heterologous expression and extracellular secretion of...
TRANSCRIPT
![Page 1: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/1.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
1
Heterologous Expression and Extracellular Secretion of 1
Cellulolytic Enzymes in Zymomonas mobilis 2
3
Jeffrey G. Linger1, William S. Adney
2, Al Darzins
1* 4
1National Bioenergy Center,
2 Chemical and Biosciences Center, National Renewable 5
Energy Laboratory, 1617 Cole Blvd, Golden, CO 80401. 6
7
Running Title: Expression and Secretion of Cellulases in Z. mobilis 8
9
* Corresponding Author. Mailing Address: National Renewable Energy 10
Laboratory, 1617 Cole Blvd, Golden, CO 80401. Phone: (303) 384-7757. Email: 11
13
14
15
Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.00230-10 AEM Accepts, published online ahead of print on 6 August 2010
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 2: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/2.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
2
Abstract 16
Development of the strategy known as consolidated bioprocessing (CBP) involves the 17
use of a single microorganism to convert pretreated lignocellulosic biomass to ethanol 18
through the simultaneous production of saccharolytic enzymes and fermentation of the 19
liberated monomeric sugars. In this report, the initial steps towards achieving this goal in 20
the fermentation host Zymomonas mobilis were investigated by expressing heterologous 21
cellulases, and subsequently examining the potential to secrete these cellulases 22
extracellularly. Numerous strains of Z. mobilis were found to possess endogenous 23
extracellular activities against carboxymethyl cellulose, suggesting that this 24
microorganism may harbor a favorable environment for the production of additional 25
cellulolytic enzymes. The heterologous expression of two cellulolytic enzymes, E1 and 26
GH12 from Acidothermus cellulolyticus, was examined. Both proteins were successfully 27
expressed as soluble, active enzymes in Z. mobilis although to different levels. While E1 28
was less abundantly expressed, the GH12 enzyme comprised as much as 4.6% of the total 29
cell protein. Additionally, fusing predicted secretion signals native to Z. mobilis to the N-30
termini of E1 and GH12 was found to direct the extracellular secretion of significant 31
levels of active E1 and GH12 enzymes The sub-cellular localization of the intracellular 32
pools of cellulases revealed that a significant portion of both the E1 and GH12 secretion 33
constructs resided in the periplasmic space. Our results strongly suggest that Z. mobilis 34
is capable of supporting the expression and secretion of high levels of cellulases relevant 35
to biofuels production, thereby serving as a foundation for developing Z. mobilis into a 36
CBP platform organism. 37
38
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 3: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/3.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
3
Introduction 39
The biological conversion of lignocellulosic biomass to ethanol potentially 40
represents a major source of future domestic transportation fuels yet the current cost of 41
converting biomass to fermentable sugars still needs to be further reduced (12). Most 42
current strategies for ethanol production via biochemical conversion of lignocellulosic 43
feedstocks utilize simultaneous saccharification and fermentation (SSF) or simultaneous 44
saccharification and co-fermentation (SSCF) processes (8, 21, 22). The process 45
configuration known as consolidated bioprocessing [CBP; (20)] would alleviate the 46
financial strain of producing saccharolytic enzyme cocktails by combining the necessary 47
steps for ethanol production, as an action of one microorganism. 48
A particularly attractive microbial candidate for the development of a CBP 49
microorganism is the gram-negative fermentative bacterium, Zymomonas mobilis. Z. 50
mobilis has been studied for its exceptionally high ethanol production rate, yield, and 51
tolerance to the toxicity of the final product (15-17, 20, 31-33, 35, 43). In addition, Z. 52
mobilis has the ability to ferment sugars at low pH, and has a naturally high tolerance to 53
many of the inhibitory compounds found in lignocellulosic-derived hydrolysates (46, 47) 54
Furthermore, the use of the Entner-Doudoroff pathway (37) allows Z. mobilis to achieve 55
the near-theoretical maximum ethanol yields during fermentation while achieving 56
relatively low biomass formation. Accordingly, Z. mobilis has been used successfully in 57
SSF and SSCF processes (14, 24, 36). Additionally, Z. mobilis has been successfully 58
engineered to ferment the pentose (C5) sugars, xylose (45) and arabinose (10). 59
A necessary prerequisite to establishing Z. mobilis as a CBP host is the ability to 60
achieve high levels of cellulolytic enzyme expression. However, there is not yet a strong 61
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 4: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/4.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
4
consensus on how to achieve maximal heterologous protein expression in Z. mobilis. 62
Multiple groups have attempted heterologous expression of numerous genes including 63
cellulolytic enzymes in Z. mobilis with varying degrees of success (6, 7, 9, 19, 27, 42, 64
44). Unfortunately, there are no obvious correlations between the expression strategies 65
employed compared to the results obtained. Intriguingly, however, when researchers 66
used the tac promoter (Ptac) to drive expression of native Z. mobilis genes they were able 67
to express several genes to extremely high levels (2). The results from this previous 68
study suggest that while the potential to achieve high levels of heterologous cellulase 69
expression in Z. mobilis certainly exists, the ability to do so on a consistent basis will 70
need further investigation. 71
While achieving high-level expression of cellulases is an important hurdle to 72
overcome in the development of the CBP technology, it is imperative that these enzymes 73
additionally be translocated to the extracellular medium in order to directly contact the 74
lignocellulosic substrate. The most obvious means by which to achieve this translocation 75
is by harnessing the host cell’s protein secretion apparatus. There is, however, in general, 76
very little fundamental knowledge regarding the capacity of Z. mobilis to secrete proteins. 77
There is only one account to our knowledge of fusing secretion signals native to Z. 78
mobilis onto proteins from exogenous sources, where extracellular secretion of a 79
recombinant β-glucosidase reached only 11% of the total amount of enzyme synthesized 80
(43). 81
We initially report the finding that several Z. mobilis strains natively produce an 82
endogenous activity against carboxymethyl cellulose (CMC), and that this activity can be 83
detected extracellularly. Together, these results suggest that Z. mobilis may be adept at 84
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 5: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/5.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
5
producing and secreting cellulolytic enzymes, and as this attribute is essential for a CBP 85
organism, Z. mobilis serves as an ideal candidate for further investigation. 86
We next describe the expression of two cellulolytic enzymes (E1 and GH12) in 87
both E. coli and Z. mobilis. “E1” (locus tag: Acel_0614) and “GH12” (locus tag: 88
Acel_0619) are both from the acidothermophile Acidothermus cellulolyticus and are 89
representative of families 5 and 12 glycoside hydrolases, respectively (U.S. Patents 90
5536655 and 7059993). E1 is an endo-1,4-β-glucanase, and GH12 is an uncharacterized 91
enzyme that has a very high sequence identity to the GH12 domain of GuxA (Acel_0615) 92
from A. cellulolyticus. GuxA has activities against a wide variety of substrates including 93
carboxymethyl cellulose, arabinoxylan, xylan and xyloglucan (unpublished results, 94
William Adney). While GH12 has yet to be fully characterized, we used homology 95
modeling (3) to predict the enzyme class of GH12 and found that it strongly resembles an 96
endo-1,4-β-glucanase. These enzymes were chosen because of their relatively small 97
molecular weight, high stability and activity over a broad temperature and pH range using 98
