 293 isolated from grape

shoot, leaf, root and rhizosphere selected on the basis of in

vitro evaluation, were evaluated for control of downy

mildew in pot trials. The pooled analysis of the three trials

indicated that 6 isolates viz., 171, 204 and 219 gave significant

reduction in PDI, followed by isolates 205, 209, 198 and 201.

· The same 25 bacterial isolates were also evaluated for control

of anthracnose in pot trials. The pooled analysis of the three

trials indicated that 16 isolates gave significant reduction in

PDI.

· Similarly these 25 bacterial isolates were also evaluated for

control of powdery mildew on infected detached leaves.

Isolates 38, 39 and 126 gave significant reduction in PDI.

· Thirty four Trichoderma isolates were evaluated for control of

powdery mildew on infected detached leaves. Fifteen

isolates gave significant reduction in PDI. Isolate T.

harzianum (NAIMCC 01741) and T. pseudokoningii (NAIMCC

01775) were most effective.

· All 34 Trichoderma isolates were screened in vitro against C.

gloeosporioides, and the most virulent ones were identified for

in vivo trials.

· 14 Trichoderma isolates were evaluated for control of downy

mildew and anthracnose diseases on infected detached

leaves. 2 isolates each were found effective in reducing PDI.

· All 34 Trichoderma isolates were evaluated in vitro for

biodegradation of the fungicide flusilazole used for control

of powdery mildew in grapes. 21 isolates could effectively

after spray in plots sprayed with combination formulation @ 2.5

and 3.0 g/l and spinosad 45 SC @ 1.0 ml/l.


· R.D.Prasad, T. Navaneetha and M.A.Raoof. 2010. Efficacy of

biocontrol agents against Botrytis grey rot of castor under

field conditions. Journal of Oil seeds Research, 27: 243-245.

· T. Navaneetha, R.D.Prasad, M. A. Raoof and G. Srinivasa

Rao. 2010. Evaluation of consortia of Trichoderma spp.

against Botrytis gray rot of castor. Journal of Oil seeds Research,

27: 240-243.

· S. Chander Rao, R.D.Prasad and T. Navaneetha. 2010.

Evaluation of Trichoderma spp. against Botrytis grey rot of

castor. Journal of Oil seeds Research, 27: 238-239.

Seminar, Symposia and Conferences attended:th · 9 National Symposium on “Crop Health Management for

Sustainable Agri – Horticultural Cropping System” held at

Central Agricultural Research Institute, Port Blair, 17-19

February, 2011.

· National Symposium on “Research and Development in

castor: present status and future stratergies” at Directorate of

Oilseeds Research, Hyderabad, Oct., 22-23, 2010.

Bacterial isolate 204 effectiveagainst downy mildew.

Bacterial isolate 205 effectiveagainst downy mildew.


62

degrade flusilazole from 0.5 ppm to less than 0.05 ppm (EU

MRL limit) within 15 days. Four of these 21 isolates provided

cent percent degradation. These isolates were selected for

further studies on rate of degradation and other

characteristics to select the most efficient ones for field trials.

Conclusion:

Bacterial isolates 6, 3 and 16 from the 25 isolates from grape

shoot, leaf, root and rhizosphere gave significant control of

downy mildew, powdery mildew and anthracnose diseases in in

vivo trials. Six isolates of Trichoderma, from the 34 isolates obtained

from NBAIM, gave significant control of downy mildew,

powdery mildew or anthracnose disease in in vivo trials. Of these

34 Trichoderma isolates, 21 could effectively degrade flusilazole.

Based on in vivo trials, 8 bacterial isolates and 6 isolates of

Trichoderma were selected for field evaluation for control of

anthracnose, downy mildew and powdery mildew diseases.

Twenty one Trichoderma isolates were selected for further in vitro

and in vivo evaluation.


· 4th Indian Horticulture Congress 2010 from 18-21

November, 2010, at New Delhi.

· National Symposium on Molecular Approaches for

Management of Fungal Diseases of Crop Plants from 27-30,

December, 2010 at IIHR, Bangalore.

· X Agricultural Science Congress from 10-12 Feb., 2011 at

NBFGR, Lucknow.

Development of a library putative probionts from marine environment belonging to the genus Pseudomonas,

Micrococcus and Bacillus for application in mariculture systems

PI : K. K. VijayanCo PIs : Subhadeep Ghosh, Kajal ChakrabortyCentral Marine Fisheries Research Institute, Cochin, Kerala

Rationale

Documentation of biodiversity of native aquatic microbes

viz., Pseudomonas, Bacillus and Micrococcus from marine ecosystem

and provide a depository of potential microbes for

biotechnological application. Development of protocols for

bioprocess technology for the commercial production of potential

microbial metabolite from useful microbes. Development of

microbial products for application in aquaculture,

pharmaceuticals and health. Development of human resource in

the areas of microbial diversity, microbial genetics, bioprocess

technology and microbial product development.

Objectives

· To screen and document microbial diversity and establish

useful marine resources with special reference to

Pseudomonas, Bacillus and Micrococcus.

· To evaluate microbes for secondary metabolites for use in

aquaculture

· To characterize, develop and optimize bioprocess

technology for potential microbial metabolites antagonistic

towards pathogenic bacteria.

· To purify the target molecules and elucidate structure/s of

the purified molecules.

· To develop microbial products and evaluate their efficiency

in commercial application.

· To establish library of bioactive microbes for the future

biotechnological exploitation.


· Samples collected and processed from the above mentioned

sites gave the yield of about 2920 cultivable isolates. Of which

45 isolated from sediment and water samples and 23 isolated

from seaweed possess a good antibacterial activity against

the test pathogens.

· Identification and characterization of the potential isolates

using biochemical method indicates that 9 belong to the

genus Pseudomonas and rest 59 belongs to the genus Bacillus.

16S rRNA sequence identification of the above confirmed the

same.

· On monitoring the bath challenge experiment against the

juveniles of maculata and seabass, the mortality has been

noticed in 24 hours. Except the fishes from control all fishes

died in 5 days confirming the virulence of test pathogens.

· Pseudomonas aeruginosa (P103) and Bacillus subtilis (BM1)

from mangrove sediment and Bacillus subtilis isolated from

Sargassam were chosen for isolation and characterization of

the compounds responsible for bioactivity.

· On standardization of growth medium for bioprospecting,

synthetic medium for Bacillus sp. and GA medium for

Pseudomonas sp. were showing good result.

· Temperature optimization using synthetic medium for

Bacillus sp. and GA medium for Pseudomonas sp. were

showing good result.

· The solvent extracts/purified fractions/compounds

prepared from the candidate Bacillus sp. gave ~ 19 mm

inhibition zone against Verticordia harveyii.

· The bioactive compounds obtained from Pseudomonas sp. on

spectroscopic analysis were found to be chromophore of

phenazine substitution and the auxochrome belong the

carboxyl ester moiety which is N-substituted methyl

octahydro-1-phenazinecarboxylate and propyl 2-oxoacetate.

· Work on formulation of microbial product has been initiated

using one candidate (Bacillus sp) with various carriers and

ligands under different physicochemical conditions.

· Duplicates of 11 cultures have been deposited in NBAIM

culture collection facility.

· Various solvent and aqueous extracts were prepared from

the experimental bacterial species (Bacillus subtilis) isolated

from seaweed, and were assayed against Aeromonas

hydrophilla and Vibrio spp. One of the fraction from this

bacteria was found to be active against Aeromonas hydrophilla

and Vibrio vulnificus strains (MTCC 1146 and MTCC1145)

producing inhibition zone of diameter of ~12 to 18 mm. The

fraction was separated using different solvent systems to

63


yield five major compounds (F3 , F3 F3 F3 and F3 ) with R M N, O, P Q f

0.2-0.8.

Conclusion

From 9 sampling sites, about 2920 isolates of bacteria have

been isolated, and out of which 68 were found to possess good

antibacterial activity (> 15 mm inhibition zone) against

aquaculture pathogens. Forty bacteria have been selected for

primary screening having wide range of antibacterial potential

and subjected to various studies (viz., growth kinetics) and

characterized using biochemical and molecular methods. The

growth medium have been standardized for the both Bacillus and

Pseudomonas for optimum production of bioactive molecles. The

solvent extracts/purified fractions/compounds prepared from

the candidate Pseudomonas and Bacillus spp. registered > 19 mm

inhibition zone against pathogenic V. harveyii. Potential bacterial

strains (Bacillus- 2 no and Pseudomonas- 1 no) were bioprospected

to isolate antibacterial molecules, and the potential molecules

from Bacillus subtilis were found to possess conjugated carbonyl

moiety with hydroxylated derivative/ terpenoid/phenolic

skeleton; and the one identified as Pseudomonas was found to

possess N-substituted methyl octahydro-1-phenazinecarboxylate

and propyl 2-oxoacetate as antibacterial constituents. Work on

formulation of microbial product has been initiated using one

candidate strain (Bacillus sp.) with various carriers and ligands

under different physicochemical conditions.


· Nair, A.V., Ghosh, S., Chakraborty, K., Chakraborty, R.D.,

and Vijayan, K.K. (2011). Isolation and identification of

potential probionts having Antimicrobial activity from south

west and south east coast of India. Conference paper

presented in Asian Pacific Aquaculture 2011, January 17-20,

2011, Le Méridien Resort and Convention Center, Kochi,

India, pp. 358.

· Thilakan, B., Chakraborty, K., Chakraborty, R.D., and

Vijayan, K.K. (2011). Bacillus subtilis MTCC 10403 isolated

from seaweed Sargassam longifolium as a potential source to

isolate antibacterial metabolites. Conference paper

presented in Asian Pacific Aquaculture 2011, January 17-20,

2011, Le Méridien Resort and Convention Center, Kochi,

India, pp. 574.

Microbial phosphorus transformations in inland open waters

PI : Sanjib Kumar MannaCo PIs : Srikanta Samanta Central Inland Fisheries Research Institute (ICAR), Barrackpore, Kolkata

Rationale

Phosphorus (P) is an essential macronutrient. Most of the

freshwater environments are poor in available forms of P, limiting

the aquatic productivity. Although P availability in water column

drives the primary production, sediment acts as a sink or source of

P to the water column. In terrestrial soil P remains bound with Fe,

Al and Ca and P release has long been explained in terms of redox

mediated changes in P sorption by cations, considering the

mineral-bound forms as the predominant or potentially

releasable forms. The phosphorus solubilizing bacteria (PSB)

capable of releasing Ca-bound P, has been used for augmenting

soil fertility. In India and most of the other countries, various

fractionations of sediment P have been rarely studied in

limnology and fisheries research and study of PSB in aquatic

environments are scarce. The overall processes of P availability in

aquatic environments are less understood. In last century, the role

of microbial decomposition has been highlighted as major process

of P releas.e in aquatic environments; however, the extent of P

release through microbial decomposition is debated. However,

little systematic study has been conducted to focus on the major P

release processes, and harvesting and use of microbes to augment

P release processes for enhanced aquatic productivity.

Objectives

· To understand processes of phosphorus transformations and

availability in inland open water environment.

· To evaluate the roles of microbial decomposition on P

availability.

· Isolation of bacteria having strong phytase/phosphatase

activity from aquatic resources for their possible application

in production enhancement.

· Identification of the bacteria and submission of bacterial

cultures to NBAIM.


· The study was conducted in Bhomra and Akaipur wetlands

in West Bengal. Although both the wetlands had low levels

of water available P, the sediments were very rich in organic

matter and total P.

· Although P sedimentology is traditionally explained by

interactions between P and Fe/Al/Ca, total mineral (Al-, Ca-

& Fe)-bound P accounted for less than 20% of total P,

indicating, unlike in agricultural soil, less potentiality of P


64

release from mineral-bound forms in wetland ecosystems.

Organically bound P formed the bulk (80-93%) of total

sediment P.

· Temperature induced soil microbial activities, including

those involving phosphatases, played key roles in releasing

soil-bound P during summer providing much needed

available P in to water. Organically bound P form was the

major mobile pool and this large pool may be manipulated to

augment release.

· The Fe-P fraction was the second largest mobile pool in

summer. By unknown process, Al-P fraction increased in

summer and decreased in winter. Thus total mineral-bound

P remained more or less constant throughout the year.

· Forty five bacterial strains have been isolated capable of

releasing P from inorganic P source. Wetland and river

sediments were major sources of these microbes. Overall,

isolates from Bhomra wetland and river had higher P release

activity, which correlated with higher level of Ca-P fraction

in these sediments. Most of these strains lack phosphatase

activity and acid production was their mechanism of P

release.

· A total of 25 bacterial strains have been isolated having

phytate mineralizing activity. Fish gut was the major source

of these bacteria followed by pond sediment. Majority of the

isolates from fish gut and wetland sediments had high

phytate degradation ability and may have future application

in enhancing feed digestibility. Interestingly, most of these

strains have P solubilization capability also.

· Considering the significance of organic fraction of P in

wetland sediment, few bacteria and fungi have been isolated

from wetland sediments using chemically separated

Organic-P fraction as carbon and phosphorus sources in an

otherwise chemically defined medium.

· PCR and sequencing of the 16S rDNA gene has identified

many of these isolates as Acinetobacter septicus, Arthrobacter

sp., Bacillus megatarium, Bacillus spp., Curtobacterium citreum,

Enterobacter cloaceae, Klebsiella oxytoca, Methylobacterium

hispanicum, Microbacterium spp., Pseudomonas aeruginosa and

Pseudomonas spp.

Conclusion:

Wetland sediment is very rich in P bound mainly with the

organic matter. A substantial amount of this phosphorus pool is

released through microbial decomposition during summer

season. A good number of microbes have been isolated from

aquatic environments that can release phosphorus from mineral-

bound, organically-bound forms and from phytate. Microbial

isolates from wetland sediment had higher phosphate

solubilzation and isolates from fish gut have higher phytate

degradation abilities and may find their applications in respective

fields.


· N. Maitra, S. K. Manna, S. Samanta and M. Banerjee. 2010.

Isolation and characterization of phytate mineralizing

bacteria from aquatic environments. In: Souvenir &

Abstracts, Seminar on Caring wetlands & conservation of

riverine fisheries, Organized by Central Inland Fisheries

Research Institute, Department of Fisheries Govt. of West ndBengal, and Inland Fisheries Society of India on October 2 ,

2010, Kolkata. p. 132.

· S. Samanta, M. Banerjee, S. K. Manna, N. Maitra and A.N.

Chowdhury. 2010. Phosphorus fractions in wetland

sediment: idea versus reality. In: Souvenir & Abstracts,

Seminar on Caring wetlands & conservation of riverine

fisheries, Organized by Central Inland Fisheries Research

Institute, Department of Fisheries Govt. of West Bengal, and ndInland Fisheries Society of India on October 2 , 2010,

Kolkata. p. 140.

· N. Maitra, S. K. Manna, S. Samanta, D. Debnath and C.

Bandopadhyay. 2010. Organic phosphorus mineralizing stbacteria from aquatic environment. In: Book of Abstracts, 21

All India Congress of Zoology and National Seminar on

Biodiversity Conservation with special reference to Fisheries

and its management for food livelihood and Environmental

Security, Organized by Zoological Society of India Bodh

Gaya, IFSI, CIFRI during December 21-23, 2010, Barrackpore.

p. 94.

Basic and applied investigations on endophytic microorganisms in horticultural crops

PI : P. ThomasCo PI : M. Krishna ReddyIndian Institute of Horticultural Research, Bangalore

Rationale

Microorganisms that colonize the plants internally are

generally referred to as endophytes. They include bacteria and

fungi. An understanding of the endophytic microorganisms

associated with different crop plants assume importance in

agriculture and microbiology taking into account the potential

significance of such organisms in plant growth promotion or

protection against biotic and abiotic stresses. The elucidations of

the nature of relationship they share with the host also assume

significance in understanding their roles in the natural conditions

facilitating their future exploitation. The project aims at

understanding the nature of and the extent of association between

the host plant and the endophytic microorganisms, generating

basic information on the organisms and the association, and

exploring the possibility of exploiting beneficial organisms in

crop growth and production.

Objectives

· Elucidation of endophytic microbial association with

hor t i cu l tura l c rops , inc luding non-cu l turab le

microorganisms.

· Isolation, identification and characterization of endophytic

microorganisms.

· Exploitation of endophytes for applications in agriculture

and allied areas.


· Fourteen organisms isolated from in vitro grown watermelon

were assessed for production of auxin, cytokinin and

65


gibberllins in pure cultures. Major auxin producers included

Gordonia, Bacillus, B. pumilus and Xenophilus sp. All the

organisms showed the production of zeatin riboside (ZR),

dihydro zeatin riboside (DHZR). Production of GA was 3

recorded in all the organisms except Xenophilus sp. The

leading GA producers included Microbacterium,

Sphingobacterium and Agrobacterium spp. This implied that

such organisms might be playing significant roles in

governing culture performance under in vitro conditions

depending on the extent of colonization by individual

organisms.

· Investigating into host-endophyte interaction, the reliance of

watermelon endophytes on the host was demonstrated

through host tissue extract (HTE) assay. The application of

HTE on watermelon multiplication medium prior to the

inoculation of different endophytic bacteria resulted in

accelerated growth of all the organisms. The results indicated

that host tissue constituents exerted a beneficial effect on the

growth of the associated organisms

· Host tissue extract supplementation was identified as a way

to activate some of the originally non-culturable organisms

to cultivation from cultures that were not displaying

culturable bacteria. Four organisms namely B. pumilus, B.

firmus, Agrobacterium tumefaciens and Microbacterium sp,

were thus brought to cultivation from watermelon cultures

through this approach.

· Growth promotion in watermelon seedlings was shown by

some organisms. Results were not quite consistent on

account of the high variation in seedling vigour. Differences

in the time taken for seed germination, seedling vigour and

the hard seed coat that limits the penetrability of inoculm

into the seeds appeared to be major limiting factors.

· Assessing the reasons for the variable results on growth

promotion effects by different endophytes, tomato seeds

were checked for the possible interfering effects from the

resident seed microflora. Dry seeds as such did not show

much microorganisms. However, overnight incubation of

seeds in sterile water or in nutrient broth brought out

considerable CFU, predominantly Bacillus spp. This

indicated that the effect due to the applied inoculum could be

modified by the resident seed microflora, which may vary

from batch to batch of seeds.

· The observation on resident seed microflora in tomato

suggested the need for surface sterilization of seeds prior to

the application of inoculum. Surface sterilization using

NaOCl and HgCl2 were quite effective for the removal of

seed microflora but H O was not. HgCl had a negative effect 2 2 2

on seedling growth. NaOCl appeared to be the best chemical

for the surface sterilization.

· NaOCl surface sterilization, however, had a significant

negative effect on the survival of Enterobacter cloacae and the

vegetative cells of Bacillus spp., even 10 days after seed

surface sterilization. Spore-formers appeared to be better

candidates for exploitation than non-spore formers like E.

cloacae.

· Papaya: Field evaluation of plants that were inoculated with

beneficial organisms including Microbacterium, Pantoea and

Sphingomonas spp. could not be taken to logical conclusion

due to the interference from Papaya Ring Spot Virus (PRSV)

incidence in the field. As such, the endophytic organisms did

not provide any protection to the host from the viral

infection.

· Management of microbial contamination: 90% ethanol

appeared to be the best level of ethanol for use as a

bactericide. Alcohol challenge and wipes were very effective

to contain the culture spills and hand contamination from

non-sporulating bacteria but ineffective against spore-

formers.

· A new Technique for bacterial CFU enumeration, namely

'Single Plate - Serial Dilution Spotting (SP-SDS)' was

optimized using the pure cultures of diverse bacteria. The

method appeared to be an useful substitute to spread plating

for the estimation of viable bacterial counts in pure cultures,

mixed cultures and environmental samples with

considerable saving of time, and resources like labour,

nutrient media, plates etc. This allowed the simultaneous

testing of six different dilutions in a single plate with

dependable CFU estimates from at least one dilution in a

plate.

Conclusion

The isolation of endophytic bacteria from antibiotic–treated

and sanitized apparently clean plant tissue cultures together with

the documentation of phytohormone production by the different

organisms suggested that tissue culture associated endophytes

may be having masquerading effects on culture performance.

Trials undertaken with watermelon brought out the need for

uniform seed germination and a method to drive in the inoculum

bypassing the hard seed coat towards the identification of

beneficial organisms. The evaluation of tomato Arka Vikas seeds

brought out the presence of resident microflora in considerable

numbers and the need for their elimination before seed

fortification with endophytes. Sodium hypochlorite was the best

Demonstration of phytohormone production in pure cultures of endophytic bacteria isolated from watermelon

Bacterial isolates retrieved from watermelon cultures showing growth promotion with the supply of host tissue extract.


66

disinfectant but the survival of organisms on the seeds was

affected by the residual chloramines. Gram-negative E. cloacae

and the vegetative cells of Bacillus spp. were also highly sensitive

to chloramines but the spores were less affected, suggesting the

use of spore-forming organisms as better agents for commercial

exploitation. As for the management of culture spills and other

surface contaminations, ethanol (90%) wipe eliminated the

contamination from vegetative cells instantly, but not of spores it

warranted a 30 min to overnight UV exposition. Single plate serial

dilution spotting (SP-SDS) was developed as a simple and

efficient method for bacterial CFU enumeration with considerable

saving in the number of plates needed and other resources and

assured and acceptable CFU counts from at least one dilution in a

plate.


· Thomas P. 2010. Plant tissue cultures ubiquitously harbor

endophytic microorganisms. 865: 231-239.


· Thomas P. et al. 2010. Plant-Microbe Association in tissue

cultures. Poster presented at the 4th Indian Horticultural

Congress, New Delhi, 17-21 Nov. 2010.

Acta Horticulturae

Harnessing arbuscular mycorrrhizae for biofertilization in horticultural crops

PI : George V. ThomasCo PIs : Alka Gupta, Murali Gopal, R. ChandraMohanan, Alok K. Srivastva, S. K. Singh, V. B. Patel, Anil K.

Sharma, Sukhada Mohandas, V. V. Sulladmat, P. Panneerselvam, R. Thangavelu, K. K. Kumar, Rajesh Kumar Central Plantation Crops Research Institute, Kasaragod, Kerala

Objectives

· Diversity analysis and population estimation of AMF and

beneficial microbes-PGPR (Pseudomonas, Bacillus), Biocontrol

agents- Trichoderma, Nitrogen fixers and phosphate

solubilizers from horticultural cropping (coconut, arecanut,

guava, litchi, citrus etc) systems.

· Isolation and identification of efficient strains of AMF and

beneficial microbes for nutritional, plant growth

promotional and disease suppressive properties.

· Green house evaluation for growth response and disease

suppression.

· Interaction studies of AMF with other beneficial microbes.

· Mass multiplication and field evaluation of consortia.


· Analysis of soil and root samples in coconut and arecanut

based cropping systems indicated that the AM-root

colonization ranged from 22 to 40% and the spore population

33 to 66 per 10g soil. In the case of citrus spp., the AM

colonization ranged from 16-48% with the spore count of 2 to

29 per 100g soil. Maximum colonization and spore numbers

were found in pummelo, Assam lemon and khasi mandarin

growing in Shillong.

· The coconut, arecanut, sapota, guava and banana based

cropping systems had preponderant population of Glomus

spp and Gigaspora spp whereas; the citrus was having more

diversity with Glomus, Acaulospora, Gigaspora and Entrospora

spp. In Litchi at least eight spp of Glomus genera was

recorded followed by Gigaspora, Scutellospra and Sclerocyctis.

· Mass-multiplication of Glomus and Gigaspora isolated from

coconut and arecanut soils yielded positive results. In funnel

technique experiment, Glomus spp. produced infection

ranging from 20-75% in sorghum roots while Gigaspora

produced 20-58% infection. However in pot studies

Gigaspora produced an average of 43% infection compared to

27% by Glomus spores. Twelve monospore cultures of AMF

could be obtained at GBPUAT which are being maintained

for molecular studies.

