doi.org/10.26434/chemrxiv.11316098.v1

Expanding the Natural Products Heterologous Expression Repertoire inthe Model Cyanobacterium Anabaena sp. Strain PCC 7120: Productionof Pendolmycin and Teleocidin B-4Patrick Videau, Kaitlyn Wells, Arun Singh, Jessie Eiting, Philip Proteau, Benjamin Philmus

Submitted date: 04/12/2019 • Posted date: 12/12/2019Licence: CC BY-NC-ND 4.0Citation information: Videau, Patrick; Wells, Kaitlyn; Singh, Arun; Eiting, Jessie; Proteau, Philip; Philmus,Benjamin (2019): Expanding the Natural Products Heterologous Expression Repertoire in the ModelCyanobacterium Anabaena sp. Strain PCC 7120: Production of Pendolmycin and Teleocidin B-4. ChemRxiv.Preprint. https://doi.org/10.26434/chemrxiv.11316098.v1

Cyanobacteria are prolific producers of natural products and genome mining has shown that many orphanbiosynthetic gene clusters can be found in sequenced cyanobacterial genomes. New tools and methodologiesare required to investigate these biosynthetic gene clusters and here we present the use of Anabaena sp.strain PCC 7120 as a host for combinatorial biosynthesis of natural products using the indolactam naturalproducts (lyngbyatoxin A, pendolmycin, and teleocidin B-4) as a test case. We were able to successfullyproduce all three compounds using codon optimized genes from Actinobacteria. We also introduce a newplasmid backbone based on the native Anabaena7120 plasmid pCC7120ζ and show that production ofteleocidin B-4 can be accomplished using a two-plasmid system, which can be introduced by co-conjugation.

File list (2)

download fileview on ChemRxivCombiBiosynth-Anabaena__2019December03.pdf (632.96 KiB)

download fileview on ChemRxivCombiBiosynth-Anabaena_SI_2019December03.pdf (3.26 MiB)

1

Expanding the Natural Products Heterologous Expression Repertoire in the Model

Cyanobacterium Anabaena sp. Strain PCC 7120: Production of Pendolmycin and

Teleocidin B-4

Patrick Videau,†,§ Kaitlyn N. Wells,‡,† Arun J. Singh,† Jessie Eiting,† Philip J. Proteau,†

Benjamin Philmus†,*

†Department of Pharmaceutical Sciences, College of Pharmacy, Oregon State University,

Corvallis, OR 97331

‡Undergraduate Honors College, Oregon State University, Corvallis, OR 97331

Present address: §Department of Biology, Southern Oregon University, Ashland, OR

97520

*E-mail: benjamin.philmus@oregonstate.edu

2

Abstract

Cyanobacteria are prolific producers of natural products and genome mining has shown

that many orphan biosynthetic gene clusters can be found in sequenced cyanobacterial

genomes. New tools and methodologies are required to investigate these biosynthetic

gene clusters and here we present the use of Anabaena sp. strain PCC 7120 as a host for

combinatorial biosynthesis of natural products using the indolactam natural products

(lyngbyatoxin A, pendolmycin, and teleocidin B-4) as a test case. We were able to

successfully produce all three compounds using codon optimized genes from

Actinobacteria. We also introduce a new plasmid backbone based on the native

Anabaena 7120 plasmid pCC7120ζ and show that production of teleocidin B-4 can be

accomplished using a two-plasmid system, which can be introduced by co-conjugation.

3

Cyanobacteria are prevalent producers of natural products with diverse structures

and interesting bioactivities. Over 1,100 secondary metabolites have been identified from

cyanobacteria, and the majority of those are produced by only four genera:

Hapalosiphon, Lyngbya (now known as Moorea), Microcystis, and Nostoc.1 Natural

products of known or predicted cyanobacterial origin account for roughly 20% of marine-

inspired small molecules currently in clinical trials.2 The compounds produced by

cyanobacteria can be quite complex, often tailored with rare and unique modifications.3

The ability to produce such an array of compounds hints at the likely untapped

biosynthetic capacity of the cyanobacteria. One group of compounds based on the

indolactam-V (ILV, 1) core has been the focus of our recent research.

To date, at least three gene clusters have been shown to produce ILV as a

biosynthetic intermediate: the ltxA-C genes from the filamentous marine cyanobacterium

Moorea producens (formerly Lyngbya majuscula) yield lyngbyatoxin A (2),4-5 a protein

kinase C activator;6 the mpnB-D genes from the marine actinomycete Marinactinospora

thermotolerans SCSIO

00652 yield pendolmycin

(3),7 a compound shown

to inhibit

phosphatidylinositol

turnover;8 and the tleA-D

genes of Streptomyces

blastmyceticus NBRC

4

12747 yield teleocidin B-4, teleocidin B-1, and O-desmethylolivoretin C (4-6),9 which

are protein kinase C activators.10 The first gene of each of these clusters encodes a two

module non-ribosomal peptide synthetase (NRPS; LtxA, MpnB, and TleA, respectively)

that forms N-methyl-L-valyl-L-tryptophanol (NMVT, 7). Following the reductive release

of 7, a cytochrome P450 (LtxB, MpnC, and TleB, respectively) cyclizes 7 into 1.

Pendolmycin and lyngbyatoxin A are formed by reverse prenylation of 1 by MpnD or

LtxC/TleC in

the presence of

dimethylallyl

diphosphate or

geranyl

diphosphate,

respectively.

Finally, 4, 5,

and 6 are

formed by the

methylation and

cyclization of

the prenyl

group of

lyngbyatoxin A

onto the indole

ring by TleD Figure 1. Biosynthetic pathway for the formation of indolactam natural products.

5

(Figure 1). The presence of multiple tailoring enzymes that modify the common

intermediate (1) has led to a natural combinatorial library of compounds across genera.

The production of desirable cyanobacterial compounds is often hampered by slow

growth of the producing strain, low compound yields, recalcitrance to laboratory culture

or genetic manipulation, and the spontaneous cessation of compound production. To

overcome these hurdles, Anabaena sp. strain PCC 7120 (herein Anabaena 7120) was

assessed as a general heterologous expression host for cyanobacterial natural products.11

Introduction of the ltxA-C genes into Anabaena 7120 on a replicative plasmid resulted in

lyngbyatoxin A production with no biosynthetic intermediates (1 or 7) being observed.

Exchange of the native ltxA promoter region with the glnA promoter from Anabaena

7120, coupled with a preliminary optimization of growth conditions, resulted in a 13-fold

increase in lyngbyatoxin A yield up to 3.2 mg/L. Promoter regions from four other

cyanobacterial natural products gene clusters were recognized and expressed by the

native Anabaena 7120 transcriptional machinery. Taken together, these results indicate

that Anabaena 7120 is a viable candidate for a general cyanobacterial heterologous

expression host.11

Here we describe our efforts to expand the toolbox for heterologous expression of

natural products in Anabaena 7120 using the indolactam family as a proof of concept. To

expand the functional capacity of Anabaena 7120 as a heterologous host, we used

different combinations of cyanobacterial (ltxA-C) and codon-optimized non-

cyanobacterial genes (mpnD, tleC, and tleD) to produce 2, 3, and 4 in good yields.

Several media conditions, in which the nitrogen source was altered, fructose was added to

increase the resulting dry cell mass, and introduction of the glnA promoter were used to

6

increase compound titers as previously described.11 A new replicative origin of

replication, based on the endogenous plasmid pCC7120ζ, was defined and validated for

plasmid selection and maintenance in Anabaena 7120. Assessment of the introduction of

one or two plasmids simultaneously into Anabaena 7120 demonstrated that, though

possible, the efficiency drops with complexity of the conjugation mixture.

Results and Discussion

Heterologous Production of Pendolmycin and Teleocidin B-4 in Anabaena 7120

Using Codon-Optimized Genes from Cyanobacterial and Non-Cyanobacterial

Genera in Mixed Gene Clusters. To extend the utility of Anabaena 7120 as a

heterologous host, we sought to determine whether derivations of 1 could be

accomplished using tailoring genes of non-cyanobacterial origin. Given the increased

yields we previously observed using solid media over liquid media, our experiments were

performed primarily using BG-11(Nit) and BG-11(NH4) solid media.11

Three tailoring genes were chosen for study: tleC and tleD from S. blastmyceticus

NBRC 12747,9 which encode proteins responsible for the formation of 2 from 1 and the

conversion of 2 to 4, 5, and 6 respectively; and mpnD from M. thermotolerans SCSIO

00652,7 which encodes a prenyltransferase that catalyzes the production of 3 from 1. As

tleC, tleD, and mpnD are derived from Actinobacteria with high G+C content genomes,

the coding regions of tleC, tleD, and mpnD were codon optimized for Anabaena 7120

and commercially synthesized for the following experiments.

7

The tleC gene encodes a prenyltransferase that has been shown to transfer a

geranyl group to 1 to create 2.9, 12 To verify the function of TleC in Anabaena 7120, ltxC

was replaced with codon-optimized tleC to retain the gene order if these are transcribed

as an operon and use the native promoters if they are not, creating pPJAV642, which was

introduced into Anabaena 7120. The resulting strain was cultured on BG-11(Nit) plates,

which contain sodium nitrate as the nitrogen source. The cells were collected,

lyophilized, and extracted as previously described,11 and the extract was analyzed by

HPLC-MS/MS and HPLC-HRMS as described in the Experimental Section. A peak was

present only for the extract from the culture harboring ltxAB-tleC (pPJAV642, Figure 2)

with a HRESIMS (m/z 438.3112; calcd 438.3115, 0.7 ppm error), and MS/MS

fragmentation (Figure S1) pattern consistent with 2.11, 13 To confirm the produced

compound was 2 and not the epimer at the C-18 position we pursued isolation of the

compound. To facilitate the isolation we exchanged the native promoter with the strong,

constitutive PglnA promoter to create pPJAV647.11 Introduction of pPJAV647 to

Anabaena 7120 was followed by cultivation in 20 L of liquid BG11(Nit) media

supplemented with 50 mM fructose. Addition of fructose was previously shown to

increase the growth of Anabaena 7120 under mixotrophic conditions.14 Here we utilized

the addition of 50 mM fructose to BG-11(Nit) to increase the yield of dried cell mass that

we obtained, which increases the total yield of compound. This allowed sufficient

compound to be isolated for characterization via 1H NMR spectroscopy. Comparison to

literature data validated that this compound was 2 (Figure S2). These results show that

TleC is functional in Anabaena 7120 and can convert 1 to 2 as previously described.9

8

The tleD gene encodes a protein with C-methyltransferase and terpene cyclase

activities that converts 2 to 4 as the major product, while 5 and 6 are produced in lower

yield.9 To verify the function of TleD in Anabaena 7120, tleD was cloned into the

position of ltxD in ltxABCD to create pPJAV644, such that tleD was expressed at the

native level of the ltxD gene. Following plasmid introduction, extraction, and analysis

Figure 2. Production of lyngbyatoxin A (2) and teleocidin B-4 (4). Zoomed

LCMS MRM chromatogram showing the constructs used and production of 2

(438.3 → 410.3), left column; and constructs used and production of 4 (452.3 →

424.3), right column. Traces are from a single replicate of culture grown on BG-

11(Nit) media containing 1.5% agar (1 plate = approximately 40 mL) and are

representative of all samples.

: PltxA

pPJAV361 (empty vector)

pPJAV642

ltxA ltxB tleC

pPJAV644

ltxA ltxB ltxC tleD

pPJAV500

ltxA ltxB ltxC

28 29 30 31 32

28 29 30 31 32

28 29 30 31 32

28 29 30 31 32

28 29 30 31 32

28 29 30 31 32

28 29 30 31 32

28 29 30 31 32

N

HN

O

OH

NH

2

NNH

O

OH

NH

4

pPJAV500

ltxA ltxB ltxC

pPJAV632

tleD

28 29 30 31 32time (min)

28 29 30 31 32time (min)

: PltxD

9

(see Experimental Section), four peaks were present between 29.2-30.4 min for the

extract from the culture carrying ltxABC-tleD (pPJAV644, Figure 2). Each of these peaks

displayed a UV absorption spectrum (Figure S3), high-resolution protonated molecules of

452.3247, 452.3263, 452.3277, and 452.3268 ([M+H]+ calcd 452.3272, Figure S4), and

MS/MS fragmentation patterns consistent with teleocidin B-like compounds (Figure S5).

To definitively identify the structure of the compounds produced we placed ltxABC-tleD

under the control of PglnA to create pPJAV657 (Table S8). Roughly 1.1 mg of the major

compound was isolated from Anabaena 7120 containing pPJAV657 (PglnA-ltxABC-tleD)

cultivated in 20 L of BG11(Nit) medium supplemented with 50 mM fructose and

analyzed by 1H NMR, which confirmed the major product to be 4 (Figure S6, Table S1)

in agreement with previous work.9 The other three compounds were produced at low

levels and co-eluted with contaminating compounds despite the use of multiple HPLC

columns and conditions, which prevented definitive structure characterization.

Under our standard culture conditions, the PltxA-ltxABC-tleD construct produced

the four compounds in a 1.6 ± 0.3:1.1 ± 0.1:1.0 ± 0.0:6.0 ± 0.6 ratio as determined

through peak area integration in the MRM chromatogram (Figure 2, Figure S7), and

inclusion of fructose in the growth medium resulted in a similar distribution of

metabolites (2.1 ± 0.5:1.1 ± 0.2:1.1 ± 0.2:6.3 ± 1.1). The production of four compounds

here is in contrast to the observation of three compounds by Abe and co-workers.9

However, we note that it is possible that a fourth compound in the in vitro reaction co-

eluted with unreacted 2 and was therefore unobservable.9 Given the previous work, two

of the other teleocidin B-like peaks are presumed to be O-desmethylolivoretin C and

teleocidin B-1. Though the structure of the fourth compound is currently unknown, we

10

postulate that it could be either 9 or 10 (Figure S58), possibly arising from deprotonation

of the carbocation intermediate as proposed by Abe and co-workers.9 Experiments to

identify the fourth compound are underway in our lab. Production levels of the teleocidin

B-like compounds were consistent with those from our previous data on lyngbyatoxin

A,11 and the addition of fructose had variable effects on compound production (Figure 3,

Table S2-S3). While fructose did occasionally reduce the yield per dried cell mass, as

calculated in ng/mg of dried cell mass (Figure, Table S2-S3), it almost universally

increased the mass of the cells harvested (Table S4), which often increased total

compound yield.