only the catalytic domains (unpublished results, William Adney). We report the 99
successful expression of both enzymes in Z. mobilis by addressing several variables 100
related to gene expression. Additionally, the use of codon optimization was explored as a 101
way of enhancing heterologous expression in Z. mobilis. After successfully 102
demonstrating the intracellular expression of E1 and GH12 in Z. mobilis, we further show 103
that Z. mobilis is capable of secreting these proteins extracellularly through the use of 104
native secretion signals predicted to utilize two separate protein translocation pathways in 105
Z. mobilis the SecB-dependent and Twin Arginine Translocation (TAT) pathways. This 106
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 6: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/6.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
6
finding should prove valuable beyond the production of cellulases and could include all 107
classes of recombinant proteins. 108
109
Materials & Methods 110
Strains, media and growth conditions 111
Z. mobilis strains 39676 (ATCC), ZM4 (ATCC 31821) and CP4 (41) were routinely 112
grown in RMG medium (w/v 1% yeast extract, 0.2% KH2PO4, 2% glucose, and for 113
plates: 1.5% Bactoagar) at 30°C, and shaken at 120RPM. Where applicable, tetracycline 114
was added to a final concentration of 20 µg/mL for plates and 10 µg/mL for liquid 115
culture. 116
117
Z. mobilis transformations 118
The transformation protocol was adapted from Deanda et al. (10). 3-5 µg of plasmid 119
DNA was used to transform approximately 1010
cells per mL of Z. mobilis in 100 µL of 120
10% glycerol. A Biorad Gene Pulser was used with the following conditions: 200 Ω, 25 121
µF, and 1.6 kV in a 0.1 cm cuvette. Following electroporation, 1mL of mating medium 122
(50 g/L Glucose, 10g/L Yeast Extract, 5g/L Tryptone, 2.5g/L (NH4)2SO4, and 0.2g/L 123
K2HPO4, and 1mM MgSO4) was added to the cells then incubated at 30°C for at least 6 124
hours. 100-200µL of cells were then plated onto mating medium agar plates (without 125
MgSO4) supplemented with 20 µg/mL tetracycline and incubated at 30°C for 2-3 days 126
anaerobically. Positive transformants were identified by NotI-restriciton digestion of 127
purified plasmid DNA. 128
129
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 7: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/7.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
7
Gene synthesis, codon optimization and plasmid construction 130
The coding sequences of the catalytic domains of E1and GH12 from A. cellulolyticus 131
were codon optimized using Gene Designer (39) based on the codon bias of Z. mobilis 132
strain ZM4, and synthesized by DNA 2.0 (Menlo Park, CA). 133
Plasmids 134
Schematics of all plasmids used in this study are shown in Table I. All plasmids 135
have been sequence-verified and the Genbank accession numbers associated with novel 136
sequences are listed below. Using standard overlap PCR techniques, the gap promoter 137
region from Z. mobilis genomic DNA (ATCC strain 39676) was fused to the T7 138
terminator region from plasmid pET101/D-topo (Invitrogen, Carlsbad CA) separated by a 139
NotI restriction site to create plasmid pJL100. 140
To create plasmids pJL101 and pJL103, PCR products representing coding 141
sequences for E1 and GH12 were cloned into pFLAG-CTC (Sigma-Aldrich, St. Louis, 142
MO). A. cellulolyticus genomic DNA was used as the PCR template for the E1 and 143
GH12 coding sequences for plasmids pJL101 and pJL103. pJL101 encodes for the first 144
274 amino acid residues of GH12 while pJL103 encodes for amino acid residues 42-404 145
of E1. 146
Plasmids p25143 and p25144 were codon-optimized, synthesized, and sub-cloned 147
by DNA 2.0 (Menlo Park, CA) and encode the amino acid residues 42-422 of E1 and 148
amino acid residues 35-274 of GH12, both lacking the predicted native signal peptide. 149
These sequences entail the catalytic domains and are lacking the cellulose binding 150
domains (CBM). These sequences were then subcloned into the NotI site of vector 151
pZB188 (46) to create plasmids p25143 and p25144, respectively. 152
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 8: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/8.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
8
Plasmid pJL110 was created by PCR amplifying the Z. mobilis strain 39676 pdc 153
gene including extended 5’ (75 base pairs) and 3’ (122 base pairs) non-coding sequences 154
with flanking NotI sequences incorporated. This PCR product was Topo-TA cloned into 155
pYES2.1 (Invitrogen, Carlsbad, CA) to create plasmid pYes2.1-PDC. The E1 gene was 156
PCR amplified using primers with homology to the 5’ and 3’ non-coding sequences of Z. 157
mobilis pdc.. Primer sequences were as follows with E1-specific nucleotides shown in 158
lower case and Z. mobilis pdc homology shown as upper case: Forward: 159
CCTGATTCAGACATAGTGTTTTGAATATATGGAGTAAGCAatgtgtggaattgtgagcgg, 160
Reverse: 161
GGACGGGCTTTTCGCCTTAAGCTCTAAGTTTATTTAAAAAttagcttggactgggactgg 162
Saccharomyces cerevisiae strain w303 was transformed with the resulting PCR product 163
as well as KpnI-linearized pYES2.1-E1. Through endogenous homologous 164
recombination in yeast, the Z. mobilis pdc ORF was exchanged with the E1 ORF on 165
plasmid pYes2.1-E1 to create plasmid pYES2.1-PDC-E1-PDC. The E1 fragment 166
containing the 5’ and 3’ sequences of pdc was excised with NotI and ligated into pZB188 167
to create plasmid pJL110. 168
To create plasmids pJL111 and pJL116 the sequence representing the predicted 169
secretion signal of the phoC gene (ZM0130, 170
ATGATAAAAGTCCCGCGGTTCATCTGTATGATCGCGCTTACATCCAGCGTTCT171
GGCAAGCGGCCTTTCTCAAAGCGTTTCAGCTCAT ) was fused to the 5’ termini of 172
E1 and GH12 genes, respectively. For plasmid pJL112, the predicted secretion signal of 173
the predicted Z. mobilis ORF ZM0331 174
(ATGAAAAGAAAGCTTGGTCGTCGCCAGTTATTAACTGGCTTTGTTGCCCTTG175
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 9: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/9.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
9
GCGGTATGGCGATTACAGCTGGTAAGGCGCAGGCTTCT) was fused to the 5’ 176
terminus of the E1 gene sequence. 177
178
179
Immunoblots and CMC zymogram analysis 180
Following SDS-PAGE, cellular proteins were transferred to a polyvinylidene 181
fluoride (PVDF) membrane at a constant 200V for one hour. A mouse monoclonal αE1 182
antibody diluted 1:4000 in 3% milk in Tris-Buffered Saline Tween-20 (TBST) was added 183
to the PVDF membranes which were allowed to incubate for 2 hours at room 184
temperature. After washing the membranes with TBST they were incubated in TBST 185
containing 3% milk and a goat-anti-mouse alkaline phosphatase conjugated secondary 186
antibody (diluted 1:4000) for 1 hour at room temperature. The protocol used to perform 187
the carboxymethyl cellulose (CMC) zymograms is described by (38), except the reaction 188
buffer used was 50mM sodium citrate buffer, pH 7.0. 189
190
Total and Extracellular Fraction Preparations 191
For each strain an equal volume of cell culture was moved into two separate 192
microcentrifuge tubes. In one of the replicates, the cells were removed by two rounds of 193
centrifugation (5 minutes 15000 X g each) to create the extracellular fraction. Equal 194
volumes of the culture with cells (Total) and the extracellular fraction were treated with 195
10X BugBuster lysis buffer (Novagen) to create a 1x concentration of lysis buffer. Lysis 196
buffer was added to the extracellular fraction to ensure that the presence or absence of 197
lysis buffer had no effect on the enzyme activity assays performed on these fractions. 198
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 10: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/10.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
10
Samples were vortexed and incubated at room temperature for 20 minutes. Samples were 199
centrifuged (5 minutes 15000 X g) and the supernatants were moved to a new tube. 200
201
Subcelluar Fractionations 202
Cultures of Z. mobilis (50mL) were grown to the beginning of stationary phase 203
and cells were centrifuged at 4000 X g for 10 minutes. Cells were resuspended in 204
periplasting buffer (200mM TRIS-HCL, pH 7.5, 20% Sucrose, 1mM EDTA, and 2.5 205
million units of Lysozyme (.00625g/5 mL; Sigma L-6876) at a volume corresponding to 206