· Several plant growth promoting Bacillus spp., Pseudomonas

spp., Enterobacter spp., Brevibacillus spp., Streptomyces spp.

with phosphate and zinc solubilizing, plant growth hormone

producing and pathogen antagonistic capacities were

isolated from different horticultural crops. Bioassays

revealed that combining AMF with the bacteria could

improve growth parameters in sapota seedlings and guava

air-layering. In banana, combination of AMF and

Entoerobacter/ Azotobacter/ Bacillus spp. was able to

significantly promote the root growth and available

phosphorus levels while suppressing the nematode

populations.

· The four MHBs isolated from AM spores of coconut based

cropping systems were identified as Corynebacterium coyleae,

Bacillus subtilis, Bacillus cereus and Bacillus amyloliquefacience

based on their carbon utilization pattern by BIOLOG. The

MHBs isolated from sapota cropping system were identified

as Brevibacillus parabrevis, B. choshinensis, Psudomonas putida,

and P. aeruginosa by molecular method.


· Best Poster Paper Award for paper by Pathak, D, Singh, S.K.,

Francis, R G. and Patel, V.B. 2010. Arbuscular mycorrhizal

fungi (AMF) associated in sustainable production of citrus

under changing climatic conditions in different regions of

India”. XXIII Ann. Conf. of National Environmental Science

Academy 27-29th Dec. 2010, New Delhi.

· Pathak, D, Singh, S.K., Francis, R G. and Patel, V.B. 2010.

Diversity and infectivity of Arbuscular mycorrhizal fungi

(AMF) in citrus rhizosphere soil in the northern and western

regions of India. Presented during 4th Indian Hort. Congress

18-21 Nov. 2010, New Delhi, p. 146-147.

· Viji M.V., Thomas, G.V, Ambili K, Gupta, A., Gopal, M. 2010.

Mycorrhizal and other microbial association with coconut

palms of Minicoy, Kalpeni and Kavaratti Islands of

Lakshadweep Island. In proceedings of International

conference on “Coconut Biodiversity for Prosperity”, 25 – 28

October, 2010, Kasaragod, Kerala. p.104.

· Panneerselvam, P., Saritha, B., Ajay, M., Ranganath, S,

Sulladmath V.V. and Mohandas.S 2010. Diversity of

Arbuscular Mycorrhizal fungi in guava cropping system. In:

National Seminar on Developmental Biology, University of

67


Bangalore, 15-17th Sep 2010. p. 72.

· Mohandas, S., Panneerselvam, P., B. Saritha, K.M. Ajay and

V.V.Sulladmath.2011. Arbuscular mycorrhizae (AM) fungal

diversity in sapota (Manilkara achras (Mill.) Forsberg)

cropping system and their effect on growth promotion of the

crop under nursery condition. (Paper submitted to National

symposium on microbial diversity and its application in

health, Agriculture and Industry to be held during 4th-5th

March 2011 at ICAR Res. Complex, Goa.


68

Theme : Microbial Management of Agrowaste,Bioremediation, Microbes in Post Harvest and Processing

Assessing structural and functional shifts in soil microbial communities of paper mill effluentcontaminated soils and utilization of microflora for crop growth promotion in these soils

Rationale

The pulp and paper industry is a large consumer of fresh 3water (100- 250 m /ton paper). With practically all of this water

3reappearing as effluent (72- 225 m /ton paper), a large amount of

treatment and disposal is required. Pulp and paper mill effluent

contains several elements including important plant growth

nutrients such as nitrogen (N), phosphorus (P) and potassium (K),

which can help contribute to higher crop yields when applied to

nutrient deficient soils. However, other elements (magnesium,

sodium, chlorides, and sulfur) and organic compounds

(chlorinated lignins, phenolic derivatives) that are common in

pulp and paper mill effluent can cause toxicities and nutrient

imbalance in plants. The tendency of certain elements (especially

Na) to accumulate in pulp and paper mill effluent irrigated soils

affects soil structure, increases soil salinity, decreases root

expansion capabilities, and reduces water percolation and soil

aeration. Furthermore, the addition of such a “mixed bag” of

compounds, such as that found in pulp and paper mill effluent,

may induce changes in physiochemical properties of the soil and

also create significant shifts in structure and function of the

associated microbial community, which in turn may ultimately

affect the soil viability for agriculture purposes .

Soil microbial communities play a vital role in nutrient

cycling, the decomposition of organic matter, carbon

sequestration and more general effects on soil genesis, such as

effects on structure and consequently water retention of the soil.

Through several studies pulp and paper mill effluent application

to soil is known to increase the organic matter content in the soil,

thereby increasing the populations of soil microorganisms. The

introduction of culture-independent techniques like 16S rRNA

gene cloning directly from the environment have provided a more

thorough insight into changes occurring in the structure of the

microbial community as a whole .

Objectives

• To assess the functional and structural shift in culturable soil

microbial population as a result of long term irrigation of

pulp and paper mill effluent.

• Diversity analysis of unculturable microflora in pulp and

paper mill effluent contaminated soils.

• Characterization and utilization of selected microbial

isolates for plant growth promotion in effluent degraded

soil.


· A total of 128 isolates were randomly selected (71 from water

PI : D. K AroraCo PI : K.K. MeenaNational Bureau of Agriculturally Important Microorganisms, Mau

irrigated fields (WIF) and 57 from effluent irrigated fields

(EIF)) for molecular characterization. Cluster analysis of

combined 16S rRNA gene restriction pattern based on

Jaccard's similarity index, all these isolates grouped under 20

distinct groups. For phylogenetic analysis of the strains

described in this study, one representative isolate from each

ARDRA group was investigated with partial 16S rRNA gene

sequencing. A total of 9 genera were identified from the WIF

and EIF soil samples, viz., Bacillus, Brevibacillus,

Amycolaptosis, Staphylococcus, Flavobacterium, Streptomyces,

Arthrobacter, Rheinheimera and Pseudomonas.

· From the bacterial 16S rDNA clone library, 258 clones (115

from WIF and 143 from EIF) were randomly selected and

each clone was subjected to PCR-RFLP. A total of 82 (37 from

WIF and 45 from EIF) different banding patterns were

detected. DNA isolated from a single representative clone

from each RFLP group was PCR-amplified and sequenced on

both strands. After excision of 3 chimeric sequences, a total of

79 (35 from WIF and 44 from EIF) different phylotypes were

obtained.

· A total of 71 OTU were detected on based on sequences

having similarity of ≥ 97%. The sequenced clones were

affiliated with sequences from 10 phyla of which one (OP10)

is unculturable of the domain Bacteria. Other phyla were α-,

β-, γ-, and δ- subdivisions of the Proteobacteria, Acidobacteria,

Firmicutes, Bacteroidetes, Planctomycetes, Cyanobacteria,

Chloroflexi, Gemmatimonadates, and Aquificae.

· OTUs corresponding to the phylum Proteobacteria were

most abundant in all libraries (55%). Among them, the

subdivision β- Proteobacteria was detected in the majority of

both WIF and EIF soil library. The Acidobacteria related

phylotypes delivered the second most abundant (24%)

number of clones in the library

Conclusion

In conclusion, we found that microbial communities in pulp

and paper mill effluent irrigated fields were more diverse in both

structure and function. This increase in diversity and function

supports the continued use of pulp and paper effluent as the main

source of irrigation water for crops in regions where clean

freshwater is scarce. We showed that the different methods of

microbial fingerprinting gave similar results when samples were

processed consistently and compatible statistical methods were

used. An integrated multi-technique approach where

biochemical and molecular methods are combined can yield

69


results that will allow more confidence than the use of a single

method. This approach is important for ecological studies,

especially for determining the impact of anthropogenic activity,

where a single method will not provide data in which researchers

can have absolute confidence in their validity when applied and

used in larger perspective ecological conclusions.


· Tripathi, B.M., Kaushik, R., Kumari P., Saxena, A.K., and

Arora, D.K. (2010). Genetic and metabolic diversity of

streptomycetes in pulp and paper mill effluent treated crop

fields. World J. of Microbiology and Biotechnology, DOI:

10.1007/s11274-010-0614-1.

· Singh, A.K., Tripathi, B.M., Singh, R.N., Sahay, H., Kaushik,

R., Saxena, A.K., and Arora, D.K. (2010). Biochemical and

Molecular characterization of thermo- alkali tolerant

xylanase producing bacteria from Hot water springs of

Manikaran. Indian J. of Microbiology, vol. 50, pp. 2-9.


· Kumari P., Tripathi, B.M., Saxena, A.K., Kaushik, R., and

Arora, D.K. (2011). Diversity analysis of pentachlorophenol

degrading bacteria from pulp and paper mill effluent

contaminated fields. In: International Conference on

Microbes in Waste Water (International Water Association),

Goa, India.

Bioremediation of polycyclic aromatic hydrocarbons (PAH) through microbial consortia

Rationale

Polycyclic aromatic hydrocarbons (PAHs) are organic

pollutants found in various ecosystems. They are considered as

priority pollutants due to their potential toxicity, mutagenicity

and carcinogenicity. PAHs occur as natural constituents and

combustion products of crude and refined fossil fuels. In recent

decades, the major sources of PAHs pollution are industrial

production, vehicular discharge, gasification and plastic waste

incineration. Due to their hydrophobic nature, most PAHs bind to

particulate in soil, rendering them less available for biological

degradation. Microbial metabolism plays an important role in

bioremediation of contaminated sites. Soil Pseudomonads are

being reported to possess genes coding for Catechol-2,3-

dioxygenases,a group of key enzymes in the degradative pathway

of the aromatic compounds. Likewise, white rot fungi (WRF)

degrade a variety of organic compounds that are not readily

degraded by other organisms. This has been attributed to low

substrate specificity of their lignin degrading enzymes (Phenol

oxidases and lignin peroxidases).Although, many researchers

have investigated single microorganisms to degrade individual

PAHs, and reports are lacking on use of microbial consortium for

degradation of low and high molecular weight PAH mixtures in

soil. Therefore, the purpose of this project is to develop a

consortium of bacteria and fungi for bioremediation of PAH

contaminated soil.

Objectives

· Isolation and characterization of PAH degrading

microorganisms from soil.

· Screening of microorganisms for their PAH degrading

potentialities.

· Evaluation of selected microorganisms for in situ

decomposition of PAH.

· Development of practical method for application of consortia

to degrade PAH in soil.


· Potent PAHs degrading microbial consortium was

developed which consist of a bacterium (Serratia marcescens

L-11), actinomycetes (Streptomyces rochei PAH-13) and a

white rot fungus identified as Phanerochaete chrysosporium

PI : LataCo PI : Anju Arora, Shashi Bala SinghIndian Agricultural Research Institute, New Delhi

VV18.

· The consortium was evaluated for its PAHs( mixture of

anthracene, phenanthrene, flourene and pyrene)degrading

potential with concentration level of 200 ppm under

submerged condition in Bushnell and Haas medium at

37°C.The degradation percentage of individual PAHs

ranged from18-72%.

· Different carbon and nitrogen sources (yeast extract,

ammonium nitrate, glucose, sodium glutamate) were

evaluated as co metabolic [email protected]% for enhanced

degradation of PAH under submerged condition.

Supplementation of yeast extract resulted in 13-65% increase

in PAH degradation at 200 ppm as compared to

unsupplemented control. This study proved the role of N-

source in improving the efficiency of PAH degradation by

consortia under submerged conditions.

· A microcosm experiment with unamended soil (Soil + PAH

mix + consortium (1%v/w), and amended soil (Soil + PAH

mix + consortium 1%v/w+ *co-substrates) [*urea, paddy

straw (0.2%w/w), ammonium sulphate (0.1% v/w), yeast

extract (0.1% v/w), corn steep liquor (0.1% v/w)] was carried

out for in-situ degradation of PAH mixture.

· Amendment of PAH spiked soil with different co-substrates

(urea, paddy straw, ammonium sulphate, yeast extract, corn

steep liquor) resulted in better microbial activities during

microcosm studies.

· The treatment receiving the combination of ammonium

sulphate (0.1% v/w) and paddy straw (0.2% w/w) showed

highest dehydrogenase activity and enzymes involved in

PAH degradation like lignin peroxidase, laccase and aryl

esterase. Therefore, supplementation of contaminated soil

with combination of paddy straw and ammonium sulphate

alongwith microbial consortia can significantly enhance in-

situ removal of PAHs.

· Amendment of PAH spiked soil with different co-substrates

(urea, paddy straw, Ammonium sulphate, yeast extract, corn

steep liquor) resulted in better in situ degradation of PAHs.

· Biostimulation and bioaugmentation are most feasible and

effective approaches for in situ bioremediation of PAH.


70

Conclusion

A microbial consortium consisting a bacteria (Serratia

marcescens L-11), an actinomycete (Streptomyces rochei PAH-13)

and a white rot fungus Phanerochaete chrysosporium VV18 was

found to be very effective for degradation of PAH mixture even

up to 200ppm concentration. Supplementation of yeast extract

(0.1%) improved the degradation of PAH. In situ incorporation of

paddy straw and ammonium sulphate in combination with

consortium can be used as an effective measure for removal of

PAH from soil. Enhancement of PAH degradation by

biostimulation of microbial cultures has been found to be most

feasible and effective approaches for in situ bioremediation of

accidental spills and chronically contaminated sites.


· Chaudhary P, Sharma R., Singh S.B. and Lata (2011).

Bioremediation by Streptomyces sp. Bulletin of Environmental

contamination and Toxicology. (in Press)DOI: 10.1007/s00128-

011-02115).

· Chaudhary P., Pandey A.K., Prasanna R., Singh S.B.,

Chaudhary S. and Lata (2011).Evaluating the phenotypic and

functional diversity of polycyclic aromatic hydrocarbon

(PAH) utilizing bacteria isolated from petroleum refinery

soil. Annals of Plant Protection Sciences. (In Press).

· Chaudhary P., Singh S.B., Lata and Chaudhry S. (2010).

Effect of carbon source on growth of hydrocarbon

degrading strain Serratia marcescens isolated from compost.

Annals of Plant Protection Sciences. 18: 543-544.

Selected microbial strains for consortium development and bioremediation of PAHs.

Genotyping and isolation of sphingomonads from HCH contaminated agricultural soils and theirapplication in bioremediation

Rationale

In India technical HCH was used until 1997 followed by

restricted use of lindane. This led to low (at agricultural land) as

well as high levels (at dump sites) of HCH contamination

problems. From these contaminated sites the HCH residues

spread and leach upto ground water. Thus there is an urgent need

to decontaminate the HCH contaminated soils. The project has

been designed from basic (pathway and genetics of HCH

degrading sphingomonads) as well as applied (application of

microorganisms to decontaminate the contaminated sites) point

of view. The isolation of novel HCH degrading bacteria and genes

enrich the diversity and genetic pool of HCH degraders while

characterization of rate of degradation and study of genes and

enzymes involved in HCH degradation will help in selection of

better organisms for bioaugmentation of contaminated soils.

Finally the part of basic research will be applied to develop

effective bioremediation technology for cheap, effective and

sustainable removal of HCH from contaminated agricultural

sites.

Objectives

· Identify heavily contaminated agricultural sites with HCH

isomers.

· Enrichment of soil samples for the isolation of

sphingomonads that degrade HCH or other pollutant.

· Genotyping of soils for presence of sphingomonads.

· PCR amplification and cloning of degradative genes.

PI : Rup LalDepartment of Zoology, University of Delhi, Delhi

· Microcosm/mesocosm studies to determine efficacy in the

field.


· Highly HCH contaminated agricultural sites have been

found in Chinhat, Deva, and Ummari village (Lucknow, UP).

· A number of HCH degrading bacterial strains have been

isolated.

· The rate and genetics of degradation has been worked out in

these strains. Moreover some of these strains have been

characterized taxonomically and belong to sphingomonads.

· The genes responsible for HCH degradation have been

characterized in these strains.

· Metagenomic approach has been taken up to study bacterial

diversity and genes involved in HCH degradation from

these contaminated sites.

· Biostimulation has been carried out to determine the HCH

degradation potential of indigenous soil organism.

· A defined consortium of 5 HCH degrading bacteria has been

developed.

· Small scale pot experiments have been conducted which

suggested the efficiency of consortium in HCH degradation.

· The preliminary laboratory work on consortium is being

applied to the fields.

Conclusion

A number of bacterial strains have been isolated that have

71


HCH degradation potential. These strains have lin genes that are

responsible for HCH degradation. Many variants of lin genes

have been isolated using metagenomic approach. Biostimulation

of indigenous soil population suggests that it can be used for

decontamination of those sites where bioaugmentation fails.

Consortium application to the pot level experiments suggests that

a consortium is more efficient than a single bacterium for

decontamination of such sites. The degradation data from the

fields can eventually suggest the possibility to use this consortium

in developing an efficient bioremediation technology in near

future.


• Lal D., Gupta S.K., Schumann P. and Lal R. (2010)

Microbacterium lindanitolerans sp. nov. isolated from

hexachlorocyclohexane contaminated soil. Int. J. Syst. Evol. Microbiol. (Accepted)

• Jit S., Dadhwal M., Kumari H., Jindal S., Kaur J., Lata, P.,

Niharika, N., Lal, D., Garg, N., Gupta, S. K., Sharma, P., Bala,

K., Singh, A., Vijgen, J., Weber R. & Lal R. (2010). Evaluation

of hexachlorocyclohexane contamination from the last

Lindane production plant operating in India. Environ Sci

Pollute Res DOI 10.1007/s11356-010-0401-4.

• Kaur, J., Verma, M. and Lal, R. (2010). Rhizobium

rosettiformans sp. nov., isolated from hexachlorocyclohexane

(HCH) dump site in India, and reclassification of

[Blastobacter] aggregatus Hirsch et al. [1985] as Rhizobium

aggregatum comb. nov. .Int. J. Syst. Evol. Microbiol. (Accepted).

• Kumari, K., Sharma, P., Tyagi, K. and Lal, R. (2010).

Pseudoxanthomonas indica sp. nov. isolated from

Hexachlorocyclohexane dumpsite in north India. Int. J. Syst.

Evol. Microbiol. (Accepted).

Refinement in indoor compost technology for white button mushroom using thermophilic organisms

Rationale

Cereal straw, which is abundantly available in our country, is

the basic raw material for the compost production of white button

mushroom. Our yields levels of white button mushroom

(Agaricus bisporus) are the lowest in the world and main reason

attributed to this is the poor quality compost used for the

cultivation. The present project envisages its improvements

through thermophilic microorganisms for increased yields.

Compost prepared either by long method of composting (LMC) or

by short method of composting (SMC) involves traditional

outdoor composting, which causes environmental problems. In

our country laws governing pollution (emission of odour) have

become very stringent which may result in closure of such units

producing compost by above methods. Need is therefore felt to

control the composting process in such a manner so that there is a

least possibility of environmental pollution and at the same time

to monitor the whole composting procedure in such a way that an

end product most suitable for the growth of mushroom mycelium

is obtained with a clean procedure in shortest possible time

specially with the help of thermophilic organisms. Present project

envisages the exploitation of different thermophilic organisms

towards refinement in environment friendly indoor composting

procedure where compost will be prepared in 7-10 days time as

against 16-28 days presently taken in LMC and SMC. Further

improvements in the present day composting procedures (LMC &

SMC) by their inoculations with potent stains of thermophilic

organisms are also envisaged for increased yields of this

mushroom.

Objectives

· To conduct surveys at compost units in different corners of

India for the isolation of thermophilic organisms for their

screening towards their potential in converting agro wastes

into white button mushroom compost.

· Molecular characterization, physiological and enzymatic

studies on different thermophilic organisms.

PI : B. VijayDirectorate of Mushroom Research, Chambaghat, Solan

· Refinement in environmental friendly indoor, long and short

method composts using above strains of thermophilic

organisms.

· Development of microbial inoculation technology package

for bulk production of different composts for commercial

purpose.


· During the year under report a large number of compost

samples were analyzed for mycoflora isolations. S.

thermophilum, H. insolens and H. grisea were dominantly

isolated from various samples. Theses fungi showed lots of

variability among them selves. Molecular characterization is

under progress.

· Seven strains of Humicola insolens collected from different

locations across the country were screened for laccase and

manganese peroxidase activity on seven compost

formulations. Formulation –1 having chicken manure and

cottonseed meal exhibited highest laccase activity for all

most all the strains. Among all the strains tried, strain-2

exhibited highest activity in formulation- 6.

· All the above strains secreted lesser manganese peroxidase

enzyme compared to laccase. Highest activity of this enzyme

was shown by all most all the strains in formulation-2,

compared to control, which showed far lesser activity. Strain

–1 showed the highest activity among all the strains tried in

formulation –1.

· Seven strains of S. thermophilum were evaluated for C-1

Cellulase production on seven compost formulations. All the

strains exhibited different activities of this enzyme on

different formulations. Among all the strains tried Strain X-

10 exhibited highest activity.

· Total cellulose percentage was estimated in compost piles

inoculated with S. thermophilum, H.insolens and their

consortium. Consortium of above fungi showed highest

cellulose degradation activity from initial to maturation


72

phase.

· Composting period was brought down to 20 days from 28

days under LMC with the help of thermophilc fungi.

· Methodology for total indoor compost production using

consortium of thermophlic fungi (S. thermophilum, H.

insolens, H. grisea) almost standardized (3 trials done). In this

case, compounding mixture after its thorough wetting

(3days) was directly filled in the Phase II tunnel, escaping

Phase -I conditions altogether. Compost was subjected to

pre- pasteurization conditioning, pasteurization and post

pasteurization conditioning. Entire operation lasted for 10

days (3days mixing + 7days in tunnel). All the trials gave

excellent results. Wheat straw to final compost ratio was 1:3.

No environment pollution was observed using such

technique.

· In another trial on indoor composting, pasteurized compost

was used as consortium of thermophlic organisms. Compost

was successfully prepared in 10-12 days time using this as

inoculum source. Excellent spawn run was observed in all

the treatments.

· Looking to the success of the new technology developed for

total indoor compost production and its demonstration to

the mushroom growers in the mushroom mela organized at ththe center on 10 Sept.2010, one mushroom grower Mr.

Harsuranjeet Singh (Sunny) from Hosiarpur (Punjab) came

forward to adopt this technology. One large scale on farm

trial (20 tons compost production) on this technique was

taken at his unit. Very good compost was produced by this

new technique and the grower reported around 20%

conversion from such compost in 60 days of cropping.

· One day mushroom consumption fair was organized at

above farm on 03.02.11 in which newly developed indoor

composting technique was demonstrated.

Conclusion

A new method of total indoor compost production was

standardized in 10 days time escaping phase-I conditions

altogether using consortium of thermophilic fungi. Such

composting procedure, besides being an express method (only 10

days against 20 days of short method) is environment friendly,

less labour consuming and steam requirement for pasteurization

is almost nil (pasteurized by self generation of heat) and end

product is most suitable for the growth of mushroom mycelium

giving higher productivity of mushroom. Efforts are also on to

reduce the period of long method compost for seasonal growers

from 28 days to 20-16 days with the help of thermophilic fungi

(partial success achieved).


· Vijay B., Nitika Sharma and Swet Kamal. 2010. Cellulose

production by Scytalidium thermophilum and its potential use

in rapid composting for Agaricus bisporus. Mushroom Research

(accepted).


· Vijay B., Ashutosh Pathak, Vikas Taank and Manjit Singh

2011. Role of thermophilic fungi in shortening the duration of

composting for Agaricus bisporus (white button mushroom)

cultivation. Invited paper presented at Indian Science thCongress, held at Chennai from 3-7 Jan 2011

· Pathak A., V.K. Taank and B. Vijay. 2010. Laccase and

Mangenese Per Oxidase activity of Humicola insolens strains

on different compost formulations. Paper presented at National Symposium on Diversification for Sustaining

Profitability in Mushroom Production, UHF, Nauni (HP). Nov.

26-27.

