expanding the natural products heterologous expression
TRANSCRIPT
doi.org/10.26434/chemrxiv.11316098.v1
Expanding the Natural Products Heterologous Expression Repertoire inthe Model Cyanobacterium Anabaena sp. Strain PCC 7120: Productionof Pendolmycin and Teleocidin B-4Patrick Videau, Kaitlyn Wells, Arun Singh, Jessie Eiting, Philip Proteau, Benjamin Philmus
Submitted date: 04/12/2019 • Posted date: 12/12/2019Licence: CC BY-NC-ND 4.0Citation information: Videau, Patrick; Wells, Kaitlyn; Singh, Arun; Eiting, Jessie; Proteau, Philip; Philmus,Benjamin (2019): Expanding the Natural Products Heterologous Expression Repertoire in the ModelCyanobacterium Anabaena sp. Strain PCC 7120: Production of Pendolmycin and Teleocidin B-4. ChemRxiv.Preprint. https://doi.org/10.26434/chemrxiv.11316098.v1
Cyanobacteria are prolific producers of natural products and genome mining has shown that many orphanbiosynthetic gene clusters can be found in sequenced cyanobacterial genomes. New tools and methodologiesare required to investigate these biosynthetic gene clusters and here we present the use of Anabaena sp.strain PCC 7120 as a host for combinatorial biosynthesis of natural products using the indolactam naturalproducts (lyngbyatoxin A, pendolmycin, and teleocidin B-4) as a test case. We were able to successfullyproduce all three compounds using codon optimized genes from Actinobacteria. We also introduce a newplasmid backbone based on the native Anabaena7120 plasmid pCC7120ζ and show that production ofteleocidin B-4 can be accomplished using a two-plasmid system, which can be introduced by co-conjugation.
File list (2)
download fileview on ChemRxivCombiBiosynth-Anabaena__2019December03.pdf (632.96 KiB)
download fileview on ChemRxivCombiBiosynth-Anabaena_SI_2019December03.pdf (3.26 MiB)
1
Expanding the Natural Products Heterologous Expression Repertoire in the Model
Cyanobacterium Anabaena sp. Strain PCC 7120: Production of Pendolmycin and
Teleocidin B-4
Patrick Videau,†,§ Kaitlyn N. Wells,‡,† Arun J. Singh,† Jessie Eiting,† Philip J. Proteau,†
Benjamin Philmus†,*
†Department of Pharmaceutical Sciences, College of Pharmacy, Oregon State University,
Corvallis, OR 97331
‡Undergraduate Honors College, Oregon State University, Corvallis, OR 97331
Present address: §Department of Biology, Southern Oregon University, Ashland, OR
97520
*E-mail: [email protected]
2
Abstract
Cyanobacteria are prolific producers of natural products and genome mining has shown
that many orphan biosynthetic gene clusters can be found in sequenced cyanobacterial
genomes. New tools and methodologies are required to investigate these biosynthetic
gene clusters and here we present the use of Anabaena sp. strain PCC 7120 as a host for
combinatorial biosynthesis of natural products using the indolactam natural products
(lyngbyatoxin A, pendolmycin, and teleocidin B-4) as a test case. We were able to
successfully produce all three compounds using codon optimized genes from
Actinobacteria. We also introduce a new plasmid backbone based on the native
Anabaena 7120 plasmid pCC7120ζ and show that production of teleocidin B-4 can be
accomplished using a two-plasmid system, which can be introduced by co-conjugation.
3
Cyanobacteria are prevalent producers of natural products with diverse structures
and interesting bioactivities. Over 1,100 secondary metabolites have been identified from
cyanobacteria, and the majority of those are produced by only four genera:
Hapalosiphon, Lyngbya (now known as Moorea), Microcystis, and Nostoc.1 Natural
products of known or predicted cyanobacterial origin account for roughly 20% of marine-
inspired small molecules currently in clinical trials.2 The compounds produced by
cyanobacteria can be quite complex, often tailored with rare and unique modifications.3
The ability to produce such an array of compounds hints at the likely untapped
biosynthetic capacity of the cyanobacteria. One group of compounds based on the
indolactam-V (ILV, 1) core has been the focus of our recent research.
To date, at least three gene clusters have been shown to produce ILV as a
biosynthetic intermediate: the ltxA-C genes from the filamentous marine cyanobacterium
Moorea producens (formerly Lyngbya majuscula) yield lyngbyatoxin A (2),4-5 a protein
kinase C activator;6 the mpnB-D genes from the marine actinomycete Marinactinospora
thermotolerans SCSIO
00652 yield pendolmycin
(3),7 a compound shown
to inhibit
phosphatidylinositol
turnover;8 and the tleA-D
genes of Streptomyces
blastmyceticus NBRC
4
12747 yield teleocidin B-4, teleocidin B-1, and O-desmethylolivoretin C (4-6),9 which
are protein kinase C activators.10 The first gene of each of these clusters encodes a two
module non-ribosomal peptide synthetase (NRPS; LtxA, MpnB, and TleA, respectively)
that forms N-methyl-L-valyl-L-tryptophanol (NMVT, 7). Following the reductive release
of 7, a cytochrome P450 (LtxB, MpnC, and TleB, respectively) cyclizes 7 into 1.
Pendolmycin and lyngbyatoxin A are formed by reverse prenylation of 1 by MpnD or
LtxC/TleC in
the presence of
dimethylallyl
diphosphate or
geranyl
diphosphate,
respectively.
Finally, 4, 5,
and 6 are
formed by the
methylation and
cyclization of
the prenyl
group of
lyngbyatoxin A
onto the indole
ring by TleD Figure 1. Biosynthetic pathway for the formation of indolactam natural products.
5
(Figure 1). The presence of multiple tailoring enzymes that modify the common
intermediate (1) has led to a natural combinatorial library of compounds across genera.
The production of desirable cyanobacterial compounds is often hampered by slow
growth of the producing strain, low compound yields, recalcitrance to laboratory culture
or genetic manipulation, and the spontaneous cessation of compound production. To
overcome these hurdles, Anabaena sp. strain PCC 7120 (herein Anabaena 7120) was
assessed as a general heterologous expression host for cyanobacterial natural products.11
Introduction of the ltxA-C genes into Anabaena 7120 on a replicative plasmid resulted in
lyngbyatoxin A production with no biosynthetic intermediates (1 or 7) being observed.
Exchange of the native ltxA promoter region with the glnA promoter from Anabaena
7120, coupled with a preliminary optimization of growth conditions, resulted in a 13-fold
increase in lyngbyatoxin A yield up to 3.2 mg/L. Promoter regions from four other
cyanobacterial natural products gene clusters were recognized and expressed by the
native Anabaena 7120 transcriptional machinery. Taken together, these results indicate
that Anabaena 7120 is a viable candidate for a general cyanobacterial heterologous
expression host.11
Here we describe our efforts to expand the toolbox for heterologous expression of
natural products in Anabaena 7120 using the indolactam family as a proof of concept. To
expand the functional capacity of Anabaena 7120 as a heterologous host, we used
different combinations of cyanobacterial (ltxA-C) and codon-optimized non-
cyanobacterial genes (mpnD, tleC, and tleD) to produce 2, 3, and 4 in good yields.