4 mL/g of wet weight of the cell pellet. Multiple incubation times were tested 207
empirically to find the longest time point where no more than 5% of the ADH activity 208
was found within the periplasmic fraction (typically 5 minutes; ADH assay detailed 209
below). This was to ensure maximal release of periplasmic contents, while minimizing 210
contamination with cytoplasmic contents. Following the incubation in periplasting 211
buffer, ice-cold H2O was added to a volume corresponding to 6mL/g of wet weight of the 212
original cell pellet. Cells were incubated on ice for 10 minutes and then centrifuged at 213
4°C for 10 minutes at 4000 X g. The periplasmic fraction (supernatant) was transferred 214
to a new tube, and BugBuster HT lysis buffer (Novagen) was added to the cell pellet at a 215
volume corresponding to 10 mL/g wet weight of the original cell pellet. Following 216
vortexing to ensure complete resuspension, this lysing reaction was incubated for 20 217
minutes at room temperature and centrifuged for 5 minutes at 15000 X g. The resulting 218
supernatant represented the cytoplasmic fraction. 219
220
221
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 11: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/11.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
11
E1 and GH12 Activity Assays 222
Protein lysates (10 µL of whole cell lysates, periplasmic and cytoplasmic 223
fractions) were added to 90 µL of reaction buffer [50mM sodium citrate, pH 7.0, and 224
.00125g/5mL 4-methylumbelliferyl β-D-cellobiopyranoside (Sigma Aldrich)] in a 96 225
well microtiter plate. Reactions were incubated at 50°C for 30-60 minutes, and analyzed 226
for fluorescence using a BMG Labtech FLUOstar Omega with an excitation of 355nm, 227
and an emission of 460nm. Measurements were taken at multiple time points to ensure 228
fluorescence-detection was not saturated. Each lysate was created from individual 229
cultures independently at least three times, and each of those was run in triplicate on the 230
same microtiter plate. Assays were blanked against the average of three independent 231
mock reactions. For each experiment, the highest raw value average was set to one and 232
the remaining samples were normalized as a fraction of one. This was done for both the 233
whole cell lysates and the individual sub/extra-cellular fractions. 234
235
ADH assays 236
44 µL of 50mM sodium pyrophosphate, pH 8.8 was added to a 96-well microtiter 237
plate, followed by 2µL of either the periplasmic or cytoplasmic fractions prepared as 238
described above. 50.6 µL of 15mM β-nicotinamide adenine dinucleotide hydrate (Sigma 239
N7004) and 3.4 µL 95% ethanol were added to the wells. The absorbance at 340nm was 240
measured immediately and subsequently every 2 minutes for 14 minutes using a BMG 241
Labtech FLUOstar Omega. The ∆A340nm was calculated and the relative contribution of 242
the periplasmic and cytoplasmic fraction to the total rate was calculated to determine the 243
percent localization of ADH activity. 244
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 12: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/12.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
12
Growth curve analysis and doubling time calculations 245
The protocol used to analyze growth data was adapted from Franden et al. (11). 246
Logarithimically growing cultures were used to inoculate 200µL of RMG medium to an 247
OD600 of 0.05 in a 100-well honeycomb plate. Using a Bioscreen C MBR analyzer 248
(Growth Curves USA, Piscataway, NJ), turbidometric measurements were made using a 249
wide band filter (420-580nm) every 15 minutes for 24 hours with no agitation. Growth 250
rate constant measurements were taken from the early portion of logarithmic growth 251
(from OD420-580 ~0.1 to 0.3), using the following equation: Y=Xo-eµt
where Y is the 252
absorbance at time “t”, Xo is the initial absorbance (near OD420-580= 0.1) and µ is the 253
growth rate. Doubling times shown in the text of the Results section were calculated as 254
µ divided by the natural log of 2. Error measurements (+/-) represent one standard 255
deviation. 256
257
DNA sequence accession numbers 258
GenBank accession numbers for the following expression cassettes are given in 259
parentheses: p25143 (E1-Codon Optimized; HM595415), p25144 (Gh12-Codon 260
Optimized; HM595416), pJL111 (pTac-Z130-E1-T1T2: HM595412), pJL112 (pTac-261
Z331-E1- T1T2; HM595413), pJL116 (pTac-Z130-Gh12-T1T2; HM595416) 262
263
Results 264
265
Zymomonas mobilis has endogenous cellulolytic activities. 266
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 13: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/13.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
13
During the process of investigating cell lysates of Z. mobilis for carboxymethyl 267
cellulose (CMC) activity, it became clearly evident that all of the Z. mobilis strains used 268
in this study (i.e., 39676, ZM4, and CP4) demonstrated hydrolytic activity against the 269
CMC substrate. This activity manifested itself as two, closely spaced, yet distinct 270
molecular weight bands on zymograms (Figure 1A, B). The apparent size of these bands 271
(Figure 1B) are consistent with the predicted molecular weight of the Z. mobilis CelA 272
protein [37 kDa;(30)], suggesting that one (or both) of the bands may represent CelA. 273
Additionally, when grown on agar plates containing CMC Z. mobilis but not E. coli can 274
clearly hydrolyze the CMC as can be seen by the zones of clearing (Figure 1C). 275
Importantly, celA is the only annotated cellulolytic gene found within the published 276
genome of Z. mobilis (http://cmr.jcvi.org) providing further support that the CM-277
cellulolytic activity seen in Figure 1 is likely attributable to CelA. The finding that many 278
Z. mobilis strains naturally express and secrete at least one endogenous cellulase provides 279
support that Z. mobilis might prove adept at expressing and secreting heterologous 280
cellulases. 281
282
Intracellular expression of heterologous cellulolytic enzymes in E. coli and Z. 283
mobilis. 284
An altered codon bias between A. cellulolyticus and Z. mobilis could hinder the 285
successful expression of E1 and GH12 in Z. mobilis. Since there are no commercially 286
available codon-enhanced strains of Z. mobilis, the issue of codon bias was initially 287
addressed by using a codon-enhanced strain of E. coli. Separate plasmids containing Ptac-288
driven genes encoding the E1 and GH12 endoglucanases (Acel-0614 and Acel-0619, 289
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 14: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/14.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
14
respectively) from A. cellulolyticus were introduced into a strain of E. coli designed to 290
enhance the expression of heterologous proteins that contain codons rarely used in E. 291
coli. Figure 2 shows that while expression of E1 and GH12 was not detected upon IPTG 292
induction in E. coli BL21-DE3 cells, both proteins were strongly induced in the codon 293
enhanced Rosetta2 strain of E. coli (EMD; Madison, WI). This data strongly suggests 294
that the differential codon bias between the host organism (A. cellulolyticus) and the 295
expression organism (E. coli) could be a major barrier to heterologous expression in E. 296
coli. By inference, this may also suggest that differential codon usage between A. 297
cellulolyticus and Z. mobilis, may have a detrimental effect on the expression of E1 and 298
GH12 in Z. mobilis. 299
To test the effect that differential codon bias might have on gene expression, the 300
gene sequence encoding the E1 catalytic domain was codon optimized for Z. mobilis 301
(DNA 2.0; Menlo Park, CA) and the synthesized gene was tested for its expression in Z. 302
mobilis. The expression of the native and codon-optimized (version “E1-c/o”) gene 303
sequence of the E1 catalytic domain (“E1”) was examined in multiple strains of Z. 304
mobilis. Both E1 and E1-c/o can be detected using immunoblot and zymogram gel 305
analysis (Figure 3). Surprisingly, both constructs were expressed nearly equally as well in 306
Z. mobilis, though the native E1 protein might have been expressed slightly better than 307
E1-c/o (Figure 3B and 3C), when total protein loading is taken into account (Figure 3A). 308