· Vijay B., Ashutosh Pathak, Vikas Taank and Manjit

Singh.2010.Total indoor compost production for white

button mushroom (Agaricus bisporus) using thermophilic

organisms. Paper presented at National Conference on Hort. Bio-diversity for Livelihood, Economic Development and Health

Care at UHS, Bangalore, 21-31. May 2010. pp117.

Optimization of parameters for utilization of paddy straw, kinnow pulp and pea pods forproduction of cellulases, ethanol and feed supplements

Rationale

India is the second largest producer of paddy in the world

and produces about 21% of the total paddy produced in the world.

Paddy yields a significant amount of biomass in the form of paddy

straw, which due to non availability of the infrastructure or

bioprocessing technologies in India is burnt in the fields after crop

harvest resulting in loss of biomass and environmental pollution.

Since, paddy straw contains cellulose and hemicellulose in

significant quantity, it has a good potential for production of

value-added products such as cellulase and ethanol. Cellulase is

indispensable for cellulosic ethanol production and contributes

significantly to its production cost. Cellulase is a complex enzyme

of different components which show a lot of diversity depending

PI : H. S. OberoiCo PIs : V. K. Bhargav, Pranita JaiswalCentral Institute of Post- Harvest Engineering and Technology, Ludhiana

upon the microorganism used for its production. The

commercially available cellulase is expensive since different

components such as cellulase, β- glucosidase, xylanase etc are

added separately for efficient hydrolysis of lignocellulosic

material, thereby increasing the production cost. Thus,

production of consortium of all components in one cocktail with

high specific activity will help in improving the process

economics. Despite being rich in sugars and minerals, kinnow

waste and pea pods do not find any commercial application in

India and are disposed off into the municipal bins, thus leading to

environmental pollution. Development of a cost effective process

for utilization of kinnow waste and pea pods is imperative for

management of the huge quantum of biomass available in the

73


form of crop residues. Production of cellulolytic enzymes using

such substrates and use of the fermented residue as feed

supplement would add value to the residue thus generating

interest among farmers for better residue management, by getting

extra remuneration by sale of residues too and entrepreneurs for

setting up commercial units in rural areas.

Objectives

· Development of microbial consortium for cellulose

degradation, hexose and pentose fermentation.

· Optimization of operating parameters such as substrate and

inoculum concentrations, pH, temperature, aeration etc for

cellulase and ethanol production

· Optimization of downstream processing parameters for

recovery and purification of cellulase and ethanol

· Evaluation of residues after fermentation for suitability as

feed supplements.


· About twenty isolates showing characteristic zones on CMC

plates impregnated with congo red belonged to genera

Aspergillus, Trichoderma and Humicola. They were assayed for

filter paper cellulase and β-glucosidase activities.

· Four isolates belonging to the genera Aspergillus showed

filter paper cellulase activity of 1 FPU/ml or higher were

further assayed for the total cellulase enzyme profile. On the

basis of morphological and biochemical characterization,

they were identified as isolates belonging to Aspergillus niger,

Aspergillus flavus and Aspergillus fumigatus.

· Two yeast isolates and one bacterial isolate have been

isolated using selective adaptation on xylose medium and

have shown the capability to assimilate and ferment pentose

sugars such as xylose and arabinose.

· Simultaneous saccharification and fermentation of Kinnow

waste with cellulase obtained from Aspergillus niger and

fermentation by Pichia kudriavzevii resulted in ethanol

concentration of 34 g/l and ethanol productivity of 2.8 g/l/h.

· Galactose adaptation of thermotolerant Pichia kudriavzevii

cells helped in enhancing ethanol production from

sugarcane juice at fermentation temperatures at 40 and 45

ºC.

· Statistical optimization of concentration of cellulase, β-

glucosidase, hydrolysis, temperature and time helped in

obtaining 92% conversion of glucose from glucan in alkali

pre-treated rice straw.

· Crude enzyme filtrate with filter paper cellulase (FP) activity

of 1.50 FPU/ml could be concentrated to 8 FPU/ml in about

2h with protein getting concentrated from 0.17 mg/ml to 1.49

mg/ml.

· Rice straw as well as pea pods used for enzyme production

through solid-state fermentation showed a reduction in

cellulose, hemicellulose and lignin concentrations and an

increase in protein and ash concentrations in the biomass left

after enzyme extraction indicating potential for use as cattle

feed.

· The products such as kinnow peel candies and kinnow pulp

leather prepared from kinnow residues are being evaluated

for nutritional and sensory attributes.

Conclusion

Simultaneous saccharification and fermentation (SSF) using

crude cellulolytic enzyme produced by a strain of Aspergillus niger

and a thermotolerant strain of Pichia kudriavzevii cells produced

ethanol at a concentration from 34 g/l. Statistical optimization of

concentration of cellulase, β-glucosidase, hydrolysis, temperature

and time helped in obtaining 92% conversion of glucose from

glucan in alkali pre-treated rice straw. Recycling of Pichia

kudriavzevii cells in a galactose medium over three cycles helped in

enhanced ethanol production at temperatures in the vicinity of 40

ºC and 45 ºC. Rice straw as well as pea pods used for enzyme

production through solid-state fermentation showed a potential

for use as cattle feed.


· Dhaliwal SS, Oberoi HS, Sandhu SK, Nanda D, Kumar D and

Uppal SK (2011) Enhanced ethanol production from

sugarcane juice by galactose adaptation of a newly isolated

thermotolerant strain of Pichia kudriavzevii. Bioresource

Technology. (in press) Doi: 10.1016/j.biortech.2011.02.015.

· Babbar N, Oberoi HS, Uppal DS and Patil RT (2011) Total

phenolic content and antioxidant capacity of extracts

obtained from six important fruit residues. Food Research

International. 44: 391-396.

· Oberoi HS, Vadlani PV, Nanjundaswamy A, Bansal S, Singh

S, Kaur S and Babbar N (2011) Enhanced ethanol production

from Kinnow mandarin (Citrus reticulata) waste via a

statistically optimized simultaneous saccharification and

fermentation process. Bioresource Technology 102: 1593-1601.

· Oberoi HS, Babbar N, Dhaliwal SS, Kaur S, Vadlani PV,

Bhargav VK and Patil RT (2010). Enhanced oil recovery by

pre-treatment of mustard seeds using crude enzyme extract

obtained from mixed-culture solid-state fermentation of

Kinnow (Citrus reticulata) waste and wheat bran. Food and

Crude enzyme concentration using 10 kDa regenerated cellulose membranes

Effect of temperature on ethanol production from sugarcane juice with galactose adapted and non - adapted Pichia kudriavzevii cells.


74

Bioprocess Technology. (in press) Doi: 10.1007/s11947-010-

0380-y.

· Oberoi HS, Vadlani PV, Brijwani K, Bhargav VK and Patil RT

(2010). Enhanced ethanol production by fermentation of rice

straw using hydrolysate adapted Candida tropicalis ATCC

13803. Process Biochemistry 45: 1299-1306.


· Sandhu SK, Dhaliwal SS, Oberoi HS: Statistical optimization

of hydrolysis process for Kinnow Mandarin (Citrus reticulate)

peel using crude enzyme consortium obtained from newly stisolated Aspergillus oryzae in 51 annual AMI conference at

BIT, Ranchi, 14-17 December 2010.

· Babbar N, Oberoi HS, Dhaliwal SS and Kaur S: Effect of

enzymatic maceration treatment on enhancement in juice

content, total phenolic content and antioxidant activity in

guava juice in National conference on New Horizons in

Bioprocessing of Foods (NHBF) held at SLIET, Longowal, 25-

26 February 2011.

Patents filed from AMAAS project work

· One patent application “Glow U: Face care system”, has been

filed with the Controller of Patents and designs, New Delhi

(2325/DEL/2010 dated 28/09/2010).

Bioremediation of commonly used pesticides in tropical rice ecosystem

Rationale

Environmental pollution caused by the release of wide range

of compounds as a consequence of industrial and agricultural

progress has now assumed serious proportions. Bioremediation,

a biodegradation process in which sites contaminated with

xenobiotics are cleaned up by means of bacterial bio-geochemical

processes, preferably in situ, exploits the ability of

microorganisms to reduce the concentration and/or toxicity of a

large number of pollutants. Bioremediation relies on encouraging

biological processes to minimize an unwanted environmental

impact usually being the removal of a target contaminant from the

biosphere. Microbial diversity offers an immense field of

environment-friendly options for mineralization of contaminants

or their transformation into less harmful non-hazardous

compounds. Exploring the range of microbial biodiversity is the

key to developing effective and environment friendly “green

technologies”. Bioremediation is one such process that exploits

the catabolic abilities of microorganisms to degrade harmful and

toxic xenobiotics. In view of the potential role of microorganisms

to derive biochemical process in a more energy conserving

manner, it is possible to develop bioremediation process that are

in harmony with nature resulting in huge social and economic

benefit in ensuring the sustainability of the ecosystem.

Objectives

· Develop an understanding of the structural and functional

diversity analysis of microbial communities and their

dynamics in response to anthropogenic stress including

xenobiotic application.

· Determine the biochemical mechanisms including

enzymatic pathways involved in aerobic and anaerobic

degradation of pesticides.

· Expand understanding of microbial genetics as a basis for

enhancing the capabilities of microorganisms to degrade

polluting xenobiotic.

· Conduct microcosm/mesocosm studies of new

bioremediation techniques to determine in a cost-effective

manner whether they are likely to work in the field, and

establish dedicated sites where long-term field research on

bioremediation technologies can be conducted.

PI : T. K. AdhyaCo PI : T. K. DangarCentral Rice Research Institute, Cuttack

· Develop, test and evaluate models for assessing efficacy of

bioremediation technologies.


· Three times application of 10 μg α-, β-, γ- and δ-HCH/g rice

soil of Canning and CRRI at 7d intervals enriched only the β-

and γ-HCH degraders.

· Finally, about 96-98% and 72-85% of β-isomer of the pesticide

was degraded in the CRRI and Canning soils, respectively

within 29d.

· Within the same period, 14-50% and 23-35% γ-HCH was

metabolized in the Canning and CRRI soils, respectively.

· Nineteen β-HCH degrading bacteria (Is1-19) were isolated

from the pesticide treated soils and checked for degradation

of the pesticide. In MS medium, the organisms were able to

degrade about 50-97% β-HCH. The decreasing order of

degradation of β-HCH by 4 most potent isolates was Is12

(98%), Is5 (89%), Is3 (88%), and Is18 (83%) after third

application @10 μg/ml. The retention time of the

degradation product was 1.73 min.

· About 20% γ-HCH was degraded by one isolate (Is19) after

10d incubation.

· The most potent β-HCH degrading bacterium (PCRBHCH)

formed pale-pink and 1-4 mm colonies. It was Gram (–)ve,

motile, aerobic rods of 2.0-2.9 × 1.00-1.02 µm size. The

organism did not produce any diffusable fluorescent

pigment. Optimal temperature for growth of the organism 0was 30-37 C and pH 6-7.

· The organism was positive for oxidase, catalase, starch and

gelatin hydrolysis and MR-VP test but negative for nitrate

reduction and H S production. The organism utilized lactose, 2

fructose, dextrose, galactose, raffinose, trehalose, arabinose,

mannose, glycerol, inositol, mannitol, ribose, salicin,

glucosamine, chloroform and formamide. However, it did

not use xylose, maltose, melibiose, sucrose, inulin, sodium

gluconate, dulcitol, sorbitol, adonitol, citrate, α-methyl-d-

glucoside, adonitol and lactose.

· The organism produced lysine and ornithine decarboxylase

and urease but did not produce phenylaline deaminase and

75


nitrate reductase.

· The isolate was sensitive to the antibiotics penicillin G,

gentamicin, ciprofloxacin, vancomycin, chloramphenicol,

neomycin, ampicillin, tetracycline and rifampicin forming

0.3-1.9 cm inhibition zones but resistant to nalidixic acid and

erythromycin.

· The 16S rRNA sequence identified it (PCRBHCH) as

Methylobacterium (sequence accession no. G340522).

· Two other bacteria were also isolated from the flooded rice

soil of Canning which degraded p-nitrophenol (PNP)

efficiently within 24h. The isolates were identified as Bacillus

spp. by 16s rRNA sequencing.

· The 471 and 250 bp amplicons of the genome of the

Methylobacterium sp. were amplified by the HCH specific

primers viz. linA and linB in PCR, respectively which proved

that the isolates contain the HCH degrading genes.

· Five bacteria isolated from CRRI and coastal saline rice field

soils of West Bengal were capable to degrade 10 μg/ml

chlorpyriphos to undetectable level in MS medium within

12-15d. One of the isolates was similar to Labrys monachus (T)

(NCBI Accession No. AJ535707) and the other was identified

as Inquilinus limosus (NCBI Accession No. AY043373).

Characterization of the other isolates is in progress.

· Degradation of chlorpyriphos (10 μg/ml) by the soil from

flooded, planted (variety Naveen)/unnplanted,

chlorpyriphos treated/untreated conditions was faster in the

planted and treated soils than the others. About 99.6%

chemical was metabolized in the former conditions but it was

about only 60-80% in the other soils.

· Degradation trend was similar in the non-flooded, planted

and chlorpyriphos treated soils than the non-flooded,

unplanted and chlorpyriphos untreated; non-flooded,

planted and chlorpyriphos treated; and unplanted and

chlorpyriphos untreated conditions. Overall degradation

was more effective under planted and chlorpyriphos treated

and non-flooded situation which was about 99.9% of the

pesticide.

· The Labrys sp. strain CH23 did not significantly degrade

chlorpyriphos (10 μg/ml) in CRRI field soil under flooded

and non flooded conditions up to 20d.

· Repeated chlorpyriphos application in costal saline Canning stsoil, enhanced urease activity from 1 treatment (6.4-12.5

ndmg/kg/h) to 2 treatment (22.7-37.8 mg/kg/h) but declined rdafter 3 treatment (5.9-20.3 mg/kg/h) under flooded,

planted/unplanted and chlorpyriphos treated/untreated

soils. The trend, however, was not followed for non-

flooded/flooded, planted/unplanted and chlorpyriphos

treated/untreated fields. Optimum activity (24-38 ndmg/kg/h) was also recorded after 2 application in non-

flooded conditions but it subsequently remained

unchanged.nd· Alkaline phosphatase activity was also higher after 2 rdapplication (58-88.9 µg/g/h) and it declined after 3

application. But in non-flooded conditions no specific trend

could be observed.

· Dehydrogenase activity did not follow any trend in flooded,

planted/un-planted chlorpyriphos treated soils (ranged nd0.08-2 µg/g/d) but in untreated soils it declined after 2

treatment and remained unchanged thereafter (0.16-0.30 ndµg/g/d). In non-flooded soils, the activity increased after 2

treatment but in other conditions activity was low (0.04-0.28

µg/g/d) and did not change.

· Optimum temperature for chlorpyriphos degradation for the oisolate CH23 was 35 C and about 99.88% of the chemical was

detoxified by the bacteria after 15 days incubation.

· Two chlorpyriphos degrading bacteria of CRRI soil were

identified as Labrys spp. Strain CH23 (PCR2) and

Methylobacterium sp. Strain PCR CH13 by 16S rRNA

sequencing.

· One potent chlorpyriphos degrading bacteria was isolated

from Hazaribagh soil which was identified as Inquilinus sp.

· Degradation kinetics of three potent bacteria showed that

degradation increased with concomitant increase of bacterial

population of two isolates (CN 1, 2) but in case of one bacteria

(CN 3) degradation increased despite decline of bacterial

population.

Three times application of 10 μg α-, β-, γ- and δ-HCH/g rice

soil of Canning and CRRI at 7d intervals enriched only the β- and

γ-HCH degraders. Nineteen β-HCH degrading bacteria (Is1-19)

were isolated from the pesticide treated soils and checked for

degradation of the pesticide. In MS medium, the organisms were

able to degrade about 50-97% β-HCH. The decreasing order of

degradation of β-HCH by 4 most potent isolates was Is12 (98%),

Is5 (89%), Is3 (88%), and Is18 (83%) after third application @10

μg/ml. The retention time of the degradation product was 1.73

min. Degradation kinetics of three potent bacteria showed that

degradation increased with concomitant increase of bacterial

population of two isolates (CN 1, 2) but in case of one bacteria (CN

3) degradation increased despite decline of bacterial population.

Conclusion

PCR product by amplification of linA primer

PCR product by amplification of linB primer


76

Development of bacterial consortia for bio-processing agricultural wastes and bioremediation ofaquaculture effluents

Rationale

Lignocelluloses are the most abundant renewable organic

matter on the earth and their utilization could allow self-

sustainable processes and products. Lignocelluloses consist of

lignin, hemicelluloses and celluloses. Bioconversion of

lignocellulosic wastes could make a significant contribution to the

production of fish through aquaculture. Serious concern is raised

by the environmentalists about pollution and environmental

degradation from aquaculture effluents. This project aims at

remediating the effluents, which are rich in ammonia, sulphur,

organic matter and methane using bacteria. Bacterial consortium

is better than the use of one or two bacterial strains to treat the

waste having varying composition. This project aims at

developing bacterial consortium capable of decomposing

lignocellulosic agro-waste and also to develop bacterial

consortium to bio-remediate toxic materials from aquatic farms.

The project also aims at reducing the recalcitrant organic matter

content in the environment, reducing the pollution problem and

chemical fertilizers load, maintaining the sustainability in

production, and providing scope for waste land development.

Objectives

· To develop bacterial consortia capable of decomposing

lignocellulosic agro-waste.

· To develop bacterial consortia to bio-remediate toxic

materials from aquatic farms.


· The crude consortium Cb (Bacillus pumilus, B. subtilis, B.

endophyticus and B. megaterium), which was designed in 2009-

10 was evaluated for its efficiency to degrade complex agro-

wastes like cotton boll and also for its stability.

· The consortium showed lower xylanase and cellulase

activities compared to individual members.

PI : C. S. PurushothamanCo PIs : P. K. Pandey, A. VennilaCentral Institute of Fisheries Education, Mumbai

· The crude consortium Ca (B. pumilus, B. megaterium, A.

feacalis, and B. cereus) evaluated in 2009-10 was modified

since B. cereus was found to have a negative effect on the

overall activity of the consortium.

· B. cereus was replaced with B. subtilis and this modified

consortium Ca (now referred to as Ca*) was evaluated for

activity as well as stability.

· Of all the crude consortia evaluated till date, Ca* has given

the best results with higher xylanase activities compared to

individual members.

· Cellulase activity of B. subtilis was significantly higher and

that of B. megaterium was slightly higher than the consortium;

so, Ca* can be considered for further evaluation.

· Standardization of zymogram analysis to compare the types

of enzymes produced by different isolates is being done; total

protein was precipitated from culture supernatants followed

by dialysis of the precipitate.

· Higher cellulase activity was detected in the dialyzed

fraction compared to the supernatant.

· No active bands were detected in activity staining with

cellulose as substrate.

· Using the water samples collected from fish/prawn rearing

unit in 2009-10, a total of ten isolates were obtained on solid

medium for isolation of nitrifying bacteria.

Conclusion

Consortium Ca* has given the best results with higher

xylanase activity compared to that of individual members.

Cellulase activity of B. subtilis was significantly higher, and that of

B. megaterium was slightly higher than that of the consortium.

Therefore, Ca* is selected for further work. The identities of the

isolates obtained on nitrifying media need to be confirmed and

their nitrifying abilities need to be tested.

Average cellulase activity (left) and average xylanase activity (right) of consortium Ca*, its individual members and knockouts.

77


Microbial bioremediation of wastewater for heavy metals

Rationale

Waste water, particularly from industries contain high

concentration of heavy metals which enter into human beings and

animals through food chain. Physico-chemical methods such as

reverse osmosis, solvent extraction, lime coagulation, ion

exchange and chemical precipitation for removal of heavy metals

from wastewater are very expensive and these do not remove

heavy metals from wastewater up to desired limits. Therefore, it is

desirable to remove these heavy metals from wastewater through

low cost technology before its use in agriculture. Biomass of

microbes acts as adsorbent to remove heavy metals from

wastewater. The ability to remove heavy metals from wastewater

varies greatly among microbes. This needs to be exploited for

bioremediation of heavy metals from wastewater through

efficient microbes.

Objectives

· Isolation of microbes from sites polluted with heavy metals.

· Screening of microbes for tolerance to heavy metals.

· Monitoring of polluted sites for heavy metals.

· Microbial removal of heavy metals from wastewater under

laboratory conditions.

· Development of technology for removal of heavy metals

from wastewater through efficient microbes.

· Characterization of efficient microbes through biochemical

tests and molecular techniques.

· Field testing of efficient microbes for removal of heavy

metals from wastewater.


· Trichoderma longibrachiatum showed higher Pb, Cd, Ni

removal capacity (70.85%, 82.20% & 50.80%) than T.

fasciculatum (55.50%, 60.55% & 39.40%) respectively within

144 h from potato dextrose broth containing 20 ppm Pb, Cd &

Ni individually.

· Bacillus cereus showed higher Pb removal capacity (62.25%)

than Bacillus sp. (57.45%) within 48 h whereas B. cereus

removed higher Ni (43.20%) within 12 h as compared to

Bacillus sp. which removed 23.51% Ni within 18 h. Cadmium

removal capacity was also higher for Bacillus sp. (47.55%)

PI : P. K. Joshi Co-PI : L. BatraCentral Soil Salinity Research Institute, Karnal

within 36 h as compared to B. cereus (33.90%) within 48 h from

nutrient broth containing 20 ppm of Pb, Cd and Ni

individually.

· T. longibrachiatum showed higher Pb removal capacity

(80.50%) than T. fasciculatum (71.00%) at 3.0% inoculum size,

whereas T. longibrachiatum removed higher Cd (89.85%) at

2.0% inoculum size as compared to T. fasciculatum which

removed (62.60%) Cd at 2.5% inoculum size. Ni removal

capacity was also higher for T. longibrachiatum (59.20%) as

compared to T. fasciculatum (42.55%) at 2% inoculum size

from potato dextrose broth containing 20 ppm of Pb, Cd and

Ni individually.

· B. cereus showed higher Pb & Ni removal capacity (55.90%

and 40.75%) than Bacillus sp. (43.50% & 23.50%) at inoculum

size of 2.5% and 2% respectively. Cadmium removal capacity

was higher from Bacillus sp. (39.60%) as compared to B. cereus

(24.30%) at 0.5% inoculum size from nutrient broth

containing 20 ppm of Pb, Cd and Ni individually.

· The FTIR analysis of untreated and heavy metal (Pb, Cd &

Ni) treated T. longibrachiatum indicated the involvement of

functional groups such as –NH, -OH, -CH, and C=O in the

binding of Pb, Cd and Ni with T. longibrachiatum.

· Consortium of five fungi (Aspergillus niger, A. terreus, T.

longibrachiatum, T. fasciculatum & A. awamori) and two

bacteria (B. cereus & Bacillus sp.) in combination with

different agrowaste material like charcoal, pressmud, rice

straw, FYM and rice husk were tested for removal of heavy

metals (Cr, Cu & Ni) from industrial effluents. Data indicated

encouraging results with microbial consortium along with

pressmud in comparison to pressmud alone.

Conclusion

Optimum conditions like time, inoculum level were worked

out for efficient fungi (T. longibrachiatum & T. fasciculatum) and

bacteria (B. cereus & Bacillus sp.) for maximum removal of heavy

metals (Pb, Cd & Ni) under laboratory conditions. The FTIR

analysis of T. longibrachiatum indicated the involvement of

functional groups such as –NH, -OH, -CH, and C=O in the

binding of Pb, Cd and Ni with T. longibrachiatum. Consortium of

Fig. Effect of inoculum size on removal and uptake of Pb from potato dextrose broth containing 20 ppm of Pb by T. fasciculatum and T. longibrachiatum

Fig. Effect of inoculum size on removal and uptake of Cd from nutrient broth containing 20 ppm of Cd by B. cereus and Bacillus sp.