Figure 3. Total “Teleocidin B” Production in Anabaena 7120. This is the

summed total amount of all four compounds displaying the MRM transition m/z

452.3 → 424.3. Production of the individual compounds can be seen in Table S2.

Values are given as the average ng/mg of dried cell mass standard deviation from

three replicates. Each replicate culture was grown on media containing 1.5% agar (1

plate = approximately 40 mL). afruc, denotes media containing 50 mM fructose.

0

200

400

600

800

1000

1200

1400

pPJAV36

1 (e

mpty

vec

tor)

pPJAV36

1 (e

mpty

vec

tor) fr

uc

Zeta

(em

pty ve

ctor)

Zeta

(em

pty

vect

or) fr

uc

LtxABC-T

leD

LtxABC-T

leD fr

uc

LtxABC z

eta-

TleD

LtxABC zet

a-Tle

D fr

uc

PglnA L

txAB

C-T

leD

PglnA L

txAB

C-T

leD fr

uc

ng

co

mp

ou

nd

s/m

g d

rie

d c

ell

ma

ss

ammonia nitrate

11

Multiple metabolites with an m/z of 436 (16 amu less than teleocidin B-4) were

found in minor quantities in strains producing teleocidin B-4 (Figure S9), and one of the

compounds was targeted for isolation and structure determination. HRESIMS produced a

protonated molecule at m/z 436.2956 which corresponds to the molecular formula

C27H38N3O2+ (calcd 436.2956, 0.46 ppm error, Figure S10). Examination of the 1H,

COSY, HSQC, HMBC, and NOESY NMR data established the structure as 8, a

presumed oxidative degradation product of teleocidin B-4 (4), the major compound

isolated above. In this structure, the hydroxymethylene group has

been lost and replaced by a carbonyl group to generate an imide

through an oxidative degradation (8, Figure S11-S17, Table S5).

Conversion of 4 to 8 results in a single conformer being observed in

the 1H NMR spectrum, which is in contrast to the mixture of two conformers found in the

other members of the indolactam natural products. Given the extremely low quantities in

the extract compared to teleocidin B-4 and related compounds (Figure S9), we propose

that these are non-enzymatic degradation products that accumulate during purification

and the initial oxidation could be catalyzed by contaminating chlorophyll, which elutes at

a similar time. Given that the oxidation occurs at C-9 of teleocidin B-4, we propose that

the configurations of the remaining centers are unchanged. Because the XIC of m/z

435.5-436.5 showed four compounds with a similar distribution to the teleocidin B family

of compounds, we propose that all four compounds can undergo this oxidative

degradation process; however, we only characterized one because the others co-elute with

contaminating compounds.

12

The mpnD gene encodes a prenyltransferase that, unlike TleC or LtxC, transfers a

dimethylallyl group to the C-7 position of ILV to complete the biosynthesis of

pendolmycin.7 Like the verification of tleC above, mpnD was cloned into the position of

ltxC to create pPAJV643 (ltxAB-mpnD). After introduction, culture, and extraction, and

LCMS analysis, we noted the presence of a peak only for the extract from the culture

containing ltxAB-mpnD and not for plasmids containing ltxC or tleC (Figure 4). This

peak had a shorter retention time (23.6 min) than both 2 or 4 and displayed a protonated

molecule of 370.2474 Da, consistent with the molecular formula of pendolmycin (calcd

370.2489, 4.0 ppm error, Figure S18). Additionally, the MS/MS fragmentation pattern

showed a loss of 28 Da, which was identical to the loss observed in the MS/MS

fragmentation of 2 and 4

(Figure S1, S5, S19). Isolation

of this compound from a 20 L

culture of Anabaena 7120

containing pPJAV659 (PglnA-

ltxAB-mpnD) in BG11(Nit)

media supplemented with 50

mM fructose, followed by 1H

NMR analysis, confirmed it to

be pendolmycin (Figure S20,

Table S6). Pendolmycin

production levels were

comparable with our previous

Figure 4. Production of pendolmycin. Zoomed

LCMS MRM chromatogram showing the constructs

used and production of 3 (370.3 → 342.3). Y-axis are

all scaled identically. Traces are from a single

replicate of culture grown on BG-11(Nit) media

containing 1.5% agar (1 plate = approximately 40

mL) and are representative of all samples.

22 23 24 25 26

22 23 24 25 26

22 23 24 25 26

pPJAV361 (empty vector)

22 23 24 25 26

time (min)

pPJAV500

ltxA ltxB ltxC

pPJAV642

ltxA ltxB tleC

pPJAV643

ltxA ltxB mpnD

: PltxA

N

HN

O

OH

NH

3

13

data on lyngbyatoxin A production,11 and the addition of fructose had variable effects on

the production of pendolmycin, as mentioned above (Figure 5).

These results show that

the codon-optimized tleC,

tleD, and mpnD all produce

active proteins with the

expected activity when

heterologously expressed in

Anabaena 7120.9, 15 This

demonstrates that the native

levels of transcriptional and

translational regulation exerted

when these genes occupy the

same positions as ltxC (tleC,

mpnD) and ltxD (tleD) in the

ltx gene cluster are sufficient

to produce proteins that efficiently catalyzed the desired reactions; each protein

completely converted its substrate to the expected product(s) because 1 was not observed

in extracts of ltxABC-tleD or ltxAB-mpnD. We did note the presence of trace amounts of

2 in Anabaena 7120 containing pPJAV644. We also note that no other compounds were

identified by LC-HRESIMS analysis other than the expected products (e.g. pendolmycin

in Anabaena 7120/pPJAV642) despite the fact that purified TleC and MpnD were found

to accept C5-C25 prenyl groups in vitro.15

Figure 5. Pendolmycin Production in Anabaena

7120. Values are given as the average ng/mg of dried

cell mass standard deviation from three replicates.

Each replicate culture was grown on media

containing 1.5% agar (1 plate = approximately 40

mL). afruc, denotes media containing 50 mM

fructose.

0

50

100

150

200

250

300

pPJAV36

1 (e

mpty

vec

tor)

pPJAV36

1 fruc

LtxAB-M

pnD

LtxAB-M

pnD fr

uc

PglnA L

txAB

-Mpn

D

PglnA L

txAB-M

pnD fr

uc

ng

co

mp

ou

nds/m

g d

rie

d c

ell

ma

ss

ammonia nitrate

14

Creation and Validation of a New Plasmid Vector for Use in Anabaena 7120. In the

above section, we used traditional synthetic biology to stitch together gene clusters,

which is a labor-intensive process, and so we endeavored to create a new vector (with

orthogonal antibiotic resistance) and co-transformation protocols for synthetic biology

efforts in Anabaena 7120 that could be used to quickly screen potential natural product

tailoring genes from diverse sources. To date, only the pDU1, pANS, and RSF1010

origins of replication (oriV), derived from Nostoc sp. strain PCC 7524,16 Synechococcus

elongatus strain PCC 7942,17 and Salmonella typhimurium,18 respectively, have been

shown to facilitate plasmid replication in Anabaena 7120.19-20 To provide another oriV

for use in Anabaena 7120, we sought to define a region harboring the oriV from the

endogenous Anabaena 7120 plasmid pCC7120ζ.21 Plasmid pCC7120ζ is 5.58 kb in size

and has a copy number of roughly six plasmids per chromosome;22 Anabaena 7120 is

thought to carry 10 to 20 copies of its chromosome per cell.23 This low copy number is

advantageous when carrying larger inserts as lower copy numbers typically correspond

with greater insert stability.

We amplified pCC7120ζ using PCR such that every quarter, half, three‐

quarter, and linearized whole-plasmid combination was prepared and cloned onto the

pBR322 oriV and Sp/Smr cassette from pPJAV361 for replication in E. coli (Figure

S15B). Of the nine amplification products generated, only three of these products

produced positive clones: the half segments of PCC7120ζ derived from amplification

with the primers zeta-SmaI-3F and zeta-SmaI-1R and zeta-SmaI-1F and zeta-SmaI-3R,

respectively, and the three-quarter segment derived from the primers zeta-SmaI-2F and

15

zeta-SmaI-1R, which were used to create pPJAV504, pPJAV505, and pPJAV506,

respectively (Tables S7 and S8). Anabaena 7120 colonies transformed with plasmid

pPJAV504 grew on selection following conjugation (carrying pCC7120ζ DNA

nucleotides 4533-1703, relative to the annotated starting position, e. g. the region

between primers 3F and 1R, (Figure S21A)). Two independent isolates of pPJAV504,

named pPJAV579 and pPJAV580, were re-isolated from Anabaena 7120 using a DNA

methylation-deficient strain of E. coli. Sequencing of pPJAV579 and pPJAV580 showed

that both had acquired an IS10-type transposon insertion in the pCC7120ζ portion of the

plasmids (Figure S21B).24 When pPJAV579 and pPJAV580 were re-conjugated into

Anabaena 7120, pPJAV579 displayed a far higher conjugation efficiency so the

remaining studies were conducted with this isolate.

To determine which fragment of pCC7120ζ DNA flanking the transposon

insertion was required for replication, as well as whether the transposon was involved in

this process, the pCC7120ζ DNA fragments and the proximal IS10 insertion sequence

were individually deleted from pPJAV579 and the ability to replicate in Anabaena 7120

was assessed. Only introduction of pPJAV606 (harboring the segment of pCC7120ζ

proximal to primer zeta-SmaI-1R, Figure S21C), and not pPJAV607 (harboring the

segment of pCC7120ζ proximal to primer zeta-SmaI-3F, Figure S21D, Table S8),

resulted in Anabaena 7120 colonies following antibiotic selection harboring a plasmid

that could be re-isolated. This indicates that the DNA necessary for replication of

pCC7120ζ is contained with nucleotides 5427-1703 of pCC7120ζ (relative to the

annotated starting condition). Additionally, the ability of the transposon to transpose out

of the plasmid was not involved in plasmid replication because pPJAV606, which

16

harbored the transposon with an insertion sequence removed to prohibit transposition,

yielded colonies upon introduction in Anabaena 7120. To increase the utility of this

finding, a kanamycin/neomycin resistant version of pPJAV606 was also generated

(pPJAV626). It was also possible to create a version of pPJAV626 harboring an ~42 kb

DNA fragment from Moorea producens (pPJAV655) that was introduced and maintained

in Anabaena 7120 (Figure S22).4 This indicates that the pCC7120ζ oriV can support the

replication of plasmids much larger than the native pCC7120ζ plasmid (5.58 kb). After

nearly two years of repeated cultivation following the initial introduction and continued

selection of pPJAV504 and, later, pPJAV606, we were unable to cure native pCC7120ζ.

The inability to cure pCC7120ζ indicates that it may contain an essential factor for

Anabaena 7120 growth or a portion of it aids in the replication or maintenance of

pPJAV504 and pPJAV606. In previous work, a copB homolog (asl9502), shown to be

involved in plasmid replication in other systems,25 was required for plasmid maintenance

in Anabaena 7120.22 It is possible that curing pCC7120ζ did not occur because

replication of pPJAV504 and pPJAV606 required the continued presence of asl9502 and

curing of pCC7120ζ would have resulted in colony death on continued antibiotic

selection.

Determination of Plasmid Copy Numbers in Anabaena 7120. Anabaena 7120 is

thought to maintain 10-20 copies of its chromosome per cell.23 Previous studies have

shown that pDU1-based vectors can be maintained at up to 1800 copies per chromosome

while roughly six copies of pCC7120ζ per chromosome have been observed.22, 26 To

determine the influence of relevant growth conditions and cargo of plasmids on plasmid

17

copy number, qPCR was conducted and the copy number was assessed relative to the

chromosomal concentration. The growth conditions tested were liquid and solid medium

supplemented with ammonia or nitrate and liquid diazotrophic growth. In general, the

copy numbers observed for pDU1- and pCC7120ζ-based plasmids used in this study are

similar to those previously published (Table 3).22, 26 Though copy numbers were

commonly higher in liquid medium than from cultures on solid medium, they were not

significantly different (t-test, p = 0.19). In our previous work, strengths of promoters

tested with plasmid-borne transcriptional fusions were highest during growth in liquid

cultures.11 It is very likely that the increased levels of expression previously recorded

were due to the comparably higher copy numbers of pPJAV361-based plasmids during

liquid growth. Copy numbers recorded in this work were statistically higher during

growth on media supplemented with ammonia (t-test, p > 0.0001), possibly because of

the ease of assimilation into metabolic processes. The copy number of the native

pCC7120ζ plasmid remained fairly constant within each growth condition irrespective of

the presence of pCC7120ζ-based plasmids pPJAV626 or pPJAV632. In most cases, the

copy number of pPJAV500 was higher than pPJAV361, which is consistent with

previous work indicating that the cargo of the plasmid can influence the copy number of

pDU1-derived plasmids in Anabaena 7120.26 The copy numbers of pCC7120ζ-based

plasmids with either neomycin or spectinomycin/streptomycin resistance were not

statistically different (t-test, p = 0.98), which suggests that the resistance mechanism does

not exert much control over copy number. In most growth conditions, the presence of a

pDU1-based plasmid resulted in an increased copy number of the pCC7120ζ-based

plasmids (pPJAV626 or pPJAV632), though not to a statistically different level (t-test, p

18

= 0.13). In contrast, the pDU1-based plasmid copy number was not generally altered by

the presence of a pCC7120ζ-based plasmid (t-test, p = 0.31). This suggests that the

pCC7120ζ oriV controls replication in Anabaena 7120 because these two construct types

contain the same E. coli oriV. Together, these results indicate that pDU1- and pCC7120ζ-

based plasmids can be maintained individually or together in Anabaena 7120 and that

their relative copy numbers are modulated by growth condition, plasmid cargo, and, in

some cases, the presence of additional plasmids.