Several media conditions, in which the nitrogen source was altered, fructose was added to
increase the resulting dry cell mass, and introduction of the glnA promoter were used to
6
increase compound titers as previously described.11 A new replicative origin of
replication, based on the endogenous plasmid pCC7120ζ, was defined and validated for
plasmid selection and maintenance in Anabaena 7120. Assessment of the introduction of
one or two plasmids simultaneously into Anabaena 7120 demonstrated that, though
possible, the efficiency drops with complexity of the conjugation mixture.
Results and Discussion
Heterologous Production of Pendolmycin and Teleocidin B-4 in Anabaena 7120
Using Codon-Optimized Genes from Cyanobacterial and Non-Cyanobacterial
Genera in Mixed Gene Clusters. To extend the utility of Anabaena 7120 as a
heterologous host, we sought to determine whether derivations of 1 could be
accomplished using tailoring genes of non-cyanobacterial origin. Given the increased
yields we previously observed using solid media over liquid media, our experiments were
performed primarily using BG-11(Nit) and BG-11(NH4) solid media.11
Three tailoring genes were chosen for study: tleC and tleD from S. blastmyceticus
NBRC 12747,9 which encode proteins responsible for the formation of 2 from 1 and the
conversion of 2 to 4, 5, and 6 respectively; and mpnD from M. thermotolerans SCSIO
00652,7 which encodes a prenyltransferase that catalyzes the production of 3 from 1. As
tleC, tleD, and mpnD are derived from Actinobacteria with high G+C content genomes,
the coding regions of tleC, tleD, and mpnD were codon optimized for Anabaena 7120
and commercially synthesized for the following experiments.
7
The tleC gene encodes a prenyltransferase that has been shown to transfer a
geranyl group to 1 to create 2.9, 12 To verify the function of TleC in Anabaena 7120, ltxC
was replaced with codon-optimized tleC to retain the gene order if these are transcribed
as an operon and use the native promoters if they are not, creating pPJAV642, which was
introduced into Anabaena 7120. The resulting strain was cultured on BG-11(Nit) plates,
which contain sodium nitrate as the nitrogen source. The cells were collected,
lyophilized, and extracted as previously described,11 and the extract was analyzed by
HPLC-MS/MS and HPLC-HRMS as described in the Experimental Section. A peak was
present only for the extract from the culture harboring ltxAB-tleC (pPJAV642, Figure 2)
with a HRESIMS (m/z 438.3112; calcd 438.3115, 0.7 ppm error), and MS/MS
fragmentation (Figure S1) pattern consistent with 2.11, 13 To confirm the produced
compound was 2 and not the epimer at the C-18 position we pursued isolation of the
compound. To facilitate the isolation we exchanged the native promoter with the strong,
constitutive PglnA promoter to create pPJAV647.11 Introduction of pPJAV647 to
Anabaena 7120 was followed by cultivation in 20 L of liquid BG11(Nit) media
supplemented with 50 mM fructose. Addition of fructose was previously shown to
increase the growth of Anabaena 7120 under mixotrophic conditions.14 Here we utilized
the addition of 50 mM fructose to BG-11(Nit) to increase the yield of dried cell mass that
we obtained, which increases the total yield of compound. This allowed sufficient
compound to be isolated for characterization via 1H NMR spectroscopy. Comparison to
literature data validated that this compound was 2 (Figure S2). These results show that
TleC is functional in Anabaena 7120 and can convert 1 to 2 as previously described.9
8
The tleD gene encodes a protein with C-methyltransferase and terpene cyclase
activities that converts 2 to 4 as the major product, while 5 and 6 are produced in lower
yield.9 To verify the function of TleD in Anabaena 7120, tleD was cloned into the
position of ltxD in ltxABCD to create pPJAV644, such that tleD was expressed at the
native level of the ltxD gene. Following plasmid introduction, extraction, and analysis
Figure 2. Production of lyngbyatoxin A (2) and teleocidin B-4 (4). Zoomed
LCMS MRM chromatogram showing the constructs used and production of 2
(438.3 → 410.3), left column; and constructs used and production of 4 (452.3 →
424.3), right column. Traces are from a single replicate of culture grown on BG-
11(Nit) media containing 1.5% agar (1 plate = approximately 40 mL) and are
representative of all samples.
: PltxA
pPJAV361 (empty vector)
pPJAV642
ltxA ltxB tleC
pPJAV644
ltxA ltxB ltxC tleD
pPJAV500
ltxA ltxB ltxC
28 29 30 31 32
28 29 30 31 32
28 29 30 31 32
28 29 30 31 32
28 29 30 31 32
28 29 30 31 32
28 29 30 31 32
28 29 30 31 32
N
HN
O
OH
NH
2
NNH
O
OH
NH
4
pPJAV500
ltxA ltxB ltxC
pPJAV632
tleD
28 29 30 31 32time (min)
28 29 30 31 32time (min)
: PltxD
9
(see Experimental Section), four peaks were present between 29.2-30.4 min for the
extract from the culture carrying ltxABC-tleD (pPJAV644, Figure 2). Each of these peaks
displayed a UV absorption spectrum (Figure S3), high-resolution protonated molecules of
452.3247, 452.3263, 452.3277, and 452.3268 ([M+H]+ calcd 452.3272, Figure S4), and
MS/MS fragmentation patterns consistent with teleocidin B-like compounds (Figure S5).
To definitively identify the structure of the compounds produced we placed ltxABC-tleD
under the control of PglnA to create pPJAV657 (Table S8). Roughly 1.1 mg of the major
compound was isolated from Anabaena 7120 containing pPJAV657 (PglnA-ltxABC-tleD)
cultivated in 20 L of BG11(Nit) medium supplemented with 50 mM fructose and
analyzed by 1H NMR, which confirmed the major product to be 4 (Figure S6, Table S1)
in agreement with previous work.9 The other three compounds were produced at low
levels and co-eluted with contaminating compounds despite the use of multiple HPLC
columns and conditions, which prevented definitive structure characterization.
Under our standard culture conditions, the PltxA-ltxABC-tleD construct produced
the four compounds in a 1.6 ± 0.3:1.1 ± 0.1:1.0 ± 0.0:6.0 ± 0.6 ratio as determined
through peak area integration in the MRM chromatogram (Figure 2, Figure S7), and
inclusion of fructose in the growth medium resulted in a similar distribution of
metabolites (2.1 ± 0.5:1.1 ± 0.2:1.1 ± 0.2:6.3 ± 1.1). The production of four compounds
here is in contrast to the observation of three compounds by Abe and co-workers.9
However, we note that it is possible that a fourth compound in the in vitro reaction co-
eluted with unreacted 2 and was therefore unobservable.9 Given the previous work, two
of the other teleocidin B-like peaks are presumed to be O-desmethylolivoretin C and
teleocidin B-1. Though the structure of the fourth compound is currently unknown, we
10
postulate that it could be either 9 or 10 (Figure S58), possibly arising from deprotonation
of the carbocation intermediate as proposed by Abe and co-workers.9 Experiments to
identify the fourth compound are underway in our lab. Production levels of the teleocidin
B-like compounds were consistent with those from our previous data on lyngbyatoxin
A,11 and the addition of fructose had variable effects on compound production (Figure 3,
Table S2-S3). While fructose did occasionally reduce the yield per dried cell mass, as
calculated in ng/mg of dried cell mass (Figure, Table S2-S3), it almost universally
increased the mass of the cells harvested (Table S4), which often increased total
compound yield.