78

five fungi (Aspergillus Niger, A. terreus, T. longibrachiatum, T.

fasciculatum & A. awamori) and two bacteria (B. cereus & Bacillus

sp.) grown on pressmud indicated encouraging result for removal

of heavy metal (Cr, Cu & Ni) from industrial effluents.


· Joshi, P.K., Kumar, R., Rajput, V.D., and Singh, N (2010).

Isolation and screening of bacterial isolates for tolerance to

heavy metals. Journal of Soil Salinity and Water Quality 2 (1),

12-17.

· Joshi, P.K., Swarup, A., Maheshwari, S., R, Kumar and Singh,

N (2011). Bioremediation of heavy metals in liquid media

through fungi isolated from contaminated sources. Indian. J.

Microbiol (Accepted).


• Joshi, P.K., Kumar, R and Rajput, V.D. 2010. Biosorption of

Pb, Cd and Ni by fungi and bacteria from liquid medium. In st51 Annual Conference of AMI and International

symposium on recent Advances in Cross-disciplinary

Microbiology: Avenues and Challenges held at Birla Institute

of Technology, Ranchi, P-176.

Bioremediation of effluents from shrimp farms

Rationale

Modern intensive and semi-intensive aquaculture practices

involve use of supplementary feeds rich in protein (as much as 25-

40 percent). In high intensity aquaculture, water quality becomes

a limiting factor. Fish and shrimp accumulate about 20-25% of

protein and the rest is released to the pond as ammonium and

organic nitrogen. These proteinaceous wastes result in total

ammonia nitrogen (TAN) and biochemical oxygen demand

(BOD). Ammonia is also a major end product of protein

catabolism excreted by fish, crustaceans and mollusks into the

culture system. TAN is composed of unionised (NH -N) and 3

+ionised forms (NH ). The unionised ammonia is most toxic to 4

aquatic organisms, as it can readily diffuse through cell

membranes and is highly lipid-soluble. Nitrite (NO ), an 2

intermediate product of nitrification is also one of the toxic form of

nitrogen that can be found in aquaculture ecosystems. These

substances despite being toxic to the cultured animals per se

increase their susceptibility to diseases, particularly shrimp,

which are bottom dwelling organisms. Hence, it is extremely

important to mitigate these organic pollutants generated during

aquaculture to achieve optimal aquaculture productivity.

The microbes involved in ammonia and sulfur oxidation,

majority being autotrophic in nature, are extremely slow growing.

The proposed study will first of all help in understanding the

cultivable and uncultivable microbial flora involved in two

important biogeochemical cycles, viz., nitrogen and sulfur, and

PI : S. V. AlavandiCo PIs : T. C. Santiago, N. Kalaimani, K. K. VijayanCentral Institute of Brackishwater Aquaculture, Chennai

specifically, those involved in the oxidation of ammonia and

hydrogen sulfide. The approach to harness naturally occurring

AOB and SOB recovered from brackishwater aquaculture ponds

for developing immobilized microbial mats and their application

in bioreactors / biofilters has not been explored so far in India. The

proposed study provides scope for exploration of mass

production of these extremely slow growing bacteria, which is a

challenging task. Depending on the success in mass production

protocols, formulation protocols would be taken up for in situ

bioremediation.

Objectives

· To develop bioremediation tool for ammonia and nitrite

mitigation in shrimp hatchery.

· To develop bioremediation tool for ammonia, nitrite and

sulfide mitigation in shrimp grow-out ponds.


· Nitrifying-denitrifying biofilters were designed, assembled

and found to efficiently remove ammonia and nitrite

completely in lab scale aquaria.

· Occurrence of Anammox bacteria in traditional and

intensive shrimp culture ponds (with high DOC) was

confirmed using PCR-DGGE analysis.

· Eight denitrifying isolates were confirmed to carry out

denitrification under aerobic conditions using RT-PCR of

nosZ gene.

· Two Chemolithotrophic sulfur oxidizing bacteria have been

Nitrification-denitrification biofilter for ammonia and nitrite mitigation in aquarium (left) and nitrifying bacteria colonised filter cartridge (right)

Sulfide oxidizing activity of heterotrophic sulfur oxidizing bacteria

79


identified based on 16S rRNA gene sequence analysis.

· 16S rRNA gene sequences of 14 denitrifying bacteria

submitted to NCBI, Genbank

· A total 4 isolates of Beggiatoa sp. have been isolated and

identified from brackishwater ecosystem of Tamilnadu.

· Fourteen heterotrophic sulfur oxidizing bacteria (HSOB)

were confirmed for their activity in vitro.

Conclusion

Bacteria involved in nitrogen and sulfur cycles viz.,

chemolithotrophic nitrifiers, aerobic denitrifiers, heterotrophic

nitrifiers, chemolithotrophic and heterotrophic sulfur oxidizers

have been isolated and characterized for their efficiency to oxidize

ammonia, nitrite and sulfide. The activities of these isolates have

been tested in vitro. Efficient isolates have been used to construct

nitrifying-denitrifying biofilters that are capable of simultaneous

nitrification and denitrification for complete removal of

ammonia, nitrite and nitrate. Such biofilter systems could be

exploited for better management of water quality in shrimp

hatcheries and for bioremediation of aquaculture discharge.

Occurrence of Anammox bacteria in traditional shrimp culture

ponds of Kerala and intensive shrimp culture ponds of Andhra

Pradesh suggest that they play a key role in maintenance of

ammonia and nitrite in such perennially water covered

ecosystems.


· Alavandi S. V. 2010. Mitigating nitrogenous wastes in

aquaculture ENVIS Newsletter, Microorganisms and

Environment Management, 8(3 & 4): 5-9.

Assessment of nisin production in selected strains of LAB and market acceptability

Rationale

The application of various chemical preservatives has been a

common feature in processed fruits and vegetables, dairy

products, bakery and confectionery products for extending the

shelf-life. Although, these chemicals beyond the maximum

permissible limit cause serious health hazards to the consumers.

Therefore, consumers are demanding natural and fresh foods

with no chemical additives. The increasing demand of the

convenience type of foods has stimulated interest in finding

natural and safe preservative. The use of bio preservatives is

gaining popularity nowadays to reduce the health hazards

associated with chemical additives. The use of bio preservatives

seems to be more effective in controlling the large group of food

spoilage microorganisms. Nisin, an effective GRAS bio

preservative is produced by certain strains of Lactococcus lactis.

The strains Lactococcus lactis is sub-divided into L. lactis sub sp.

lactis, L. lactis sub sp. cremoris and L. lactis sub sp. biovar.

diacetylactis. L. lactis sub sp. cremoris and L. lactis sub sp. lactis are

used for lactic acid production in cheese manufacture. L. lactis sub

sp. lactis biovar. diacetylactis is used to provide flavor in cottage

cheese, cultured sour cream and cultured butter milk. Therefore,

the aim of the present study is to isolate more strains of L. lactis

from dairy and non-dairy sources in order to isolate the strains of

Lactococcus lactis and to assess the potential of nisin production

and evaluate the efficacy of these cultures in extending the shelf

life of processed vegetables.

Objectives

· Isolation, characterization and purification of nisin

producing cultures.

· Testing the utility of nisin producing culture in vegetables.


· A total 27 isolates (19 isolates from 56 LAB of dairy and 08

isolates from 44 LAB of non-dairy samples) were identified

as Lactococcus lactis sub sp. lactis on the basis of phenotypic

characterization. PCR amplification of gad B gene (600 bp

PCR product) and similar protein profiling with reference

PI : Sudhir SinghCo PI : Major SinghIndian Institute of Vegetable Research, Varanasi

strain Lactococcus lactis sub sp. lactis NCDC 094.

· The confirmation of nisin gene in the identified isolates and

reference strain L. lactis sub sp. lactis NCDC 094 was carried

out by PCR based amplification of genomic DNA using a pair

of designed primer from the published sequences for

structural gene of nisin A (nis A) yielded the amplification of

174 bp PCR products. A total of 17 Nis+ isolates (65.15 % from

dairy and 62.50 % from non-dairy samples) of Lactococcus

lactis sub sp.lactis has been observed. The bacteriocin activiry +in Nis isolates and reference strain Lactococcus lactis sub sp.

lactis NCDC 094 was ranged between 800-6400 AU/ml.

· The direct detection of purified bacteriocin of isolates and

reference strain for molecular weight determination in SDS-

PAGE resulted in an apparent molecular weight of about 5.0

kDa.

· The 100% activity of extracted bacteriocin of isolates and

reference strain was obtained over a wide range of pH 2-8

thereby decreased activity occurred in basic pH 9-12.

· The effect of various enzymes on complete inactivation or

significant reduction in the inhibitory activity of extracted

bacteriocin by exposure of extracted bacteriocin with

proteinase-K, pronase-E, lysozyme, trypsin, α-

chymotrypsin, pepsin and α-amylase resulted in the

complete inactivation of bacteriocin in the presence of

proteinase-K, pronase-E and α-chymotrypsin while no

inactivation was obtained with trypsin, pepsin, lysozyme

and α-amylase.

· A broad spectrum of antibacterial activity was exhibited by

the extracted bacteriocin against different gram positive and

related lactic acid bacterial strains. However, no inhibitory +activity was observed against Nis reference strain

Lactococcus lactis sub sp. lactis NCDC 094 and some gram

negative bacteria.

· Addition of extracted bacteriocin to early logarithmic phase

cells of L. acidophilus NCDC 015 (2 h old, 3.7×106 CFU/ml)

resulted in decreased (2.33%) cell growth after 2 h of


80

incubation of bacteriocin addition and reduction in growth

was increased to 16.79% after 14 h incubation than the

growth pattern of L. acidophilus NCDC 015 without

bacteriocin addition.

· Various responses such as extent of browning, ascorbic acid,

moisture content, texture profile analysis, color

measurement, sensory quality for flavor, body and texture,

color and appearance, overall acceptability and microbial

plate count were evaluated up to 180 days of storage (24-o32 C) for all combination of variables. Among different

combinations of nisin (400-6400 AU/ml) and KMS (1000-

3000 ppm) on blanched cauliflower, the formulation

consisting of nisin (3200 AU/ml) and KMS (1000 ppm) was

most acceptable. In the optimum combination of nisin and

KMS treated dried cauliflower, ascorbic acid was decreased

from 6.10 to 4.16 mg/100g. The moisture content and extent

of browning was increased from 2.17 to 3.79% and 0.039 to

0.149 OD at 440 nm respectively. Rehydration ratio was

decreased from 5.92 to 3.13. The total bacterial count was

increased from 3.59 to 7.30 logCFU/ml/g without yeast and

mold count during the storage at room temperature.

· An experimental model was designed by response surface

methodology to study the response pattern and to determine

the optimum combination of sugar (20% w/v) diffusion time

(70.29-360 min) and nisin concentration (0-6400AU/ml) in

osmo-air dried carrot slices for extending the shelf life.

Various responses such as β-carotene, % moisture, texture

profile analysis, sensory score for color and appearance,

flavor, body and texture, overall acceptability and microbial

plate count were evaluated up to 180 days of ambient storage otemperature of 24-32 C for the possible combination of

variables. In the optimum combination of variables (sugar

diffusion time 240 min and nisin 6400AU/ml), beta-carotene

decreased from 5.77 to 5.47 mg/100g, total sugar from 3.42 to

3.13 g/100g, pH value from 6.63 to 5.54, texture (area) from

3010.83 to 2843.41g.s, texture (force) from 1222.11 to 815.63 g

and color ('a' value) from 65.28 to 64.38. However, the %

moisture and rehydration ratio increased from 5.28 to 5.91

and 2.23 to 2.73, respectively. The total bacterial plate count

increased up to 4.95log CFU/g.

Conclusion

The isolates of Lactococcus lactis sub sp. lactis have been

identified and screened as nisin producer. Extraction of

bacteriocin and its detection, characterization and antimicrobial

activity spectrum confirmed that the extracted bacteriocin is nisin

like bacteriocin and can be used in food items. It may be an

effective alternative in controlling natural fermentation in foods. +Thus, isolation, identification and characterization of Bac L. lactis

from dairy and non-dairy sources provide potential nisin like

bacteriocin producers for enhancing the strength of industrial

important strains for the application as starter cultures. Dried

cauliflower upon rehydration exhibited maximum (6.5) overall

acceptability score on 9- point Hedonic scale with the formulation

of nisin concentration (3200 AU/ml) and KMS (1000 ppm) after 6

months of storage at ambient temperature. The shelf-life of osmo-

air dried carrot slices was extended to 6 months at ambient storage

temperature with the formulation of sugar diffusion time of 240

min and nisin concentration of 6400 AU/ml.


· Mishra Solan, Singh Sudhir and Khemariya Priti. Influence of

nisin and potassium metabisulfite on quality of dehydrated

cauliflower, Paper presented ICON11 BHU. 21-23 January

2011.

· Mehrotra Puja, Singh Sudhir and Khemariya Priti. Influence

of nisin and potassium metabisulfite on quality of

dehydrated carrot slices. Paper presented ICON11 BHU, 21-

23 January 2011.

Molecular weight determination of purified bacteriocin in Glycine –SDS PAGE produced by Lactococcus lactis ssp. lactis

Effect of heat treatment on bacteriocin activity (AU/ml) of extracted bacteriocin of Lactococcus lactis ssp. lactis

81


Fermented products from fruits, vegetables and Cereals

Rationale

Demand for natural instead of synthetic pigments for

colouring fabrics, foods and cosmetics is increasing. Unlike

pigments that are synthetic, natural sources allow subtle

differences in tone because such pigments generally comprise

various colour components. Natural dyes and pigments were

emerged as an important alternative to potentially harmful

synthetic dyes. These natural dyes and pigments were applied in

dyeing of cotton, silk and wool samples. However, the main

disadvantage of these natural dyes or pigments lies in the order of

magnitude of their extraction yield factors (a few grams of

pigment per kg of dried raw material). This makes their current

market price about USD 1/g, thus limiting their application to

high-value-added natural-coloured garments only. To defeat this

constraint, it is suggested to exploit the potentiality of other

biological sources such as fungi, bacteria and cell cultures, since

appropriate selection, mutation or genetic engineering techniques

are likely to improve significantly the pigment production yields

with respect to wild organisms. Glycanoligosaccharides have

received particular attention recently because of their excellent

biological and functional properties, namely as a prebiotic

compound it encourages the growth of beneficial bacteria in the -1colon and as low calorie (2 KCal.g ), non-carcinogenic sweetener

suggested health benefits which include immune system

activation, resistance to infections, synthesis of B-complex

vitamins and calcium absorption and it is recommended for

diabetic patients. Microbial production of fructooligosaccharides

by the action of microbial fructosyltransferase (FTase) on sucrose

is more feasible at industrial level and it provides a cost effective

and convenient alternative to chemical synthesis. In view of the

great demand of glycanoligosaccharides as food ingredients,

scope exists for screening and identification of newer strains

capable of producing glycansucrases.

Objectives

· Selection of microbial cultures with high potential for bio

colorants and nutraceuticals from fruits, vegetables and

cereals.

· Exploitation of microorganisms for food preservation and

nutrient fortification.

· Selection of microbial cultures for wine production from

cereals and fruits and studying their antioxidant properties.


· Concentrated yellow pigment extracted from Thermomyces

sp. was utilized as colour additive for the development of

food products. To enhance the appearance and acceptability

of foodstuff yellow pigment was added. The products

namely cookies, rice wine, jelly and orange squash were

developed by adding the pigment. The colour value of food

products was analyzed. The stability of the colorants were

also studied.

· Yellow colour bands identified by TLC were further purified

by using HPLC. From the TLC separated yellow pigment, a

total of 6 peaks excluding solvent peak was obtained.

Occurrence of more than one peak indicated the presence of

PI : S. GunasekaranCo PIs : R. Murugesan, K. Vijila, S. KarthikeyanTamil Nadu Agricultural University, Coimbatore

more than one molecule in the extract. The HPLC fraction 3

and 4 were collected for further analysis by GC-MS.

· The GC-MS analysis resulted in single peak for both fractions

of band 3 and 4 . The library match of GC –MS showed that it

could be 2, 4 – bis (1, 1 dimethylethyl) - phenol and pentanoic

acid 5 hydroxyl ester as per the NIST library.

· The infra red spectra showed the presence of hydrogen -1bonded-OH groups (3300 – 3400 cm ) and of the carbonyl

function. The carbonyl stretching vibration frequency of the -1pigments is in the region 1635 -1639 cm . The observed

stretching frequencies are, however close to phenol and

quinines.

· The extracted yellow fungal pigment was subjected to

dyeing in cotton, silk and wool using various chemical and

natural mordant. The cotton and wool have poor affinity for

fungal pigment but the silk have high affinity to yellow

pigment.

· The rubbing and washing fastness results showed that the

fastness to wet and dry rubbing of the pigment dyed fabric

rated between 3-4. The rating for wash fastness was

determined with respect to staining on cotton, wool, acrylic,

polyester, nylon and acetate had recorded 4-5 ratings.

· The anti-bacterial activity of fabric dyed with yellow

pigment of Thermomyces sp. showed a maximum bacteria

reduction in optimized fabric against Salmonella typhi (51.05

%), Staphylocococus aureus (45.52 %), E. coli (48.32 %), B. cereus

(52.2 %) and Vibrio cholerae (23.73 %).

· Selection of acceptor molecule for the glycansucrase

produced by the selected LAB isolates (LAB 11) indicated its

specificity to the sucrose molecules.

· Optimization of concentration of sucrose and the physical

parameters such as pH and temperature by composite design

was carried out.

· Intrinsic antioxidant potential of fruit wines and cereal wine

was measured by FRAP assay. Antioxidant potential has

increased gradually during ageing of wines. Among nine

wines, grape wine showed more ferric reducing antioxidant -1power (18.45±0.10 mML ascorbic acid) followed by

pomegranate wine and mango wine.

· Free radicals such as super oxide radical, hydroxyl radical,

nitric oxide and ABTS radical scavenging activities were

analyzed for nine wines. Grape wine and rice wine showed

more scavenging activity of super oxide radicals. In hydroxyl

radical scavenging assay, grape wine had exhibited highest

scavenging activity followed by musambi wine and mango

wine. Grape wine recorded more ability to scavenge nitric

oxide and ABTS radicals.

· Physico – chemical properties of fruit wines and cereal wine

were determined at various intervals i.e. initial (fruit juice),

12 months and 18 months of ageing. The alcohol content, pH,

reducing sugars at different storage levels were studied.

· HPLC analysis was performed to quantify the trans –

resveratrol compound in the fruit wines. Among the fruit

wines, grape wine and muskmelon wine had shown with


82

similar retention time as that of standard trans – resveratrol. -1The trans- resveratrol content in grape wine was 0.92 mgL

-1and in muskmelon wine, was 0.42mgL .

Conclusion

Thermomyces sp. yellow color pigments application in food

products (cookies, rice wine, jelly and orange squash) were

studied. The cotton and wool have poor affinity for fungal

pigment but the silk have high affinity to yellow pigment. The

anti-bacterial activity of fabric dyed with yellow pigment of

Thermomyces sp. showed a maximum bacteria reduction. The

library match of GC –MS showed that it could be 2, 4 – bis (1, 1

dimethylethyl) - phenol and pentanoic acid 5 hydroxyl ester as per

the NIST library. Improvement in biomass production with

sucrose as a growth limiting nutrient was found while culturing

the isolate in fed -batch system. The correlation between growth,

lactic acid production and oligosaccharides production were

studied. Free radicals such as super oxide radical, hydroxyl

radical, nitric oxide and ABTS radical scavenging activities were

analyzed for nine wines. During fermentation of fruit juice, total

soluble solids, reducing sugars, tannin content and pH decreased

and acidity of wines increased. HPLC analysis was performed to

quantify the trans – resveratrol compound in the fruit wines.


· Parthiban. M., G. Thilagavathi, R. Poornimmal and S.

Gunasekaran (2010). Optimization of Process Parameters for

Coloration & Antimicrobial Finishing of Protein Fabrics

Using Natural Fungal Extracts. Paper presented at the

International Conference on “Health care and hygiene care

& textiles (HEAT 2010)” held at PSG College of Technology,

Coimbatore, India on 30- 31July 2010.

· Gnanasambandam A.V., M. Karthikadevi and S.

Gunasekaran. Grape wine – a health drink. Paper presented

at the International Conference on bio resource Technology-

its applications and achievements, held at Nirmala College

for Women, Coimbatore, 7-8 October2010. p. 83.

· Karthikadevi M., A.V. Gnanasambandam and S.

Gunasekaran. Antibacterial Properties of red wine. Paper

presented at the International Conference on bioresource

Technology- its applications and achievements, held at

Nirmala College for Women, Coimbatore, 7- 8 October 2010.

P 168.

· Poorniammal R. and S. Gunasekaran 2010. Production and

food application of the yellow pigment of Thermomyces sp.

Paper presented at the International Conference on

bioresource Technology- its applications and achievements,

, held at Nirmala College for Women, Coimbatore, October 7-

8, 2010. p 168.


Gunasekaran 2010. Basil Wine – A Medicinal drink. Paper

presented at the National Symposium on “Unbound

Opportunities in Food Processing “held at Tamil Nadu

Agricultural University, Coimbatore, 13 October 2010.


Gunasekaran 2011. Nutrition In Wine. International

Conference on Food and Nutraceuticals for Nutrition and

Health: Technology and Delivery, Periyar University, Salem-

NC-P-100. 20–22 January 2011. p 62.

Utilization of fruit processing waste for obtaining value added products through fermentation

Rationale

Substantial amount of solid waste is generated during

processing of fruits. For example, mango generates 30-50%,

banana 20%, pineapple 40-50% and orange 30-50% solid waste.

These wastes are rich in organic constituents like, cellulose, starch

pectin vitamins, minerals etc and posed serious environmental

pollution.

The utilization of waste through fermentation will not only

economize the cost of finished products but also reduce the

pollution level. The waste could be used for the production of

value added products such as enzymes, protein enriched feed,

bio fuel, fibre and other biomolecules.

Objectives

1. Standardization of protocols for enzyme (amylase and cellulase) immobilization for enhanced enzyme stability and storability.

2. Testing of enzyme produced for juice clarification.

3. Strain improvement for hyper production of enzymes

4. Mushroom production using fruit waste compost


· Extracellular amylase mass produced by Fusarium solani using mango kernel as substrate was immobilized in calcium alginate beads through entrapment technique.

PI : Neelima GargCo PI : M. Muthukumar Central Institute for Subtropical Horticulture, Lucknow

· Maximum enzyme immobilization efficiency was achieved in 2mm size beads formed by 6.5 % (w/v) of sodium alginate in 2% (w/v) calcium chloride.

· The catalytic properties of the immobilized amylase were assessed in comparison with the free enzyme (soluble). The activity yield of the immobilized enzyme was 81% of the free enzyme.

· The immobilized enzyme showed optimum activity at pH and temperature of 4.5-6.0 (range) and 40ºC, respectively, in contrast to the free enzyme at 5.5 and 30ºC, respectively.

· Thermal stability of the immobilized enzyme after heat inactivation at 60ºC was found to be more than the free enzyme over a long time interval. The immobilized enzyme retained activity upto 20% of optimum even after 180 min. but the activity of the free enzyme was less than 20% after 60 min which reached zero by 120 min.

· The kinetic constants, viz., K (Michaelis constant), V and M max

activation energy of the immobilized enzyme were affected by immobilization which influenced the substrate utilization negatively.

· The immobilized enzyme showed higher stability over a wider pH and temperature ranges. The immobilized amylase in calcium alginate beads supports its long term storage which has immense industrial applications

· Cellulase was mass produced by Aspergillus niger using mango

83


peel as substrate and immobilized in calcium alginate beads through entrapment technique.

· The catalytic properties of the immobilized CMCase were compared to free enzyme.

· The activity yield of the immobilized CMCase was 89.87% over free enzyme, while for β-glucosidase, it was 96.45% of the free enzyme.

· Maximum CMCase and β-glucosidase immobilization efficiency was achieved in 2mm & 1mm bead size respectively.