The fact that the codon-optimized version of E1 did not express significantly better than 309
the native E1 coding sequence suggests that either the codon optimization strategy 310
undertaken was suboptimal, or that differential codon usage bias was not a major obstacle 311
(or at least not the sole obstacle) to achieving higher levels of expression. 312
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 15: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/15.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
15
Expression of the codon optimized E1 gene sequence was also examined using 313
the promoter, and the 5’ and 3’ untranslated regions (UTRs) of the Z. mobilis pdc gene, 314
which is a highly transcribed gene with very stable mRNA (25). It was reasoned that this 315
strategy might increase E1 transcription levels and its mRNA stability thus increasing E1 316
protein expression. We compared the expression of this new construct with that of the 317
Ptac-driven constructs, and surprisingly found very low levels of E1 expression using the 318
pdc transcriptional unit (Figure 3). It should be noted that while Ppdc-driven E1 is 319
difficult to visualize in Figure 3B, it was, in fact, clearly visible on the immunoblot. To 320
ensure that the low level of E1 expression detected was not a strain-specific phenomenon, 321
the expression of the various E1 constructs was examined using multiple Z. mobilis 322
strains. While both Z. mobilis strains 39676 and ZM4 showed similar expression levels 323
of the E1 constructs, strain CP4 repeatedly showed a reduced level of expression for all 324
of the constructs suggesting that differences in gene expression can also be strain-325
specific. The possibility that the E1 protein was being expressed to a high level but was 326
escaping our detection by either being released into the supernatant or forming SDS 327
insoluble aggregates was ruled out by immunoblot analysis of the culture supernatant and 328
using the Agarose Gel Electrophoresis to Resolve Aggregates (AGERA) technique, 329
respectively ((40), data not shown). 330
The intracellular expression of GH12 from A. cellulolyticus in Z. mobilis (Strain 331
39676) was also examined. Using an identical approach to E1, the GH12 catalytic 332
domain was codon-optimized and subcloned it into a plasmid under control of Ptac. 333
Surprisingly, the level of GH12 expression observed in Z. mobilis stood in stark contrast 334
to that of E1. Figure 4A clearly shows that GH12 can be detected by Coomassie stained 335
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 16: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/16.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
16
SDS-PAGE gels (Figure 4A). The GH12 protein represented approximately 4.6% 336
(standard deviation: 1.3%; n=6) of the total cellular protein in logarithmically growing 337
cells (as measured by densitometry analysis of Coomassie-stained polyacrylamide gels), 338
This stands in contrast to the low levels of recombinant E1 protein produced which 339
represented 1.7 % (standard deviation: 0.2%; n=3) of the total protein. Furthermore, a 340
significant portion of the GH12 protein expressed in Z. mobilis was soluble (Figure 4A). 341
In addition, the protein was enzymatically active as evident by the zones of substrate 342
clearing on a CMC-zymogram (Figure 4B). 343
344
Extracellular secretion of heterologously expressed cellulases in Z. mobilis. 345
We next examined the capability of Z. mobilis to secrete both E1 and GH12 346
through the use of predicted secretion signals native to Z. mobilis. We chose two 347
independent secretion signals that are predicted to utilize two separate protein secretion 348
pathways. The first secretion signal was that of the Z. mobilis phoC gene (ZM0130; 349
predicted by Genome Atlas (http://www.cbs.dtu.dk/services/GenomeAtlas/show-350
subcell.php?KLSO=ASC&KLSK=ORGANISMSORT&kingdom=Bacteria&tableType=351
Secreted%20Proteins&segmentid=Zmobilis_ZM4_Main&secType=Cytoplasm) which 352
uses the SecB-dependent (Type II) pathway (34). The second secretion signal was that 353
belonging to a hypothetical protein (ZM0331) of Z. mobilis predicted by Genome Atlas to 354
utilize the Twin Arginine Translocation (TAT) pathway (18). These signal sequences 355
were fused onto the 5’ end of the coding sequence of the E1 catalytic domain to create 356
the plasmid constructs “Z130-E1” (pJL111) and “Z331-E1” (pJL112). The resulting 357
plasmids along with the control vector pZB188 and a plasmid containing an 358
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 17: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/17.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
17
intracellularly expressed version of E1 (p25143) were used to examine the cellular 359
localization of E1 in Z. mobilis cultures. Figure 5A shows an amido black stained PVDF 360
membrane containing the protein in either the total culture (“T”, lysate of whole cells 361
plus growth medium) or the extracellular fraction (“Ex”, mock-lysate of the growth 362
medium with the cells removed by centrifugation). Figure 5B shows an anti-E1 363
immunoblot of the membrane shown in Figure 5A and reveals the location of E1 in either 364
the total culture or extracellular fractions. This figure clearly shows that a significant 365
portion of Z130-E1 can be found extracellularly, while E1 without a secretion signal and 366
Z331-E1 can only be detected in the total fraction suggesting they are localized 367
intracellularly. Furthermore, it is interesting to note that the addition of the Z130 368
secretion signal appears to have increased the overall expression of E1 (Figure 5). 369
To ensure that the E1 enzyme found in the extracellular space was in fact due to 370
protein secretion, and not as a byproduct of passive release due to increased cell 371
death/lysis in the strains with E1 tagged with secretion signals, we examined the growth 372
medium for alcohol dehydrogenase (ADH), an enzyme activity found exclusively in the 373
cytoplasm and frequently used as a cytoplasmic marker (1, 5, 6, 29). While we were able 374
to detect ADH activity in a lysate of cells plus growth medium, we were unable to detect 375
any ADH activity in the culture medium alone suggesting that there was not a significant 376
increase in cell lysis (data not shown). In addition there were no significant differences 377
in the cell viability among the strains as measured by the Live/Dead BacLight bacterial 378
viability test (data not shown). Combined these findings suggest that the E1 protein 379
detected in the extracellular space was a result of protein translocation rather than 380
increased levels of cell death and release of the E1 protein due to cell lysis. 381
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 18: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/18.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
18
In order to determine how well the Z130 and Z331 signal sequences were 382
functioning to translocate the E1 protein to the periplasmic space, we examined the 383
subcellular localization of E1. To achieve this, periplasmic and cytoplasmic fractions in 384
each of the four strains were isolated and examined for the presence of E1. Figure 5C 385
shows the amido-black-stained PVDF membrane and represents the total protein in each 386
subcellular fraction. An anti-E1 immunoblot of the membrane shown in Figure 5D 387
shows that the periplasmic fractions of the strains harboring the E1-secretion plasmids 388
Z130-E1 and Z331-E1 contain more E1 than either the control or the strain harboring the 389
control E1 construct without a secretion signal (Figure 5D and 5E). The cellulolytic 390
activity present in the cytoplasmic, periplasmic and extracellular fractions was 391
determined using the fluorescent substrate, 4-methylumbelliferyl β-D-cellobiopyranoside 392
(MUC). The cellulolytic activity associated with the control E1 construct lacking a 393
secretion signal was found almost exclusively in the cytoplasm (Figure 5F). In contrast, 394
however a significant amount of the enzymatic activity in strains containing constructs 395
Z130-E1and Z331-E1 was found in the periplasmic or extracellular spaces. Importantly, 396
while Z331-E1 was undetectable in the extracellular fraction by immunoblot (Figure 5B), 397