Figure 3. Total “Teleocidin B” Production in Anabaena 7120. This is the
summed total amount of all four compounds displaying the MRM transition m/z
452.3 → 424.3. Production of the individual compounds can be seen in Table S2.
Values are given as the average ng/mg of dried cell mass standard deviation from
three replicates. Each replicate culture was grown on media containing 1.5% agar (1
plate = approximately 40 mL). afruc, denotes media containing 50 mM fructose.
0
200
400
600
800
1000
1200
1400
pPJAV36
1 (e
mpty
vec
tor)
pPJAV36
1 (e
mpty
vec
tor) fr
uc
Zeta
(em
pty ve
ctor)
Zeta
(em
pty
vect
or) fr
uc
LtxABC-T
leD
LtxABC-T
leD fr
uc
LtxABC z
eta-
TleD
LtxABC zet
a-Tle
D fr
uc
PglnA L
txAB
C-T
leD
PglnA L
txAB
C-T
leD fr
uc
ng
co
mp
ou
nd
s/m
g d
rie
d c
ell
ma
ss
ammonia nitrate
11
Multiple metabolites with an m/z of 436 (16 amu less than teleocidin B-4) were
found in minor quantities in strains producing teleocidin B-4 (Figure S9), and one of the
compounds was targeted for isolation and structure determination. HRESIMS produced a
protonated molecule at m/z 436.2956 which corresponds to the molecular formula
C27H38N3O2+ (calcd 436.2956, 0.46 ppm error, Figure S10). Examination of the 1H,
COSY, HSQC, HMBC, and NOESY NMR data established the structure as 8, a
presumed oxidative degradation product of teleocidin B-4 (4), the major compound
isolated above. In this structure, the hydroxymethylene group has
been lost and replaced by a carbonyl group to generate an imide
through an oxidative degradation (8, Figure S11-S17, Table S5).
Conversion of 4 to 8 results in a single conformer being observed in
the 1H NMR spectrum, which is in contrast to the mixture of two conformers found in the
other members of the indolactam natural products. Given the extremely low quantities in
the extract compared to teleocidin B-4 and related compounds (Figure S9), we propose
that these are non-enzymatic degradation products that accumulate during purification
and the initial oxidation could be catalyzed by contaminating chlorophyll, which elutes at
a similar time. Given that the oxidation occurs at C-9 of teleocidin B-4, we propose that
the configurations of the remaining centers are unchanged. Because the XIC of m/z
435.5-436.5 showed four compounds with a similar distribution to the teleocidin B family
of compounds, we propose that all four compounds can undergo this oxidative
degradation process; however, we only characterized one because the others co-elute with
contaminating compounds.
12
The mpnD gene encodes a prenyltransferase that, unlike TleC or LtxC, transfers a
dimethylallyl group to the C-7 position of ILV to complete the biosynthesis of
pendolmycin.7 Like the verification of tleC above, mpnD was cloned into the position of
ltxC to create pPAJV643 (ltxAB-mpnD). After introduction, culture, and extraction, and
LCMS analysis, we noted the presence of a peak only for the extract from the culture
containing ltxAB-mpnD and not for plasmids containing ltxC or tleC (Figure 4). This
peak had a shorter retention time (23.6 min) than both 2 or 4 and displayed a protonated
molecule of 370.2474 Da, consistent with the molecular formula of pendolmycin (calcd
370.2489, 4.0 ppm error, Figure S18). Additionally, the MS/MS fragmentation pattern
showed a loss of 28 Da, which was identical to the loss observed in the MS/MS
fragmentation of 2 and 4
(Figure S1, S5, S19). Isolation
of this compound from a 20 L
culture of Anabaena 7120
containing pPJAV659 (PglnA-
ltxAB-mpnD) in BG11(Nit)
media supplemented with 50
mM fructose, followed by 1H
NMR analysis, confirmed it to
be pendolmycin (Figure S20,
Table S6). Pendolmycin
production levels were
comparable with our previous
Figure 4. Production of pendolmycin. Zoomed
LCMS MRM chromatogram showing the constructs
used and production of 3 (370.3 → 342.3). Y-axis are
all scaled identically. Traces are from a single
replicate of culture grown on BG-11(Nit) media
containing 1.5% agar (1 plate = approximately 40
mL) and are representative of all samples.
22 23 24 25 26
22 23 24 25 26
22 23 24 25 26
pPJAV361 (empty vector)
22 23 24 25 26
time (min)
pPJAV500
ltxA ltxB ltxC
pPJAV642
ltxA ltxB tleC
pPJAV643
ltxA ltxB mpnD
: PltxA
N
HN
O
OH
NH
3
13
data on lyngbyatoxin A production,11 and the addition of fructose had variable effects on
the production of pendolmycin, as mentioned above (Figure 5).
These results show that
the codon-optimized tleC,
tleD, and mpnD all produce
active proteins with the
expected activity when
heterologously expressed in
Anabaena 7120.9, 15 This
demonstrates that the native
levels of transcriptional and
translational regulation exerted
when these genes occupy the
same positions as ltxC (tleC,
mpnD) and ltxD (tleD) in the
ltx gene cluster are sufficient
to produce proteins that efficiently catalyzed the desired reactions; each protein
completely converted its substrate to the expected product(s) because 1 was not observed
in extracts of ltxABC-tleD or ltxAB-mpnD. We did note the presence of trace amounts of
2 in Anabaena 7120 containing pPJAV644. We also note that no other compounds were
identified by LC-HRESIMS analysis other than the expected products (e.g. pendolmycin
in Anabaena 7120/pPJAV642) despite the fact that purified TleC and MpnD were found
to accept C5-C25 prenyl groups in vitro.15
Figure 5. Pendolmycin Production in Anabaena
7120. Values are given as the average ng/mg of dried
cell mass standard deviation from three replicates.
Each replicate culture was grown on media
containing 1.5% agar (1 plate = approximately 40
mL). afruc, denotes media containing 50 mM
fructose.
0
50
100
150
200
250
300
pPJAV36
1 (e
mpty
vec
tor)
pPJAV36
1 fruc
LtxAB-M
pnD
LtxAB-M
pnD fr
uc
PglnA L
txAB
-Mpn
D
PglnA L
txAB-M
pnD fr
uc
ng
co
mp
ou
nds/m
g d
rie
d c
ell
ma
ss
ammonia nitrate
14
Creation and Validation of a New Plasmid Vector for Use in Anabaena 7120. In the
above section, we used traditional synthetic biology to stitch together gene clusters,
which is a labor-intensive process, and so we endeavored to create a new vector (with
orthogonal antibiotic resistance) and co-transformation protocols for synthetic biology
efforts in Anabaena 7120 that could be used to quickly screen potential natural product
tailoring genes from diverse sources. To date, only the pDU1, pANS, and RSF1010
origins of replication (oriV), derived from Nostoc sp. strain PCC 7524,16 Synechococcus
elongatus strain PCC 7942,17 and Salmonella typhimurium,18 respectively, have been
shown to facilitate plasmid replication in Anabaena 7120.19-20 To provide another oriV
for use in Anabaena 7120, we sought to define a region harboring the oriV from the
endogenous Anabaena 7120 plasmid pCC7120ζ.21 Plasmid pCC7120ζ is 5.58 kb in size
and has a copy number of roughly six plasmids per chromosome;22 Anabaena 7120 is
thought to carry 10 to 20 copies of its chromosome per cell.23 This low copy number is
advantageous when carrying larger inserts as lower copy numbers typically correspond
with greater insert stability.