· Beads formed by 5 % (w/v) of sodium alginate in 2% (w/v) calcium chloride resulted in max. immobilization efficiency

· The immobilized CMCase showed optimum activity at 4.5 pH and 50ºC, in contrast to the free enzyme at 4.5 and 40ºC, respectively.

· β-glucosidase showed optimum activity at pH 5.0 and 40ºC over free enzyme at pH 5.0 and 40ºC

2+· Mg showed positive effect in immobilized CMCase activity but 2+, 2+, 2+ 2+ 3+ 2+ 2+ Cu Mo Mn , Ca , B , Zn and Fe showed negative whereas in

2+ 2+ 2+ 2+ 3+, 2+ 2+ 2+β-glucosidase Cu , Mo , Mn , Ca , B Zn , Mg and Fe , showed positive effect.

· Immobilized CMCase and β-glucosidase expressed 20-25 % relative activity after 4th time repeated use.

· Thermal stability of the immobilized CMCase after heat treatment at 70ºC was better over the free enzyme.

· CMCase & β-glucosidase produced by A. niger and purified 12.26 and 13.06 fold was used to clarify mango juice using response surface methodology by (Brookfield DV-II) rotating cylindrical viscosity meter.

· The optimum yield (97%) of juice was obtained at 1% cellulase enzyme concentration.

· Suitability of Mango peel and mulberry pomace composts for growing Oyster mushroom, Pleurotus florida (Mont.) Singer was investigated. Preliminary studies indicated that the mango and mulberry waste composts could very well support the spawn run and fruiting of P. florida and may be utilized as substrates for oyster mushroom cultivation.

· Highest production (609g) of fruiting bodies was recorded from mango compost, followed by wheat straw (507g) and mulberry compost (477g), respectively.

· Biological efficiency was recorded highest (50.7%) in wheat straw followed by mango compost (30.5%) and mulberry compost (23.9%), respectively.

· Protein content of fully mature fruiting bodies was highest (30.6%) in mulberry compost, followed by mango compost (28.0%) and wheat straw (24.3%) respectively.

Conclusion

Extracellular amylase mass produced by Fusarium solani using mango kernel as substrate was immobilized in calcium alginate beads

pH optima for immobilized vs. Free cellulaseGL IM- Immobilized β glucosidase; GL FE-Free β glucosidase; CMC IM-Immobilized CMCase; CMC FE- Free CMCase

Temperature optima for immobilized vs. Free cellulaseGL IM- Immobilized β glucosidase; GL FE-Free β glucosidase; CMC IM-Immobilized CMCase; CMC FE- Free CMCase

Mushroom fruiting on mango peel compost


84

through entrapment technique. Maximum enzyme immobilization efficiency was achieved in 2mm size beads formed by 6.5 % (w/v) of sodium alginate in 2% (w/v) calcium chloride. Cellulase was mass produced by Aspergillus niger using mango peel as substrate and immobilized in calcium alginate beads through entrapment technique. Suitability of Mango peel and mulberry pomace composts for growing Oyster mushroom, Pleurotus florida (Mont.) Singer was investigated. Preliminary studies indicated that the mango and mulberry waste composts could very well support the spawn run and fruiting of P. florida and may be utilized as substrates for oyster mushroom cultivation.


· Devendra Kumar, Mohd. Ashfaque, Muthukumar. M, Munna Singh and Neelima Garg. Production and characterization of carboxymethyl cellulase from Paenibacillus polymyxa using

mango peel as substrate. Journal Environmental biology (Accepted)


· Immobilization of extracellular amylase from Fusarium solani as calcium alginate beads in 51 Annual conference association of microbiologist of India as “International symposium on resent advances in cross-disciplinary microbiology: Avenues & challenges” & International workshop on rRNA sequencing, phylogeny & next generation genome sequencing held at Birala institute of technology, Mesra, Ranchi, India, from 14-17 December, 2010, pp.191-192.

· Prelimiliry studies on Utilization of fruit Waste compost for production of Pleurotus florida in 10th x Agriculture Science Congress held at National Bureau of Fish Genetic Resources, Lucknow from 10-12 February, 2011, pp. 436.

85


Development of microbial consortium for alleviation of salt and drought stress for growth and yield of wheat

Rationale

Environmental stresses represent the most limiting factors

for agricultural productivity. Apart from biotic stress caused by

plant pathogens, a number of abiotic stresses such as extremes

temperature, drought, salinity, heavy metals and radiation have

detrimental effects on plant growth and yield. Drought is very

detrimental to all types of plant growth. When there is no water in

the soil, there are deficiency of many nutrients to support plant

growth. Salinity affects plant growth and development adversely

and exerts negative impact on critical ecological balance in the

agro ecosystem to disturb biological stability. Metabolic

imbalances caused by ion toxicity, osmotic stress and nutritional

deficiency under saline conditions may lead to oxidative stress. It

has been claimed by one study that abiotic stress causes the most

crop loss of any other factor and that most major crops are reduced

in their yield by more than 50% from their potential yield. The

project, therefore, addresses the application of microbial

consortium for the alleviation of salt and drought stress in wheat

crop. Microorganisms have been implicated in alleviating the

effects of abiotic stress by different mechanisms. They can

alleviate salt and drought stress by production of growth

promoting substances and also involved in production of

antioxidants to prevent injury to the plant due to stress. Bacterial

exo-polysaccharides have been implicated in providing

protection from environmental stresses and host defenses.

Objectives

· Survey of salt and drought affected area of India.

· Isolation of microorganisms from rhizotic zones of cereal

crop grown under salt stress and drought stress.

· Screening of salt & drought tolerant bacteria at different

NaCl and PEG concentration.

· Evaluation of selected micro-organisms in the rhizosphere of

cereal crop on the basis of phytotron studies.

· Biochemical & molecular characterization of selected

microorganisms.

· Development of consortium of microorganisms that can

alleviate the effect of salinity and drought to improve the

growth and yield of cereal crop (wheat).

· Field evaluation of consortium of microorganisms for

improvement of wheat growth and yield.

· Osmoprotectant studies (proline, glycine betaine) on salt

tolerant and drought tolerant bacteria.

PI : Dilip K. AroraCo- PI : Kamlesh Kumar MeenaNational Bureau of Agriculturally Important Microorganisms, Mau


· The isolates obtained from salt and drought affected regions

have been identified using molecular techniques like

16SrRNA gene sequencing.

· On the basis of biochemical screening, the potent isolates

were subjected to develop the HPLC profiling to identify the

osmoprotectent produced in response of the stresses. Potent

isolates on the basis of HPLC profiling were selected to

further characterization for their PGP traits.

· The potent osmoprotectent producing bacterial isolates i.e.

Bacillus pumilus (EU 927414), Pseudomonas mendocina (EU

927412), Arthrobacter sp. (EU 927410), Halomonas sp.

(FJ984532), and Nitrinicola lacisaponensis (FJ973520) were

selected for further characterized for PGP traits. The results

showed that all isolates were found to be IAA-producers and

possess different PGP-traits like P-solubilization,

siderophore and ammonia production and salt-tolerance

capabilities varied from 0-22% NaCl concentration.

· Bacterial strains (AS 121, AS 40 and AS 18) were isolated from

the rhizospheric soils collected from Mau, Ghazipur and

Ballia districts of Uttar Pradesh (India) and other two isolates

SL-9 and SL-11 isolated from sambhar salt lake were used for

pot experiment.

· The effect of individual treatment was studied in the form of

chlorophyll, carotenoid and protein content of the wheat

leaves at different stages. Apart from this, other parameter

like root, shoot length, fresh weight and dry weight were also

considered.

· Treatments with bacterial inoculants supported plant

growth as assessed 15 and 30 days after inoculation (DAI) as

compared to non-inoculated control showed significant

enhancement shoot and root length after inoculation of B. pumilus.

· Total chlorophyll and protein content was maximum in B. -1pumilus inoculated plant leaves (17.47 and 19.21 mg fresh

wt. after 15 and 30 DAI) as compared to control (11.36 and -114.94 mg fresh wt.).

· Carotenoid content was maximum in plants inoculated with -1 Halomonas sp. (806.8 and 912.9 mg fresh wt.) as compared to

-1 control (682.7 and 726.4 mg fresh wt.) after 15 and 30 DAI.

Arthrobacter sp. caused maximum accumulation of total -1 protein (2.45 and 2.62 mg fresh wt.) in comparison to control

-1 (1.33 and 1.72 mg fresh wt) at 15 and 30 DAI.


86

Theme: Microbial Management of Abiotic StressTheme: Microbial Management of Abiotic Stress

· Inoculation with bacterial isolates increased the levels of total

flavonoids and total phenol content in wheat leaves. In

comparison to control, proline and reducing sugar

accumulation was maximum in N. lacisaponensis (1.74 -1µmole/g and 268.6 µg fresh wt. respectively) after 15 DAI

-1 -1and (2.28 µmole and 419.9 µg fresh wt respectively) in B.

pumilus after 30 DAI. Halomonas sp., favoured maximum -1accumulation of total soluble sugar (283.8 and 375.5 µg fresh

-1wt.) as compared to uninoculated control (1.12 and 1.54 µg

fresh wt.) after 15 and 30 DAI.

· Inoculation with B. pumilus resulted in maximum

accumulation of individual phenolics (gallic, caffeic,

syringic, vanillic, ferulic and cinnamic) after 15 DAI. When

root exudates from the inoculated plants and control were

assessed, higher level of phenolics was again recorded and

interestingly, in the root exudates, we were able to analyse

the presence of a flavonoid, quercetin.

Conclusion

The results showed that the microbes which can tolerate up

to 15 -20% NaCl, 25% PEG concentration could be utilized to

alleviate salt and drought stress for growth and yield of wheat

crop. Particularly isolate Bacillus pumilus AS-121 and

Nitrinicolalacis aponensis SL 11 has a great potential as it has all the

attributes of physical, biochemical and PGP traits. It is evident

from the growth kinetics and HPLC studies that bacteria-

mediated presence of phenolics and quercetin in the root exudates

and rhizosphere played an essential role in the enhanced

interaction of bacterial inoculants on the plant roots which finally

played a cumulative synergistic role in systemic accumulation of

stress-tolerance biochemical in leaves and enhanced plant growth

promotion. Cultivable isolates of salt and drought tolerant

isolates further explored for consortia developmental studies as a

bioinoculant under alleviated abiotic stress for growth and yield

of wheat crop.


· Shweta Tiwari, K.K. Meena, D.P.Singh and D.K.Arora. Salt-

tolerant rhizobacteria-mediated induced systemic tolerance

in wheat (Triticum aestivum) and chemical diversity in

rhizosphere enhance plant growth. Under review Biology

and Fertility of Soil.


· Field evaluation of Bacterial consortia to alleviate salt stress

for growth and yield of wheat. First Asian PGPR Congress

2009, Hyderabad

· Molecular Diversity of Halotolerant bacteria from Chilka stLake, India. (51 AMI Conference 2010, Ranchi)

Utilization of actinomycetes to alleviate salt and drought stress in cereal crops

Rationale

Agricultural productivity is severely affected by soil salinity

because salt levels that are harmful to plant growth affect large

terrestrial areas of the world. The damaging effects of salt

accumulation in agricultural soils have influenced ancient and

modern civilizations. It is estimated that 20% of the irrigated land

in the world is presently affected by salinity. In India about 10

million ha of arable land is salt affected and approximately 68% is

affected with drought. Increased salinity and drought in soil is

harmful to both microbes and crops. Microbes have been

implicated in alleviation of effects of abiotic stresses by various

mechanisms like production of osmolytes, sugars, sugar alcohols,

exopolysaccharides etc. Such microorganisms not only alter the

environment around the rhizosphere of crops but also maintain

the ratio of various nutrients. Actinomycetes are found in neutral

to saline soils. Most of actinomycetes are tolerant to alkaline

conditions and in alkaline soils, 95% population may be

actinomycetes. Most of the actinomycetes possess inherent

capacity to tolerate salt stress (especially Streptomycetes genera,

Nocardiopsis sp., Saccharomonospora sp.) by synthesis of the

compatible solutes like alanine, proline, glycine betaine and -

glutamine in response to stresses. It is also known that

actinomycetes produce important antibiotics and secondary

metabolites. They are known to inhibit many plant pathogens and

some are known to produce plant growth promoting substances.

Thus, keeping these points in consideration, an attempt was made

to utilize actinomycetes to alleviate the salt and drought stresses

and increase the crop yields under salt and drought affected soils.

PI : Mahesh YandigeriCo- PI : Kamlesh Kumar MeenaNational Bureau of Agriculturally Important Microorganisms, Mau

Objectives

· Isolation and screening of actinomycetes from different salt

affected regions of India.

· Diversity analysis studies from salt stressed regions.

· Characterization of the isolates for the accumulation of

sugars, sugar alcohols, amino acids, osmolytes and

secondary metabolites.

· Evaluation of the promising actinomycetes under pot/ field

experiments and study of plant microbial interactions during

salt stress.

· Development of consortia of actinomycetes to alleviate the

effect of salinity in crop plants.


· Soil sampling survey was carried out for the salt affected

regions of Kanpur, Fatehpur, Auraiya, Etawah, Mainpuri

and Mau Districts of Uttar Pradesh for the isolation of salt

tolerant actinomycetes. A total of 23 soil samples were

collected from Kanpur, Etawah, Auraiya, Mainpuri and 10

soil samples were collected from Mau district.

· The pH of soil samples ranged from 7.5 to 11.0 and electrical

conductivity (EC) from 0.30 to 13.33 dS/m. A total of 112

morphotypes were obtained from saline soils of Kanpur and

Mau Districts of Uttar Pradesh using different media and

enrichment methods.

· Actinomycetes isolated from the Uttar Pradesh saline soils

region were evaluated on different salts (NaCl, KCl and

87


Map depicting the sampling sites of salt affected regions of Kanpur District and drought affected regions of Rajasthan

Pie diagram representing salt tolerance capacity of Kanpur and Mau isolates against different NaCl concentrations

MgSO ). The Actinomycetes isolated from Kanpur regions 4

had shown significant results on NaCl. A total of 5 isolates

shown growth on 4% NaCl concentration, 20 isolates were

shown growth at 10% KCl and 30 isolates were shown

growth at 10% MgSO4 while the isolates from Mau region

showed tolerance up to only 10% NaCl concentration.

· Salt tolerant actinomycetes from Uttar Pradesh showed

significant PGP traits viz., IAA production, ammonia

production, siderophore production, HCN production, H S 2

production and P-solubilization and extracellular enzyme

activity.

· Salt tolerant actinomycetes have been subjected for osmolyte

production (proline) and estimation of osmolytes.

· The actinomycetes have been subjected to molecular

identification using universal 16S rDNA primers and

restriction fragment length polymorphism is under progress

for clustering and identification of representative isolates for

sequencing.

Conclusion

Among all the isolates obtained from the salt stressed regions

most of the isolates showed tolerance upto 6-8% of NaCl

concentration along with considerable extent of PGP attributes

and extracellular enzyme activity. These isolates can be taken

further to assess their potential for seed germination and

promotion of plant growth under stress conditions as well as

production of compatible solutes to cope up with stressed

environment. Promising isolates will be further taken for pot and

then field assay in saline soil for assessing their potential as stress

alleviators and in development of consortia along with other

microbes.


· Nityanand M., Yadav A. K., Divya S., Shrivastava P.,

Yandigeri M.S. and Arora D.K (2010). Genotypic diversity of

actinomycetes from Indogangetic plain of India. In:

International Conference on Aquatic Microbiology (status,

challenges and opportunities) to be held at CAS in Marine


Parangipettai, September 2 – 4, 2010, p. 117.

· Singh D., Shrivastava P., Malviya N., Yadav A.K., Mahesh

S.Y. and Arora D.K. (2010). Utilization of plant associated

actinomycetes to alleviate drought stress in cereal crops. In:

International Conference on Aquatic Microbiology (status,

challenges and opportunities) to be held at CAS in Marine


Parangipettai, September 2 – 4, 2010, p. 32-33.

· Manish Roy, Divya Singh, Pooja Shrivastava, Mahesh S.

Yandigeri and Dilip K. Arora (2010) Isolation, identification

and characterization of halophilic actinomycetes from salt

affected regions of Eastern Uttar Pradesh. In: International

Conference on Aquatic Microbiology (status, challenges and

opportunities) to be held at CAS in Marine Biology, Faculty

of Marine Sciences, Annamalai University, Parangipettai,

September 2 – 4, 2010, p. 40.

Isolation, inventorization and field assessment of agriculturally important microorganisms in thestress ecosystems of Karnataka

Rationale

Increased incidences of abiotic and biotic stresses impacting

productivity in principal crops are being witnessed all over the

world. Extreme events like prolonged droughts, intense rains and

flooding, heat waves and frost damages are likely to further

increase in future due to climate change. A wide range of

adaptations and mitigation strategies are required to cope with

such impacts. Efficient resource management and crop/livestock

PI : A. R. AlagawadiCo PIs : P. U. Krishnaraj, K. S. Jagadeesh, S. G. PatilUniversity of Agricultural Sciences, Dharwad

improvement for evolving better breeds can help to overcome

abiotic stresses to some extent. However, such strategies being

long drawn and cost intensive, there is a need to develop simple

and low cost biological methods for the management of abiotic

stresses, which can be used on short term basis. Microorganisms

could play a significant role in this respect, if we can exploit their

unique properties of tolerance to extremities, their ubiquity,

genetic diversity, their interaction with crop plants and develop


88

methods for their successful deployment in agricultural

production. Besides influencing the physico-chemical properties

of rhizospheric soil through production of exopolysaccharides

and formation of biofilm, microorganisms can also influence the

response of higher plants to abiotic stresses through different

mechanisms like induction of osmo-protectants and heat shock

proteins etc. in plant cells. Use of these microorganisms per se can

alleviate stresses in crop plants thus opening a new and emerging

application in agriculture. These microbes also provide excellent

models for understanding the stress tolerance, adaptation and

response mechanisms that can be subsequently engineered into

crop plants to cope with climate change induced stresses.

Objectives

· Isolation, enumeration, characterization and inventorization

of AIMs (N fixers, P-solubilizers, PGPRs, fluorescent 2

pseudomonads, cellulose and lignin degraders) from

saline/salt affected soils, water logged areas and dry tracts of

Karnataka,

· Assessing the functional potential of each group of

organisms for use in agriculture,

· Setting up the culture bank of the potential isolates under

each group and deposit them with the NBAIM,

· Field testing of potentially efficient isolates/consortia of

isolates (based on lab/ green house studies.


· ACC deaminase activity of 172 salt tolerant AIMs (18

Azospirillum, 14 Azotobacter, 60 P-solubilizers and 80

fluorescent pseudomonads) was determined in vitro and

found 132 of them (15 Azospirillum, 14 Azotobacter; 45 P-

solubilizers and 58 fluorescent pseudomonads) to be positive

for ACC deaminase activity. The enzyme activity of the

isolates ranged from 15.08 to 457.8 nmol keto-butyrate/g

biomass/h.

· The amount of glycine betaine accumulated by the salt

tolerant AIM's ranged from 0.3 to 1.42 moles, 0.33 to 1.9

moles, 0.68 to 1.79 moles, 0.34 to 1.49 moles, and 0.27 to 0.8

moles/mg of protein in the presence of 8, 10, 12.5, 15 and

17.5% respectively as compared to 0.03 to 0.25 moles/mg of

protein in the control medium (without any added salts).

· Out of 24 salt tolerant AIMs identified using 16S rDNA

sequencing technique, four isolates showed closest

affiliation to Pseudomonas putida; three each to Pseudomonas

chlororaphis sub. sp. aureofaciens, Pseudomonas aeruginosa,

Azotobacter vinelandii and Azospirillum irakense; two each to

Pseudomonas sp. and Azotobacter chrocooccum; one each to Azotobacter salinestris, Azospirillum halopreferans, Azospirillum

brasilense, and Azospirillum sp. All the 24 sequences were

deposited to NCBI using Sequin software and Accession

numbers issued for each sequences were from HQ18734 to

HQ18757. All these strains have been deposited with

NBAIM.

· Consortia comprising Azospirillum (ES-173), Azotobacter

(S63(1)R), PSB (S125R) and fluorescent pseudomonad

(S4(1)S) gave significant improvement in the plant growth

and yield of cotton (cv RAHS-14) at all the soil EC levels.

Consortia recorded 16.5 per cent increase in seed cotton yield

over UIC at soil EC 10 dS/m.

· Influence of 19 efficient salt tolerant AIMs on sorghum (CSH-

14) was assessed with two soil salinity levels (4.28 and 8.0

dS/m) under field conditions at ARS, Gangavati. Inoculation

of sorghum with Azotobacter S63(1)R, Azospirillum ES-145,

PSB S-125R, PSF WL-9S and FP S4(1)S gave 46 to 76 and 56 to

92 per cent increase in fodder yield over UIC at soil EC 4.28

and 8.0 dS/m respectively.

· Field efficacy studies of selected AIMs and their consortia in

sunflower (KBSH-1) at three salinity levels indicated

consortia to give significantly higher seed yield (14.5, 10.95

and 7.39 q/ha, respectively) over UIC (8.52, 6.50 and 3.75

q/ha, at soil EC of 4.5, 7.9 and 10.3 dS/m respectively).

· Seed inoculation of sunflower with selected salt tolerant

isolates and their consortia gave 10 to 14, 14 to 21 and 28 to 39

per cent increase in seed germination; 16 to 30, 21 to 41 and 22

to 60 per cent increase in biological yield; and 16 to 70, 18 to

68, 26 to 97 per cent increase in grain yield over UIC at soil EC

of 4.5, 7.9 and 10.3 dS/m respectively.

Conclusion

Most of the isolates tolerating varied concentration of NaCl

were found to have ACC deaminase activity indicating the

importance of this property to overcome the adverse effect of salt

stress. Inoculation effect was more at higher salinity, indicating

the importance of these isolates in improving growth and yield of

different crops grown under saline soils. It can be concluded that,


· Alagawadi, A.R., Krishnaraj, P.U., Mudenoor, M.G., Chaitra,

D. and Ammanna, S., 2011, Studies on salt tolerant

fluorescent pseudomonads isolated from stress ecosystems

of Karnataka. National symposium on “Microbial Diversity

and its Applications in Agriculture, Industry and Health” held at

ICAR complex for Goa, March 4-5, 2011. p. 37.

screening of salt tolerant potentially efficient AIMs resulted in

finding useful strains for improving agricultural productivity and

eco-restoration of stressful surroundings.

Consortia at soil EC 10.3 dS/m UIC at soil EC 10.3 dS/m

Response of Sunflower KBSH-1 to inoculation of salt tolerant isolates and their consortia under different soil salinity at ARS, Gangavati

89


Development of microorganism consortium to alleviate abiotic stresses like drought, hightemperature and salinity in millets

Rationale

Since biotic stresses like drought and salinity are limiting the

crop yields in rainfed agriculture, any attempt to manage these

stresses with low cost methods like use of AIMs will contribute to

sustainable production of rainfed crops and minimize the risk to

the farmers. Hence, this project is proposed to utilize the high

biodiversity of AIMs available in rainfed agro ecosystem for

management of biotic stresses in plants through a systematic

programme of screening, characterization, green house, field

evaluation and product development based single and

consortium of microorganisms.

Objectives

• To isolate microorganisms from rhizotic zones of millets

grown under stress conditions like drought and extreme

temperatures.

• Biochemical characterizations and testing of these organisms

for their response to drought and high temperature stresses

under in vitro conditions.

• Evaluation of promising strains on millet crops (pearl millet

and finger millet) in pot culture conditions.

• Development of consortium of microorganisms, application

methods and field evaluation for improvement of yield of

target crops.