its activity was clearly detected extracellularly as measured by MUC hydrolysis (Figure 398
5E). 399
We also examined the subcellular localization of GH12 and GH12 fused with the 400
Z130 secretion signal. An examination of the expression and activity of the subcellular 401
pools of GH12 by Coomassie-stained SDS-PAGE (Figure 6A) and CMC zymogram 402
analysis (Figure 6B), reveals several important findings. First, it is clear that the total 403
expression of Z130-GH12 is reduced when compared to GH12 without the secretion 404
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 19: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/19.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
19
signal (Figure 6A, lanes 2 and 3). Secondly, it appears that while both GH12 and Z130-405
GH12 show activity in the periplasmic fraction, when compared to the activity found in 406
the cytoplasmic or total fractions, Z130-GH12 contributes a relatively higher activity in 407
the periplasmic fraction. As the data presented in Figures 6A and 6B are qualitative by 408
nature, we confirmed this result and quantified the activity through the measurement of 409
MUC hydrolysis (Figure 6C). The lack of a secretion signal resulted in 96% of GH12 410
activity being localized within the cytoplasm, while the addition of the Z130 signal 411
resulted in a localization of 13% of the GH12 activity in the periplasm and 26% in the 412
extracellular space. Furthermore, no ADH activity was detected in the medium and cell 413
viability associated with each culture was indistinguishable between the strains, 414
suggesting that the extracellular pool of GH12 was in fact due to secretion rather than 415
heightened cell lysis. It is also important to note that contrary to the results obtained with 416
E1 (Figure 5), the Z130 signal served to decrease the overall expression of GH12 as 417
observed by Coomassie-stained polyacrylamide gel, CMC-Zymogram (Figure 6A and 418
6B) and total activity analysis (Figure 6C). Figure 6D qualitatively shows the 419
extracellular CMC-degrading activities of all of the strains examined in Figures 5 and 6. 420
Culture spots shown in the top panel were washed from the plate which was subsequently 421
stained with Congo red to reveal zones of CMC degradation. 422
In order to determine the overall effect of recombinant protein production and 423
secretion, we examined the growth rate of Z. mobilis strain 39676 harboring the various 424
expression constructs (Figure 6E). Doubling times for strains with the indicated plasmids 425
were as follows in RMG medium: Control (pZB188) 2.3h +/- .03, E1 (p25143) 2.7h +/ 426
0.00, Z130-E1 (pJL111) 2.83h +/- 0.51, Z331-E1 (pJL112) 3.06, Gh12 (p25144), 2.82 +/-427
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 20: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/20.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
20
0.04, and Z130-Gh12 (pJL116) 2.56 +/-0.07. These numbers indicate that while the 428
expression of E1 and Gh12 has a modest effect on the growth rate compared to the 429
control strain, the addition of the Z130 signal peptide does little to inhibit growth in the 430
case of E1 and actually enhances growth rate in the case of Gh12. Furthermore, the 431
addition of the Z331 signal peptide to E1 imparts a more detrimental effect on growth 432
rate. 433
434
Discussion 435
The results of our studies first revealed that Z. mobilis has the capacity to degrade 436
carboxymethyl cellulose extracellularly (Figures 1, 4, and 6). Rajnish et al. (2008) 437
identified the Z. mobilis celA gene, (ZMO1086) that shows β-1,4-endocellulolytic 438
activity when expressed in E. coli. However, these investigators were unable to detect 439
any cellulolytic activity in the Z. mobilis strain ZM4. We independently identified a 440
native CM-cellulolytic activity present in Z. mobilis strains 39676, CP4, and ZM4. While 441
the data presented in this report cannot definitively attribute the cellulolytic activity we 442
observed to CelA, the bands showing activity had a molecular weight consistent with that 443
predicted for CelA (Figure 1). While it is possible that one of the bands showing CMC 444
activity may represent an unidentified cellulase, we favor the hypothesis that the larger of 445
the two bands (Figure 1B) represents the full length version of CelA, while the smaller 446
band most likely represents the mature protein with its signal peptide removed. Our 447
reason for believing this is based on subcellular fractionation experiments detailed in 448
Figure 6B which show that the larger of the two bands is the only band present in the 449
cytoplasmic fractions, while both forms are present in the periplasmic fraction. As signal 450
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 21: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/21.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
21
peptides are typically removed in the periplasm (34), this is exactly what would be 451
expected if in fact the two bands represented the full length protein (i.e., protein plus 452
signal sequence) and the mature protein. While future identification of these proteins 453
will be required to validate this hypothesis, cellulolytic activity against CMC was 454
detected extracellularly in several Z. mobilis strains (Figure 1 C). This finding is 455
consistent with the fact that CelA contains a predicted secretion signal at the N-terminus 456
(4). Together these findings suggest that Z. mobilis may have evolved as a cellulose-457
degrading fermentative organism. Given the ability of Z. mobilis to produce at least one 458
cellulase and potentially others (Figure 1), there may be reason to believe that this 459
organism may harbor an environment conducive to the production of additional 460
heterologous cellulolytic enzymes. 461
We also demonstrated in this report the exogenous expression and extracellular 462
secretion in Z. mobilis of two endo-1,4-β-glucanases from A. cellulolyticus useful in the 463
degradation of pretreated lignocellulosic biomass. Importantly, both enzymes we 464
heterologously expressed in Z. mobilis (E1 and GH12 from A. cellulolyticus) were found 465
to be enzymatically active, yet any metabolic burden of their expression resulted in minor 466
changes in the growth rate of Z. mobilis. While we show approximately a 20% reduction 467
in the logarithmic growth rate of cells for cells expressing either E1 and Gh12 when 468
compared to a Z. mobilis control strain, fusing the Z130 secretion signal onto these genes 469
does not seem to impart major additional limitations. Conversely, cultures harboring the 470
Z331-E1 construct, have a much larger growth limitation. Our data, taken together with 471
the results of the Arfman et al. study (1992) suggest that Z. mobilis is capable of handling 472
high levels of additional protein expression before major growth rate limitations occur. 473
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 22: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/22.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
22
This is an important finding, as high level expression of cellulolytic enzymes will be 474
required for the future development of Z. mobilis as a CBP organism, and future efforts 475
should be made to minimize this defect. 476
The robust levels of expression observed in this study using the GH12 construct 477
certainly warrants further investigation. Not only was Z. mobilis able to produce GH12 at 478
levels approaching 5% of the total cellular protein, but this level of expression was a 479
stable throughout the entire logarithmic and stationary phases of growth. The expression 480
plasmids used in this study containing the Ptac lacked the lacI gene, so the cellulase genes 481
were being expressed constitutively without the need for isopropyl-β-D-482
thiogalactopyranoside (IPTG) induction. Constitutive cellulase expression will be an 483
important trait for a CBP organism, and the fact that GH12 can be expressed 484
constitutively to a high level in a largely soluble and enzymatically active form provides 485
an optimistic outlook for developing Z. mobilis as a CBP host. 486
We further show that Z. mobilis is capable of translocating both E1 and GH12 487
through the periplasmic space into the extracellular medium when the genes encoding 488
these cellulases are fused with the previously-uncharacterized N-terminal secretion 489