We amplified pCC7120ζ using PCR such that every quarter, half, three‐
quarter, and linearized whole-plasmid combination was prepared and cloned onto the
pBR322 oriV and Sp/Smr cassette from pPJAV361 for replication in E. coli (Figure
S15B). Of the nine amplification products generated, only three of these products
produced positive clones: the half segments of PCC7120ζ derived from amplification
with the primers zeta-SmaI-3F and zeta-SmaI-1R and zeta-SmaI-1F and zeta-SmaI-3R,
respectively, and the three-quarter segment derived from the primers zeta-SmaI-2F and
15
zeta-SmaI-1R, which were used to create pPJAV504, pPJAV505, and pPJAV506,
respectively (Tables S7 and S8). Anabaena 7120 colonies transformed with plasmid
pPJAV504 grew on selection following conjugation (carrying pCC7120ζ DNA
nucleotides 4533-1703, relative to the annotated starting position, e. g. the region
between primers 3F and 1R, (Figure S21A)). Two independent isolates of pPJAV504,
named pPJAV579 and pPJAV580, were re-isolated from Anabaena 7120 using a DNA
methylation-deficient strain of E. coli. Sequencing of pPJAV579 and pPJAV580 showed
that both had acquired an IS10-type transposon insertion in the pCC7120ζ portion of the
plasmids (Figure S21B).24 When pPJAV579 and pPJAV580 were re-conjugated into
Anabaena 7120, pPJAV579 displayed a far higher conjugation efficiency so the
remaining studies were conducted with this isolate.
To determine which fragment of pCC7120ζ DNA flanking the transposon
insertion was required for replication, as well as whether the transposon was involved in
this process, the pCC7120ζ DNA fragments and the proximal IS10 insertion sequence
were individually deleted from pPJAV579 and the ability to replicate in Anabaena 7120
was assessed. Only introduction of pPJAV606 (harboring the segment of pCC7120ζ
proximal to primer zeta-SmaI-1R, Figure S21C), and not pPJAV607 (harboring the
segment of pCC7120ζ proximal to primer zeta-SmaI-3F, Figure S21D, Table S8),
resulted in Anabaena 7120 colonies following antibiotic selection harboring a plasmid
that could be re-isolated. This indicates that the DNA necessary for replication of
pCC7120ζ is contained with nucleotides 5427-1703 of pCC7120ζ (relative to the
annotated starting condition). Additionally, the ability of the transposon to transpose out
of the plasmid was not involved in plasmid replication because pPJAV606, which
16
harbored the transposon with an insertion sequence removed to prohibit transposition,
yielded colonies upon introduction in Anabaena 7120. To increase the utility of this
finding, a kanamycin/neomycin resistant version of pPJAV606 was also generated
(pPJAV626). It was also possible to create a version of pPJAV626 harboring an ~42 kb
DNA fragment from Moorea producens (pPJAV655) that was introduced and maintained
in Anabaena 7120 (Figure S22).4 This indicates that the pCC7120ζ oriV can support the
replication of plasmids much larger than the native pCC7120ζ plasmid (5.58 kb). After
nearly two years of repeated cultivation following the initial introduction and continued
selection of pPJAV504 and, later, pPJAV606, we were unable to cure native pCC7120ζ.
The inability to cure pCC7120ζ indicates that it may contain an essential factor for
Anabaena 7120 growth or a portion of it aids in the replication or maintenance of
pPJAV504 and pPJAV606. In previous work, a copB homolog (asl9502), shown to be
involved in plasmid replication in other systems,25 was required for plasmid maintenance
in Anabaena 7120.22 It is possible that curing pCC7120ζ did not occur because
replication of pPJAV504 and pPJAV606 required the continued presence of asl9502 and
curing of pCC7120ζ would have resulted in colony death on continued antibiotic
selection.
Determination of Plasmid Copy Numbers in Anabaena 7120. Anabaena 7120 is
thought to maintain 10-20 copies of its chromosome per cell.23 Previous studies have
shown that pDU1-based vectors can be maintained at up to 1800 copies per chromosome
while roughly six copies of pCC7120ζ per chromosome have been observed.22, 26 To
determine the influence of relevant growth conditions and cargo of plasmids on plasmid
17
copy number, qPCR was conducted and the copy number was assessed relative to the
chromosomal concentration. The growth conditions tested were liquid and solid medium
supplemented with ammonia or nitrate and liquid diazotrophic growth. In general, the
copy numbers observed for pDU1- and pCC7120ζ-based plasmids used in this study are
similar to those previously published (Table 3).22, 26 Though copy numbers were
commonly higher in liquid medium than from cultures on solid medium, they were not
significantly different (t-test, p = 0.19). In our previous work, strengths of promoters
tested with plasmid-borne transcriptional fusions were highest during growth in liquid
cultures.11 It is very likely that the increased levels of expression previously recorded
were due to the comparably higher copy numbers of pPJAV361-based plasmids during
liquid growth. Copy numbers recorded in this work were statistically higher during
growth on media supplemented with ammonia (t-test, p > 0.0001), possibly because of
the ease of assimilation into metabolic processes. The copy number of the native
pCC7120ζ plasmid remained fairly constant within each growth condition irrespective of
the presence of pCC7120ζ-based plasmids pPJAV626 or pPJAV632. In most cases, the
copy number of pPJAV500 was higher than pPJAV361, which is consistent with
previous work indicating that the cargo of the plasmid can influence the copy number of
pDU1-derived plasmids in Anabaena 7120.26 The copy numbers of pCC7120ζ-based
plasmids with either neomycin or spectinomycin/streptomycin resistance were not
statistically different (t-test, p = 0.98), which suggests that the resistance mechanism does
not exert much control over copy number. In most growth conditions, the presence of a
pDU1-based plasmid resulted in an increased copy number of the pCC7120ζ-based
plasmids (pPJAV626 or pPJAV632), though not to a statistically different level (t-test, p
18
= 0.13). In contrast, the pDU1-based plasmid copy number was not generally altered by
the presence of a pCC7120ζ-based plasmid (t-test, p = 0.31). This suggests that the
pCC7120ζ oriV controls replication in Anabaena 7120 because these two construct types
contain the same E. coli oriV. Together, these results indicate that pDU1- and pCC7120ζ-
based plasmids can be maintained individually or together in Anabaena 7120 and that
their relative copy numbers are modulated by growth condition, plasmid cargo, and, in
some cases, the presence of additional plasmids.