Simultaneous Addition of Multiple Plasmids Via Conjugation. Plasmids are generally

introduced into Anabaena 7120 via conjugation from E. coli host strains27 containing a

self-mobilizable plasmid such as pRK24 or pRK2013.28 To increase the efficiency of

plasmid maintenance following the conjugal event, an Anabaena 7120 DNA methylase

on plasmid pRL528 is included to methylate mobilizable plasmids so they are not

digested by the native Anabaena 7120 restriction systems.27 This can proceed as a bi- or

triparental mating. In a biparental mating, the E. coli donor strain UC585 (or similar

conjugal strain) harbors three plasmids: pRK24, pRL528, and the mobilizable plasmid to

be introduced, which contains a compatible oriT.29 In a triparental mating, two E. coli

strains are utilized: one carrying pRK2013 and pRL528 (e.g. strain JCM113) and a

second strain with the oriT-containing mobilizable plasmid to be introduced into

Anabaena 7120. Using biparental, triparental, or quadriparental mating strategies, it is

theoretically possible to introduce up to two plasmids into Anabaena 7120

simultaneously. As a triparental mating, both mobilizable plasmids are introdcued

separately into E. coli strain UC585, and a quadriparental mating proceeds when E. coli

19

strain JCM113 is mixed with two E. coli strains each harboring only a single mobilizable

plasmid for transfer. We introduced pPJAV361 (pDU1-based empty vector,

Spectinomycin/Streptomycin resistant (Sp/Smr)), pPJAV500 (harboring ltxABC,

Sp/Smr),11 pPJAV626 (pCC7120ζ-based empty vector, Neomycin resistant (Neor)), and

pPJAV632 (harboring PltxD-tleD, Neor) into Anabaena 7120 singly or in combinations of

two plasmids with different selectable markers (Neor or Sp/Smr), and utilized both

triparental and quadriparental mating strategies to demonstrate the feasibility of

simultaneous addition of two plasmids to Anabaena 7120. We successfully selected for

the introduction of two plasmids using both triparental mating and quadriparental mating

with varying efficiencies (Table S7).

This is the first report of simultaneous addition of multiple plasmids into

Anabaena 7120 and indicates that pDU1 and pCC7120ζ are in different plasmid

incompatibility groups. This work also opens up the possibility of cloning multiple

biosynthetic gene clusters (BGCs) into a single Anabaena 7120 strain or splitting a BGC

into two vectors to facilitate conjugation and maintenance of said BGC.

The Use of Multiple Plasmids for Heterologous Compound Production. Following

the assessment of a new oriV for plasmid maintenance in Anabaena 7120 and

ascertaining that multiple plasmids can be conjugated into Anabaena 7120

simultaneously, we set out to determine if both plasmids (pPJAV500 and pPJAV632)

were functional in tandem. Anabaena 7120 strains carrying either pPJAV361 (empty

vector) and pPJAV626 (empty vector), or pPJAV500 (PltxA-ltxABC) and pPJAV632

(PltxD-tleD) were cultured, harvested, extracted, and assessed for the production of 2

20

and/or 4. While the negative control did not display peaks corresponding to either

compound, the two-plasmid combination resulted in the production of the teleocidin B

family of compounds in every condition tested (Figure 2, Table S2-S3). We observed

incomplete conversion of 2 to the teleocidin B family from the pPJAV500/pPJAV632

dual-plasmid system. During the media optimization experiments noted above, we noted

that the addition of fructose (50 mM) increased both LTXA yield and cell mass obtained,

greatly increasing the overall yield. We tested the effect of fructose addition on

compound production in Anabaena 7120 containing pPJAV500/pPJAV632. Cultivation

on BG-11(Nit) supplemented with 50 mM fructose resulted in no 2 being observed as

well as an increased yield of the teleocidin B family (Figure 3, Table S2-S3). This

observation and the experiments modulating plasmid copy number described above

suggest that incomplete conversion of intermediates, formed by the action of proteins

encoded on one plasmid, by accessory proteins encoded by the second plasmid may be

overcome by media optimization, promoter exchange, or shuffling genes between

plasmids.

In the S. blastmyceticus NBRC 12747 genome, the tleD gene is located distally

from tleABC.9 It is entirely possible that the tailoring genes associated with other natural

product gene clusters are spread throughout the producers’ genomes. Using this two-

plasmid system, it would be possible to clone the main gene cluster into one plasmid and

then create a cosmid library using the other plasmid to screen for tailoring genes of

interest. This strategy could also be employed to test a library of random mutants of a

single gene to identify amino acids required for function.

21

Conclusions/Summary

In this study, we showed that Anabaena 7120 is a viable host for combinatorial

biosynthesis of natural products and introduced a new plasmid backbone to enable these

investigations. Using the indolactam natural products as a test case and codon optimized

genes from Actinobacteria, we were able to produce pendolmycin and teleocidin B-4 in

acceptable yields in Anabaena 7120. We were also able to isolate and structurally

characterize a previously unknown oxidative degradation product of the indolactam

natural product family. We believe that the co-conjugation protocols and new plasmid

backbone described in this paper will be useful in studying cyanobacterial natural

products and in combinatorial biosynthesis studies in the future.

Acknowledgements. We thank Dr. Neil K. Garg (UCLA) for synthetic standards of

lyngbyatoxin A and pendolmycin. We thank Drs. William Gerwick and Lena Gerwick

(UCSD) for fos-DE-96 containing the lyngbyatoxin gene cluster. This work was

supported by the College of Pharmacy, Oregon State University, a New Investigator

Grant from the Medical Research Foundation of Oregon (grant #1415), and an AREA

award grant from the National Institutes of Health (1R15GM117541) to Benjamin

Philmus. We acknowledge the support of the Oregon State University NMR Facility

funded in part by the National Institutes of Health, HEI Grant 1S10OD018518, and by

the M. J. Murdock Charitable Trust grant #2014162. Patrick Videau was supported by

startup funds from Southern Oregon University (SOU) and use of the SOU

Biotechnology Research Center is acknowledged.

22

Abbreviations

BG-11(NH4), BG-11 media with ammonium chloride as the nitrogen source; BG-11(Nit),

BG-11 media with sodium nitrate as the nitrogen source; BGC, biosynthetic gene cluster;

COSY, correlation spectroscopy; DNA, deoxyribonucleic acid; HMBC, heteronuclear

multiple bond correlation; HPLC, high pressure liquid chromatography; HRESIMS, high

resolution electrospray ionization mass spectrometry; HSQC, heteronuclear single

quantum coherence quantum correlation; ILV, indolactam V; MRM, multiple reaction

monitoring; MS/MS, tandem mass spectrometry; Neor, neomycin resistant; NMR, nuclear

magnetic resonance; NMVT, N-methyl-L-valyl-L-tryptophanol; NOESY, Nuclear

Overhauser spectroscopy; NRPS, non-ribosmal peptide synthetase; ori, origin of

replication; oriT, origin of transfer; Smr, spectinomycin resistant; Spr, spectinomycin

resistant; XIC, extracted ion chromatogram.

Experimental Section

General Experimental Procedures. All UV-vis spectroscopy was performed using a

BioSpectrometer Kinetic (Eppendorf). NMR spectra were obtained on a Bruker DPX-500

MHz instrument with a 5mm TXI triple resonance (HCN) probe or a Bruker Avance III-

800 MHz instrument equipped with a 4-channel 5 mm TCI cryoprobe using TopSpin

version 3.5pl7. Data was processed using TopSpin version 4.0 (Bruker). Quantitation of

metabolites was obtained using a Shimadzu Prominence HPLC (consisting of a degasser,

23

two LC-10AD HPLC pumps, an autosampler, a photodiode array, and system controller)

upstream of a 3200 QTrap mass spectrometer (AbSciex) operated using the Analyst

software package. Data was analyzed offline using Peakview version 2.2 software. High-

resolution mass spectrometry was performed using an Agilent 6230 time-of-flight mass

spectrometer downstream of an Agilent 1260 Infinity HPLC system consisting of a

degasser, quaternary pump, autosampler, and diode array detector. The instrument was

operated using MassHunter software and data was processed offline using MassHunter

Qualitative software.

LCMS grade H2O and MeOH were purchased from MilliporeSigma, while all restriction

enzymes, polynucleotide kinase, Escherichia coli NEB10 and DH5MCR cells, and T4

DNA ligase were purchased from New England Biolabs. The QIAquick PCR purification

kit, QIAquick gel extraction kit, and QIAprep Spin Miniprep Kit were purchased from

Qiagen and were used according to the manufacturer’s instructions. LCMS grade H2O,

MeCN, and formic acid were purchased from Fisher Chemicals. All other chemicals were

purchased from Sigma-Aldrich and used without further purification unless otherwise

specified. Sanger sequencing was performed with Big Dye Terminator chemistry at the

Center for Genome Resources and Biocomputing (Oregon State University). Primestar

GXL was purchased from CloneTech and KOD Hot Start DNA polymerase was

purchased from EMD Millipore and both were used according to the manufacturer’s

instructions. Oligonucleotides were purchased from IDT Technologies with standard

desalting and used without further purification.

24

Bacterial Strains and Growth Conditions. The strains used in this study are listed in

Table S8. E. coli was routinely cultured in Lysogeny Broth (LB), Miller supplemented

with spectinomycin (100 g/mL), kanamycin (50 g/mL), ampicillin (100 g/mL), or

chloramphenicol (30 g/mL) for plasmid selection as previously described and solidified

with 1.5% agar for plate culture.11 Anabaena PCC 7120 was routinely grown on BG-11

medium with nitrate (BG-11(Nit)) or ammonia (BG-11(NH4)) as the nitrogen source and

supplemented with streptomycin and spectinomycin (2.5 g/mL each) or neomycin (90

g/mL) for plasmid selection as previously described.11, 30 Plasmids were introduced into

Anabaena 7120 by conjugation from E. coli as previously described.27, 31 Bacteria were

handled using aseptic technique and all molecular biology protocols were performed

according to standard procedures unless otherwise stated.32

Plasmid Construction. The plasmids used in this study are listed in Table S8. The

oligonucleotides used in this study are listed in Table S9. The preparation of inserts and

vectors for ligase-mediated cloning and /Red recombination using pKD46 in E. coli

strain BW25113 were conducted as previously described.11, 33 Plasmids pUC57-tleC,

pUC57-tleD, and pUC57-mpnD, which contain codon-optimized genes encoding TleC

and TleD from Streptomyces blastmyceticus NBRC 12747 and MpnD from

Marinactinospora thermotolerans SCSIO 00652, respectively, were purchased from

GenScript, and individually cloned into the EcoRV site of pUC57 to create pUC57-tleC,

pUC57-tleD, and pUC57-mpnD.

Construction of Plasmids pPJAV504, pPJAV505, and pPJAV506. Plasmids

pPJAV504, pPJAV505, and pPJAV506 are mobilizable shuttle vectors based on

25

pPJAV36111 with fragments of the endogenous Anabaena 7120 Zeta plasmid individually

replacing the pDU1 oriV.16, 21 Fragments 2, 3, and 6 of the Zeta plasmid were amplified

by PCR from Anabaena 7120 chromosomal DNA with the primer pairs zeta-SmaI-3F and

zeta-SmaI-1R, zeta-SmaI-4F and zeta-SmaI-2R, zeta-SmaI-2F and zeta-SmaI-1R,

respectively (Figure S16A, Table S9), and all digested with SmaI. A fragment from

pPJAV361 containing the pBR322 oriV, oriT, and the Spr/Smr Ω interposon was

amplified by PCR from pPJAV361 with the primers pAM504-pBR-F and pAM504-pBR-

R and each fragment of Zeta was individually cloned with the product to create

pPJAV504, pPJAV505, and pPJAV506.

Construction of Plasmids pPJAV579 and pPJAV580. Plasmids pPJAV579 and

pPJAV580 are mobilizable shuttle vectors based on pPJAV361 harboring a transposon

insertion within the fragment of Zeta DNA (pCC7120ζ). Following introduction and

selection of pPJAV504 in Anabaena 7120, positive colonies were isolated, genomic

DNA was extracted, and transformed into E. coli strain DH5αMCR. Plasmids were

extracted from the spectinomycin resistant E. coli colonies arising from transformation

with DNA extracted from two independent Anabaena 7120 isolates. PCR analysis

showed that the Zeta fragment amplified from each isolate was larger than analogous

fragment amplified from pPJAV504. The region was sequenced with the walking primers

505-BamHI, pAM504Ecoliup-R, Zeta2-1-walk1-F, Zeta2-1-walk1-R, and zeta-SmaI-4R.

Both isolates harbor a transposon insertion within the fragment of Zeta DNA to create

pPJAV579 and pPJAV580.

Construction of Plasmids pPJAV606 and pPJAV607. Plasmids pPJAV606 and

pPJAV607 are mobilizable shuttle vectors based on pPJAV361 harboring half of the

26

fragment of Zeta DNA on either side of the transposon insertion present in pPJAV579.

pPJAV579 was linearized by PCR with the primer pairs Tnp-int-F and pAM504-pBR-R

and Tnp-int-R and pAM504-pBR-F, respectively, and phosphorylated with

polynucleotide kinase). The products were self-ligated removing the up- and downstream

portions of Zeta DNA and the transposon insertion sequence relative to the orientation of

the transposon in pPJAV579 to create pPJAV606 and pPJAV607.

Construction of Plasmid pPJAV626. Plasmid pPJAV626 is a mobilizable shuttle

vector based on pPJAV50434 harboring the fragment of Zeta DNA allowing pPJAV606 to

replicate in Anabaena 7120. A fragment containing Zeta and transposon DNA was

amplified by PCR from pPJAV606 with the primers Zeta-SmaI-3F and pAM504-

Ecoliup-R, which was phosphorylated with polynucleotide kinase. This product was

digested with SmaI and cloned onto the portion of pAM504 required for kanamycin

resistance, conjugation, and replication in E. coli, amplified by PCR from pAM504 with

the primers pAM504-pBR-F and pAM504-pBR-R, to create pPJAV626.

Construction of Plasmid pPJAV631. Plasmid pPJAV631 is a source of the ltxA

promoter. The ltxA promoter was amplified by PCR from the fosmid fos-DE3-864 with

the primers PlxtA-XhoI-F and Pltx-R. The product was cloned into the EcoRV site of

pBlueScript SK+ (Stratagene) and screened for directionality by PCR such that the

promoter reads toward the SmaI site to create pPJAV631.

Construction of Plasmid pPJAV632. Plasmid pPJAV632 is a mobilizable shuttle

vector based on pPJAV626 carrying PltxD-tleD. The ltxD promoter region was amplified

by PCR from the fosmid fos-DE3-86 with the primers PltxD-tleC-red-F and PltxD-R and

the coding region of tleD was amplified from pUC57-tleD with the primers tleD-PltxD-

27

OEX-F and tleD-R. The products were fused by overlap extension,35 cloned into the

SmaI site of pPJAV626, and screened for directionality by PCR to read away from the

Zeta DNA involved in replication to create pPJAV632.