signals Z130 and Z331. These signal sequences presumably direct the translocation of 490
proteins via the SecB-dependent and TAT secretory pathways, respectively. As the N-491
terminal signals used by both secretion pathways function only to translocate the protein 492
to the periplasmic space (18, 34), it is very significant that when fused to E1 and GH12 493
nearly 50% and 40% of the respective protein translocates through the inner membrane to 494
reside either periplasmically or extracellularly (Figures 5 and 6). An interesting 495
observation is that while the presence of the Z130 secretion signal resulted in an 496
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 23: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/23.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
23
increased expression of the E1 enzyme, it resulted in a decreased expression of GH12 497
(Figures 5 and 6). The reasons for this are unclear, but one possibility is that perhaps the 498
more oxidizing periplasmic environment (28) favors the proper folding of E1 thus 499
increasing its stability. Regarding GH12, it is possible that since this protein is expressed 500
to such a high level (Figures 4 and 6), perhaps the incorporation of the secretion signal is 501
overloading the secretion pathway at some level, and GH12 is getting degraded at a faster 502
rate. A mechanistic hypothesis supposes that perhaps SecB is binding to the N-terminal 503
signal sequence keeping GH12 in its unfolded state, yet the overburdening of the 504
translocase complex is slowing the rate of periplasmic translocation thus leaving GH12 505
more susceptible to cytoplasmic degradation. Another possibility is that GH12 is being 506
efficiently translocated to the periplasmic space, yet periplasmic proteases are degrading 507
the protein at a faster rate than occurs cytoplasmically. A third possibility is that the 508
addition of the signal sequence itself reduces the translation rate of the GH12 protein. 509
While the levels of E1 and GH12 secretion demonstrated here certainly represent a 510
significant step towards achieving high level secretion, the fact remains that in the realm 511
of developing a CBP technology, any cellulolytic enzyme that remains localized within a 512
cell is essentially wasted regarding the degradation of extracellular biomass. Future 513
efforts will be directed to increasing the secretory capacity of Z. mobilis regarding 514
cellulolytic enzymes along three fronts: 1) Increasing the translocation through the inner 515
membrane to the periplasm, 2) Increasing the translocation through the outer membrane 516
to the extracellular space, and 3) Exploring the use of alternate secretion pathways such 517
as the type I secretion pathway which bypasses the two step secretion mechanism and 518
instead translocates proteins across both membranes (26). 519
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 24: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/24.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
24
Ultimately, several classes of cellulolytic enzymes will likely need to be co-expressed 520
in order to effectively break down lignocellulosic biomass. At a minimum, we expect 521
that the simultaneous expression of an endoglucanase, an exoglucanase, and a β-522
glucosidase would be required (13), although the expression of additional enzymes will 523
also quite likely be necessary. We have shown here the effective production and 524
secretion of two endo-1,4-β-glucanases, and future work will need to address the ability 525
of Z. mobilis to express the other two classes of enzymes. 526
We have shown that Z. mobilis can effectively express and secrete heterologously 527
expressed proteins, and while we personally envision this being useful in developing Z. 528
mobilis into a CBP organism, this could theoretically open up a new pipeline for the 529
production of other classes of valuable proteins. E. coli is one of several organisms that 530
have long been favored for high-level production of recombinant proteins. However, 531
despite extensive knowledge about recombinant protein production in E. coli, not all 532
expression attempts have been successful. Furthermore, E. coli is notoriously poor at 533
secreting heterologous proteins (23), which can be an advantageous route in the 534
expression of recombinant proteins. The ability of Z. mobilis to express and secrete 535
recombinant proteins may represent a complementary pathway to E. coli-based 536
expression systems, and may prove valuable to researchers in all disciplines requiring 537
recombinant protein production that is unsuccessful using E. coli. 538
Z. mobilis has proven to be an extremely valuable organism in the conversion of 539
biomass-derived sugars to ethanol and is currently being developed into a commercial 540
fermentation host as part of an integrated lignocellulosic ethanol process. The data 541
presented in this report shows the potential for Z. mobilis to extend its usefulness beyond 542
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 25: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/25.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
25
its fermentative abilities, and play a significant role in the degradation of pretreated 543
lignocellulosic biomass. Given the proven adeptness of Z. mobilis in industrial-scale 544
fermentation, the ability to express high levels of active cellulases shown in this study 545
and the capacity to secrete these enzymes, the foundation has been laid for further 546
investigations in the establishment of Z. mobilis as a CBP organism. While CBP might 547
be considered the ultimate goal, any significant production of cellulolytic enzymes by Z. 548
mobilis could be considered a success. As this would reduce the required loading levels 549
of exogenously-produced cellulases during simultaneous saccharification and 550
fermentation or co-fermentation, processes in which Z. mobilis has already been tried and 551
tested (14, 24, 36). 552
553
Acknowledgements 554
We gratefully thank Min Zhang, Larry Taylor, Yat-Chen Chou and Mary Ann 555
Franden for technical advice and invaluable discussions, and Philip Pienkos and Min 556
Zhang for a critical review of this manuscript. 557
558
References 559
1. Aldrich, H. C., L. McDowell, M. F. Barbosa, L. P. Yomano, R. K. Scopes, 560
and L. O. Ingram. 1992. Immunocytochemical localization of glycolytic and 561
fermentative enzymes in Zymomonas mobilis. J Bacteriol 174:4504-8. 562
2. Arfman, N., V. Worrell, and L. O. Ingram. 1992. Use of the tac promoter and 563
lacIq for the controlled expression of Zymomonas mobilis fermentative genes in 564
Escherichia coli and Zymomonas mobilis. J Bacteriol 174:7370-8. 565
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 26: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/26.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
26
3. Arnold, K., L. Bordoli, J. Kopp, and T. Schwede. 2006. The SWISS-MODEL 566
workspace: a web-based environment for protein structure homology modelling. 567
Bioinformatics 22:195-201. 568
4. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Improved 569
prediction of signal peptides: SignalP 3.0. Journal of Molecular Biology 340:783-570
795. 571
5. Brestic-goachet, N., P. Gunasekaran, B. Cami, and J. Baratti. 1990. Transfer 572
and Expression of a Bacillus-Licheniformis Alpha-Amylase Gene in Zymomonas 573
mobilis. Archives of Microbiology 153:219-225. 574
6. Brestic-Goachet, N. G., P; Cami, B; Baratti, J 1989. Transfer and expression of 575
an Erwinia chrysanthemi cellulase gene in Zymomonas mobilis. Journal of 576
General Microbiology. Vol. 135:893-902. 577
7. Byun, M. O. K., J. B. Kaper, and L. O. Ingram. 1986. Construction of a New 578
Vector for the Expression of Foreign Genes in Zymomonas mobilis. Journal of 579
Industrial Microbiology 1:9-15. 580
8. Carere, C. R., R. Sparling, N. Cicek, and D. B. Levin. 2008. Third generation 581
biofuels via direct cellulose fermentation. International Journal of Molecular 582
Sciences 9:1342-1360. 583
9. Carey, V. C., S. K. Walia, and L. O. Ingram. 1983. Expression of a Lactose 584
Transposon (Tn951) in Zymomonas mobilis. Appl Environ Microbiol 46:1163-585
1168. 586
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 27: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/27.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