Simultaneous Addition of Multiple Plasmids Via Conjugation. Plasmids are generally
introduced into Anabaena 7120 via conjugation from E. coli host strains27 containing a
self-mobilizable plasmid such as pRK24 or pRK2013.28 To increase the efficiency of
plasmid maintenance following the conjugal event, an Anabaena 7120 DNA methylase
on plasmid pRL528 is included to methylate mobilizable plasmids so they are not
digested by the native Anabaena 7120 restriction systems.27 This can proceed as a bi- or
triparental mating. In a biparental mating, the E. coli donor strain UC585 (or similar
conjugal strain) harbors three plasmids: pRK24, pRL528, and the mobilizable plasmid to
be introduced, which contains a compatible oriT.29 In a triparental mating, two E. coli
strains are utilized: one carrying pRK2013 and pRL528 (e.g. strain JCM113) and a
second strain with the oriT-containing mobilizable plasmid to be introduced into
Anabaena 7120. Using biparental, triparental, or quadriparental mating strategies, it is
theoretically possible to introduce up to two plasmids into Anabaena 7120
simultaneously. As a triparental mating, both mobilizable plasmids are introdcued
separately into E. coli strain UC585, and a quadriparental mating proceeds when E. coli
19
strain JCM113 is mixed with two E. coli strains each harboring only a single mobilizable
plasmid for transfer. We introduced pPJAV361 (pDU1-based empty vector,
Spectinomycin/Streptomycin resistant (Sp/Smr)), pPJAV500 (harboring ltxABC,
Sp/Smr),11 pPJAV626 (pCC7120ζ-based empty vector, Neomycin resistant (Neor)), and
pPJAV632 (harboring PltxD-tleD, Neor) into Anabaena 7120 singly or in combinations of
two plasmids with different selectable markers (Neor or Sp/Smr), and utilized both
triparental and quadriparental mating strategies to demonstrate the feasibility of
simultaneous addition of two plasmids to Anabaena 7120. We successfully selected for
the introduction of two plasmids using both triparental mating and quadriparental mating
with varying efficiencies (Table S7).
This is the first report of simultaneous addition of multiple plasmids into
Anabaena 7120 and indicates that pDU1 and pCC7120ζ are in different plasmid
incompatibility groups. This work also opens up the possibility of cloning multiple
biosynthetic gene clusters (BGCs) into a single Anabaena 7120 strain or splitting a BGC
into two vectors to facilitate conjugation and maintenance of said BGC.
The Use of Multiple Plasmids for Heterologous Compound Production. Following
the assessment of a new oriV for plasmid maintenance in Anabaena 7120 and
ascertaining that multiple plasmids can be conjugated into Anabaena 7120
simultaneously, we set out to determine if both plasmids (pPJAV500 and pPJAV632)
were functional in tandem. Anabaena 7120 strains carrying either pPJAV361 (empty
vector) and pPJAV626 (empty vector), or pPJAV500 (PltxA-ltxABC) and pPJAV632
(PltxD-tleD) were cultured, harvested, extracted, and assessed for the production of 2
20
and/or 4. While the negative control did not display peaks corresponding to either
compound, the two-plasmid combination resulted in the production of the teleocidin B
family of compounds in every condition tested (Figure 2, Table S2-S3). We observed
incomplete conversion of 2 to the teleocidin B family from the pPJAV500/pPJAV632
dual-plasmid system. During the media optimization experiments noted above, we noted
that the addition of fructose (50 mM) increased both LTXA yield and cell mass obtained,
greatly increasing the overall yield. We tested the effect of fructose addition on
compound production in Anabaena 7120 containing pPJAV500/pPJAV632. Cultivation
on BG-11(Nit) supplemented with 50 mM fructose resulted in no 2 being observed as
well as an increased yield of the teleocidin B family (Figure 3, Table S2-S3). This
observation and the experiments modulating plasmid copy number described above
suggest that incomplete conversion of intermediates, formed by the action of proteins
encoded on one plasmid, by accessory proteins encoded by the second plasmid may be
overcome by media optimization, promoter exchange, or shuffling genes between
plasmids.
In the S. blastmyceticus NBRC 12747 genome, the tleD gene is located distally
from tleABC.9 It is entirely possible that the tailoring genes associated with other natural
product gene clusters are spread throughout the producers’ genomes. Using this two-
plasmid system, it would be possible to clone the main gene cluster into one plasmid and
then create a cosmid library using the other plasmid to screen for tailoring genes of
interest. This strategy could also be employed to test a library of random mutants of a
single gene to identify amino acids required for function.
21
Conclusions/Summary
In this study, we showed that Anabaena 7120 is a viable host for combinatorial
biosynthesis of natural products and introduced a new plasmid backbone to enable these
investigations. Using the indolactam natural products as a test case and codon optimized
genes from Actinobacteria, we were able to produce pendolmycin and teleocidin B-4 in
acceptable yields in Anabaena 7120. We were also able to isolate and structurally
characterize a previously unknown oxidative degradation product of the indolactam
natural product family. We believe that the co-conjugation protocols and new plasmid
backbone described in this paper will be useful in studying cyanobacterial natural
products and in combinatorial biosynthesis studies in the future.
Acknowledgements. We thank Dr. Neil K. Garg (UCLA) for synthetic standards of
lyngbyatoxin A and pendolmycin. We thank Drs. William Gerwick and Lena Gerwick
(UCSD) for fos-DE-96 containing the lyngbyatoxin gene cluster. This work was
supported by the College of Pharmacy, Oregon State University, a New Investigator
Grant from the Medical Research Foundation of Oregon (grant #1415), and an AREA
award grant from the National Institutes of Health (1R15GM117541) to Benjamin
Philmus. We acknowledge the support of the Oregon State University NMR Facility
funded in part by the National Institutes of Health, HEI Grant 1S10OD018518, and by
the M. J. Murdock Charitable Trust grant #2014162. Patrick Videau was supported by
startup funds from Southern Oregon University (SOU) and use of the SOU
Biotechnology Research Center is acknowledged.
22
Abbreviations
BG-11(NH4), BG-11 media with ammonium chloride as the nitrogen source; BG-11(Nit),
BG-11 media with sodium nitrate as the nitrogen source; BGC, biosynthetic gene cluster;
COSY, correlation spectroscopy; DNA, deoxyribonucleic acid; HMBC, heteronuclear
multiple bond correlation; HPLC, high pressure liquid chromatography; HRESIMS, high
resolution electrospray ionization mass spectrometry; HSQC, heteronuclear single
quantum coherence quantum correlation; ILV, indolactam V; MRM, multiple reaction
monitoring; MS/MS, tandem mass spectrometry; Neor, neomycin resistant; NMR, nuclear
magnetic resonance; NMVT, N-methyl-L-valyl-L-tryptophanol; NOESY, Nuclear
Overhauser spectroscopy; NRPS, non-ribosmal peptide synthetase; ori, origin of
replication; oriT, origin of transfer; Smr, spectinomycin resistant; Spr, spectinomycin
resistant; XIC, extracted ion chromatogram.
Experimental Section
General Experimental Procedures. All UV-vis spectroscopy was performed using a
BioSpectrometer Kinetic (Eppendorf). NMR spectra were obtained on a Bruker DPX-500
MHz instrument with a 5mm TXI triple resonance (HCN) probe or a Bruker Avance III-
800 MHz instrument equipped with a 4-channel 5 mm TCI cryoprobe using TopSpin
version 3.5pl7. Data was processed using TopSpin version 4.0 (Bruker). Quantitation of
metabolites was obtained using a Shimadzu Prominence HPLC (consisting of a degasser,
23
two LC-10AD HPLC pumps, an autosampler, a photodiode array, and system controller)
upstream of a 3200 QTrap mass spectrometer (AbSciex) operated using the Analyst
software package. Data was analyzed offline using Peakview version 2.2 software. High-
resolution mass spectrometry was performed using an Agilent 6230 time-of-flight mass
spectrometer downstream of an Agilent 1260 Infinity HPLC system consisting of a
degasser, quaternary pump, autosampler, and diode array detector. The instrument was
operated using MassHunter software and data was processed offline using MassHunter
Qualitative software.