Construction of Plasmid pPJAV642. Plasmid pPJAV642 is a mobilizable shuttle

vector based on pPJAV361 carrying PltxA-ltxAB-tleC. The coding region of tleC was

amplified by PCR from pUC57-tleC with the primers tleC-ltxB-red-F and tleC-R and

cloned into the SmaI site of pPJAV631. A fragment containing PltxA-tleC was amplified

by PCR from the previous construct with the primers PltxA-XhoI-F and tleC-R, cloned

into the SmaI site of pPJAV361, and checked for directionality such it read away from

the spectinomycin/streptomycin resistance cassette. The resulting plasmid was linearized

by PCR with the primers Pltx-R and tleC-ltxB-red-F and electroporated into competent E.

coli as described above for lambda red recombination to recombineer ltxA-C. Resulting

transformants were screened by PCR for the presence of ltxA-C to create pPJAV642.

Construction of Plasmid pPJAV643. Plasmid pPJAV643 is a mobilizable shuttle

vector based on pPJAV361 carrying PltxA-ltxAB-mpnD. The coding region of mpnD was

amplified by PCR from pUC57-mpnD with the primers mpnD-ltxB-red-F and mpnD-R

and cloned into the SmaI site of pPJAV631. A fragment containing PltxA-mpnD was

amplified by PCR from the previous construct with the primers PltxA-XhoI-F and mpnD-

R, cloned into the SmaI site of pPJAV361, and checked for directionality such it read

away from the spectinomycin/streptomycin resistance cassette. The resulting plasmid was

linearized by PCR with the primers Pltx-R and mpnD-ltxB-red-F and electroporated into

competent E. coli as described above for lambda red recombination to recombineer ltxA-

28

C. Resulting transformants were screened by PCR for the presence of ltxA-C to create

pPJAV643.

Construction of Plasmid pPJAV644. Plasmid pPJAV644 is a mobilizable shuttle

vector based on pPJAV361 carrying PltxA-ltxABC-tleD. The coding region of tleD was

amplified by PCR from pUC57-tleD with the primers tleD-PltxD-OEX-F and tleD-R and

PltxD was amplified by PCR from fos-DE3-86 with the primers PltxD-tleC-red-F and

PltxD-R. These products were fused by overlap extension and cloned into the SmaI site

of pPJAV631. A fragment containing PltxA-PltxD-tleD was amplified by PCR from the

previous construct with the primers PltxA-XhoI-F and tleD-R, cloned into the SmaI site

of pPJAV361, and checked for directionality such it read away from the

spectinomycin/streptomycin resistance cassette. The resulting plasmid was linearized by

PCR with the primers Pltx-R and PltxD-tleC-red-F and electroporated into competent E.

coli as described above for lambda red recombination to recombineer ltxA-C. Resulting

transformants were screened by PCR for the presence of ltxA-C to create pPJAV644.

Construction of Plasmid pPJAV647. Plasmid pPJAV647 is a mobilizable shuttle

vector based on pPJAV361 carrying PglnA-ltxAB-tleC. A fragment harboring PglnA-ltxA

was amplified by PCR from pPJAV50311 with the primers PglnA-XhoI-F and ltxA-int-

SmaI-R. The product was cloned as an XhoI-NdeI fragment into the same sites of

pPJAV642 to create pPJAV647.

Construction of Plasmid pPJAV650, pPJAV657, pPJAV658, and pPJAV659.

Plasmids pPJAV650, pPJAV657, pPJAV658, and pPJAV659 are mobilizable shuttle

vectors based on pPJAV361 carrying PglnA-ltxAB-mpnD-tleD, PglnA-ltxABC-tleD, PglnA-

ltxAB-tleC-tleD, and PglnA-ltxAB-mpnD, respectively. A fragment harboring PglnA-ltxA was

29

amplified by PCR from pPJAV503 with the primers PglnA-XhoI-F and ltxA-int-SmaI-R,

digest with XhoI, and cloned into the XhoI-EcoRV sites of pBlueScript SK+. Fragments

containing mpnD-tleD, ltxC-tleD, tleC-tleD, and mpnD were amplified by PCR from

pPJAV645, pPJAV644, pPJAV646, and pPJAV643, respectively, with the forward

primer ltxB-int-NdeI-F and the corresponding reverse primer tleD-R or mpnD-R. The

products were digested with NdeI and individually cloned into the NdeI-SmaI sites

downstream of PglnA-ltxA in pBlueScript SK+. Fragments containing PglnA-ltxA-mpnD-

tleD, PglnA-ltxA-ltxC-tleD, PglnA-ltxA-tleC-tleD, and PglnA-ltxA-mpnD were excised from

pBlueScript SK+ via XhoI-SacI digestion and cloned into the SalI-SacI sites of

pPJAV361. Each of the resulting constructs was linearized by NdeI digestion and

electroporated into competent E. coli as described above for Lambda Red recombination

to recombineer ltxAB. Resulting transformants were screened by PCR for the presence of

ltxAB, ltxC, tleC, tleD, and mpnD as appropriate to create pPJAV650, pPJAV657,

pPJAV658, and pPJAV659, respectively.

Construction of Plasmid pPJAV653. Plasmid pPJAV653 is a mobilizable shuttle

vector based on pAM50436 carrying the coding region of hetR as well as an Ω interposon

conferring resistance to spectinomycin and streptomycin. The coding region of hetR was

amplified by PCR from Anabaena 7120 chromosomal DNA with the primers HetR-NdeI-

F and HetR-R and the product was cloned into the SmaI site of pAM504. This construct

was digested with EcoRI, blunt-ended, and the Ω interposon from pDW937 was cloned in

as a blunt-ended HindIII fragment to create pPJAV653.

Construction of Plasmid pPJAV655. Plasmid pPJAV655 is a mobilizable shuttle

vector based on pPJAV626 carrying the ~40 kb M. producens DNA fragment from fos-

30

DE3-86. Regions up- and downstream of the M. producens insert were amplified by PCR

from fos-DE3-86 with the primer pairs fos-up-F and fos-up-BamHI-R and fos-dn-

BamHI-F and fos-dn-EcoRI-R, respectively. The up- and downstream products were

digested with BamHI and cloned into the SmaI site of pPJAV626. The resulting plasmid

was linearized by PCR with the primers fos-dn-BamHI-F and fos-up-BamHI-R and

electroporated into competent E. coli as described above for Lambda Red recombination

to recombineer the M. producens DNA fragment from fos-DE3-86. Resulting

transformants were screened by PCR for the presence of ltxA-D to create pPJAV655.

Quantification of Conjugation Efficiency. Anabaena 7120 was cultured in 100 mL of

BG-11 (Nit) until mid-log phase (OD750 of 0.6 – 0.9), cells were pelleted using

centrifugation at 2,000 x g for 3 min, all but 10 mL of the supernatant was decanted, and

then the cells were transferred to a glass culture tube. The culture was disrupted by

sonication with a Branson 3510 sonicator until the average filament length was roughly

10 cells long as determined by visual assessment. E. coli strains NEB10β (New England

Biolabs) and UC585,29 individually harboring pPJAV361, pPJAV500, pPJAV606, or

pPJAV636, and JCM113 (HB101 with pRL528 and pRK2013 for conjugation, a kind gift

of J. C. Meeks) were grown overnight in 2 mL liquid cultures of LB containing the

appropriate antibiotic, and were used to inoculate fresh 2 mL LB cultures in the morning

(1:100 dilution). Once these new cultures grew to an OD600 of 0.7-0.9, they were pelleted

by centrifugation at 7,000 x g and washed twice with BG-11(Nit). For conjugation, 200

μL of sonicated Anabaena 7120 (about 5.6 x 108 CFU) was mixed with 50 μL of each

washed E. coli strain (about 2.1 x 108 CFU) and allowed to dry onto the surface of BG-

31

11(Nit) plates supplemented with 5% LB broth as previously described.31 Every bi-, tri-,

and quadraparental mating was mixed in triplicate to create all possible combinations that

would result in the introduction of one or two plasmids. After 2 days of growth on the

conjugation plates, each mix was individually resuspended in 1 mL of BG-11(Nit) and

used to create five ten-fold serial dilutions from which 300 uL was plated onto BG-

11(Nit) supplemented with the appropriate antibiotics. Colonies were counted 3 weeks

later and used to calculate the combined efficiency of conjugation, plate transfer, and

selection as compared to the possible growth of the unconjugated sonicated Anabaena

7120 culture. The data was expressed in this manner because it more accurately

represents the number of colonies expected following completion of this protocol rather

than solely an approximation of conjugal efficiency.

Production, Purification, and LC-MS/MS Quantification of Lyngbyatoxin A,

Pendolmycin A, and Teleocidin B. Assays for the production of heterologously

expressed compounds were prepared, carried out, and compounds were extracted as

previously described.11 Assay conditions were identical to those previously published.11

LC-MS/MS analyses were conducted as previously described with minor modifications.

Briefly, a Shimadzu Prominence HPLC consisting of a degasser, two LC-10AD HPLC

pumps, an autosampler, a photodiode array, and system controller, upstream of a 3200

QTrap mass spectrometer (AbSciex) was used for separation and quantitation. Separation

was achieved using a Luna C18(2) column (2.0 Å~ 150 mm, 3 μm, Phenomenex) with a

flow rate of 0.2 mL/min with line A containing H2O + 0.1% (v/v) formic acid and line B

containing MeCN + 0.1% (v/v) formic acid, which operated under the following

32

program. The column was pre-equilibrated in 95% A/5% B, and upon injection, this

composition was held for 1 min. The composition of mobile phase was then changed to

0% A/100% B over 29 min utilizing a linear gradient. This composition was held for 5

min, followed by changing to 95% A/5% B over 3 min. The column was equilibrated in

95% A/5% B for 5 min prior to the next injection. Under these chromatographic

conditions, pendolmycin eluted at 23 min, lyngbyatoxin A eluted at 29 min, and the four

compounds with protonated molecules at m/z 452.3 eluted from 29.2-30.4 min. MS/MS

analysis was done in MRM mode for pendolmycin (Q1, 370.3; Q2, 242.3; 40 ms),

lyngbyatoxin A (Q1, 438.3; Q2, 410.2; 40 ms), and m/z 452.3 compounds (Q1, 452.3;

Q2, 424.2; 40 ms). The instrument was operated with Analyst 1.5.1, build 5218, and data

analysis was performed with PeakView, ver. 2.1.0.11041 (AbSciex). Known

concentrations of purified pendolmycin, lyngbyatoxin A, and teleocidin B-4 were run on

the same program and standard curves were created for the low range from the MRM

programs described above and for the high range by integrating the area under the UV

curve at 300 ± 2 nm.

DNA Extraction and Plasmid Copy Number Determination by qPCR. Anabaena

7120 strains harboring pPJAV361, pPJAV500, pPJAV606, pPJAV626, and/or

pPJAV636 were grown on plates or in 30 mL liquid cultures in identical conditions to

those used for heterologous expression, as well as in liquid BG-11(NH4) or liquid BG-

11(Nit) 48 h after the removal of combined nitrogen, to represent many physiologically

relevant growth conditions. After the required culture duration, cells were scraped from

plates or pelleted by centrifugation at 2,000 x g for 3 min, washed with TES (10 mM Tris

33

HCl, pH 7.5; 25 mM EDTA, pH 8.0, 500 mM NaCl) to remove exopolysaccharides as

previously described,38 and stored at -80 °C until processing. The pellets were treated

with lysozyme as previously described39 and DNA was purified by phenol-chloroform

extraction as described.40-41 DNA concentrations were measured using a BioSpectrometer

kinetic (Eppendorf) and all samples were diluted to 100 pg/uL for use. All qPCRs were

performed in MicroAmp Fast Optical 96 well reaction plates (Thermo Fisher Scientific)

covered with MicroAmp Optical Adhesive film (Thermo Fisher Scientific). qPCR

reactions were assembled manually and contained 10 pmol of each primer, 100 pg of

template DNA, and 10 μL of iTaq Universal SYBR Green Supermix (Bio-Rad) in 20 μL

reactions. The primers AMO-645 and AMO-646 were utilized to amplify a portion of the

hetR coding region to assesses the concentration of Anabaena 7120 chromosomes as

previously described.22 Portions of the alr9504, nptII, and aadAI genes were amplified

from purified plasmid DNA with the primer sets Zeta-qPCR-F and Zeta-qPCR-R, AMO-

679 and AMO-680, and aadA1-F and aadA1-R, respectively, as previously described.22

The reaction profile was 3 min at 95 °C followed by 40 cycles of 30 s at 95°C, 30 s at 56

°C, and 30 s at 72 °C. An annealing temperature of 56°C was used because this

temperature elicited similar amplification levels from all primer sets. Negative controls

(no template DNA) were included and a melting curve analysis was performed in all

cases. qPCRs were performed with two biological replicates and technical triplicate of

each DNA sample in a StepOnePlus Real-Time PCR System (Applied Biosystems).

Standard curves were performed with eight ten-fold serial dilutions for each primer set in

technical triplicate, using purified PCR products, derived from either pPJAV653 or

chromosomal DNA, as templates. The relative quantities of each sample were calculated

34

using the ΔΔCt method, considering each primer’s specific efficiency calculated from the

standard curves. All values are expressed as the plasmid copy number per chromosome as

previously described.22

35

Table 1. Copy Number of pDU1- and Zeta-based Plasmids in Anabaena 7120 During

Culture in Liquid or Solid BG-11 Medium Supplemented with Nitrate or Ammonia

as Nitrogen Sources or Grown Diazotrophically. Experiments not conducted are

denoted as N/A.