27
10. Deanda, K., M. Zhang, C. Eddy, and S. Picataggio. 1996. Development of an 587
arabinose-fermenting Zymomonas mobilis strain by metabolic pathway 588
engineering. Applied and Environmental Microbiology 62:4465-4470. 589
11. Franden, M. A., P. T. Pienkos, and M. Zhang. 2009. Development of a high-590
throughput method to evaluate the impact of inhibitory compounds from 591
lignocellulosic hydrolysates on the growth of Zymomonas mobilis. Journal of 592
Biotechnology 144:259-267. 593
12. Himmel, M. E., S. Y. Ding, D. K. Johnson, W. S. Adney, M. R. Nimlos, J. W. 594
Brady, and T. D. Foust. 2007. Biomass recalcitrance: engineering plants and 595
enzymes for biofuels production. Science 315:804-7. 596
13. Kumar, R., S. Singh, and O. V. Singh. 2008. Bioconversion of lignocellulosic 597
biomass: biochemical and molecular perspectives. J Ind Microbiol Biotechnol 598
35:377-91. 599
14. Lee, J. H., R. J. Pagan, and P. L. Rogers. 1983. Continuous Simultaneous 600
Saccharification and Fermentation of Starch Using Zymomonas mobilis. 601
Biotechnology and Bioengineering 25:659-669. 602
15. Lee, K. J., M. Lefebvre, D. E. Tribe, and P. L. Rogers. 1980. High Productivity 603
Ethanol Fermentations with Zymomonas mobilis Using Continuous Cell Recycle. 604
Biotechnology Letters 2:487-492. 605
16. Lee, K. J., M. L. Skotnicki, D. E. Tribe, and P. L. Rogers. 1980. Kinetic-606
Studies on a Highly Productive Strain of Zymomonas mobilis. Biotechnology 607
Letters 2:339-344. 608
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 28: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/28.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
28
17. Lee, K. J., D. E. Tribe, and P. L. Rogers. 1979. Ethanol-Production by 609
Zymomonas mobilis in Continuous Culture at High Glucose-Concentrations. 610
Biotechnology Letters 1:421-426. 611
18. Lee, P. A., D. Tullman-Ercek, and G. Georgiou. 2006. The bacterial twin-612
arginine translocation pathway. Annu Rev Microbiol 60:373-95. 613
19. Lejeune, A., D. E. Eveleigh, and C. Colson. 1988. Expression of an 614
Endoglucanase Gene of Pseudomonas fluorescens var. cellulosa in Zymomonas 615
mobilis. Fems Microbiology Letters 49:363-366. 616
20. Lynd, L. R. 1996. Overview and evaluation of fuel ethanol from cellulosic 617
biomass: Technology, economics, the environment, and policy. Annual Review of 618
Energy and the Environment 21:403-465. 619
21. Lynd, L. R., W. H. van Zyl, J. E. McBride, and M. Laser. 2005. Consolidated 620
bioprocessing of cellulosic biomass: an update. Current Opinion in Biotechnology 621
16:577-83. 622
22. Lynd, L. R., P. J. Weimer, W. H. van Zyl, and I. S. Pretorius. 2002. Microbial 623
cellulose utilization: fundamentals and biotechnology. Microbiology and 624
Molecular Biology Reviews 66:506-77, table of contents. 625
23. Makrides, S. C. 1996. Strategies for achieving high-level expression of genes in 626
Escherichia coli. Microbiol Rev 60:512-38. 627
24. McMillan, J. D., M. M. Newman, D. W. Templeton, and A. Mohagheghi. 628
1999. Simultaneous saccharification and cofermentation of dilute-acid pretreated 629
yellow poplar hardwood to ethanol using xylose-fermenting Zymomonas mobilis. 630
Applied Biochemistry and Biotechnology 77-9:649-665. 631
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 29: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/29.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
29
25. Mejia, J. P., M. E. Burnett, H. An, W. O. Barnell, K. F. Keshav, T. Conway, 632
and L. O. Ingram. 1992. Coordination of expression of Zymomonas mobilis 633
glycolytic and fermentative enzymes: a simple hypothesis based on mRNA 634
stability. J Bacteriol 174:6438-43. 635
26. Mergulhao, F. J., D. K. Summers, and G. A. Monteiro. 2005. Recombinant 636
protein secretion in Escherichia coli. Biotechnol Adv 23:177-202. 637
27. Misawa, N., T. Okamoto, and K. Nakamura. 1988. Expression of a Cellulase 638
Gene in Zymomonas mobilis. Journal of Biotechnology 7:167-178. 639
28. Missiakas, D., and S. Raina. 1997. Protein folding in the bacterial periplasm. J 640
Bacteriol 179:2465-71. 641
29. Omullan, P. J., T. Chase, and D. E. Eveleigh. 1992. Purification and Some 642
Properties of Extracellular Invertase-B from Zymomonas mobilis. Applied 643
Microbiology and Biotechnology 38:341-346. 644
30. Rajnish, K. N., G. M. K. Choudhary, and P. Gunasekaran. 2008. Functional 645
characterization of a putative endoglucanase gene in the genome of Zymomonas 646
mobilis. Biotechnology Letters 30:1461-1467. 647
31. Rogers, P. L., Y. J. Jeon, K. J. Lee, and H. G. Lawford. 2007. Zymomonas 648
mobilis for Fuel Ethanol and Higher Value Products. Adv Biochem Eng 649
Biotechnol. 650
32. Rogers, P. L., K. J. Lee, and D. E. Tribe. 1980. High Productivity Ethanol 651
Fermentations with Zymomonas mobilis. Process Biochemistry 15:7-&. 652
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 30: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/30.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
30
33. Rogers, P. L., K. J. Lee, and D. E. Tribe. 1979. Kinetics of Alcohol Production 653
by Zymomonas mobilis at High Sugar Concentrations. Biotechnology Letters 654
1:165-170. 655
34. Sandkvist, M. 2001. Biology of type II secretion. Mol Microbiol 40:271-83. 656
35. Skotnicki, M. L., K. J. Lee, D. E. Tribe, and P. L. Rogers. 1981. Comparison 657
of Ethanol-Production by Different Zymomonas Strains. Applied and 658
Environmental Microbiology 41:889-893. 659
36. Spangler, D. J., and G. H. Emert. 1986. Simultaneous Saccharification 660
Fermentation with Zymomonas mobilis. Biotechnology and Bioengineering 661
28:115-118. 662
37. Swings, J., and J. Deley. 1977. Biology of Zymomonas. Bacteriological Reviews 663
41:1-46. 664
38. Taylor, L. E., 2nd, B. Henrissat, P. M. Coutinho, N. A. Ekborg, S. W. 665
Hutcheson, and R. M. Weiner. 2006. Complete cellulase system in the marine 666
bacterium Saccharophagus degradans strain 2-40T. J Bacteriol 188:3849-61. 667
39. Villalobos, A., J. E. Ness, C. Gustafsson, J. Minshull, and S. Govindarajan. 668
2006. Gene Designer: a synthetic biology tool for constructing artificial DNA 669
segments. Bmc Bioinformatics 7:-. 670
40. Weiss, A., C. Klein, B. Woodman, K. Sathasivam, M. Bibel, E. Regulier, G. 671
P. Bates, and P. Paganetti. 2008. Sensitive biochemical aggregate detection 672
reveals aggregation onset before symptom development in cellular and murine 673
models of Huntington's disease. Journal of Neurochemistry 104:846-858. 674
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 31: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/31.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
31
41. Yablonsky, M. D., A. E. Goodman, N. Stevnsborg, O. G. Delima, J. O. F. 675
Demorais, H. G. Lawford, P. L. Rogers, and D. E. Eveleigh. 1988. Zymomonas 676
mobilis Cp4 - a Clarification of Strains Via Plasmid Profiles. Journal of 677
Biotechnology 9:71-79. 678
42. Yanase, H., J. Kurii, and K. Tonomura. 1986. Construction of a Promoter-679
Cloning Vector in Zymomonas mobilis. Agricultural and Biological Chemistry 680
50:2959-2961. 681
43. Yanase, H., K. Nozaki, and K. Okamoto. 2005. Ethanol production from 682
cellulosic materials by genetically engineered Zymomonas mobilis. Biotechnol 683
Lett 27:259-63. 684
44. Yoon, P., Pack. 1988. Transfer of Bacillus subtilis Endo-β-1,4-glucanase gene 685
into Zymomonas anaerobia. Biotechnology letters 10:213-216. 686
45. Zhang, M., C. Eddy, K. Deanda, M. Finkestein, and S. Picataggio. 1995. 687
Metabolic Engineering of a Pentose Metabolism Pathway in Ethanologenic 688
Zymomonas-mobilis. Science 267:240-243. 689
46. Zhang, M., C. Eddy, K. Deanda, M. A. Franden, M. Finkelstein, and S. 690
Picataggio. 1995. Metabolic Engineering of Zymomonas mobilis for Ethanol-691
Production from Renewable Feedstocks. Abstracts of Papers of the American 692
Chemical Society 209:115-BTEC. 693
47. Zhang, M., M. A. Franden, M. Newman, J. Mcmillan, M. Finkelstein, and S. 694
Picataggio. 1995. Promising Ethanologens for Xylose Fermentation - Scientific 695
Note. Applied Biochemistry and Biotechnology 51-2:527-536. 696
697
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 32: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/32.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
32
Figure Legends 698