LCMS grade H2O and MeOH were purchased from MilliporeSigma, while all restriction
enzymes, polynucleotide kinase, Escherichia coli NEB10 and DH5MCR cells, and T4
DNA ligase were purchased from New England Biolabs. The QIAquick PCR purification
kit, QIAquick gel extraction kit, and QIAprep Spin Miniprep Kit were purchased from
Qiagen and were used according to the manufacturer’s instructions. LCMS grade H2O,
MeCN, and formic acid were purchased from Fisher Chemicals. All other chemicals were
purchased from Sigma-Aldrich and used without further purification unless otherwise
specified. Sanger sequencing was performed with Big Dye Terminator chemistry at the
Center for Genome Resources and Biocomputing (Oregon State University). Primestar
GXL was purchased from CloneTech and KOD Hot Start DNA polymerase was
purchased from EMD Millipore and both were used according to the manufacturer’s
instructions. Oligonucleotides were purchased from IDT Technologies with standard
desalting and used without further purification.
24
Bacterial Strains and Growth Conditions. The strains used in this study are listed in
Table S8. E. coli was routinely cultured in Lysogeny Broth (LB), Miller supplemented
with spectinomycin (100 g/mL), kanamycin (50 g/mL), ampicillin (100 g/mL), or
chloramphenicol (30 g/mL) for plasmid selection as previously described and solidified
with 1.5% agar for plate culture.11 Anabaena PCC 7120 was routinely grown on BG-11
medium with nitrate (BG-11(Nit)) or ammonia (BG-11(NH4)) as the nitrogen source and
supplemented with streptomycin and spectinomycin (2.5 g/mL each) or neomycin (90
g/mL) for plasmid selection as previously described.11, 30 Plasmids were introduced into
Anabaena 7120 by conjugation from E. coli as previously described.27, 31 Bacteria were
handled using aseptic technique and all molecular biology protocols were performed
according to standard procedures unless otherwise stated.32
Plasmid Construction. The plasmids used in this study are listed in Table S8. The
oligonucleotides used in this study are listed in Table S9. The preparation of inserts and
vectors for ligase-mediated cloning and /Red recombination using pKD46 in E. coli
strain BW25113 were conducted as previously described.11, 33 Plasmids pUC57-tleC,
pUC57-tleD, and pUC57-mpnD, which contain codon-optimized genes encoding TleC
and TleD from Streptomyces blastmyceticus NBRC 12747 and MpnD from
Marinactinospora thermotolerans SCSIO 00652, respectively, were purchased from
GenScript, and individually cloned into the EcoRV site of pUC57 to create pUC57-tleC,
pUC57-tleD, and pUC57-mpnD.
Construction of Plasmids pPJAV504, pPJAV505, and pPJAV506. Plasmids
pPJAV504, pPJAV505, and pPJAV506 are mobilizable shuttle vectors based on
25
pPJAV36111 with fragments of the endogenous Anabaena 7120 Zeta plasmid individually
replacing the pDU1 oriV.16, 21 Fragments 2, 3, and 6 of the Zeta plasmid were amplified
by PCR from Anabaena 7120 chromosomal DNA with the primer pairs zeta-SmaI-3F and
zeta-SmaI-1R, zeta-SmaI-4F and zeta-SmaI-2R, zeta-SmaI-2F and zeta-SmaI-1R,
respectively (Figure S16A, Table S9), and all digested with SmaI. A fragment from
pPJAV361 containing the pBR322 oriV, oriT, and the Spr/Smr Ω interposon was
amplified by PCR from pPJAV361 with the primers pAM504-pBR-F and pAM504-pBR-
R and each fragment of Zeta was individually cloned with the product to create
pPJAV504, pPJAV505, and pPJAV506.
Construction of Plasmids pPJAV579 and pPJAV580. Plasmids pPJAV579 and
pPJAV580 are mobilizable shuttle vectors based on pPJAV361 harboring a transposon
insertion within the fragment of Zeta DNA (pCC7120ζ). Following introduction and
selection of pPJAV504 in Anabaena 7120, positive colonies were isolated, genomic
DNA was extracted, and transformed into E. coli strain DH5αMCR. Plasmids were
extracted from the spectinomycin resistant E. coli colonies arising from transformation
with DNA extracted from two independent Anabaena 7120 isolates. PCR analysis
showed that the Zeta fragment amplified from each isolate was larger than analogous
fragment amplified from pPJAV504. The region was sequenced with the walking primers
505-BamHI, pAM504Ecoliup-R, Zeta2-1-walk1-F, Zeta2-1-walk1-R, and zeta-SmaI-4R.
Both isolates harbor a transposon insertion within the fragment of Zeta DNA to create
pPJAV579 and pPJAV580.
Construction of Plasmids pPJAV606 and pPJAV607. Plasmids pPJAV606 and
pPJAV607 are mobilizable shuttle vectors based on pPJAV361 harboring half of the
26
fragment of Zeta DNA on either side of the transposon insertion present in pPJAV579.
pPJAV579 was linearized by PCR with the primer pairs Tnp-int-F and pAM504-pBR-R
and Tnp-int-R and pAM504-pBR-F, respectively, and phosphorylated with
polynucleotide kinase). The products were self-ligated removing the up- and downstream
portions of Zeta DNA and the transposon insertion sequence relative to the orientation of
the transposon in pPJAV579 to create pPJAV606 and pPJAV607.
Construction of Plasmid pPJAV626. Plasmid pPJAV626 is a mobilizable shuttle
vector based on pPJAV50434 harboring the fragment of Zeta DNA allowing pPJAV606 to
replicate in Anabaena 7120. A fragment containing Zeta and transposon DNA was
amplified by PCR from pPJAV606 with the primers Zeta-SmaI-3F and pAM504-
Ecoliup-R, which was phosphorylated with polynucleotide kinase. This product was
digested with SmaI and cloned onto the portion of pAM504 required for kanamycin
resistance, conjugation, and replication in E. coli, amplified by PCR from pAM504 with
the primers pAM504-pBR-F and pAM504-pBR-R, to create pPJAV626.
Construction of Plasmid pPJAV631. Plasmid pPJAV631 is a source of the ltxA
promoter. The ltxA promoter was amplified by PCR from the fosmid fos-DE3-864 with
the primers PlxtA-XhoI-F and Pltx-R. The product was cloned into the EcoRV site of
pBlueScript SK+ (Stratagene) and screened for directionality by PCR such that the
promoter reads toward the SmaI site to create pPJAV631.
Construction of Plasmid pPJAV632. Plasmid pPJAV632 is a mobilizable shuttle
vector based on pPJAV626 carrying PltxD-tleD. The ltxD promoter region was amplified
by PCR from the fosmid fos-DE3-86 with the primers PltxD-tleC-red-F and PltxD-R and
the coding region of tleD was amplified from pUC57-tleD with the primers tleD-PltxD-
27
OEX-F and tleD-R. The products were fused by overlap extension,35 cloned into the
SmaI site of pPJAV626, and screened for directionality by PCR to read away from the
Zeta DNA involved in replication to create pPJAV632.