· Based on previous years studies, abiotic stress tolerant

bacterial consortium was developed using Pseudomonas-P7,

Bacillus-B30 and Azospirillum- G12. The different ratios of

three bacterial strain were studied for their effect on sorghum

plants under drought as well as temperature stress. Study

revealed that bacterial consortium with equal cell population -9(10 ) of three strains (P7+B30+G12) showed significant

increase in shoot, root and dry biomass of sorghum seedlings

compared to mono, dual and mixture of three strains with

different cell population of each strain under non-stress

(NS),drought stress (DS) and temperature stress (TS).

· A similar trend was observed with plant biochemical

parameters inoculated with equal ratio (1:1:1) of cell -9population (10 ) of three strains (P7+B30+G12). A significant

increase in proline (34.6±0.4, DS; 32.5±0.4, TS; 13.9±0.04 non-

stress), total sugars (146.9±1.1,NS; 101.5±0.3,DS; 98.4±0.4);

and chlorophyll (17.4±0.08,NS; 14.9±0.05,DS;13.1±0.04,TS)

content was observed in sorghum seedlings compared to

other ratios. Inoculation with bacterial consortium (1:1:1)

also improved relative water content under drought stress

and decreased electrolyte leakage under temperature stress.

· Field studies were also conducted with two bacterial

consortia; P7+B30+G12 for sorghum and (P45+B17+G12) for

sunflower with inorganic and organic fertilizers

amendments. Studies revealed that soil amended with 100%

inorganic and organic fertilizers and with bacterial

consortium increased grain yield in sorghum as well as in

sunflower plants compared to 75% chemical + Inoculation;

50% chemical +8tons FYM+ Inoculation; 75% chemical +

PI : Minakshi GroverCo PI : S. K. YadavCentral Research Institute for Dryland Agriculture, Santoshnagar, Hyderabad

4tons FYM+ Inoculation; 75% chemical + 4tons FYM and

100% Inoculation.

· As suggested by nodal center, more than 200 new

rhizobacteria were isolated from stressed rhizosphere soils

using different oligotrophic and selective media. All isolates

were screened for tolerance to abiotic stresses viz.,

temperature, drought and salinity.

· 29 thermotolerant (50º C), 31 drought tolerant (30% PEG) and

18 salinity tolerant (10% NaCl) isolates were identified. Eight

isolates could tolerate all the three abiotic stresses tested.

· Abiotic stress tolerant isolates were screened for plant

growth promoting characters viz. phosphorus solubilization,

siderophore and IAA production and 19, 9 and 15 isolates

showed the above PGPR characters respectively.

· Biochemical characterization viz . carbohydrate

fermentation, oxidase, catalase, citrate and indole

production, gelatin and starch hydrolysis, Methyl Red and

Voges Proskauer test were done for the abiotic stress tolerant

isolates.

Conclusion

Bacterial consortium containing equal ratios (1:1:1) of

Pseudomonas-P7, Bacillus-B30 and Azospirillum- G12 was found to

be more effective in improving plant growth and biochemical

parameters of sorghum plants under drought as well as high

temperature stress as compared to other ratios studied, dual and

single inoculations. Field experiment with sorghum and

sunflower crops with 100% (inorganic and integrated) and 75%

(Inorganic and integrated) fertilizer dose indicated that treatment

with 100% chemical fertilizer + consortium inoculation was

performing better in terms of plant growth, yield and biochemical

status, as compared to uninoculated 100% (inorganic and

integrated), 100% integrated + consortium, and 75% (inorganic

and integrated) + inoculation. Besides more that 200 stress

tolerant rhizobacteria were isolated and characterized for

tolerance to different abiotic stresses, biochemical and plant

growth promoting traits. Twenty nine thermotolerant (50º C), 31

drought tolerant (30% PEG) and 18 salinity tolerant (10% NaCl)

isolates were identified. Eight isolates could tolerate all the three

abiotic stresses tested. Phosphorus solubilization, siderophore

and IAA production was observed in 19, 9 and 15 isolates

respectively. The isolates are under further screening for

imparting tolerance to host plant under drought and heat stress.


· Sandhya Vardharajula, Shaik Zulfikar Ali, Minakshi Grover,

Gopal Reddy; Venkateswarlu Bandi (2010) Drought-tolerant

plant growth promoting Bacillus spp. effect on growth,

osmolytes, and antioxidant status of maize under drought

stress. J. Plant Interact. DOI: 10.1080/17429145.2010.535178

· Shaik Zulfikar Ali, Vardharajula Sandhya, Minakshi

Grover, Linga Venkateswar Rao, Bandi Venkateswarlu

(2010) Effect of inoculation with a thermotolerant plant

growth promoting Pseudomonas putida strain AKMP7 on

growth of wheat (Triticum spp.) under heat stress. J Plant


90

Interact. DOI:10.1080/17429145.2010.545147

· V.Sandhya, Sk.Z.Ali, Minakshi Grover, Gopal Reddy,

B.Venkateswarlu (2010) Effect of plant growth promoting

Pseudomonas spp. on compatible solutes, antioxidant status

and plant growth of maize under drought stress. Plant

Growth Regul. 62: 21-30.

· V. Sandhya, Sk.Z.Ali, Minakshi Grover, Gopal Reddy,

B.Venkateswarlu (2010) Effect of osmotic stress on plant

growth promoting Pseudomonas spp. Arch. Microbiol. 192:

867-876.

· Minakshi Grover, Sk.Z.Ali, V.Sandhya, B.Venkateswarlu

(2010) Role of microorganisms in adaptation of agricultural

crops to abiotic stresses. W.J.Microbiol. Biotechnol. DOI:

10.1007/s11274-010-0572-7.


· Minakshi Grover, Sk Z Ali, V. Sandhya, Madhubala, Komal Vig, Shree R Singh and B. Venkateswarlu. Effect of drought

tolerant bacterial consortium on sorghum plants, under

different nutrient management practices. 96th South Eastern

Branch of American Society of Microbiology annual meeting

held at Montgomery, Alabama, USA, November 4-6, 2010.

Development of a bacterial consortium to alleviate cold stress

Rationale

The hill and mountain agro-ecosystems are characterized by

difficult terrain inadequate infrastructure, fragile ecosystem and a

society entrenched in traditions. Despite the low population

density, hill farmers face difficulty in producing crops to meet

their needs due to scattered land holdings, severe topsoil erosion

and low input application due to various factors. Therefore, by

default hill agriculture largely remains a low external input based

production system. The hill and mountain agro-ecosystem of

Uttarakhand and Garhwal state is subject to extreme winters

(during rabi season), during which the frost and snowfall are quite

common. In the upper reaches of the state, the ground remains

frozen for varying periods of time, subjecting the various rabi

crops to intense cold stress, thereby reducing the productivity of

crops. The effects of cold stress on crops can be reduced to a great

extent by utilizing plant growth promoting microbial inoculants

that retain their functionality at cold temperature conditions and

thereby offset the deleterious effects of cold stress on plants.

Alternatively selection of bacteria with low ice nucleating activity,

for phyllosphere colonization would help in overcoming frost

induced damages, which has been largely attributed to ice

nucleating bacterial inhabitants of the leaf surface. Since such an

approach has not been carried out earlier and most microbial

inoculants that have been developed so far are from the plain

regions of the nation where such harsh extremities of temperature

are non-existent. Hence, this study aims at developing bacterial

consortia that would alleviate cold stress on crop plants when

applied in the rhizospheric and phyllosphere regions of crop

plants.

Objectives

· To isolate cold tolerant bacteria from the rhizosphere of

various hill crops and screen them under in- vitro cold

conditions for their PGPR activity.

· To develop comprehensive biomarkers for the quality

control and field detection of the elite PGPR isolates.

· To develop a consortium of elite bacterial isolates to alleviate

the effect of cold stress.

· To evaluate the performance of consortium on selected Rabi

crops under pot culture conditions.



· Cold tolerant bacterial cell survival in charcoal based -1formulation ranged from 7.2 to 7.6 log cfu gm under non-

refrigerated and refrigerated condition after six months.

· Bacterization with cold tolerant bacterial consortia had

significantly (P < 0.05) enhanced uptake of N (6.0. to 51.3%), P

(10.3 to 48.7% except C3), K (1.19 to 1.87 fold), Fe (1.46 to 2.43 + +fold), Zn (11.2 to 62.55%) and decreased Na / K ratio in

wheat (VL Gehun 804) at 60 DAS as compared to

nonbacterized control under pot condition.

· Bacterization with cold tolerant bacterial strains significantly

(P < 0.05) enhanced uptake of N (11.2 to 34.1% except PGRs4),

P (5.5 to 87.7%), K (8.7 to 129.0%), Fe (1.3 to 2.9 fold except

PGERs17), Na (10.4-55.2% except PGRs4), Zn (7.7 to 53.9% + +except PGRs4 & NPRs3) and decrease Na / K ratio in wheat

(VL Gehun 804) at 60 DAS as compared to nonbacterized

control under field condition.

· Inoculation with single cold tolerant bacterial strain NARs9,

PBRs5, PPERs23 and PGERs17 enhanced wheat (VL Gehun

804) yield by 19.2, 17.1, 16.0 and 13.5% respectively, over the

uninoculated control under field condition.

· In field condition seed bacterization with cold tolerant

bacterial strains improved plant growth parameters {root

length – 3.8 to 35.7%, shoot length - 9.0 to 35.3%, dry shoot

biomass - 3.7 to 55.5%, dry root biomass - 7.1 to 28.5%, (except

NARs9, NPRp15 & NPRs3), chlorophyll a/b ratio - 0.9 to

47.2%} and cold alleviating parameters {free proline - 1.9 to

2.5 fold, starch content - 1.01 to 2.86 fold (except PPERs23),

amino acids - 1.34 to 1.77 fold (except PPRs4), anthocyanin -

10.1 to 33.7% (except PPRs4), total phenolics - 0.6 to 20.4%

(except PGERs17 and PPRs4), relative water content and

decrease in electrolyte leakage} of wheat (VL Gehun 804) at

60 DAS as compared with uninoculated control in field

condition.

· Inoculation with cold tolerant bacterial consortia enhanced

plant growth parameters {root length - 3.1 to 21.7%, shoot

length - 34.8 to 69.2%, dry shoot biomass - 14.2 to 76.1%

(except C1), dry root biomass - 14.2 to 42.8% (except C3),

chlorophyll a/b ratio - 1.09 to 1.53 fold} and cold alleviating

parameters {free proline - 5.7 to 77.1%, starch content - 0.9 to

72.5%, amino acids - 2.7 to 42.5% (except C4, C5, C6),

91


anthocyanin - 1.04 to 1.65 fold, total phenolics - 2.7 to 31.3%

relative water content and decrease in electrolyte leakage} of

wheat (VL Gehun 804) at 60 DAS as compared to

uninoculated control in field condition.

· All the individual strains in the consortium showed wheat

root colonization in the range of 6.0 – 8.4 log cfu after 60 DAS.

· Under field condition three consortium C3, C1 and C4

significantly enhanced wheat (VL Gehun 804) grain yield

25.4, 27.4 and 29.5% respectively, over uninoculated control.

Conclusion

In the context of hill and mountain agro-ecosystems, utility of

such cold active bacterial strains/ consortium is immense

considering the unique crop growing situations and the climatic

conditions of the high altitude agricultural systems. Such systems

require situation specific microbial inoculants that withstand

extremities of cold and retain their functional traits for plant

growth promotion. Twelve cold tolerant bacterial strains and

eight bacterial consortia were evaluated on wheat (VL Gehun 804)

growth and nutrient uptake under pot/ field condition.

Inoculation with Pseudomonas strains significantly enhanced

root/ shoot biomass and nutrients uptake as compared to

nonbacterized control at 60 day of plant growth. Bacterization

significantly improved the level of cellular metabolites like

chlorophyll, anthocyanin, free proline, total phenolics, starch

content, physiologically available iron, proteins and amino acids

that are sign of alleviation of cold stress in wheat plants. Increased

relative water content, reduced membrane injury (electrolyte + +leakage) and Na /K ratio was also recorded in bacterized wheat

plants. Cold tolerant Pseudomonas strain NARs9, PBRs5, PPERs23

and PGERs17 enhanced wheat yield by 19.2, 17.1, 16.0 and 13.5%

respectively, over the uninoculated control under field condition.

Among the bacterial consortium C4 (P. fluorescens PPRs4, P. sp.

PCRs4, P. jessenii PGRs1) recorded maximum (29.5%) wheat yield

over the control under field condition. The result showed that

single as well as bacterial consortium could be utilized to alleviate

the cold stress effect of wheat crop.


· Pankaj K. Mishra, Shekhar C. Bisht, Pooja Ruwari, Gopal K. Joshi, G. Singh, Jaideep K. Bisht, J. C. Bhatt (2010).

Bioassociative effect of cold tolerant Pseudomonas spp. and

Rhizobium leguminosarum-PR1 on iron acquisition, nutrient

uptake and growth of lentil (Lens culinaris L.). European

Journal of Soil Biology. 47:35-43.

· Pankaj K Mishra, Shekhar C Bisht, Pooja Ruwari, Govindan

Selvakumar, Gopal K Joshi, Jaideep K Bisht, Jagdish C Bhatt,

Hari S Gupta (2011) Alleviation of cold stress in

wheat (Triticum aestivum L.) seedlings with psychrotolerant

Pseudomonads from N.W. Himalayas,

· Pankaj K. Mishra, Shekhar C. Bisht, Smita Mishra, G.

Selvakumar, J. K. Bisht and Hari Shankar Gupta (2010).

Coinoculation of Rhizobium leguminosarum-PR1 with a cold

tolerant Pseudomonas sp. Improves iron Acquisition,

Nutrient Uptake and growth of Field Pea (Pisum sativum L.).

Journal of Plant Nutrition. (In press).

Book Chapter

· Pankaj Kumar Mishra, Shekhar Chandra Bisht, Jaideep

Kumar Bisht and Jagdish Chandra Bhatt (2011). Cold

Tolerant PGPRs as Bioinoculant for Stress Management In:

D.K. Maheshwari (ed.) Bacteria in Agrobiology: Stress

Management, Microbiology Monographs Springer-Verlag

Berlin Heidelberg (In press).


· Pankaj K. Mishra, Shekhar C. Bisht, Pooja Ruwari, K.

Jeevanandan, G.K. Joshi, J. K. Bisht, J. C. Bhatt: Development

of cold tolerant bacterial consortium to alleviate cold stress theffects in wheat (Triticum aestivum L.) seedlings. 51 Annual

Conference of AMI, BITS, Pilani. Dec 14-16, 2010.

· Pankaj K. Mishra, Shekhar C. Bisht, Pooja Ruwari, J. K. Bisht,

J.C. Bhatt: Enhancement of chilling tolerance in wheat

(Triticum aestivum L.) seedlings with psychrotolerant growth

promoting Pseudomonads from N.W. Himalayas.

International workshop: Mountain Biodiversity & Impacts of

climate change. GBPIHED, Kosi Katarmal, Almora, Dec. 6-8,

2010.

· Shekhar C. Bisht, Pankaj K. Mishra, Tanuja Joshi, Pooja

Ruwari, J. K. Bisht, J.C. Bhatt: Asending migration of

endophytic Bacillus thuringiensis, from roots to leaves and

assessment of benefits to four different legumes of N.W. thHimalayas. 5 Annual Conference UCOST, Doon University,

Dehradun, Nov. 10-12, 2010, p. 12.

inoculated

Arch Microbiol.

(Accepted).

Effect of cold tolerant bacterial strains on plant growth, physiological and biochemical parameters of wheat (variety VL Gehun 804) in field condition


92


Complete genome sequencing of Mesorhizobium ciceri Ca 181

Rationale

Mesorhizobium ciceri ca181 was selected for whole genome

sequencing as it is a nodule forming chick pea rhizobia with very

specific and high qualities like, efficient nitrogen fixer shows good

nodulation competitiveness and performed well at different locations

in different agro-climatic regions, different soil types in All India

Coordinated trials. The whole genome sequencing of this bacterium

unveils the specific properties of it which is encoded by genes that

works in the coordinated form of specific metabolic pathways. After

the completion of gene prediction and annotation, we will understand

the reason of uniqueness of this bacterium, this will come in the form

of new genes and operons and proteins.

Objective

· Complete Genome Sequencing of Mesorhizobium ciceri Ca 181.


· Genome Assembly and Annotation: Sequencing of the genome

was done by 454 Next Generation pyrosequencing as well as

Sanger technology. A total of 6461 genes have been predicted

and annotated for the functions they perform in Mesorhizobium

ciceri Ca181. Filtration of annotated genes according to their

functional categories (stress, biosynthesis, regulatory and

signaling) is in the progress.

· Nitrogenous products accumulate in plants when soil nitrogen

level is high and readily available but the plant is unable to utilize

it. Nitrate level can go up and go in plants. After harvesting plant

nitrate gets converted in nitrite that is ten times more toxic in

comparison to nitrate. Above 5000 ppm of nitrate, it is dangerous

for the growth of plants and it checks the formation of root

nodules in the legumes. So the assessment of utilization of toxic

level of nitrate in the soil is planned.

· Experiment has been setup for the assessment of soil nitrate and

nitrite utilization ability of the strain Ca181. Four sets of

PI : Dilip K. AroraCo- PI : Alok K. SrivastavaNational Bureau of Agriculturally Important Microorganisms, Mau

experimental combinations have been made.

· The experiment is set up for the competitiveness of M. ciceri

Ca181 with other chick pea rhizobia strains. A total of eight

different rhizobia strains have been taken including M. ciceri

Ca181. 28 combinations have been made and experiment was

setup with 5 replication including negative control.

Conclusion

After assembly, the genome was search for the similarity in

genome database available at NCBI Genome browser and it found

about 35% similar from its closest organism M. loti. These results show

potential that after complete analysis of the genome, it will give some

new and unique genes and process involved in the specificity of this

organism. The study is incomplete to draw final conclusion. However

the identification of few sequences with unknown function could be

interesting to further work on because it does not have any match in

the database.


·

·

·

Singh RP, Singh RN, Shahi P, Sharma A, Srivastava AK, and

Arora DK (2010) 3D structure prediction and modelling of FUR

protein in Bradyrhizobium japonicum USDA110, Interantional

Conference on Genomic Sciences-Recent Trends, Madurai

Kamaraj University, Madurai, India

Shahi P, Singh R N, Sharma A, Singh RP, Srivastava AK, and

Arora DK (2010) Identification of CSP homologous genes in

psychrophillic bacteria isolated from Gurudongmar Lake,

Interantional Conference on Genomic Sciences-Recent Trends,

Madurai Kamaraj University, Madurai, India

Sharma A, Babu BK, Singh RN, Shahi P, Singh RP, Srivastava AK,

and Arora DK (2010) Isolation and sequence characterization of

plasmid present in Mesorhizobium ciceri, Interantional

Conference on Genomic Sciences-Recent Trends, Madurai

Kamaraj University, Madurai, India

Total Contigs used for gene prediction 109 Total number of genes predicted

6461

Genes used for protein prediction and annotation

5560

Distribution of Genes in the Genome of M. ciceri Ca181

Protein involved in different functions in the Genome of M. ciceri Ca181

93



Genomic studies of uncultivated N fixing communities from Uttarakhand2

Rationale

Since, it is established that only less than 3% microbial

population is culturable, it is the need of this hour to unravel the

hidden treasure troves of nature by some alternative approaches.

In view of the above, the proposed objectives will not only

facilitate the characterization, but also expression and

conservation of desired gene(s) in suitable host. Furthermore, this

will provide a systematic documentation of Uttarakhand

microbial wealth which can be explored for socio-economic

upliftment and sustainable crop productivity by local inhabitants.

Objectives

· Identification of targets/isolates from different geographical

regions.

· Metagenomics for csp and nif.

· Isolation of full-length nitrogen fixing genes from a large

number of isolates.

· Characterization of the above genes by sequencing.

· Sequence alignment and identification of different alternate

forms of the above mentioned target genes.


· A total of 35 bacterial cultures were isolated from soil

samples of seven different geographical regions of Indian

Western Himalaya.

· The nitrogen-fixing properties of isolates were observed at

low and ambient temperature and six potential strains from

temperate and subtropical regions, were selected for

sequencing and further studies.

· The selected strains were screened for nifH gene and out of 10

nifH positive cultures; six positive strains were sequenced

and submitted to NCBI GenBank.

· Protein expression profile of three potential strains namely

Enterobacter ludwigii strain PAS1; Enterobacter hormaechei

Strain AAB8 and Pseudomonas Sp., Strain JAZ1 during the

PI : Reeta GoelG. B. Pant University of Agri. and Tech., Pantnagar

shiftment of cell cultures temperature from 30°C to 4°C was

studied by two dimensional gel electrophoresis.

· Identified spots were annotated using the database swiss-2D

PAGE.

· In silico analysis was performed on the basis of pI (Isoelectric

point) and Mw (molecular weight) of seperated protein

spots.

· These proteins were further characterized and validated

through mass spectrometry (MALDI-TOF).

Conclusion

Low temperature N fixing bacterial communities were 2

screened from temperate and subtropical regions of Western

Indian Himalayas. Out of 35 isolates, six strains were

sequenced and their 16S rRNA gene sequences were

submitted to NCBI-GenBank. Comparative profiling of three

potential strains (i.e. JAZ1, AAB8 and PAS1) is being carried

out by 2 D gel electrophoresis and MALDI-TOF mass

spectrometry. In-silico analysis of four identified proteins

revealed that these proteins were Universal stress protein A,

GroES protein, Alkyl hydro peroxide reductase subunit C

and GroEL protein, respectively.


· Singh C., Soni R., Jain S., Roy S. and Goel R. (2010) Study of

nitrogen fixing bacterial community using nifH gene as a

biomarker in different geographical soils of Western Indian

Himalayas. Journal of Environmental Biology.31:553-556.

· Soni R. and Goel R. (2010) Triphasic Approach for

Assessment of Bacterial Population in Different Soil Systems.

Ekologija. 56(3&4) 99-104.

· Soni R. Shaluja B.and Goel R. (2010) Bacterial community

analysis using temporal gradient gel Electrophoresis of 16 S

rDNA PCR products of soil metagenomes. Ekologija. 56(3&4)

94-98.

Characterization of proteins expressed in 2-DE by using MALDI-TOF Mass spectrum. Protein score is significant i.e. (P<0.05) after databases


94

Structural Genomics of Mesorhizobium ciceri Ca 181

Rationale

Mesorhizobium ciceri Ca181 is a soil bacterium of Rhizobium

species. Chickpea is an important leguminous crop in most of the

Asian countries. Mesorhizobium ciceri ca181 is a nodule forming

chickpea rhizobia with very high specific qualities like, efficient

nitrogen fixation and shows good nodulation competitiveness

and performed well at different locations in different agro-

climatic regions and soil types. In agriculture, Rhizobium spp.

improves soil fertility in leguminous crops by biological nitrogen

fixation. Rhizobium spp. strains are very sensitive to soil

environmental abiotic factors such as water stresses, high salt, pH,

and temperature stresses that affect their nitrogen fixation

capacity and hence the productivity of legumes. Rhizobium spp.

are also sensitive to desiccation in soils and on seeds. An

understanding of the genetic potential for increased tolerance to

these adverse environmental stresses could enhance production

of food and forage legumes in semi-arid and arid regions of the

world. Phosphorus (P) is one of the major essential

macronutrients for plants and is applied to soil in the form of

phosphate fertilizers. Microorganisms are involved in a range of

processes that affect the transformation of soil P from phosphate

and are thus an integral part of the soil P cycle. In particular, soil

microorganisms are effective in releasing P from inorganic and

organic pools of total soil P through solubilization and

mineralization. Complete genome sequences give us a whole

genomic blue print of an organism such as M. c. Ca181. This will

dissect nitrogen fixation process at molecular level so as to enable

us manipulate genes involved for increasing crop productivity.

Moreover, generating M. c. Ca181 mutants for important genes

like gens involved in water stresses tolerance and phosphate

solubalization will increase our understanding about these genes.

Using the knowledge of different gene sequences and their

function, it may by be possible to use them for increasing crop

yield and development of transgenics with enhanced biological

nitrogen fixation ability and enhanced phosphate solubalization

under abiotic stresses.