Liquid BG-11

Plasmids pDU1 Zeta-Sp/Km Native Zeta

pPJAV606 N/A 4.9 ± 0.01 12.9 ± 0.6

pPJAV626 N/A 2.1 ± 0.2 1.9 ± 0.1

pPJAV632 N/A 4.2 ± 0.1 12.2 ± 0.2

pPJAV361 2.9 ± 0.1 N/A 10.7 ± 0.3

pPJAV500 15.9 ± 0.3 N/A 12.2 ± 0.9

pPJAV361 + pPJAV626 15.5 ± 0.0 1.4 ± 0.1 11.8 ± 0.5

pPJAV361 + pPJAV632 3.2 ± 0.2 3.6 ± 0.1 9.9 ± 0.1

pPJAV500 + pPJAV626 8.1 ± 0.1 8.9 ± 0.2 9.9 ± 0.2

pPJAV500 + pPJAV632 4.4 ± 2.1 4.9 ± 2.5 10.4 ± 0.2

Liquid BG-11(NH4)

Plasmids pDU1 Zeta-Sp/Km Native Zeta

pPJAV606 N/A 6.1 ± 0.8 15.6 ± 2.1

pPJAV626 N/A 1.7 ± 0.1 1.5 ± 0.1

pPJAV632 N/A 5.0 ± 1.0 17.3 ± 5.3

pPJAV361 182.2 ± 8.7 N/A 17.4 ± 5.3

pPJAV500 414.5 ± 64.1 N/A 25.4 ± 5.4

pPJAV361 + pPJAV626 296.4 ± 84.3 2.8 ± 0.7 30.3 ± 5.1

pPJAV361 + pPJAV632 93.9 ± 16.6 92.2 ± 15.5 13.9 ± 1.4

pPJAV500 + pPJAV626 237.7 ± 5.2 230.5 ± 6.4 19.0 ± 3.4

pPJAV500 + pPJAV632 199.0 ± 44.7 206.9 ± 34.8 20.1 ± 1.2

Liquid BG-11 Diazotrophy

Plasmids pDU1 Zeta-Sp/Km Native Zeta

pPJAV606 N/A 5.9 ± 0.7 1.5 ± 0.0

pPJAV626 N/A 2.4 ± 0.2 2.2 ± 0.0

pPJAV632 N/A 5.2 ± 0.4 2.2 ± 0.2

pPJAV361 3.1 ± 0.1 N/A 1.7 ± 0.0

pPJAV500 17.9 ± 1.4 N/A 1.9 ± 0.0

pPJAV361 + pPJAV626 6.7 ± 0.1 1.3 ± 0.1 1.9 ± 0.2

pPJAV361 + pPJAV632 13.0 ± 1.0 3.8 ± 0.4 2.0 ± 0.1

pPJAV500 + pPJAV626 2.9 ± 0.1 9.0 ± 2.3 1.5 ± 0.3

pPJAV500 + pPJAV632 7.4 ± 1.9 7.5 ± 1.1 1.4 ± 0.1

BG-11 Plates

Plasmids pDU1 Zeta-Sp/Km Native Zeta

pPJAV606 N/A 7.5 ± 1.5 1.9 ± 0.1

pPJAV626 N/A 4.2 ± 0.2 1.9 ± 0.1

pPJAV632 N/A 4.7 ± 0.6 1.4 ± 0.1

36

pPJAV361 2.8 ± 0.1 N/A 1.5 ± 0.01

pPJAV500 12.9 ± 0.3 N/A 1.4 ± 0.1

pPJAV361 + pPJAV626 2.7 ± 0.2 13.8 ± 0.1 1.7 ± 0.1

pPJAV361 + pPJAV632 1.8 ± 0.5 23.3 ± 1.7 1.3 ± 0.1

pPJAV500 + pPJAV626 1.9 ± 0.02 24.6 ± 1.9 1.1 ± 0.01

pPJAV500 + pPJAV632 2.2 ± 0.02 29.7 ± 1.0 1.2 ± 0.01

BG-11(NH4) Plates

Plasmids pDU1 Zeta-Sp/Km Native Zeta

pPJAV606 N/A 10.4 ± 5.3 1.3 ± 1.2

pPJAV626 N/A 1.1 ± 0.3 1.1 ± 1.0

pPJAV632 N/A 38.0 ± 0.1 1.9 ± 0.1

pPJAV361 99.5 ± 33.0 N/A 2.3 ± 0.2

pPJAV500 244.8 ± 12.8 N/A 5.6 ± 0.6

pPJAV361 + pPJAV626 203.4 ± 39.5 30.8 ± 1.2 3.5 ± 0.2

pPJAV361 + pPJAV632 493.7 ± 149.5 438.1 ± 56.4 1.5 ± 0.1

pPJAV500 + pPJAV626 692.7 ± 17.3 744.1 ± 2.9 1.7 ± 0.1

pPJAV500 + pPJAV632 763.7 ± 28.6 828.1 ± 77.0 1.8 ± 0.01

37

References

1. Dittmann, E.; Gugger, M.; Sivonen, K.; Fewer, D. P., Natural product

biosynthetic diversity and comparative genomics of the cyanobacteria. Trends Microbiol.

2015, 23 (10), 642-652.

2. Gerwick, William H.; Moore, Bradley S., Lessons from the past and charting the

future of marine natural products drug discovery and chemical biology. Chem. Biol.

2012, 19 (1), 85-98.

3. Kleigrewe, K.; Gerwick, L.; Sherman, D. H.; Gerwick, W. H., Unique marine

derived cyanobacterial biosynthetic genes for chemical diversity. Nat. Prod. Rep. 2016,

33 (2), 348-364.

4. Edwards, D. J.; Gerwick, W. H., Lyngbyatoxin biosynthesis: Sequence of

biosynthetic gene cluster and identification of a novel aromatic prenyltransferase. J. Am.

Chem. Soc. 2004, 126 (37), 11432-11433.

5. Cardellina, J. H., 2nd; Marner, F. J.; Moore, R. E., Seaweed dermatitis: structure

of lyngbyatoxin A. Science 1979, 204 (4389), 193-195.

6. Basu, A.; Kozikowski, A. P.; Lazo, J. S., Structural requirements of lyngbyatoxin

A for activation and downregulation of protein kinase C. Biochemistry 1992, 31 (15),

3824-3830.

7. Ma, J.; Zuo, D.; Song, Y.; Wang, B.; Huang, H.; Yao, Y.; Li, W.; Zhang, S.;

Zhang, C.; Ju, J., Characterization of a single gene cluster responsible for

methylpendolmycin and pendolmycin biosynthesis in the deep sea bacterium

Marinactinospora thermotolerans. ChemBioChem 2012, 13 (4), 547-552.

38

8. Yamashita, T.; Imoto, M.; Isshiki, K.; Sawa, T.; Naganawa, H.; Kurasawa, S.;

Zhu, B.-Q.; Umezawa, K., Isolation of a new indole alkaloid, pendolmycin, from

Nocardiopsis. J. Nat. Prod. 1988, 51 (6), 1184-1187.

9. Awakawa, T.; Zhang, L.; Wakimoto, T.; Hoshino, S.; Mori, T.; Ito, T.; Ishikawa,

J.; Tanner, M. E.; Abe, I., A methyltransferase initiates terpene cyclization in teleocidin B

biosynthesis. J. Am. Chem. Soc. 2014, 136 (28), 9910-9913.

10. Hitotsuyanagi, Y.; Fujiki, H.; Suganuma, M.; Aimi, N.; Sakai, S.; Endo, Y.;

Shudo, K.; Sugimura, T., Isolation and structure elucidation of teleocidin B-1, B-2, B-3,

and B-4. Chem Pharm Bull (Tokyo) 1984, 32 (10), 4233-4236.

11. Videau, P.; Wells, K. N.; Singh, A. J.; Gerwick, W. H.; Philmus, B., Assessment

of Anabaena sp. strain PCC 7120 as a heterologous expression host for cyanobacterial

natural products: Production of lyngbyatoxin A. ACS Synth. Biol. 2016, 5 (9), 978-988.

12. Jones, A. C.; Ottilie, S.; Eustáquio, A. S.; Edwards, D. J.; Gerwick, L.; Moore, B.

S.; Gerwick, W. H., Evaluation of Streptomyces coelicolor A3(2) as a heterologous

expression host for the cyanobacterial protein kinase C activator lyngbyatoxin A. FEBS J.

2012, 279 (7), 1243-1251.

13. Ongley, S. E.; Bian, X.; Zhang, Y.; Chau, R.; Gerwick, W. H.; Müller, R.; Neilan,

B. A., High-titer heterologous production in E. coli of lyngbyatoxin, a protein kinase C

activator from an uncultured marine cyanobacterium. ACS Chem. Biol. 2013, 8 (9), 1888-

1893.

14. Stebegg, R.; Wurzinger, B.; Mikulic, M.; Schmetterer, G., Chemoheterotrophic

growth of the cyanobacterium Anabaena sp. strain PCC 7120 dependent on a functional

cytochrome c oxidase. J. Bacteriol. 2012, 194 (17), 4601-4607.

39

15. Mori, T.; Zhang, L.; Awakawa, T.; Hoshino, S.; Okada, M.; Morita, H.; Abe, I.,

Manipulation of prenylation reactions by structure-based engineering of bacterial

indolactam prenyltransferases. Nat. Commun. 2016, 7 (EARLY EDITION).

16. Wolk, C. P.; Vonshak, A.; Kehoe, P.; Elhai, J., Construction of shuttle vectors

capable of conjugative transfer from Escherichia coli to nitrogen-fixing filamentous

cyanobacteria. Proc. Natl. Acad. Sci. U. S. A. 1984, 81 (5), 1561-1565.

17. Chen, Y.; Taton, A.; Go, M.; London, R. E.; Pieper, L. M.; Golden, S. S.; Golden,

J. W., Self-replicating shuttle vectors based on pANS, a small endogenous plasmid of the

unicellular cyanobacterium Synechococcus elongatus PCC 7942. Microbiology 2016, 162

(12), 2029-2041.

18. Anderson, E. S.; Lewis, M. J., Characterization of a transfer factor associated with

drug resistance in Salmonella typhimurium. Nature 1965, 208 (5013), 843-849.

19. Wolk, C. P.; Fan, Q.; Zhou, R.; Huang, G.; Lechno-Yossef, S.; Kuritz, T.;

Wojciuch, E., Paired cloning vectors for complementation of mutations in the

cyanobacterium Anabaena sp. strain PCC 7120. Arch. Microbiol. 2007, 188 (6), 551-563.

20. Fan, Q.; Huang, G.; Lechno-Yossef, S.; Wolk, C. P.; Kaneko, T.; Tabata, S.,

Clustered genes required for synthesis and deposition of envelope glycolipids in

Anabaena sp. strain PCC 7120. Mol. Microbiol. 2005, 58 (1), 227-243.

21. Kaneko, T.; Nakamura, Y.; Wolk, C. P.; Kuritz, T.; Sasamoto, S.; Watanabe, A.;

Iriguchi, M.; Ishikawa, A.; Kawashima, K.; Kimura, T.; Kishida, Y.; Kohara, M.;

Matsumoto, M.; Matsuno, A.; Muraki, A.; Nakazaki, N.; Shimpo, S.; Sugimoto, M.;

Takazawa, M.; Yamada, M.; Yasuda, M.; Tabata, S., Complete genomic sequence of the

40

filamentous nitrogen-fixing cyanobacterium Anabaena sp. strain PCC 7120. DNA Res.

2001, 8 (5), 205-213.

22. Lee, M. H.; Scherer, M.; Rigali, S.; Golden, J. W., PlmA, a new member of the

GntR family, has plasmid maintenance functions in Anabaena sp. strain PCC 7120. J.

Bacteriol. 2003, 185 (15), 4315-4325.

23. Lang, J. D.; Haselkorn, R., A vector for analysis of promoters in the

cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol. 1991, 173 (8), 2729-2731.

24. Chalmers, R. M.; Kleckner, N., IS10/Tn10 transposition efficiently

accommodates diverse transposon end configurations. EMBO J. 1996, 15 (18), 5112-

5122.

25. del Solar, G.; Hernández-Arriaga, A. M.; Gomis-Rüth, F. X.; Coll, M.; Espinosa,

M., A genetically economical family of plasmid-encoded transcriptional repressors

involved in control of plasmid copy number. J. Bacteriol. 2002, 184 (18), 4943-4951.

26. Yang, Y.; Huang, X.-Z.; Wang, L.; Risoul, V.; Zhang, C.-C.; Chen, W.-L.,

Phenotypic variation caused by variation in the relative copy number of pDU1-based

plasmids expressing the GAF domain of Pkn41 or Pkn42 in Anabaena sp. PCC 7120.

Res. Microbiol. 2013, 164 (2), 127-135.

27. Elhai, J.; Wolk, C. P., [83] Conjugal transfer of DNA to cyanobacteria. In

Methods Enzymol., Academic Press: 1988; Vol. Volume 167, pp 747-754.

28. Figurski, D. H.; Helinski, D. R., Replication of an origin-containing derivative of

plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci.

U. S. A. 1979, 76 (4), 1648-1652.

41

29. Liang, J.; Scappino, L.; Haselkorn, R., The patB gene product, required for

growth of the cyanobacterium Anabaena sp. strain PCC 7120 under nitrogen-limiting

conditions, contains ferredoxin and helix-turn-helix domains. J. Bacteriol. 1993, 175 (6),

1697-1704.

30. Mitschke, J.; Vioque, A.; Haas, F.; Hess, W. R.; Muro-Pastor, A. M., Dynamics

of transcriptional start site selection during nitrogen stress-induced cell differentiation in

Anabaena sp. PCC 7120. Proc. Natl. Acad. Sci. U. S. A. 2011, 108 (50), 20130-20135.

31. Elhai, J.; Vepritskiy, A.; Muro-Pastor, A. M.; Flores, E.; Wolk, C. P., Reduction

of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC

7120. J. Bacteriol. 1997, 179 (6), 1998-2005.

32. Sambrook, J.; Russell, D., Molecular Cloning: A Laboratory Manual. Cold

Spring Harbor Labs Publishing: Cold Spring Harbor, N.Y, 2001; p 2344.

33. Datsenko, K. A.; Wanner, B. L., One-step inactivation of chromosomal genes in

Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 2000, 97 (12),

6640-6645.

34. Wei, T. F.; Ramasubramanian, T. S.; Golden, J. W., Anabaena sp. strain PCC

7120 ntcA gene required for growth on nitrate and heterocyst development. J. Bacteriol.

1994, 176 (15), 4473-4482.

35. Higuchi, R.; Krummel, B.; Saiki, R., A general method of in vitro preparation and

specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic

Acids Res. 1988, 16 (15), 7351-7367.

42

36. Wei, T. F.; Ramasubramanian, T. S.; Pu, F.; Golden, J. W., Anabaena sp. strain

PCC 7120 bifA gene encoding a sequence-specific DNA-binding protein cloned by in

vivo transcriptional interference selection. J. Bacteriol. 1993, 175 (13), 4025-4035.

37. Golden, J. W.; Wiest, D. R., Genome rearrangement and nitrogen fixation in

Anabaena blocked by inactivation of xisA gene. Science 1988, 242 (4884), 1421-1423.