Construction of Plasmid pPJAV642. Plasmid pPJAV642 is a mobilizable shuttle
vector based on pPJAV361 carrying PltxA-ltxAB-tleC. The coding region of tleC was
amplified by PCR from pUC57-tleC with the primers tleC-ltxB-red-F and tleC-R and
cloned into the SmaI site of pPJAV631. A fragment containing PltxA-tleC was amplified
by PCR from the previous construct with the primers PltxA-XhoI-F and tleC-R, cloned
into the SmaI site of pPJAV361, and checked for directionality such it read away from
the spectinomycin/streptomycin resistance cassette. The resulting plasmid was linearized
by PCR with the primers Pltx-R and tleC-ltxB-red-F and electroporated into competent E.
coli as described above for lambda red recombination to recombineer ltxA-C. Resulting
transformants were screened by PCR for the presence of ltxA-C to create pPJAV642.
Construction of Plasmid pPJAV643. Plasmid pPJAV643 is a mobilizable shuttle
vector based on pPJAV361 carrying PltxA-ltxAB-mpnD. The coding region of mpnD was
amplified by PCR from pUC57-mpnD with the primers mpnD-ltxB-red-F and mpnD-R
and cloned into the SmaI site of pPJAV631. A fragment containing PltxA-mpnD was
amplified by PCR from the previous construct with the primers PltxA-XhoI-F and mpnD-
R, cloned into the SmaI site of pPJAV361, and checked for directionality such it read
away from the spectinomycin/streptomycin resistance cassette. The resulting plasmid was
linearized by PCR with the primers Pltx-R and mpnD-ltxB-red-F and electroporated into
competent E. coli as described above for lambda red recombination to recombineer ltxA-
28
C. Resulting transformants were screened by PCR for the presence of ltxA-C to create
pPJAV643.
Construction of Plasmid pPJAV644. Plasmid pPJAV644 is a mobilizable shuttle
vector based on pPJAV361 carrying PltxA-ltxABC-tleD. The coding region of tleD was
amplified by PCR from pUC57-tleD with the primers tleD-PltxD-OEX-F and tleD-R and
PltxD was amplified by PCR from fos-DE3-86 with the primers PltxD-tleC-red-F and
PltxD-R. These products were fused by overlap extension and cloned into the SmaI site
of pPJAV631. A fragment containing PltxA-PltxD-tleD was amplified by PCR from the
previous construct with the primers PltxA-XhoI-F and tleD-R, cloned into the SmaI site
of pPJAV361, and checked for directionality such it read away from the
spectinomycin/streptomycin resistance cassette. The resulting plasmid was linearized by
PCR with the primers Pltx-R and PltxD-tleC-red-F and electroporated into competent E.
coli as described above for lambda red recombination to recombineer ltxA-C. Resulting
transformants were screened by PCR for the presence of ltxA-C to create pPJAV644.
Construction of Plasmid pPJAV647. Plasmid pPJAV647 is a mobilizable shuttle
vector based on pPJAV361 carrying PglnA-ltxAB-tleC. A fragment harboring PglnA-ltxA
was amplified by PCR from pPJAV50311 with the primers PglnA-XhoI-F and ltxA-int-
SmaI-R. The product was cloned as an XhoI-NdeI fragment into the same sites of
pPJAV642 to create pPJAV647.
Construction of Plasmid pPJAV650, pPJAV657, pPJAV658, and pPJAV659.
Plasmids pPJAV650, pPJAV657, pPJAV658, and pPJAV659 are mobilizable shuttle
vectors based on pPJAV361 carrying PglnA-ltxAB-mpnD-tleD, PglnA-ltxABC-tleD, PglnA-
ltxAB-tleC-tleD, and PglnA-ltxAB-mpnD, respectively. A fragment harboring PglnA-ltxA was
29
amplified by PCR from pPJAV503 with the primers PglnA-XhoI-F and ltxA-int-SmaI-R,
digest with XhoI, and cloned into the XhoI-EcoRV sites of pBlueScript SK+. Fragments
containing mpnD-tleD, ltxC-tleD, tleC-tleD, and mpnD were amplified by PCR from
pPJAV645, pPJAV644, pPJAV646, and pPJAV643, respectively, with the forward
primer ltxB-int-NdeI-F and the corresponding reverse primer tleD-R or mpnD-R. The
products were digested with NdeI and individually cloned into the NdeI-SmaI sites
downstream of PglnA-ltxA in pBlueScript SK+. Fragments containing PglnA-ltxA-mpnD-
tleD, PglnA-ltxA-ltxC-tleD, PglnA-ltxA-tleC-tleD, and PglnA-ltxA-mpnD were excised from
pBlueScript SK+ via XhoI-SacI digestion and cloned into the SalI-SacI sites of
pPJAV361. Each of the resulting constructs was linearized by NdeI digestion and
electroporated into competent E. coli as described above for Lambda Red recombination
to recombineer ltxAB. Resulting transformants were screened by PCR for the presence of
ltxAB, ltxC, tleC, tleD, and mpnD as appropriate to create pPJAV650, pPJAV657,
pPJAV658, and pPJAV659, respectively.
Construction of Plasmid pPJAV653. Plasmid pPJAV653 is a mobilizable shuttle
vector based on pAM50436 carrying the coding region of hetR as well as an Ω interposon
conferring resistance to spectinomycin and streptomycin. The coding region of hetR was
amplified by PCR from Anabaena 7120 chromosomal DNA with the primers HetR-NdeI-
F and HetR-R and the product was cloned into the SmaI site of pAM504. This construct
was digested with EcoRI, blunt-ended, and the Ω interposon from pDW937 was cloned in
as a blunt-ended HindIII fragment to create pPJAV653.
Construction of Plasmid pPJAV655. Plasmid pPJAV655 is a mobilizable shuttle
vector based on pPJAV626 carrying the ~40 kb M. producens DNA fragment from fos-
30
DE3-86. Regions up- and downstream of the M. producens insert were amplified by PCR
from fos-DE3-86 with the primer pairs fos-up-F and fos-up-BamHI-R and fos-dn-
BamHI-F and fos-dn-EcoRI-R, respectively. The up- and downstream products were
digested with BamHI and cloned into the SmaI site of pPJAV626. The resulting plasmid
was linearized by PCR with the primers fos-dn-BamHI-F and fos-up-BamHI-R and
electroporated into competent E. coli as described above for Lambda Red recombination
to recombineer the M. producens DNA fragment from fos-DE3-86. Resulting
transformants were screened by PCR for the presence of ltxA-D to create pPJAV655.