Figure 1: Activity of the native cellulolytic proteins in Z. mobilis strains. A) 699
Coomassie stained polyacrylamide gel. B) Carboxymethyl cellulose (CMC) zymogram. 700
C) Patched colonies of Z. mobilis and E. coli growing on an RMG-CMC plate, and same 701
plate with cells removed and stained with Congo red to reveal areas of CMC degradation. 702
Figure 2: Expression of E1 and GH12 in E. coli strains Bl21-DE3 and Rosetta 2. A) 703
Coomassie stained polyacrylamide gel of protein lysates from E. coli strains BL21-DE3 704
and Rosetta 2 harboring plasmids pJL101 (“ E1”), and pJL103 (“GH12”) with (+) or 705
without (-) protein induction with 1 mM IPTG 706
Figure 3: Expression of various E1 constructs in multiple strains of Z. mobilis. 707
Protein lysates from Z. mobilis strains 39676, CP4, and ZM4 transformed with the 708
plasmids pZB188 (“control”), pJL113 (“Ptac-E1”), p25143 [“Ptac-E1 (c/o)], and pJL110 709
(“Ppdc-E1”) were run identically on two independent 12% polyacrylamide gels 710
supplemented with 0.12% carboxymethyl cellulose (CMC). A) A PVDF membrane 711
stained with amido black to show total protein. B) Immunoblot probed with an α-E1 712
antibody. C) A CMC zymogram performed on the second of two duplicate 713
polyacrylamide gels to show cellulolytic activity. E1 activity is represented by the upper 714
band, and cellulolytic activity endogenous to Z. mobilis can be seen by the lower band. 715
Figure 4: Expression, solubility analysis, and activity of E1 and GH12 in Z. mobilis 716
strain 39676. Protein lysates from Z. mobilis strain 39676 transformed with pZB188 717
(“control”), p25144 (“GH12”), and p25143 (“E1”) were run identically on two 718
independent 12% polyacrylamide gels supplemented with 0.12% carboxymethyl 719
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 33: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/33.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
33
cellulose (CMC). A) Coomassie stain of one of the duplicate polyacrylamide gels 720
showing total protein. The arrow denotes the location of the GH12 and E1 proteins. B) A 721
CMC zymogram performed on the second of two duplicate polyacrylamide gels designed 722
to show cellulolytic activity. 723
Figure 5: Extracellular secretion, and subcellular localization of E1 in Z. mobilis 724
strain 39676. A) Amido black stained PVDF membrane showing Total (“T”) and 725
Extracellular Medium (“Ex”) protein lysate fractions, to show total protein load. B) 726
Anti-E1 immunoblot of the membrane in “A”. C) Amido black stained PVDF 727
membrane showing total protein load of protein lysates derived from Z. mobilis 728
expressing multiple versions of E1. “Cp” and “Pp” represent the cytoplasmic and 729
periplasmic fractions, respectively. D) Anti-E1 immunoblot of the membrane in “C”. E) 730
Relative quantification of E1 activity against methylumbelliferyl cellobiopyranoside 731
(MUC) in periplasmic, cytoplasmic and extracellular fractions. Relative total activity of 732
equivalent whole cell lysates from the indicated strains is shown in the bottom panel to 733
highlight differential expression between the strains. 734
735
Figure 6: Extracellular secretion, and subcellular localization of Gh12 in Z. mobilis 736
strain 39676. Whole cell protein lysates, periplasmic and cytoplasmic fractions derived 737
from Z. mobilis strain 39676 transformed with plasmids pZB188 (“control”), p25144 738
(“GH12”) and pJL116 (“Z130-GH12”) were run identically on two independent 12% 739
polyacrylamide gels supplemented with 0.12% carboxymethyl cellulose (CMC). A) 740
Coomassie stained gel to show total protein. B) A CMC zymogram performed on the 741
second of two duplicate polyacrylamide gels designed to show cellulolytic activity. C) 742
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 34: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/34.jpg)
Running title: Expression and Secretion of Cellulases in Z. mobilis
34
Relative quantification of GH12 activity against methylumbelliferyl cellobiopyranoside 743
(MUC) in periplasmic, cytoplasmic and extracellular fractions. Relative total activity of 744
equivalent whole cell lysates from the indicated strains is shown in the bottom panel to 745
highlight differential expression between the strains. D) Z. mobilis strain 39676 746
transformed with plasmids pZB188 (“control”), p25143 (“E1”), p25144 (“GH12”), 747
pJL111 (“Z130-E1”), pJL112 (“Z331-E1”), and pJL116 (“Z130-GH12”) were spotted 748
onto an agar plate containing 2% glucose and 0.12% CMC. After 18 hours of anaerobic 749
growth at 30°C, plates were photographed and cells were washed off. The plate was 750
subsequently stained with 0.2% Congo Red and destained with 1M NaCl and 751
photographed again to show CMC degradation. E) Growth curve analysis of Z. mobilis 752
strain 39676 in RMG harboring the plasmids: Control (pZB188; closed diamonds), E1 753
(p25143; open diamonds), Z130-E1 (pJL111; closed triangles), Z331-E1 (pJL112; open 754
triangles), Gh12 (p25144; closed circles), and Z130-Gh12 (pJL116; open circles). 755
756
Table I: Plasmids used in this study. Plasmid names and relevant expression elements 757
are shown graphically. For E1 and GH12 plasmids, amino acids that are encoded for are 758
shown in parentheses. 759
760
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 35: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/35.jpg)
50
37
75
Figure 1
A B
C Z. mobilis E. coli
Strain: CP4 ZM439676 Bl21-DE3
39676
CP4
ZM4
kDa
Bl21-DE3
39676
CP4
ZM4
Bl21-DE3
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 36: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/36.jpg)
Figure 2
E1 Gh12
Bl21-DE3
IPTG: - - - -+ + + +
E1 Gh12
Rosetta 2
100
50
37
25
20
15
kDa
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 37: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/37.jpg)
Fig
ure 3
CP
4
control
Ptac-E1
Ptac-E1 (c/o)
ZM
4
Ppdc-E1
control
Ptac-E1
Ptac-E1 (c/o)
Ppdc-E1
control
Ptac-E1
Ptac-E1 (c/o)
Ppdc-E1
Z. m
obilis
Strain
:
Plasm
id:
39676
50
37
25
20
kD
a
50
37
25
2050
37
25
20
C AB
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 38: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/38.jpg)
37
25
20
37
25
20
Figure 4
Soluble Insoluble
ctrl
Gh
12
E1
ctrl
Gh
12
E1
kDa
A
B
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 39: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/39.jpg)
FIGURE 5
Control
T Ex T Ex T Ex T Ex
E1 Z130-E1 Z331-E1
50
37
25
20
50
37
25
20
kDa:
kDa:
Cytoplasmic
Periplasmic
Extracellular
Control E1 Z331-E1Z130-E1
Nrm
aliz
ed A
ctiv
ity
0
1
0.8
0.6
0.4
0.2
Relative Total
Activity:0 0.38 (+/- .039) 1 (+/- 0.018) 0.32 (+/- 0.028)
9864
50
36
kDa:A.
B. D.
C.
E.
Cp Cp CpCpPp PpPpPp
Control E1 Z130-E1 Z331-E1
22
16
9864
50
36
kDa:
22
16
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 40: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/40.jpg)
FIGURE 6
Total
Contr
ol
Gh12
Z130-G
h12
Contr
ol
Gh12
Z130-G
h12
Contr
ol
Gh12
Z130-G
h12
Cytoplasm Periplasm
50
37
25
20
kDa:75
50
37
25
20
kDa:
75
Control Gh12 Z130-Gh12
Cytoplasmic
Periplasmic
Extracellular
0
0.2
0.4
0.6
0.8
1
Control E1 Gh12
Z130-
Gh12
Z331-
E1
Z130-
E1
A.
Relative
Total Activity: 0 1 (+/- .029) 0.29 (+/- .049)
Norm
aliz
ed A
ctiv
ity
0
1.2
1.0
0.8
0.6
0.4
0.2
OD
420-5
80
0 252015105Time (h)
B.
E.
D.
C.
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 41: Heterologous Expression and Extracellular Secretion of ...aem.asm.org/content/early/2010/08/06/AEM.00230-10.full.pdf · 67 used the tac promoter (P tac) to ... 135 Schematics of all](https://reader031.vdocuments.us/reader031/viewer/2022030803/5b0c2d5f7f8b9abc0a8bbd03/html5/thumbnails/41.jpg)
pZB188 (Zhang et al., 1995)N/A
pFLAG-CTC Sigma Aldrich (St. Louis, MO)N/A
Zm-PgappJL100 This studypZB188
Zm-Pgap XynApJL100-XynA This studypJL100
pJL101 Ptac Gh12 (AA’s1-274) This studypFLAG-CTC
Ptac E1 (AA’s 42-404)pJL103 This studypFLAG-CTC
Ptac XynApJL105 This studypFLAG-CTC
Ptac E1 (AA’s 42-404)pJL113 This studypZB188
E1-c/o (AA’s 42-404)Zm-5’ & Ppdc Zm-pdc3’ regionpJL110 This studypZB188
Ptac E1-c/o (AA’s 42-404)p25143 This studypZB188
Ptac Gh12-c/o (AA’s1-274)p25144 This studypZB188
Plasmid Expression Schematic Parent vector Source
TABLE I
Ptac Gh12-c/o (AA’s1-274)pJL116 This studypZB188Z130
PtacpJL111 This studypZB188Z130 E1-c/o (AA’s 42-404)
PtacpJL112 This studypZB188Z331 E1-c/o (AA’s 42-404)
on July 2, 2018 by guesthttp://aem
.asm.org/
Dow
nloaded from