38. Smith, R. J.; Carr, N. G., An investigation of RNA synthesis in Anacystis nidulans

during exponential growth using techniques of RNA-DNA hybridization. J. Gen.

Microbiol. 1977, 98 (2), 559-567.

39. Craig, I. W.; Leach, C. K.; Carr, N. G., Studies with deoxyribonucleic acid from

blue-green algae. Arch. Microbiol. 1969, 65 (3), 218-227.

40. Pigott, G. H.; Midgley, J. E., Characterization of rapidly labelled ribonucleic acid

in Escherichia coli by deoxyribonucleic acid-ribonucleic acid hybridization. Biochem. J.

1968, 110 (2), 251-263.

41. Bancroft, I.; Wolk, C. P., Characterization of an insertion sequence (IS891) of

novel structure from the cyanobacterium Anabaena sp. strain M-131. J. Bacteriol. 1989,

171 (11), 5949-5954.

43

Table of Content Graphic

download fileview on ChemRxivCombiBiosynth-Anabaena__2019December03.pdf (632.96 KiB)

S1

Supporting Information for:

Expanding the Natural Products Heterologous Expression Repertoire in the Model

Cyanobacterium Anabaena sp. Strain PCC 7120: Production of Pendolmycin and the

Teleocidin B-4.

Patrick Videau,†,§ Kaitlyn N. Wells,‡,† Arun J. Singh,† Jessie Eiting,† Philip J. Proteau,† Benjamin

Philmus†,*

†Department of Pharmaceutical Sciences, College of Pharmacy, Oregon State University,

Corvallis, OR 97331

‡Undergraduate Honors College, Oregon State University, Corvallis, OR 97331

Present address: §Department of Biology, Southern Oregon University, Ashland, OR 97520

Email: benjamin.philmus@oregonstate.edu

S2

Table of Contents

1. Figure S1: MS/MS spectra (positive ionization mode, 438.3, collision energy, 45.0) of

lyngbyatoxin A (2) produced by Anabaena 7120 containing pPJAV642...................... S3

2. Figure S2: 1H NMR spectrum (500 MHz) of lyngbyatoxin A (2) isolated from Anabaena

7120 containing pPJAV647 (PglnA-ltxABtleC) .............................................................. S4

3. Figure S3: UV spectra of the four compounds produced by Anabaena 7120 containing

pPJAV644 (PltxA-ltxABC-tleD) ....................................................................................... S5

4. Figure S4: High resolution ESIMS spectra (positive ionization mode) for the four

compounds produced by Anabaena 7120 containing pPJAV644 (PltxA-ltxABC-tleD) .. S6

5. Figure S5: MS/MS spectra (positive ionization mode, 452.3, collision energy, 45.0) for

the four compounds produced by Anabaena 7120 containing pPJAV644 (PltxA-ltxABC-

tleD) ............................................................................................................................... S7

6. Figure S6: 1H NMR spectrum (500 MHz) of teleocidin B-4 isolated from Anabaena

7120 containing pPJAV644 (PltxA-ltxABC-tleD) ............................................................ S8

7. Figure S7: Representative LCMS chromatogram demonstrating the ratio of teleocidin B-

like compounds produced in Anabaena 7120 containing pPJAV644 (PltxA-ltxABC-tleD).

........................................................................................................................................ S9

8. Figure S8: Potential structures of the shunt metabolites resulting from methylation by

TleD followed by deprotonation .................................................................................... S9

9. Figure S9: Representative LCMS chromatogram demonstrating the production of

compounds with an m/z of 452 compared to m/z 436 produced by Anabaena 7120

containing pPJAV644 (PltxA-ltxABC-tleD) .................................................................. S10

10. Figure S10: A. High resolution ESIMS spectra (positive ionization mode) for compound

7; B. UV-vis spectrum of compound 8 ........................................................................ S10

11. Figure S11: 1H NMR (800 MHz) spectra of compound 8 .......................................... S11

12. Figure S12: 1H-13C HSQC spectra of compound 8..................................................... S12

13. Figure S13: 1H-13C HMBC spectra of compound 8 ................................................... S13

14. Figure S14: 1H-1H COSY spectra of compound 8 ...................................................... S14

15. Figure S15: 1H-1H NOESY (600 ms mixing time) spectra of compound 8 ............... S15

16. Figure S16: Structure of the isolated degradation product (8) derived from teleocidin B-4

with atom numbering ................................................................................................... S16

17. Figure S17: Proposed mechanism for the degradation of O-desmethylolivoretin C to

compound 8 .................................................................................................................. S16

18. Figure S18: A. High resolution ESIMS spectra (positive ionization mode) for

pendolmycin produced by Anabaena 7120 containing pPJAV643 (PltxA-ltxAB-mpnD).

...................................................................................................................................... S16

19. Figure S19: MS/MS spectra of ESIMS spectra (positive ionization mode, 370.3, CE

45.0) for pendolmycin (3) produced by Anabaena 7120 containing pPJAV643 (PltxA-

ltxAB-mpnD) ............................................................................................................... S17

20. Figure S20: 1H NMR spectrum (500 MHz) of pendolmycin isolated from Anabaena

7120 containing pPJAV659 (PglnA-ltxAB-mpnD). ..................................................... S18

21. Figure S21: Diagram of plasmids created to define the pCC7120ζ origin of replication

(oriV)............................................................................................................................ S19

22. Figure S22: Figure demonstrating the stability of pPJAV655, which contains a large

(~40 kb) insert. ............................................................................................................. S20

S3

23. Table S1: NMR data (500 MHz) for teleocidin B-4 (4) collected from Anabaena 7120

containing pPJAV657 (PglnA-ltxABC-tleD) in CDCl3. ................................................. S21

24. Table S2: LCMS determined yields of teleocidin B-like compounds in Anabaena 7120

...................................................................................................................................... S22

25. Table S3: Production of lyngbyatoxin A (2) in Anabaena 7120 ................................ S23

26. Table S4: Dried cell mass values obtained during growth of Anabaena 7120 ........... S24

27. Table S5: NMR data (800 MHz) for compound 8 in CDCl3 purified from collected from

Anabaena 7120 containing pPJAV657 (PglnA-ltxABC-tleD) ........................................ S25

28. Table S6: NMR data (500 MHz) for pendolmycin (3) in CDCl3 ............................... S26

29. Table S7: Efficiency of plasmid introduction into Anabaena 7120............................ S27

30. Supplemental discussion ............................................................................................ S27

31. Table S8: Strains and plasmids utilized in this study.................................................. S28

32. Table S9: Oligonucleotide primers used in this study. ............................................... S30

33. References ................................................................................................................... S32

Figure S1: MS/MS spectra (positive ionization mode, 438.3, collision energy, 45.0) of

lyngbyatoxin A produced by Anabaena 7120 containing pPJAV642.

50 150 250 350 450

m/z

410.5

393.5

351.5

S4

Figure S2: 1H NMR spectrum (500 MHz) of lyngbyatoxin A isolated from Anabaena 7120 containing pPJAV647 (PglnA-ltxABtleC).

9.59.0

8.58.0

7.57.0

6.56.0

5.55.0

4.54.0

3.53.0

2.52.0

1.51.0

ppm

S5

Figure S3: UV spectra of the four compounds produced by Anabaena 7120 containing

pPJAV644 (PltxA-ltxABC-tleD). The numbers indicate the order of elution seen in Figure S7.

1 2

3 4

S6

Figure S4: High resolution ESIMS spectra (positive ionization mode) for the four compounds produced by Anabaena 7120 containing

pPJAV644 (PltxA-ltxABC-tleD). The numbers indicate the order of elution seen in Figure S7.

1 2

3 4

S7

Figure S5: MS/MS spectra (positive ionization mode, 452.3, collision energy, 45.0) for the four compounds produced by Anabaena 7120

containing pPJAV644 (PltxA-ltxABC-tleD). The numbers indicate the order of elution seen in Figure S7.

50 150 250 350 450

m/z

424.5

407.6

365.6

50 150 250 350 450

m/z

424.5

407.6

365.6

50 150 250 350 450

m/z

424.5

407.5365.5

50 150 250 350 450

m/z

424.4

407.5

365.6

1

3

2

4

S8

Figure S6: 1H NMR spectrum (500 MHz) of teleocidin B-4 (4) isolated from Anabaena 7120 containing pPJAV644 (PltxA-ltxABC-tleD).

9.59.0

8.58.0

7.57.0

6.56.0

5.55.0

4.54.0

3.53.0

2.52.0

1.51.0

ppm

S9

Figure S7: Representative LCMS chromatogram demonstrating the ratio of compounds

produced in Anabaena 7120 containing pPJAV644 (PltxA-ltxABC-tleD). The extracted ion

chromatogram was generated from the MS/MS transition established for teleocidin B (m/z

452.3→ 424.3). This is representative chromatogram from a single analysis, but the additional

replicate runs appear similar.

-5.0E+00

1.0E+04

2.0E+04

3.0E+04

4.0E+04

5.0E+04

6.0E+04

7.0E+04

8.0E+04

0 10 20 30

Ion

co

un

ts (

ab

s.)

time (min)

MRM (m/z 452.3-->424.3)

1

4

Figure S8: Potential structures of the shunt metabolites resulting from methylation by

TleD followed by deprotonation.

S10

Figure S9: Representative LCMS chromatogram demonstrating the production of compounds

with a m/z of 452 compared to m/z 436 produced by Anabaena 7120 containing pPJAV644 (PltxA-

ltxABC-tleD). A. Total ion current chromatogram. B. Extracted ion chromatogram for

“teleocidin B” (m/z 451.5-452.5), black trace; and “imido-teleocidin B” (m/z 435.5-436.5), red

trace. Insert is the zoomed in region of panel B from 28-33 min.

Figure S10: A. High resolution ESIMS spectra (positive ionization mode) for compound 8; B.

UV-vis spectrum of compound 8.

-5.0E+00

2.0E+08

4.0E+08

6.0E+08

8.0E+08

1.0E+09

1.2E+09

1.4E+09

1.6E+09

0 10 20 30

Ion

co

un

ts (

ab

s.)

time (min)

TIC

-5.0E+00

1.0E+07

2.0E+07

3.0E+07

4.0E+07

5.0E+07

6.0E+07

7.0E+07

8.0E+07

9.0E+07

1.0E+08

0 10 20 30

Ion

co

un

ts (

ab

s.)

time (min)

EIC (m/z 451.5-452.5)

EIC (m/z 435.5-436.5)

A

B

A B

0.0E+00

1.0E+06

2.0E+06

3.0E+06

4.0E+06

5.0E+06

6.0E+06

7.0E+06

-5.0E+00

1.0E+07

2.0E+07

3.0E+07

4.0E+07

5.0E+07

6.0E+07

7.0E+07

8.0E+07

9.0E+07

1.0E+08

28 29 30 31 32 33

Ion

co

un

ts (

ab

s.)

fo

r E

IC (

435

.5-

43

6.5

)

Ion

co

un

ts (

ab

s.)

fo

r E

IC (

451

.1-

45

2.5

)

time (min)

EIC (m/z 451.5-452.5)

EIC (m/z 435.5-436.5)

S11

Figure S11: 1H NMR (800 MHz) spectra of compound 8.

9.59.0

8.58.0

7.57.0

6.56.0

5.55.0

4.54.0

3.53.0

2.52.0

1.51.0

ppm

S12

Figure S12: 1H-13C HSQC spectra of compound 8.

9.59.0

8.58.0

7.57.0

6.56.0

5.55.0

4.54.0

3.53.0

2.52.0

1.51.0

0.5ppm

160

140

120

100 80 60 40 20

ppm

S13

Figure S13: 1H-13C HMBC spectra of compound 8.

9.59.0

8.58.0

7.57.0

6.56.0

5.55.0

4.54.0

3.53.0

2.52.0

1.51.0

0.5ppm

160

140

120

100 80 60 40 20

ppm

S14

Figure S14: 1H-1H COSY spectra of compound 8.

109

87

65

43

21

ppm

10 9 8 7 6 5 4 3 2 1 ppm

S15

Figure S15: 1H-1H NOESY spectra (mixing time, 600 ms) of compound 8.

F2 [ppm] 8 6 4 2

F1

[p

pm

] 8

6

4

2

BJ's sample

09/10/2019

20190910_philmus 3 1 "C:\Users\Lab User\Desktop\BJ NMR data\Teleocidin paper"

S16

Figure S16: Structure of the isolated degradation product (8) derived from teleocidin B-4 with

atom numbering (panel A); major HMBC (red) and COSY (black) correlations observed (panel

B); and key NOESY correlations observed (panel C).

Figure S17: Proposed mechanism for the degradation of teleocidin B-4 (4) to compound 8.

Figure S18: High resolution ESIMS spectra (positive ionization mode) for pendolmycin

produced by Anabaena 7120 containing pPJAV643 (PltxA-ltxAB-mpnD).

S17

Figure S19: A. MS/MS spectra of ESIMS spectra (positive ionization mode, 370.3, CE 45.0) for

pendolmycin (3) produced by Anabaena 7120 containing pPJAV643 (PltxA-ltxAB-mpnD).

50 150 250 350 450

m/z

342.4

325.5

253.6

S18

Figure S20: 1H NMR spectrum (500 MHz) of pendolmycin (3) isolated from Anabaena 7120 containing pPJAV659 (PglnA-ltxAB-mpnD).

9.59.0

8.58.0

7.57.0

6.56.0

5.55.0

4.54.0

3.53.0

2.52.0

1.51.0

ppm

S19

Figure S21: Diagram of plasmids created to define the pCC7120ζ origin of replication (oriV).

pCC7120ζ is presented with the primers (small arrows labeled 1F/R through 4F/R; the primer

names begin with zeta-SmaI followed by the number in Table S9) utilized to cut the pCC7120ζ

into sections (A). Reverse primer names include the last nucleotide they amplify. The colors of

sections correspond with the colors of the primers and are maintained throughout the figure for

the portions capable of replication in Anabaena 7120. The starting point of the nucleic acid

numbering on pCC7120ζ is denoted by a 1. Annotated gene names are given outside the plasmid.

pPJAV579 was reisolated from Anabaena 7120 based on its ability to replicate in the host (B).

pPJAV579 was subcloned into pPJAV606 (C) and pPJAV607 (D) in which part of the

pCC7120ζ DNA was removed along with the proximal insertion sequence (IS-1 or IS-2). Origin

of transfer (oriT); Sp/Sm Interposon (spectinomycin and streptomycin resistance from pDW9).