PI : Major SinghIndian Institute of Vegetable Research, Varanasi

Simple sequence repeats (SSRs) or microsatellites are tandem

short stretches of DNA with the repeat units of 1-6 bp in length for

varying numbers of times, and the property of microsatellite is

determined by their composition, motif length, and the

distribution in the genome. Simple sequence repeats (SSRs) or

microsatellites, as genetic markers, are ubiquitous in genomes of

various organisms. The analysis of SSRs in various Rhizobium

strains will provide useful information for a variety of

applications in population genetics of Rhizobia.

Objectives

· Complete genome sequencing of Mesorhizobium ciceri Ca 181.

· To utilize sequence data for identification of genes involved

water stress tolerance and phosphate solubilisation.

· SSR markers profiling of Mesorhizobium ciceri Ca 181 with

other Rhizobium.

· Generating Mesorhizobium ciceri Ca 181 mutants for genes

involved water stress tolerance and phosphate

solubilisation.

· Screening of Mesorhizobium ciceri Ca 181 mutants for

phosphate solubilisation and moisture tolerance (low, high).


· Small insert shotgun Genomic DNA insert plasmid library

spanning 1152 (96 x 12 plates) clones was prepared and

plasmid DNA was isolated and analyzed. 702 clones have

been sequenced from 10 plates (5 forward and 5 reverse)

spanning 4,43,407 nucleotides (443.4 Kb). After vector

sequence removal 140 Contigs were assembled and 352

singletons were left. Mesorhizobium ciceri Ca 181 genomic

sequencing has been completed.

· After analysis of genomic sequence of Mesorhizobium ciceri Ca

181, we found 18 SSRs in the genome of Mesorhizobium ciceri

Ca 181 and the frequency of SSRs longer than 10 bp. Among

the various class of microsatellite, trinucleotide and

dinucleotide repeat was the most abundant class. The

frequency of Maximum mononucleotide SSRs are longer

Graph showing the absorbance (600nm) of Mesorhizobium ciceri culture at 0% to 50 % (A);and 25% to 30% of PEG concentration (B).

95


Genome analysis of the nitrogen-fixing symbiotic bacteriam Mesorhizobium ciceri

Rationale

Mesorhizobium ciceri, the bacterium responsible for nitrogen

fixation in chickpea has been analysed through conventional

approaches in India and it lead to identification of a superior

strain, CA181. The main features of this strain has been studied

and described earlier. Under the AMAAS project its genome has

been sequenced and annotated. Based on the annotation

information a set of 24 'nif' genes were identified and flanking

primers for amplification of full length genes were synthesized.

Validation and study of sequence variation for these genes in

other nitrogen fixing microorganisms is expected to provide

useful information on reasons for difference in efficiency of

nitrogen fixation in different bacterium analyzed. The DNA

samples of the isolated provided by NBAIM, MAU is being used

for the analyses of nitrogen fixing genes.

Objective

· Complete genome sequencing of Mesorhizobium ciceri strain

Ca181.


· Optimization of PCR amplification conditions for all 18

primers to amplify the 24 'nif' genes has been completed for

three of the primer pairs.

PI : K.V.BhatCo PI : A. B. Gaikwad, Rakesh SinghNBPGR, Pusa Campus, New Delhi

· All primers gave good amplification of target genes in Ca181

except gene 30, gene 155 & gene 56.

· There was very poor amplification in other isolates for all

primers.

· For gene 7 and gene 35, the amplification product size in

other Rhizobia is different from that of Mesorhizobium ciceri

Ca181.

· Optimization process is being continued and sequence

than 10 bp and one mononucleotide repeat was C motif

longer than 22 bp. Dinucleotide repeats were all GC (GC and

CG were included) and GA motif. Within trinucleotide

repeats CGG, GGC, GCC, TCG were the predominant repeat

type. With the help of SSRs of Mesorhizobium ciceri Ca 181, we

designed 18 primers for making SSR markers profiling of

Mesorhizobium ciceri Ca 181 with other Rhizobium bacteria.

· For Mesorhizobium ciceri Ca 181 mutants development, we are

using some methods for development of mutants of

Mesorhizobium ciceri Ca 181 such as Tn5 transposon

mutagenesis experiment, chemical mutagenesis by ethyl

methyl sulphonate (EMS) and site directed mutagenesis of

genes related to phosphate solubilisation and moisture stress

tolerance. After analysis of genomic sequence of

Mesorhizobium ciceri Ca 181 we found Pyrriloquinoline

quinone (PQQ) gene series family has property for

phosphate solubilisation and there are 7 genes of PQQ series

family present in Mesorhizobium ciceri Ca 181. Trehalose

phosphate synthatase, cold shock protein, fructosyl

transferase, and choline oxidase series genes family are

responsible for low moisture stress tolerance and there are 14

genes are related to this series. For screening of mutants for

phosphate solubilisation and moisture stress tolerance, we

optimized the screening protocols of Mesorhizobium ciceri Ca

181 for low moisture stress tolerance and phosphate

solubilisation. Polyethylene glycol was used for low

moisture because PEG one of the most useful molecules for

applying osmotic pressure in osmotic stress technique. We

tried different percentage of PEG i.e. 10, 15, 20, 25, 30, 40, and 050 % (w/v) in YEMB. After 6 days of culture at 28 C

absorbance was recorded at 600 nm of M. c. Ca 181 with

different percentage of PEG in Yeast extract Mannitol Broth

(YEMB).

· With increase in concentration of PEG the number of

bacterial cells decreased. With the help of above data we

concluded that at 25% PEG there was growth of the

bacterium is considerable and at 30%, 40% and 50% PEG the

growth was negligible. Therefore, 25% PEG concentration

was found fit to screen low moisture stress tolerance

Mesorhizobium ciceri Ca 181 mutants. For screening of

phosphate solubilisation, the bacteria was grown in

phosphate solubilisation media with bromophenol blue.

When phosphate solubilises by M. c. Ca 181 then blue colour

of bromophenol blue converted into red. However, M. c. Ca

181 was little change the colour in initial experiments.

Conclusion

702 clones have been sequenced from 10 plates (5 forward

and 5 reverse) spanning 4,43,407 nucleotides (443.4 Kb).

Mesorhizobium ciceri Ca 181 genomic sequencing has been

completed. The present study is focused on the development of

mutants of Mesorhizobium ciceri Ca 181, which are able to grow in

low moisture condition and solubilises phosphate. The results

indicated that M. c. Ca 181 has ability to grow in low moisture

condition and can little solubilise phosphate. We are trying to

develop better mutants than wild type. After genome sequence

analysis of Mesorhizobium ciceri Ca 181, we concluded that there

are 18 SSRs and 21 genes related to phosphate solubalization and

low moisture stress. This study will provide valuable information

for SSR application in Rhizobia research.

Amplification profiles for the 25 isolates of Rhizobium for the 'nif' genes tentatively designated as Gene7, Gene35, Gene25, Gene46, Gene56I, Gene241, Gene190 and Gene160. The first lane after DNA size marker lane in all gels is M. cicerii CA181 isolate


96

polymorphism is being analysed across the isolates.

Conclusion

Considerable variation was observed for the length of the

total genes across the isolates. Further, failure to obtain good

amplifications with the primers across isolates in all samples

Functional genomic analysis of plant growth promoting rhizobacteria (PGPR) fluorescent Pseudomonads

Rationale

Root colonization is an important step for the successful

establishment plant microbe interaction at the root and

rhizosphere regions whereby the plant growth promoting

bacteria compete with indigenous soil microflora. This process is

regulated by several biotic and abiotic factors at the rhizosphere.

Of these, tolerance to stress induced by the plant partner as well as

other microbiota is of considerable importance. Dissecting the

mechanism of tolerance to stresses in the rhizosphere such as

nutrient starvation would provide critical information regarding

the choice of effective inoculant bacteria and their ecological

success and performance in field conditions.

Objectives

· Selection and characterization of plant growth promoting

rhizobacteria (PGPR) Fluorescent Pseudomonads.

· Genome-wide comparison of the PGPR fluorescent

Pseudomonads isolated from different ecological niches.

· Selection of a PGPR strain, suitable host system for plant root

colonization and analysis of various parameters (biological,

biochemical and environmental) influencing root

colonization.

PI : P. GunasekharanCo PI : K. ManoharanMadurai Kamaraj University, Madurai

· Identification of novel genes influencing rhizosphere

colonization using random Tn5 mutagenesis.


· In a transposon mutant library of Pseudomonas putida S11W,

an iron starvation tolerant (Ht3) was isolated. The region

flanking insertion site of transposon in mutant Ht3 was

sequenced by genome walking PCR.

· Nucleotide sequence analysis revealed the ORF (roxS) into

which transposon had inserted encodes histidine kinase. A

two component signal transduction system (RoxSR)

comprises of an integral membrane sensor signal

transduction histidine kinase (RoxS) and its cognate

transcriptional regulator (RoxR).

· Iron starvation tolerant mutant Ht3 produced more amount

of siderophore pyoverdine under iron limiting conditions

and showed higher iron acquisition ability than parent strain

· Physiological functions namely biofilm formation and seed

adhesion are known to be influenced by iron uptake. Hence,

the mutant Ht3 showed improved ability of biofilm

formation on abiotic surfaces and adhesion to corn seeds.

· An IVET vector was constructed to trap promoters active

during root colonization by beneficial bacteria.

· A suitable host system to apply this developed vector for

promoter trap studies was identified by enriching rice

rhizospheric bacterial suspension in-planta for rice root

colonizing bacteria.

· One strain exhibited very strong seed adherence, root

colonization and plant growth promoting properties.

· The above strain was identified to be Enterobacter cloacae GS1

(ECGS1) by 16S rDNA sequencing and biochemical tests.

· Rice root colonization by GFP tagged ECGS1 was studied in

hydroponic culture conditions by epifluorescence

microscopy.

Conclusion:

In fluorescent pseudomonad P. putida S11W, a two

component regulatory system involved in regulation of

siderophore pyoverdine synthesis was identified and

characterized. To identify bacterial promoters active during plant

root colonization, a Recombinase –IVET vector was constructed.

Promoters active during root colonization by E. cloacae GS1, rice

root colonizing and growth promoting strain shall be identified

using R-IVET.


· Shankar, M., Ponraj, P., Ilakkiam, D., Gunasekaran, P., 2010.

indicated presence of sequence variations for the flanking regions

of the gene. Analyses of sequence variation for the genes are

expected to provide insight into the reasons for differences in

efficiency of nitrogen fixation by different isolates.

Rice root colonization by Enterobacter cloacae GS1 in a hydroponic environment

Recombinase-IVET vector constructed from pGP704 for trapping promoters active during rice root colonization

97


Root colonization of a rice growth promoting strain of

Enterobacter cloacae. J. Basic Microbiol. (In Press).


· P. Ponraj, M. Shankar, D. Illakkiam and P. Gunasekaran,

“Two component signal transduction system (roxSR)

Structural Genomics of Mesorhizobium ciceri Ca181

Rationale

Studies on whole genome sequences give us a complete

genomic blueprint for an organism so that it is possible to examine

how all parts operate cooperatively to influence the activities and

behavior of an entire organism Mesorhizobium ciceri Ca181.

Similarly complete genome sequencing of this microorganism

will enable us to dissect the nitrogen fixation process at the

molecular level at every stage from bacterial recognition of the

plant, nodulation, infection to finally atmospheric nitrogen

assimilation so as to manipulate the genes involved for increasing

crop productivity. Isolated genes after functional validation will

be used to enhance effectiveness of nitrogen fixation of

indigenous rhizobial strains. This project will yield useful

information on total number of protein and rRNA coding genes,

gene phylogenies, biology and diversity of these important

nitrogen fixing microorganisms, in comparison to other rhizobia,

endophytes as well as other microbes. Further experimental

validation of assignment of functions to the various genes

identified in this project will lead to discovery of many genes of

agricultural importance. Using the knowledge of different gene

sequences and their function it may be possible to use them for

development of transgenics with enhanced biological nitrogen

fixing ability.

Objectives

· Complete genome sequencing of Mesorhizobium ciceri strain

Ca181.

· To utilize the sequence data for isolation/identification of

novel genes imparting competitiveness to Ca181.

· To search for homologues/orthologues for nod and nif genes

and their regulatory sequences, in other strains of rhizobia.


· Construction of large insert (30-40 kb) Fosmid Library of

Mesorhizobium ciceri Ca181: High molecular weight genomic

DNA was isolated from Mesorhizobium ciceri Ca181. Shearing

of genomic DNA into 40kb fragments was done by passing

it through a 200 µl small bore pipette 50-60 times. Sheared

DNA was end repaired to generate blunt ended and 5′-

phosphorylated DNA. Size selection for 25-40 kb fragments

of end repaired DNA was done. Ligation of recovered end

repaired, concentrated insert DNA to copy control pCC2FOS

cloning ready vector was done using fast-link DNA ligase.

Ligated product was packaged using Max Plax lamda

packaging extract. E.coli EPI300-T1 cells were infected with

packaged phage particles and plated on selection medium.

Around 3800 clones have been picked.

· Quality Check and size estimation of fosmid clones: DNA

PI : N. K. SinghCo PI : KanikaNational Research Centre on Plant Biotechnology, New Delhi

from the recombinant fosmid clones was isolated using

fosmid isolation kit (Epicenter).The quality of the fosmid

DNA was checked on 0.8% agarose gel. Pulse field gel

electrophoresis was carried out to estimate the approximate

insert size of DNA in fosmid vector. Fosmid DNA was

digested with HindIII and the digested product was run on

1% PFGE gel.

· End sequencing of the Fosmid DNA: End sequencing of 1824

fosmid clones was done. An average of 700-900 bp good

quality read for forward and reverse sequencing was

obtained.

· Use of fosmid end sequence data for scaffolding of the M.

regulates pyoverdine synthesis in Pseudomonas putida S11” ndpresented at National Science Day and 42 AQUA-TERR

Annual Conference on Genomic Sciences, held at Madurai thKamaraj University, Madurai, India on 28 Feburary, 2011.

Snapshot of sequence data of the fosmid DNA clone

Electrogram of the sequenced fosmid DNA


98

ciceri sequence contigs: 1400 Mbp sequence data (60 fold

coverage) from Solexa sequencing and 467 Mbp sequence

date (20.02 fold coverage) using 454 GS FLX Titanium

sequencing have been obtained. De novo assembly was done

with 454 sequence data using 454 Newblerassembler. After

the assembly 23 large contigs were formed. Paired-end

sequences of 672 fosmid clones have been used to fill the

gaps. Out of 22 gaps, 13 gaps were filled using fosmid end

sequence data.

Conclusion

End sequencing of 1824 fosmid clones have been done.

Sequence assembly done using Newbler Assembler, Velbet and

Lasegene DNA Star software and generation of 23 sequence

contigs. Fosmid end-sequences were used for creating scaffolds of

23 sequence contigs and 14 gaps between contigs have been filled

and we have only 3 major scaffolds.

Mining for genes involved in the production of fungicidal compounds in Anabaena strains

Rationale

Cyanobacteria, with their relatively short generation time,

capability of being easily handled and cultured under controlled

conditions and metabolic flexibility, play diverse and significant

roles in the sustainability of the environment and represent a

favourite workhorse for deeper understanding of several

metabolic processes. Anabaena is an important genus, widely

distributed in diverse habitats and exploited not only as a

biofertilizer, but also as a rich source of bioactive compounds,

such as microcystins & laxaphycins. Many such compounds

exhibit fungicidal and herbicidal/weedicidal properties have

been implicated in allelopathic interactions in water and soil.

However, their genomics and proteomics is far from understood.

The present project envisages the identification, sequencing of

genes responsible for fungicidal activity in promising Anabaena

strains, using the tools of genomics and maximizing the

production of these compounds using suitable delivery systems.

Objectives

· To utilize PCR based techniques and sequencing tools to

identify genes involved in the production of the fungicidal

compound(s) in a selected set of Anabaena strains.

· To sequence the gene(s) involved in the production of the

fungicidal compound(s).

· To validate the fungicidal effect of the gene by

transformation of non-toxic strain.

· To develop delivery and expression systems for enhanced

production of fungicidal compound(s).


· The genomic library clones of Anabaena laxa were screened

using plate assays for both β-1,3 and β-1,4 endoglucanase

activities and quantitative analyses was undertaken using

cell free recombinant proteins from the positive clones. Both

end 1 and 2 were successfully subcloned into the pET-14b

expression vector, and the recombinant End 1 and 2 proteins

purified using Ni-NTA kit and quantified using modified

Bradford's method. SDS-PAGE of the recombinant purified

proteins revealed 38 and 74 kDa molecular weight from End

1 and 2, respectively and the expression of the purified

recombinant proteins of both End 1 and 2 was evaluated

using activity staining gel method using 1 % CMC (carboxy

methyl cellulose) and laminarin as substrates. The purified

End2 exhibited positive results with both substrates, while

PI : Radha PrasannaCo PI : N. K. SinghIndian Agricultural Research Institute, New Delhi

End1 was positive for only CMC as substrate. The negative

controls did not show any activity with respect to substrate.

· Time course studies were undertaken using two Anabaena

strains (A. fertilissima; A. sphaerica) under different light: dark

conditions viz. continuous light (CL) and dark (CD), L: D::

8:16 and L:D::16:8 (Light: Dark). The time dependent

measurement of chitosanase and antifungal activities under

different light-dark conditions indicated that in A. fertilissima

(RPAN1), both these activities were stimulated in the dark

phase and maximum under L:D::8:16 condition. The

relatively lower level of protein in A. fertilissima (as compared

to A. sphaerica) in the dark phase of L:D-8:16 (particularly at

28d) suggested that the increase in the length of dark phase

leads to retardation of growth which may act as a

physiological signal to increase the chitosanase/antifungal

activities in A. fertilissima. PCR amplified products using

chitosanase specific primers were gel purified and cloned

into pGEM-T easy vector and then transformed into E. coli

host strain DH5α. Sequence analysis of the amplified

product showed that they were similar to glycoside

hydrolase family 3 like (GH3-like) N terminal domain

proteins of A. variabilis ATCC 29413 strain. This enzyme

belongs to the GH3 family protein (PFAM Accession

PF00933).

· The pair-wise amino acid sequence alignment further

revealed 5 insertions and 5 substitutions in the amino acid

sequence of A. fertilissima as compared to A. sphaerica

(negative control). An open reading frame of 362 and 367

amino acids with a predicted molecular mass of 40 kDa and

40.6 kDa was observed in A. sphaerica and A. fertilissima,

respectively. The N-terminal region of the deduced amino

acid sequence of A. fertilissima exhibited a putative peptide

signal of 23 residues long, whereas, neither signal peptide

nor cleavage site was detected in A. sphaerica. Chitosanase

specific proteins were isolated and purified from both the

Anabaena species. SDS-PAGE analysis revealed a size of Cho

proteins of 40.6 and 40.0 kDa in A. fertilissima and A. sphaerica,

respectively. HPLC based profiling results clearly indicated

that the presence of chitosanase activity only in A. fertilissima

Compost formulations, developed by amendment with a set

of Anabaena strains and biocontrol strain Bacillus subtilis were

evaluated for their disease suppressiveness against

phytopathogenic fungal consortium (P. debaryanum, F.

99


moniliforme, F. oxysporum lycopersici and R. solani), by

employing them as potting mixture supplements in tomato

crop under greenhouse conditions. The promising strains

were further evaluated in pot experiments set up in the

National Phytotron Facility. Anabaena variabilis RPAN 59

amended composts significantly reduced % disease severity.

The activity of the plant defense enzymes PAL and PPO were

higher in roots than shoots and enhanced significantly in the

fungi challenged treatments i.e. T6-T12.

· The extracellular filtrates from Anabaena sp. such as A. laxa, A.

iyengarii, A. variabilis and A. oscillarioides from 7, 14, 21 and

28d old cultures grown under different conditions of light

[Continuous Light (CL), Light dark (LD; 16:8) and ˚ ˚Continuous Dark (CD)], temperature [19+1 C, 29+1 C and

˚39+1 C], phosphorus doses [1/2P, 1P, 2P], pH levels [5.5, 7.5

and 9.5], were evaluated under laboratory conditions in

terms of total chlorophyll, total proteins, chitosanase,

endoglucanase and CMCase activity and inhibition assay

against P.debaryanum, F. moniliforme, F. oxysporum lycopersici

and R. solani employing standard methods. Four weeks old

cultures exhibited highest enzyme activity. Highest values of

hydrolytic enzyme activity were recorded in all the strains

under CL condition while lowest values were recorded in CD

condition. The pH of 7.5 and 9.5 were found to be optimal for

endoglucanase and CMCase activity, respectively. The ˚activity of chitosanase and CMCase was highest at 39+1 C,

while endoglucanase was not significantly affected. No ˚fungicidal activity was observed at 20+2 C as well as under

CD condition. Chitosanase activity was highest at pH 5.5

while CMCase was not influenced significantly by pH.

Conclusion

Two genes (end 1 and 2) encoding hydrolytic enzymes from

A. laxa (RPAN8) which showed β-1, 4 (end 1 and 2) and β-1, 3 (end

2) endoglucanase activities were identified, purified and

characterized. A novel cho gene associated with GH3-like family

encoding chitosanase from A. fertilissima (RPAN1) was also

characterized in terms of its expression and fungicidal activity.

These are first reports for these organisms. The environmental

conditions leading to highest fungicidal and hydrolytic enzyme

activity were identified as - 4 weeks old cultures incubated under

continuous light (CL), high temperature (39+1˚C) and

phosphorus (0.086 mM). Compost amended with Anabaena

strains showed promise in the suppression of the disease severity,

besides enhanced leading to defense responses of tomato plants

against damping off disease.


· Vishal Gupta, Chitra Natarajan, Kanika Kumar and Radha

Prasanna (2010). Identification and characterization of

endoglucanases for fungicidal activity in Anabaena laxa.

Journal of Applied Phycology 23: 73-81.

· Vidhi Chaudhary, Radha Prasanna, Vishal Gupta, Shashi

Bala Singh, Chitra Natarajan and Lata Nain (2010)

Development of microtitre plate based assay for evaluation

of fungicidal potential and microscopic analyses of

cyanobacterial metabolites with fungal mycelia. Archives of

Phytopathology and Plant Protection 43: 1435-1444.

· Vishal Gupta, Radha Prasanna, Chitra Natarajan, Ashish

Kumar Srivastava and Jitender Sharma (2010). Identification,

characterization and regulation of novel antifungal

chitosanase (cho) in Anabaena fertilissima. Applied and

Environmental Microbiology 76: 2769-2777.

Seminar, Symposia and Conferences attendedth th· 51 Annual Conference of AMI), 14-17 December 2010.

BITS, Mesra, Ranchi.

LPSomics : Characterization of lipolysaccharide (LPS) biosynthetic gene clusters in xanthomonad pathogensof plants

Rationale

Lipolysaccharides (LPS) are an important constituent of the

outer membranes of gram negative bacteria. In pathogenic

bacteria, LPS is required for virulence and at the same time has

been shown to be a potent inducer of the innate immune systems

of animal and plant hosts. In animal pathogenic bacteria,

considerable variation is found at LPS biosynthetic genes clusters

(at the species level), and this variation has been attributed to help

in evading the host innate immune system. The genus

xanthomonas includes a group of gram negative bacteria that

cause more than 300 different plant diseases. We had previously

reported that variation in LPS biosynthetic gene clusters is found

in the xanthomonad group of plant pathogens at the level of the

genus, species and pathovar. This LPS locus is present between

two conserved house keeping genes, metB (involved in

methionine biosynthesis) and etfA (involved in electron

transport). In particular, we have described an interesting

example of interstrain variation in lipopolysaccharide (LPS)

PI : Ramesh V. SontiCo PI : Hitendra Kumar PatelCentre for Cellular and Molecular Biology, Hyderabad

biosynthetic gene clusters in Xoo. The vast majority of Xoo strains

in India and Asia have an LPS gene cluster (called BXO1 type of

gene cluster) that is ~13 kb in length. Mutations in genes encoded

within this locus lead to loss of LPS and extracellular

polysaccharide (EPS) production as well as virulence deficiency.

A variant LPS gene cluster was found in a Xoo strain called BXO8.

This locus is ~24 kb long and encodes 15 genes that are arranged in

two convergently transcribed units. This project is aimed at

characterizing the LPS gene cluster of the BXO8 strain through

mutational analysis, assessing variation in LPS gene clusters in

X a n t h o m o n a d s ( i n c l u d i n g X a n t h o m o n a s a n d

Stenotrophomonas) and to assess rice defense responses to

treatment with Xanthomonas LPS.

Objectives

· Characterize the variant LPS gene cluster in Xanthomonas

oryzae pv. oryzae (Xoo) strain BXO8, an unusual pathotype of

this rice pathogen.


100

· Assess extent of LPS gene cluster variation in the related

Stenotrophomonas sp. including plant endophytes and

determine the relationships, if any between, the LPS gene

clusters of Xanthomonas and Stenotrophomonas strains.

· Examine plant (rice) responses to treatment with Xoo LPS.

· Identify new LPS gene clusters in plant pathogenic

xanthomonads.


· Out of 50 Indian Xoo strains, belonging to 11 different

pathotypes (provided to us by BAYER India Ltd), 10 strains

were found to have the BXO8 type of LPS gene cluster.

· DNA fingerprinting of these 50 strains, using Southern

hybridizations with a multi-locus RFLP probe (a Xoo IS

element), was done and a dendrogram was prepared to

assess their phytogenetic relationships.

· The most basal strain in the dendrogram has the BXO8 type

of LPS cluster suggesting that the ancestral strain of Xoo has a

BXO8 type of LPS cluster.

· A horizontal gene transfer event introduced the BXO1 (or

canonical) LPS gene cluster into the ancestor of most Indian

strains of Xoo.

· An additional HGT event occurred that re-introduced the

BXO8 type of LPS into a lineage which includes strains that

belong to pathotypes 6, 7 and 8 that are characterized by

compatibility to the xa13 disease resistance gene of rice.

· Additional HGT events occurred at multiple branchpoints in

this lineage, each of which re-introduced the BXO1 type of

LPS gene cluster and led to replacement of the BXO8 type of

LPS gene cluster.

· One of these sub-lineages is primarily comprised of strains

that belong to Xoo pathotypes 3, 4 and 5 that are incompatible

with the xa13 disease resistance gene.

Conclusion

The BXO8 LPS gene cluster appears to be the ancestral LPS

gene cluster for Indian Xoo strains. Multiple HGT events have

occurred at the LPS gene cluster within Indian Xoo strains. The

majority of these HGT events have lead to replacement of the

BXO8 LPS gene cluster with the BXO1 type of LPS gene cluster.

The BXO1 type of LPS gene cluster is either more mobile than the

BXO8 LPS gene cluster or the Xoo strains that have this LPS cluster

have a selective advantage as compared to strains that have the

BXO8 type of LPS cluster.

Cloning and characterization of insecticidal crystal protein (cry) gene from the local isolates of Bacillus

thuringiensis

Rationale

Climate driven emergence of new plant pests and diseases is

of concern- Emerging pests are often plant pests of related species

known as “new encounter” pests, which come into contact with

new hosts that do not necessarily have an appropriate level of

resistance, or are plant pests introduced without their biological

control agents (in particular, insect pests, nematodes and

weeds).There are an estimated 67,000 pest species worldwide that

damage agricultural crops, of which approximately 9,000 species

are insects and mites. Sustainable control of insects in agriculture

is very important since it was estimated that chemical control cost

7500 million dollars. In addition, the use of synthetic insecticides

is not recommended because of the long residual action and

toxicity to a wide spectrum of organisms, including human.

Consequently, interest has developed in the use of alternative

strategies for biological control, such as Bacillus thuringiensis. The

soil bacterium B. thuringiensis Berliner fulfils the requisites of a

microbiological control agent against agricultural pests and

vectors of diseases that lead to its widespread commercial

application. The interest in this microorganism relies on its

forthcoming potential as an economic, effective species-specific

and environmentally safe pesticide. The implications of our

studies are important for new design of -endotoxins that

overcome insect resistance to these toxins and for altered or

improved insecticidal activity, as has been achieved in other Cry

proteins. The discovery of novel B. thuringiensis toxins is likely to

continue at least into the near future. Continued analysis of the

molecular basis of toxin action including studies of insect

specificity, of insect resistance to Cry toxins and of the role of

PI : R. AsokanCo PI : Pious ThomasIndian Institute of Horticultural Research, Bangalore

receptor molecules in toxicity will provide new ways for a rational

design of Cry toxins to control insect pests important in

agriculture or in human health. Such developments will extend

the useful life span of this technology.

Objectives

· Collection of soil samples from different agro-ecological

zones of India.

· Isolation, enumeration of Bacillus thuringiensis.

· Molecular Characterization of the B.thuringiensis isolates.

· Cloning & toxicity of coleopteran active cry genes.


· During the year (2010-11), Soil samples collected from

Manipur, Nicobar Islands and Andra Pradesh states were

used for isolation of Bt strains.

· SDS-PAGE analysis of the all the Bacillus thuringiensis isolates

was done.

· Coleopteran active genes viz., cry9Da1, cry22A, cry23A, cry43

and cry43B (Newly primers have been designed and used for

the screening of the potential isolates). Among which cry9Da1/Db (NCBI accessions – 6), cry22A (NCBI accessions-5),

cry23 and cry28 (NCBI accessions-2) cry7Ab (NCBI accessions-

28), cry1F (NCBI accessions-6) genes successfully isolated,

cloned and sequenced. Remaining other cry genes screening

is in progress.

· Successfully cloned and sequenced Nematode active cry

genes (cry5, cry6, cry12, cry13, cry14 and cry21)-cry5A/5B

(NCBI accessions -24); cry6 (NCBI accessions-12) and active

101


against sucking pests. cry4A (NCBI accession-26); cry1Ab

(NCBI accessions-20), respectively.

Conclusion

In conclusion, although many Bt toxins have already been

isolated, the cloning of additional novel cry genes continues to

benefit the further development of Cry proteins as competitive

biological insecticides. Studies on isolation of full length gene,

cloning and characterization, recombinant protein production of

cry genes and toxicity studies on different order of insect pests

from these new isolates of Bt will be useful to open new vistas in

the area of integrated pest management for sustainable

agriculture.


· H.M.Mahadeva Swamy, R. Asokan, D. K.Arora, S. N.

Nagesha and Ajanta Birah (2011) Cloning, Characterization

and Diversity of Coleopteran Active Bacillus thuringiensis

Native Isolates From Soils of Andaman and Nicobar Islands

(Editorially accepted BMC Research notes).

· R. Asokan, H.M.Mahadeva Swamy and D.K.Arora (2011)

Screening and partial sequence comparison of vegetative

insecticidal protein (vip3A) genes in the local isolates of

Bacillus thuringiensis Berliner (Editorially accepted BMC

Research notes).

Polyacrylamide gel electrophoretic pattern of total proteins of Sporulated Bt


102


Microbial Genomic Resource Repository

Rationale

Microbes play a critical role in natural biogeochemical cycles

and make up about 60% of the Earth's biomass, yet less than 1% of

microbial species have been identified. Microbes have been found

surviving and thriving in amazing diverse habitats, in extremes of

heat, cold, radiation, pressure, salinity, and acidity, often where

no other life forms could exist. There is a growing interest in the

preservation of DNA. Many research institute/universities all

over the world are carrying out microbiological and

biotechnological research, which results to generate lot of

genomic resources like cDNA libraries, gene constructs, cloned

gene sequences, promoter regions, transgenes etc. These are

valuable resources for gene discovery and transgenic product

development. Hence collection and maintenance of these

genomic resources at a central place would play a vital role in

bioscience research and education. Indian Council of Agricultural

Research has taken up an initiation to establish Microbial

Genomic Resource Repository at National Bureau of

Agriculturally Important Microorganisms (NBAIM), Mau Nath

Bhanjan. “Microbial Genomic Resource Repository” is a facility

that preserves and conserves the genetic material of

microorganisms, maintained in selected hosts or cloned and

maintained in plasmids, accompanying the data details. MGRR

has developed the guidelines for preservation, maintenance and

distribution of the DNA resources.

Objectives

· Nationwide Survey and Collection of Information about the

genetic resources/DNA.

· D e v e l o p m e n t o f l i n k a g e s b e t w e e n r e s e a r c h

institutions/Universities, and researchers.

· Technology and Protocols development for isolation and

long-term preservation of the Microbial Genetic Resources.

· T e c h n o l o g y a n d P r o t o c o l s d e v e l o p m e n t f o r

collection/transportation of microbial samples.

· Development of infrastructure facilities for the preservation

and maintenance of genetic recourses.

· Collection of environmental samples from different Agro

climatic Regions and exploration of non-culturable

microorganisms.

· Development of Databases/Information Bank for Microbial

Genomic Resources.

· Documentation and electronic cataloguing of Microbial

Genetic Resources.

· Exploration of non-culturable microorganisms and direct

PI : Dilip K. AroraCo PIs : Alok K. Srivastava, Sudheer Kumar, Mahesh Yandigeri, K. K. MeenaNational Bureau of Agriculturally Important Microorganisms, Mau

DNA isolations from environmental samples.

· Development and implementation of genome projects to

explore non-culturable microorganisms.


· In a short period of time MGRR has enriched its gene bank

with various vectors like cloning, gene silencing GFP, RFP,

YFP. These vectors are now available in MGRR gene bank.

Other than that, MGRR has a very rich microbial genomic

DNA bank, where around 1691 DNA of various bacteria and

fungi has been preserved at -20°C.

· For performing various research activities, MGRR has

equipped with state of art instrument like GSFLX Genome

Sequencer, Confocal Laser Microscope, Automatic culture

media preparatory, Robotic DNA Extractor, Gene Analyzer,

Pulse Field Gel Electrophoresis, Growth Kinetics Analyzer,

Gene Pulser, Barcoding System, Automated Electrophoresis,

Ultra Centrifuge, Thermal Cyclers.

Conclusion

In a short period of time, MGRR DNA bank has collected and

preserved a large number of microbial genomic resources. MGRR

will collaborate with various institutions working in this field for

collection and preservation of genomic resources. It will also

provide necessary research material for an active research study.

A database library of anonymous microbial information will be

built at MGRR which can provide clues for various research

investigations.


· Sukumar Mesapogu, Achala Bakshi, Udai B. Singh, B. K.

Babu, Sangeeta Saxena and Dilip K. Arora. (2011). Genetic

markers in detection of variations among Indian isolates of thFusarium udum infecting Pigeonpea. 15 ADNAT

Convention CCMB, Hyderabad, February 23-25.

·

·

·

·

Singh RN, Srivastava AK, Arora DK (2011) Diversity of

psychrophiles of leh glaciers: a molecular approach, 4th

Congress of European Microbiologists Geneva, Switzerland

Singh RN, Srivastava AK, Arora DK (2011) Characterization

of Exiguobacterium isolated from permafrost of himalayan

glacier, 4th Congress of European Microbiologists Geneva,

Switzerland

Singh RN, Srivastava AK, Arora DK (2011) Analysis of

Khardoong La Soil Metagenome, 4th Congress of European

Microbiologists Geneva, Switzerland

Singh RN, Shahi P, Sharma A, Kaushik R, Srivastava AK, and

Arora D K (2010) Genome-wide prediction and comparison

103



of ncRNAs in Mesohizobium loti, Rhizobium leguminosarum

and Sinorhizobium meliloti, The Non-Coding Genome,

EMBL Advanced Training Centre, Heidelberg, Germany,

October 13-16, 2010

Singh RN, Singh RP, Srivastava AK, and Arora DK (2010)

CHUMATHANG: Unexplored habitat of novel

thermophiles, Association of Microbiologist of India, Ranchi,

December 14-17, 2010

·

· Mahesh Yandigiri, Sukumar Mesapogu, Arvind Yadav and

D. K. Arora. (2010). Microbial Culture Banks: Custodian of

Real Natural Wealth. National Conference on Biodiversity,

Development and Poverty Alleviation, Uttar Pradesh State

ndBiodiversity Board, India. 22 May, 2010.

· Achala Bakshi, Sukumar M and Dilip K. Arora. (2010). Soil

Microbial Community Analysis from Rhizospheric and

norhizospheric regions of different leguminous crops by

using Community-Level Physiological Profiling (CLPP).

International Conference on Genomic Sciences-Recent

Trends. Madurai Kamraj University, India.

· Sukumar. M and Dilip K. Arora (2009). Real Time SYBR

Green PCR for Rapid Detection and Quantification of

Fusarium udum by using Species specific Primers.

International Mycological Conference 2009 (IMC-09),

Edinburg, UK, 1-6 Aug 2010. Springer link.

Resource Type

Available Resources

Quantity

Plasmid

Binary, cloning, Gene silencing, GFP, RFP, YFP Expression 71

Genomic DNA

Bacteria and Fungi

1691

Primers and Probes Various gene sequences 92

Shot gun library clones Environmental samples 138 Whole genome shotgun library Mesorhizobium ciceri ca181 6720 Shotgun library Nif H 16 Host cells

DH5a, XL1

Blue, JM107, JM109, K12, TOP-10 F

6

Summary of available Genomic Resources at MGRR.


104


Objective

· To train scientists/researchers/technicians/farmers for the

exploration and application of microorganism in agriculture.


In the year 2010-11 following training was organized:

· Metagenomics: Method and Applications in Microbiology from January 11-20, 2011.

Microorganisms are responsible for sustaining life on Earth

but how they do so is still poorly understood. The readily cultured

microorganisms represent only 0.1% to 1% of the total microbial

communities present in most habitats. Until the advent of

metagenomics tools, which allow the investigation of

microorganisms that cannot be cultured in the laboratory, we

were unable to study the entire genetic makeup from particular

environments, thereby losing a fruitful source of microbial

biodiversity and functional novelties. Within microbial

communities, the microbes harbor an excellent repertoire of novel

genes for biotechnological applications and represent a key step

for understanding evolution and to comprehend metabolic

pathways. The training provided invaluable opportunities to

discuss and accelerate the implementation of metagenomic

research, it included hands on training microbial ecology,

genomics, bioinformatics, community genomics and

environmental genomics. Metagenomics is a rapidly growing

field of research that has had a dramatic effect on the way we view

and study the microbial world. By permitting the direct

investigation of bacteria, viruses and fungi irrespective of their

culturability and taxonomic identities, metagenomics has

changed microbiological theory and methods and has also

challenged the classical concept of species. This new field of

PI :National Bureau of Agriculturally Important Microorganisms, Mau

Dilip K. Arora

biology has proven to be rich and comprehensive and is making

important contributions in many areas including ecology,

biodiversity, bioremediation and bioprospection of natural

products. Recent, rapid advances in sequencing technologies and

in culture-independent genomic analysis and other microbiology

techniques have established a solid foundation upon which to

build a unique interdisciplinary community for the emerging

scientific subfield of metagenomics. At the intersection of many

diverse disciplines, metagenomics is already beginning to engage

an ever growing and exceptionally wide intellectual community.

The major point discussed under the training were

§ Functional diversity of environmental samples of any

metagenome

§ Community based comparative profiling of metagenome

§ Undepining fundamental rules of microbial ecology

adapting to environmental conditions.

§ The training provided invaluable opportunities to discuss

and accelerate the implementation of metagenomic research,

including hands on training on microbial ecology, genomics,

bioinformatics, community genomics and environmental

genomics. Demos and/or tutorials on advances in next

generation sequencing and on knowledgebase resources was

also provided.

The training covered the bioinformatic approaches and tools under the following thematic areas:

· Microbial Diversity and Community analysis

· Designing of primers and validation

· Cloning, screening and restriction analysis of meta clones

· Molecular phylogeny

105



· In silico restriction analysis

· Multiple sequence alignment

· Construction of phylogenetic tree

· Sequencing and sequence analysis

· Bioprospecting, allele mining and quantification of gene

· Annotation of genes

· Comparative genomics

Benefits to participants

· Participants acquire an insight of the culture-independent

Microbial genomic analysis and other molecular techniques,

innovative tools in microbial identification and genome

analysis

· Hands-on research experience and training and exposure to

cutting-edge research.

· Gained better understanding of the scientific process and the

application of the knowledge gained from basic science

research and state of the art techniques to solve complex

problems in microbial community analysis at molecular

level.

· Participants get an understanding of latest bioinformatics

tools.


106

Name of the PIs working at different AMAAS Centers


Dilip K. Arora

A. R. Alagawadi

D. Girija

L. C. Rai

T. K. Adhya

T. C. Santiago

Dinesh Kumar

R. C. Upadhyay

K. K. Pal

Gaurav Rathore

Kiran Singh

Rajesh Gera

V. K. Shahi

Ratul Saikia

B. N. Chakraborty

O. N. Tiwari

Ashok Kumar

Bhim Pratap Singh

Krishna Kumar

D. Radhakrishna

N. K. Maiti

S. K. Gosal

Imelda Joseph

R. D. Rai

Sri Prakash Mohanty

R. Srinivasan

Theme 2: Nutrient Management, PGPR, Antagonist, Biocontrol Agent and Disease Management

Dilip K. Arora

D. L. N. Rao

Suseelendra Desai

Pankaj Mishra

M. Anandraj

George V. Thomas

B. Ramanujam

Lata

T. K. Adhya

K. S. Subramanian

S. Gopalakrishnan

M. Lognathan

M. L. Jeeva

Mohan Singh

R. D. Prasad

Indu S. Sawant

K. K. Vijayan

Sanjib Kumar Manna

P. Thomas

Alok K. Srivastava

Sudheer Kumar

Theme 3: Microbial Management of Agro waste, Bioremediation, Microbes in Post Harvest and Processing

Dilip K. Arora

Lata

Rup Lal

B. Vijay

H. S. Oberoi

T. K. Adhya

C. S. Purushothaman

P. K. Joshi

S. Alavandi

Sudheer Singh

S. Gunasekaran

Neelima Garg

Theme 4: Microbial Management of Abiotic Stress

Dilip K. Arora

A. R. Alagawadi

Minakshi Grover

Pankaj Mishra

Mahesh Yandigeri


Dilip K. Arora

Reeta Goel

Major Singh

K. V. Bhat

P. Gunasekharan

N. K. Singh

Radha Prasanna

Ramesh V. Sonti

R. Asokan

Theme 6: Microbial Genomics Resource Repository

Dilip K. Arora

Theme 7: Nodal Center

Dilip K. Arora

107


Name of the Institute/ Project Directorate/ SAU Coordinating the Project


Theme 2: Nutrient Management, PGPR and Biocontrol

1. Nat iona l Bureau o f Agr icu l tura l ly Important

Microorganisms, Mau

2. Department of Agricultural Microbiology, University of

Agricultural Sciences, Dharwad

3. Kerala Agricultural University, Thrissur, Kerala

4. Department of Botany, Banaras Hindu University, Varanasi

5. Central Rice Research Institute, Cuttack , Orissa

6. Central Institute of Brackish Water Aquaculture, Chennai

7. National Dairy Research Institute, Karnal

8. National Research Center for Mushroom, Solan, Himachal

Pradesh

9. National Research Centre for Groundnut, Junagadh,Gujarat

10. National Bureau of Fish Genetic Resources, Lucknow

11. Maulana Azad National Institute of Technology, Bhopal

12. Department of Microbiology, Chaudhary Charan Singh

Haryana Agricultural University, Hissar, Haryana

13. Govind Ballabh Pant University of Agriculture and

Techanology, Pantnagar, Uttarakhand

14. Rajendra Agricultural University, Pusa, Samatipur, Bihar

15. North East Institute of Science & Technology (CSIR), Jorhat,

Assam

16. Department of Botany, University of North Bengal, North

Bengal

17. Institute of Bioresources and Sustainable Development,

Imphal, Manipur

18. School of Biotechnology, Banaras Hindu University,

Varanasi

19. Mizoram University, Aizwal, Mizoram

20. Central Agricultural Research Institute, Port Blair, Andaman

& Nikobar

21. University of Agricultural Sciences, Gandhi Krishi Vignyan

Kendra, Bangalore

22. Central Institute of Freshwater Aquaculture, Bhubaneshwar

23. Punjab Agricultural University, Ludhiana

24. Central Marine Fisheries Research Institute, Ernakulam,

Kochi, Kerala

25. Division of Biochemistry, Indian Agricultural Research

Institute, New Delhi

26. Central Institute of Freshwater Aquaculture, Bhubaneshwar

27. College of Dairy & Food Science Technology, Maharana

Pratap University, Udaipur

1. Indian Institute of Soil Science, Nabi Bagh, Bhopal

2. Central Research Institute for Dryland Agriculture,

Hyderabad

3. Vivekananda Parvatiya Krishi Anusandhan Sansthan,

Almora

4. Indian Institute of Spice Research, Calicut, Kerala

5. Central Plantation Crops Research Institute, Kasaragod,

Kerala


Microorganisms, Mau

7. National Bureau of Agriculturally Important Insects,

Bangalore

8. Division of Microbiology, Indian Agricultural Research


9. Central Rice Research Institute, Cuttack, Orissa

10. Tamil Nadu Agricultural University, Coimbatore

11. International Crops Research Institute for the Semi-Arid

Tropics, Patancheru, Andhra Pradesh

12. Indian Institute of Vegetable Research, Varanasi

13. C e n t r a l T u b e r C r o p s R e s e a r c h I n s t i t u t e ,

Thiruvananthapuram

14. Indian Institute of Pulses Research, Kanpur

15. Directorate of Oilseeds Research, Rajendranagar,

Hyderabad

16. National Research Centre for Grapes, Pune, Maharashtra

17. Central Marine Fisheries Research Institute, Kerala

18. Central Inland Fisheries Research Institute, Barrackpore

19. Indian Institute of Horticulture Research, Bangalore

20. Central Plantation Crops Research Institute, Kasargod

1. Division of Microbiology, Indian Agricultural Research,



Microorganisms, Mau

3. Department of Zoology, University of Delhi, Delhi

4. National Research Center for Mushroom, Solan

5. Central Institute of Post Harvest Engineering and

Technology, Ludhiana

6. Central Rice Research Institute, Cuttack , Orissa

7. Central Institute of Fisheries Education, Mumbai

8. Central Soil Salinity Research Institute, Zarifa farm, Karnal

9. Central Institute of Brackishwater Aquaculture, Chennai


11. Department of Agricultural Microbiology, Tamil Nadu

Agricultural University, Coimbatore

12. Central Institute for Subtropical Horticulture, Lucknow

Theme 3: Agrowaste management, Bioremediation and microbes in PHT


108

Theme 4: Microbial Management of Abiotic Stress



Microorganisms, Mau

2. Department of Agricultural Microbiology, University of

Agricultural Sciences, Dharwad

3. Central Research Institute for Dryland Agriculture,

Hyderabad

4. Vivekananda Parvatiya Krishi Anusandhan Sanstha,

Almora


Microorganisms, Mau

2. Department of Microbiology, Govind Ballabh Pant

University of Agriculture and Techanology, Pantnagar,

Uttarakhand


4. National Research Center for DNA Fingerprinting, National

Bureau of Plant Genetic Resources, New Delhi

5. Madurai Kamaraj University, Madurai, Tamilnadu

6. National Research Center on Plant Biotechnology, Indian

Agricultural Research, Institute, New Delhi

7. Division of Microbiology, Indian Agricultural Research,


8. Centre for Cellular and Molecular Biology, Hyderabad

9. Indian Institute of Horticulture Research, Bangalore,

Karnataka


Microorganisms, Mau


Microorganisms, Mau

Theme 6: Human Resource Development

Theme 7: Microbial Genomics Resource Repository

109


icar networking project on “application of microorganisms

Documents