A B

C D

pCC7120ζ

(5.58 kb)

pPJAV579

(8.65 kb)

pPJAV606

(7.74 kb)

pPJAV607

(6.75 kb)

S20

Figure S22: Depiction of pPJAV655 (pPJAV606 with the entire Moorea producens fragment

from fos-DE3-86; lane 3) and pPJAV626 (the vector used for cloning; lane 1) as compared to the

Quick-Load 1 kb DNA Ladder (New England Biolabs; lane 2) run on a 0.6% agarose gel. The

bands of the ladder from top to bottom: 10 kb, 8 kb, 6 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1.5 kb, 1 kb.

The plasmid DNA was isolated from E. coli MCR.

Wells

pPJAV655

(~50 kb)

pPJAV626

(~8 kb)

Lanes 1 2 3

S21

Table S1: NMR data (500 MHz) for teleocidin B-4 (4) collected from Anabaena 7120

containing pPJAV657 (PglnA-ltxABC-tleD) in CDCl3 ( in ppm, J in Hz).

a 13C NMR shifts determined through use of an 1H-13C HSQC experiment; -, no HSQC signal observed due to the fact that this is a nitrogen bound hydrogen.

Atom

number H (this work) C (this work)a H (from ref. 1) C (from ref. 1)

1 8.67 (s) - 8.65 (s) -

2 6.77 (s) 120.8 6.76 (s) 120.8

5 6.52 (s) 106.2 6.49 (s) 106.2

8a 3.05 (dd, 14.6, 5.0) 33.3 3.11 (br d, 17.2) 33.8

8b 2.98 (dd, 18.0, 8.7) 2.94 (dd, 17.7, 4.0)

9 4.34 (m) 55.7 4.30 (m) 55.8

10 7.02 (s) - 7.00 (s) -

12 4.22 (m) 70.5 4.28 (m) 70.7

14a 3.72 (11.3, 3.9) 64.3 3.70 (dd, 11.45, 4.0) 65.1

14b 3.54 (10.7, 8.8) 3.50 (dd, 11.45, 8.6)

15 2.63 (m) 28.1 2.60 (m) 28.4

16 0.69 (d, 6.83) 19.5 0.67 (d, 6.85) 19.6

17 0.92 (6.56) 21.4 0.89 (d, 6.3) 21.6

18 2.75 (s) 35.2 2.88 (s) 32.9

20 1.50 (s) 21.4 1.49 (s) 21.5

21 6.15 (dd, 10.4, 17.5) 151.5 6.14 (dd, 10.8, 18.0) 151.8

22a 5.41(d, 17.5) 111.3 5.39 (d, 18.0) 111.3

22b 5.25 (d, 10.6) 5.22 (d, 10.8)

23 1.90 (m), 1.45 (m) 34.6 1.90 (m), 1.47 (m) 34.7

24 1.90 (m), 1.42 (m) 24.7 1.90 (m), 1.42 (m) 24.9

26 2.25 (m) 37.5 2.23 (m) 37.8

27 0.55 (d, 6.8) 17.7 0.52 (d, 6.85) 17.9

28 1.02 (d, 6.7) 16.7 0.99 (d, 6.85) 16.9

29 1.35 (s) 29.0 1.33 (s) 29.1

S22

Table S2: Production of lyngbyatoxin A (2) in Anabaena 7120. Values are given as ng/mg dried

cell mass standard deviation. Each replicate culture was grown on BG-11 agar media

containing 1.5% agar (1 plate = approximately 40 mL).

BG-11(NH4+) BG-11(Nit)

361 0 0

361 fruc 0 0

Zeta 0 0

Zeta fruc 0 0

LtxABC 49.0 12.1 7.2 2.0

LtxABC fruc 98.1 13.1 8.5 6.5

LtxAB-TleC 47.8 21.1 9.2 3.2

LtxAB-TleC fruc 88.0 28.0 n.o.

PglnA LtxABC 252.5 34.7 203.1 176.6

PglnA LtxABC fruc 181.9 15.7 96.8 53.4

PglnA LtxAB-TleC 71.0 35.8 240.6 104.6

PglnA LtxAB-TleC fruc 313.3 64.1 174.3 114.3

PglnA LtxABC-TleD 47.8 15.2 74.9 8.1

PglnA LtxABC-TleD fruc 20.3 5.5 143.8 52.5

LtxABC zeta-TleD — 7.4 4.7

fruca, denotes media containing 50 mM fructose; —, none observed. BG-11(NH4+), BG-11 media with ammonium chloride as the nitrogen source; BG-11(Nit), BG-11 media with sodium nitrate as the nitrogen source.

S23

Table S3: Production of the individual teleocidin B-like compounds in Anabaena 7120. Values

are given as ng/mg dried cell mass standard deviation. Each replicate culture was grown on

BG-11 agar media containing 1.5% agar (1 plate = approximately 40 mL) with the nitrogen

source listed in the table column.

BG-11(NH4+) BG-11(Nit)

Plasmid introduced Peak 1 Peak 2 Peak 3 Peak 4 Peak 1 Peak 2 Peak 3 Peak 4

361 0 0 0 0 0 0 0 0

361 fruca 0 0 0 0 0 0 0 0

Zeta 0 0 0 0 0 0 0 0

Zeta fruc 0 0 0 0 0 0 0 0

LtxABC-TleD 9.8

7.3

10.1

4.1

14.1

12.3

22.3

8.8

12.2

1.2

8.3

2.0

7.6

1.2

11.1

2.2

LtxABC-TleD fruca 19.6

4.0

17.2

7.5

1.3

2.3

39.8

10.2

18.9

20.3

17.0

8.8

16.5

7.0

18.5

6.9

LtxABC zeta-TleD 32.6

15.5

7.9

10.8

1.9

3.3

59.0

10.0

13.2

22.9 0

25.2

15.1

5.1

8.8

LtxABC zeta-TleD fruca 55.4

21.8

4.6

8.0

8.5

2.5

69.2

11.2 0 0 0

2.7

2.6

PglnA LtxABC-TleD 249.0

68.6

141.8

45.8

98.4

54.5

546.5

23.3

133.9

116.5

84.6

29.6

76.3

19.3

453.0

108.7

PglnA LtxABC-TleD

fruca 54.5

8.4

21.4

3.3

29.6

16.0

137.7

11.2

277.4

47.0

102.1

6.9

55.5

16.9

101.0

34.3

fruca, denotes media containing 50 mM fructose. BG-11(NH4+), BG-11 media with ammonium chloride as the nitrogen source; BG-11(Nit), BG-11 media with sodium nitrate as the nitrogen source.

S24

Table S4: Dried cell mass values obtained during growth of Anabaena 7120. Each replicate

culture was grown on BG-11 agar media containing 1.5% agar (1 plate = approximately 40 mL)

with the nitrogen source listed in the table column.

Strain BG-11(NH4+)

Dried cell mass (mg) ± S.D.

BG-11(Nit)

Dried cell mass (mg) ± S.D.

pPJAV361 (empty vector) 22.9 ± 4.0 156.2 ± 77.8

pPJAV361 (empty vector) fruca 27.8 ± 3.1 149.9 ± 18.4

Zeta (empty vector) 29.5 ± 4.1 33.2 ± 4.3

Zeta (empty vector) fruca 33.7 ± 6.1 87.5 ± 14.0

LtxABC 15.8 ± 5.5 108.5 ± 65.0

LtxABC fruca 25.6 ± 6.6 128.6 ± 27.5

LtxABC-TleD 25.1 ± 7.5 120.8 ± 57.1

LtxABC-TleD fruca 15.4 ± 6.2 71.9 ± 22.4

LtxABC zeta-TleD 25.5 ± 7.3 49.7 ± 24.9

LtxABC zeta-TleD fruca 30.2 ± 3.8 122.1 ± 7.1

PglnA LtxABC-TleD 28.9 ± 11.7 51.3 ± 32.3

PglnA LtxABC-TleD fruca 44.7 ± 3.9 106.8 ± 11.0

PglnA LtxAB-TleC-TleD 51.5 ± 4.1 45.1 ± 9.8

LtxAB-MpnD 11.5 ± 8.0 82.1 ± 13.3

LtxAB-MpnD fruca 13.4 ± 0.8 174.6 ± 65.2

LtxAB-MpnD-TleD 13.7 ± 1.6 103.8 ± 20.7

LtxAB-MpnD-TleD fruca 13.6 ± 6.0 52.3 ± 12.8

PglnA LtxAB-MpnD 19.1 ± 2.1 34.0 ± 5.2

PglnA LtxAB-MpnD fruca 46.1 ± 4.1 82.9 ± 20.2

BG-11(NH4+), BG-11 media with ammonium chloride as the nitrogen source; BG-11(Nit), BG-11 media with sodium nitrate as the nitrogen source.

S25

Table S5: NMR data (800 MHz) for compound 8 in CDCl3 ( in ppm, J in Hz) purified from

collected from Anabaena 7120 containing pPJAV657 (PglnA-ltxABC-tleD).

a 13C NMR shifts determined through use of an 1H-13C HSQC experiment; b 13C NMR shifts determined through use of an 1H-13C HMBC experiment; -, no signal observed.

Atom

number H Ca,b HMBC (to C#) COSY (to H#)

1 8.85 (1H, br s) - - 2

2 7.03 (1H, s) 123.3a 3, 3a, 7a 1

3 - 106.4b - -

3a - 116.8b - -

4 - 144.4b - -

5 6.52 (1H, s) 106.9a 3a, 4, 6 -

6 - 118.6.b - -

7 - 138.6b - -

7a - 137.4b - -

8a 4.29 (1H, d, 14.6) 38.2a 2, 3, 9 8b

8b 3.9 (1H, d, 14.6) 2, 3, 3a, 9 8a

9 - 172.9b - -

10 7.50 (1H, br s) - - -

11 - 173.8b - -

12 4.67 (1H, d, 9.9) 72.7a 4, 11, 14, 16, 17 14

14 2.64 (1H, m) 28.2a 12, 15, 16 12, 15, 16

15 0.98 (3H, d, 6.4) 21.3a 12, 14, 16 14

16 0.82 (3H, d, 6.4) 19.3a 12, 14 14

17 2.82 (3H, s) 32.2a 4, 12 -

18 - 39.6b - -

19 1.53 (3H, s) 21.8a 6, 18, 20, 22 -

20 6.16 (1H, dd, 17.6, 10.6) 151.5a 6, 18, 19 21a, 21b

21a 5.43 (1H, dd,17.6, 0.96) 111.4a 18, 20 20 21b 5.27, (1H, dd, 10.9,

0.96)

18 20

22 1.90 (m), 1.47 (1H, m) 34.6a 6, 18, 19 23

23 1.90 (m), 1.43 (1H, m) 24.7a 7, 24, 28 22

24 - 39.9b -

25 2.23 (1H, m or p) 37.6a 24, 26, 28 26, 27

26 1.02 (3H, d, 6.8) 17.0a 24, 25, 27 25

27 0.55 (3H, d, 6.4) 18.0a 24, 25, 26 25

28 1.34 (3, s) 29.1 7, 23, 24, 25 -

S26

Table S6: NMR data (500 MHz) for pendolmycin (3) in CDCl3 ( in ppm, J in Hz).

Atom number H (this work) C (this work)a H (from ref. 2) C (from

ref. 2)

1 8.47 -b 8.48 (br s) -

2 6.83 120.8 6.84 (br s) 121.1

5 6.49 (d, 8.3) 106.2 6.48 (d, 8.0) 106.4

6 7.00 (d, 7.7) 119.1 7.00 (d, 8.0) 119.1

8a 2.99 (dd, 3.7, 16.7) 33.8 3.04 (dd, 4.0, 17.5) 33.9

8b 3.17 (br d, 17.8) 33.8 3.15 (br d, 17.5) 33.9

9 4.43 (m) 54.6 4.32 (m) 55.8

10 7.47 (br s) - 7.50 (br s) -

12 4.34 (d, 10.0) 71.1 4.34 (d, 10.0) 71.1

14a 3.53 (dd, 9.7, 10.3) 65.0 3.56 (br dt, 12.0, 3.0) 65.1

14b 3.74 (dd, 4.0, 11.0) 65.0 3.74 (br dt, 12.0, 7.0) 65.1

14-OH n.o.c - 3.34 (br s) -

15 2.61 (m) 28.3 2.59 (m, 7.0, 10.0) 28.6

16 0.65 (d, 6.7) 19.4 0.65 (d, 7.0) 19.6

17 0.92 (d, 6.4) 21.4 0.92 (d, 7.0) 21.6

18 2.92 (s) 32.8 2.90 (s) 33.1

20 6.19 (dd, 10.5, 17.5) 149.2 6.19 (dd, 11.0, 17.5) 149.5

21a 5.21 (br d, 10.8) 111.1 5.21 (dd, 1.5, 11.0) 111.3

21b 5.32 (br d, 17.6) 111.1 5.31 (dd, 1.5, 17.5) 111.3

22 1.48 (s) 26.9 1.47 (s) 27.2

23 1.51 (s) 26.7 1.51 (s) 26.8

a 13C NMR shifts determined through use of an 1H-13C HSQC experiment; b -, no HSQC signal observed due to the fact that this is a nitrogen bound hydrogen, c n.o., not observed due to exchange with water.

S27

Table S7: Efficiency of plasmid introduction into Anabaena 7120. A culture of Anabaena 7120

was prepared for conjugation, serial dilutions were plated and colonies counted. Conjugation

mixes were prepared, serial dilutions were plated on selection, and the colonies were counted.

The total colonies counted from selection divided by the possible total that could grow is

presented as efficiency. Each efficiency calculation is presented as the average of three

replicates.

Type of

Conjugation

Plasmid 1 Plasmid 2 Efficiency

Bi- pPJAV361 N/A 1 x 10-2

Bi- pPJAV500 N/A 6.9 x 10-3

Bi- pPJAV626 N/A 4.4 x 10-3

Bi- pPJAV632 N/A 5.8 x 10-5

Tri- pPJAV361 N/A 1.1 x 10-3

Tri- pPJAV500 N/A 6.1 x 10-4

Tri- pPJAV626 N/A 6.4 x 10-6

Tri- pPJAV632 N/A 6.5 x 10-6

Tri- pPJAV361 pPJAV626 2.3 x 10-3

Tri- pPJAV500 pPJAV632 8.7 x 10-7

Quad- pPJAV361 pPJAV626 2.4 x 10-7

Quad- pPJAV500 pPJAV632 5.4 x 10-8

Bi-, biparental conjugation; Tri-, triparental conjugation; and Quad-, quadriparental conjugation;

N/A, a second plasmid was not introduced in these experiments.

Supplemental Discussion: Using these types of conjugation mix, it is therefore theoretically

possible to introduce two plasmids into Anabaena 7120 simultaneously; as a triparental mating,

where both plasmids are carried by E. coli strain UC585, or as a quadriparental mating, where E. coli

strain JCM113 is mixed with two E. coli strains each harboring only a single plasmid for transfer. To

determine the relative efficiency of conjugation and selection, bi-, tri-, and quadriparental matings

were carried out to introduce pPJAV361 (empty vector, SmSp resistant), pPJAV500 (harboring

ltxABC, SmSp resistant),11 pPJAV626 (empty vector, Neo resistant), and pPJAV632 (harboring

PltxD-tleD, Neo resistant) into Anabaena 7120 singly or in combinations of two plasmids with

different selectable markers (Neor or Sp/Smr).

Following culture preparation, conjugation mixes were prepared, and serial dilutions were plated

onto selection to determine the number of viable conjugal events. These data were then compared to

colony counts from the same culture of Anabaena 7120 prepared but not utilized for conjugation.

This comparison is presented because it provides a more realistic number of colonies produced from

the protocol rather than a theoretical conjugal efficiency. In every case, plasmids based on

pPJAV361 were singly introduced with a higher efficiency than those based on pPJAV626 (Table

S7). When the introduction efficiency of the same plasmids was compared between bi- and

triparental conjugations, biparental conjugations displayed higher efficiencies than did triparental

conjugations by at least an order of magnitude. The lowest frequency of single introduction was

observed from pPJAV632. Assessment of the simultaneous conjugation of two plasmids showed that

triparental introduction of pPJAV361 and pPJAV626 displayed a similar efficiency to the triparental

introduction of pPJAV626 singly. Because biparental conjugation of pPJAV361 displayed the

highest efficiency, it is likely that co-introduction with pPJAV626 is the factor hampering the

observed efficiency. Interestingly, co-conjugation of pPJAV632 with pPJAV500 displayed a greatly

S28

decreased efficiency (>2,800-fold) in triparental mating with E. coli UC585 when compared to

pPJAV361 introduced under identical conditions. We hypothesize that this is due to the larger size of

pPJAV500 (22.4 kb) compared to pPJAV361 (11.2 kb). Efficiency of the simultaneous introduction

of two plasmids was higher from triparental conjugations than quadraparental mixes. These results

are consistent with the number of steps necessary to move all three plasmids into one E. coli cell.

The bi- and triparental efficiencies are higher for single and double plasmid introductions than the

analogous tri- and quadraparental mixes, respectively, because all three plasmids begin in the same

cell rather than requiring a conjugal event to occur prior to introduction into Anabaena 7120. It is

possible that the efficiencies decrease for pPJAV500 and pPJAV632 over pPJAV361 and pPJAV626

because they are larger and may cause a metabolic strain on Anabaena 7120, which could decrease

the total number of colonies produced from each conjugation mix.

Table S8: Strains and plasmids utilized in this study.

Strain or plasmid Characteristic(s)* Source or reference

Anabaena sp.

PCC 7120 Wild type Pasteur Culture

Collection

E. coli

NEB10β Cloning strain New England

Biolabs

DH5αMCR Cloning strain ΔmcrBCΔecoK New England

Biolabs

BW25113 Strain for lambda red recombination 3

JCM113 HB101 with pRL528 and pRK2013 Gift of J. C. Meeks

UC585 MC1061 with pRL528 and pRK24 4

Plasmids

pBlueScript SK+ Cloning vector, Apr Agilent

pACYC184 E. coli cloning vector, Cmr Tetr 5

pAM504 Shuttle vector for replication in E. coli and

Anabaena; Kmr Nmr

6

pDW9 Source of the Spr/Smr Ω interposon 7

fos-DE3-86 Fosmid containing ltxA-D from Moorea

producens; Cmr

8

pKD46 Temperature-sensitive /Red recombination

plasmid; Apr

9

pPJAV361 pAM504 with Spr/Smr Ω interposon replacing

nptII

10

pPJAV500 pPJAV361 with PltxA-ltxA-C 10

pPJAV503 pPJAV361 with PglnA-ltxA-C 10

pUC57-tleC Source of codon optimized tleC; Apr This study

pUC57-tleD Source of codon optimized tleD; Apr This study

pUC57-mpnD Source of codon optimized mpnD; Apr This study

pPJAV504 pPJAV361 with half of the Zeta plasmid,

amplified with the primers zeta-SmaI-3F and zeta-

SmaI-1R, replacing the pDU1 oriV

This study

S29

pPJAV505 pPJAV361 with half of the Zeta plasmid,

amplified with the primers zeta-SmaI-1F and zeta-

SmaI-3R, replacing the pDU1 oriV

This study

pPJAV506 pPJAV361 with three-quarters of the Zeta

plasmid, amplified with the primers zeta-SmaI-2F

and zeta-SmaI-1R, replacing the pDU1 oriV

This study

pPJAV579 pPJAV504 reisolated from Anabaena 7120 with a

transposon insertion in the Zeta oriV

This study

pPJAV580 pPJAV504 reisolated from Anabaena 7120 with a

transposon insertion in the Zeta oriV

This study

pPJAV606 pPJAV579 with upstream half of the Zeta oriV

removed

This study

pPJAV607 pPJAV579 with downstream half of the Zeta oriV

removed

This study

pPJAV626 pAM504 with the upstream half of the Zeta oriV

from pPJAV606 replacing the pDU1 oriV

This study

pPJAV631 pBlueScript SK+ carrying PltxA This study

pPJAV632 pPJAV626 carrying PltxD-tleD This study

pPJAV642 pPJAV361 carrying PltxA-ltxAB-tleC This study

pPJAV643 pPJAV361 carrying PltxA-ltxAB-mpnD This study

pPJAV644 pPJAV361 carrying PltxA-ltxABC-tleD This study

pPJAV645 pPJAV361 carrying PltxA-ltxAB-mpnD-tleD This study

pPJAV647 pPJAV361 carrying PglnA-ltxAB-tleC This study

pPJAV650 pPJAV361 carrying PglnA-ltxAB-mpnD-tleD This study

pPJAV653 pAM504 carrying the hetR coding region and a

Spr/Smr Ω interposon

This study

pPJAV655 pPJAV606 carrying the entire M. producens

portion of fos-DE3-86

This study

pPJAV657 pPJAV361 carrying PglnA-ltxABC-tleD This study

pPJAV659 pPJAV361 carrying PglnA-ltxAB-mpnD This study

* Km, kanamycin; Nm, neomycin; Sp, spectinomycin; Sm, streptomycin; Ap, ampicillin; Cm,

chloramphenicol; Tet, tetracycline

S30

Table S9: Oligonucleotide primers used in this study. Underlined bases indicate restriction enzyme

recognition sequences, while italicized bases indicate additional random bases added to increase

restriction enzyme efficiency.

Primer Name Sequence (5’ to 3’)

505-BamHI CTACGGGGTCTGACGCTCAGTGG

505-Sac GTCGAACTGCGCGCTAACTATTC

aadA1-F GCAATGACATTCTTGCAGGT

aadA1-R ACCTACCAAGGCAACGCTAT

AMO-645 TGCTTTACTCTGGCACGGTGAC

AMO-646 TAAGTCCGCTCTTGGTCGTCTG

AMO-679 AGCTGTGCTCGACGTTGTCA

AMO-680 GCAGGAGCAAGGTGAGATGA

CAT-SacI-R TATATGAGCTCTTACGCCCCGCCCTGCCACTCATCG

fos-up-F GGCTGCATCCGATGCAAGTGTGTCGCTG

fos-up-BamHI-R ATATAGGATCCTTCGTATAATGTATGCTATACGAAGTTATTAGCG

fos-dn-BamHI-F ATATAGGATCCGGTGTAACAAGGGTGAACACTATCCCATATC

fos-dn-EcoRI-R TATATGAATTCGAGCTTATCGCGAATAAATACCTGTGACGG

ltxA-int-SmaI-R ATATACCCGGGTGACATATGTGGTGGTCTCTGTAG

ltxB-int-NdeI-F ATCGATATCTCATATGCTATTCCAGCTGAAGAAGTGCCATGGC

HetR-NdeI-F CATATGAGTAACGACATCGATCTGATCAAGCG

HetR-R TTAATCTTCTTTTCTACCAAACACCATTTGTAAAATCATGG

mpnD-ltxB-red-F TTTTATCTGTCCTTTATCTCTGTAAATTGGAGTGTTTTCTTATGGC

TGGAGATCCATTTG

mpnD-R TTAGCGGTATAAACCTGGGGCTACATAGCATG

pAM504Ecoliup-R GTGATGCGCCCACTGCGCATAG

pAM504-pBR-F ATCGTCCATTCCGACAGCATCGCCAG

pAM504-pBR-R CTGCGCGCTAACTATTCTCGACCTGC

Pcat-F GCCGCGGCCCTCTCACTTCCCTG

PglnA-XhoI-F ATATACTCGAGCGCAGATAGTAGTCCATATCTCGTAAAC

Pltx-R AGGGGGATAATTTTATCTAGCCCTC

PlxtA-XhoI-F ATATACTCGAGTTCACCTTCTGTCTAGAATTACAGTTTGAGG

PltxD-mpnD-red-F CCGATTTGCATGCTATGTAGCCCCAGGTTTATACCGCTAAACTCT

AGGAAAAAAACATGG

PltxD-tleC-red-F TTAGCGTTTATTTAGCTCCCGGTGTATACCGTGAAGCATAAACTC

TAGGAAAAAAACATG

PltxD-R TAGACATCTCCAATAATAAAAAATAAAATCAATTATCCCAGAG

tleC-ltxB-red-F TTTTATCTGTCCTTTATCTCTGTAAATTGGAGTGTTTTCTTATGGA

ATCAGCTGGTCCTG

tleC-R TTATGCTTCACGGTATACACCGGGAGC

tleD-PltxD-OEX-F ATTATTGGAGATGTCTAATGCCACAAGAAGCCCGTACTCCTC

tleD-R TTATACTGCTGGTTTTCTTAAAGTAGCC

Tnp-int-F GGTGGATACACATCTTGTCATATGATC

Tnp-int-R GAGCTAGTAGGGTTGCAGCCACGAG

Zeta2-1-walk1-F CAACAAAGAAGGCATAGAAGC

Zeta2-1-walk1-R CTCCATCAGCCCGTGAGGTG

Zeta-qPCR-F CAATCTGGCAAGTATCGAGCG

S31

Zeta-qPCR-R GACTATCAAGCAACCTCGTGTG

zeta-SmaI-1F ATATACCCGGGGTTTAGGCTATGTTCTGCTGTTCACCTTC

zeta-SmaI-1R ATATACCCGGGGTTATCATTCACCCCCCAATCTACCTACTTG

zeta-SmaI-2F ATATACCCGGGTTATGGCATTGTCTACCAGTTTAAGC

zeta-SmaI-2R ATATACCCGGGAAGCCAGCCTACCTGATGCCCACCCAATAAAGCG

zeta-SmaI-3F ATATACCCGGGCCATAGAAACATGAGTAGCGGAGGCTTTTGACC

zeta-SmaI-3R ATATACCCGGGCATGGATAGGCACTCGTAGGCACTCCG

zeta-SmaI-4F ATATACCCGGGTCAATCAATTTTGGATTCTAGAGATAGCAG

zeta-SmaI-4R ATATACCCGGGGCAACATCATTGCATCCTTATCACCCGTG

S32

References

(1) Awakawa, T.; Zhang, L.; Wakimoto, T.; Hoshino, S.; Mori, T.; Ito, T.; Ishikawa, J.;

Tanner, M. E.; Abe, I., A methyltransferase initiates terpene cyclization in teleocidin B

biosynthesis. J. Am. Chem. Soc. 2014, 136, (28), 9910-9913.

(2) Yamashita, T.; Imoto, M.; Isshiki, K.; Sawa, T.; Naganawa, H.; Kurasawa, S.; Zhu, B.-

Q.; Umezawa, K., Isolation of a new indole alkaloid, pendolmycin, from Nocardiopsis. J.

Nat. Prod. 1988, 51, (6), 1184-1187.

(3) Datsenko, K. A.; Wanner, B. L., One-step inactivation of chromosomal genes in

Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 2000, 97, (12),

6640-6645.

(4) Liang, J.; Scappino, L.; Haselkorn, R., The patB gene product, required for growth of the

cyanobacterium Anabaena sp. strain PCC 7120 under nitrogen-limiting conditions,

contains ferredoxin and helix-turn-helix domains. J. Bacteriol. 1993, 175, (6), 1697-

1704.

(5) Rose, R. E., The nucleotide sequence of pACYC184. Nucleic Acids Res. 1988, 16, (1),

355.

(6) Wei, T. F.; Ramasubramanian, T. S.; Golden, J. W., Anabaena sp. strain PCC 7120 ntcA

gene required for growth on nitrate and heterocyst development. J. Bacteriol. 1994, 176,

(15), 4473-4482.

(7) Golden, J. W.; Wiest, D. R., Genome rearrangement and nitrogen fixation in Anabaena

blocked by inactivation of xisA gene. Science 1988, 242, (4884), 1421-1423.

(8) Edwards, D. J.; Gerwick, W. H., Lyngbyatoxin biosynthesis: Sequence of biosynthetic

gene cluster and identification of a novel aromatic prenyltransferase. J. Am. Chem. Soc.

2004, 126, (37), 11432-11433.

(9) Baba, T.; Ara, T.; Hasegawa, M.; Takai, Y.; Okumura, Y.; Baba, M.; Datsenko, K. A.;

Tomita, M.; Wanner, B. L.; Mori, H., Construction of Escherichia coli K‐12 in‐frame,

single‐gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2006, 2, (1),

2006.0008.

(10) Videau, P.; Wells, K. N.; Singh, A. J.; Gerwick, W. H.; Philmus, B., Assessment of

Anabaena sp. strain PCC 7120 as a heterologous expression host for cyanobacterial

natural products: Production of lyngbyatoxin A. ACS Synth. Biol. 2016, 5, (9), 978-988.

download fileview on ChemRxivCombiBiosynth-Anabaena_SI_2019December03.pdf (3.26 MiB)