Quantification of Conjugation Efficiency. Anabaena 7120 was cultured in 100 mL of
BG-11 (Nit) until mid-log phase (OD750 of 0.6 – 0.9), cells were pelleted using
centrifugation at 2,000 x g for 3 min, all but 10 mL of the supernatant was decanted, and
then the cells were transferred to a glass culture tube. The culture was disrupted by
sonication with a Branson 3510 sonicator until the average filament length was roughly
10 cells long as determined by visual assessment. E. coli strains NEB10β (New England
Biolabs) and UC585,29 individually harboring pPJAV361, pPJAV500, pPJAV606, or
pPJAV636, and JCM113 (HB101 with pRL528 and pRK2013 for conjugation, a kind gift
of J. C. Meeks) were grown overnight in 2 mL liquid cultures of LB containing the
appropriate antibiotic, and were used to inoculate fresh 2 mL LB cultures in the morning
(1:100 dilution). Once these new cultures grew to an OD600 of 0.7-0.9, they were pelleted
by centrifugation at 7,000 x g and washed twice with BG-11(Nit). For conjugation, 200
μL of sonicated Anabaena 7120 (about 5.6 x 108 CFU) was mixed with 50 μL of each
washed E. coli strain (about 2.1 x 108 CFU) and allowed to dry onto the surface of BG-
31
11(Nit) plates supplemented with 5% LB broth as previously described.31 Every bi-, tri-,
and quadraparental mating was mixed in triplicate to create all possible combinations that
would result in the introduction of one or two plasmids. After 2 days of growth on the
conjugation plates, each mix was individually resuspended in 1 mL of BG-11(Nit) and
used to create five ten-fold serial dilutions from which 300 uL was plated onto BG-
11(Nit) supplemented with the appropriate antibiotics. Colonies were counted 3 weeks
later and used to calculate the combined efficiency of conjugation, plate transfer, and
selection as compared to the possible growth of the unconjugated sonicated Anabaena
7120 culture. The data was expressed in this manner because it more accurately
represents the number of colonies expected following completion of this protocol rather
than solely an approximation of conjugal efficiency.
Production, Purification, and LC-MS/MS Quantification of Lyngbyatoxin A,
Pendolmycin A, and Teleocidin B. Assays for the production of heterologously
expressed compounds were prepared, carried out, and compounds were extracted as
previously described.11 Assay conditions were identical to those previously published.11
LC-MS/MS analyses were conducted as previously described with minor modifications.
Briefly, a Shimadzu Prominence HPLC consisting of a degasser, two LC-10AD HPLC
pumps, an autosampler, a photodiode array, and system controller, upstream of a 3200
QTrap mass spectrometer (AbSciex) was used for separation and quantitation. Separation
was achieved using a Luna C18(2) column (2.0 Å~ 150 mm, 3 μm, Phenomenex) with a
flow rate of 0.2 mL/min with line A containing H2O + 0.1% (v/v) formic acid and line B
containing MeCN + 0.1% (v/v) formic acid, which operated under the following
32
program. The column was pre-equilibrated in 95% A/5% B, and upon injection, this
composition was held for 1 min. The composition of mobile phase was then changed to
0% A/100% B over 29 min utilizing a linear gradient. This composition was held for 5
min, followed by changing to 95% A/5% B over 3 min. The column was equilibrated in
95% A/5% B for 5 min prior to the next injection. Under these chromatographic
conditions, pendolmycin eluted at 23 min, lyngbyatoxin A eluted at 29 min, and the four
compounds with protonated molecules at m/z 452.3 eluted from 29.2-30.4 min. MS/MS
analysis was done in MRM mode for pendolmycin (Q1, 370.3; Q2, 242.3; 40 ms),
lyngbyatoxin A (Q1, 438.3; Q2, 410.2; 40 ms), and m/z 452.3 compounds (Q1, 452.3;
Q2, 424.2; 40 ms). The instrument was operated with Analyst 1.5.1, build 5218, and data
analysis was performed with PeakView, ver. 2.1.0.11041 (AbSciex). Known
concentrations of purified pendolmycin, lyngbyatoxin A, and teleocidin B-4 were run on
the same program and standard curves were created for the low range from the MRM
programs described above and for the high range by integrating the area under the UV
curve at 300 ± 2 nm.
DNA Extraction and Plasmid Copy Number Determination by qPCR. Anabaena
7120 strains harboring pPJAV361, pPJAV500, pPJAV606, pPJAV626, and/or
pPJAV636 were grown on plates or in 30 mL liquid cultures in identical conditions to
those used for heterologous expression, as well as in liquid BG-11(NH4) or liquid BG-
11(Nit) 48 h after the removal of combined nitrogen, to represent many physiologically
relevant growth conditions. After the required culture duration, cells were scraped from
plates or pelleted by centrifugation at 2,000 x g for 3 min, washed with TES (10 mM Tris
33
HCl, pH 7.5; 25 mM EDTA, pH 8.0, 500 mM NaCl) to remove exopolysaccharides as
previously described,38 and stored at -80 °C until processing. The pellets were treated
with lysozyme as previously described39 and DNA was purified by phenol-chloroform
extraction as described.40-41 DNA concentrations were measured using a BioSpectrometer
kinetic (Eppendorf) and all samples were diluted to 100 pg/uL for use. All qPCRs were
performed in MicroAmp Fast Optical 96 well reaction plates (Thermo Fisher Scientific)
covered with MicroAmp Optical Adhesive film (Thermo Fisher Scientific). qPCR
reactions were assembled manually and contained 10 pmol of each primer, 100 pg of
template DNA, and 10 μL of iTaq Universal SYBR Green Supermix (Bio-Rad) in 20 μL
reactions. The primers AMO-645 and AMO-646 were utilized to amplify a portion of the
hetR coding region to assesses the concentration of Anabaena 7120 chromosomes as
previously described.22 Portions of the alr9504, nptII, and aadAI genes were amplified
from purified plasmid DNA with the primer sets Zeta-qPCR-F and Zeta-qPCR-R, AMO-
679 and AMO-680, and aadA1-F and aadA1-R, respectively, as previously described.22
The reaction profile was 3 min at 95 °C followed by 40 cycles of 30 s at 95°C, 30 s at 56
°C, and 30 s at 72 °C. An annealing temperature of 56°C was used because this
temperature elicited similar amplification levels from all primer sets. Negative controls
(no template DNA) were included and a melting curve analysis was performed in all
cases. qPCRs were performed with two biological replicates and technical triplicate of
each DNA sample in a StepOnePlus Real-Time PCR System (Applied Biosystems).
Standard curves were performed with eight ten-fold serial dilutions for each primer set in
technical triplicate, using purified PCR products, derived from either pPJAV653 or
chromosomal DNA, as templates. The relative quantities of each sample were calculated
34
using the ΔΔCt method, considering each primer’s specific efficiency calculated from the
standard curves. All values are expressed as the plasmid copy number per chromosome as
previously described.22
35
Table 1. Copy Number of pDU1- and Zeta-based Plasmids in Anabaena 7120 During
Culture in Liquid or Solid BG-11 Medium Supplemented with Nitrate or Ammonia
as Nitrogen Sources or Grown Diazotrophically. Experiments not conducted are
denoted as N/A.
Liquid BG-11
Plasmids pDU1 Zeta-Sp/Km Native Zeta
pPJAV606 N/A 4.9 ± 0.01 12.9 ± 0.6
pPJAV626 N/A 2.1 ± 0.2 1.9 ± 0.1
pPJAV632 N/A 4.2 ± 0.1 12.2 ± 0.2
pPJAV361 2.9 ± 0.1 N/A 10.7 ± 0.3
pPJAV500 15.9 ± 0.3 N/A 12.2 ± 0.9
pPJAV361 + pPJAV626 15.5 ± 0.0 1.4 ± 0.1 11.8 ± 0.5
pPJAV361 + pPJAV632 3.2 ± 0.2 3.6 ± 0.1 9.9 ± 0.1
pPJAV500 + pPJAV626 8.1 ± 0.1 8.9 ± 0.2 9.9 ± 0.2
pPJAV500 + pPJAV632 4.4 ± 2.1 4.9 ± 2.5 10.4 ± 0.2
Liquid BG-11(NH4)
Plasmids pDU1 Zeta-Sp/Km Native Zeta
pPJAV606 N/A 6.1 ± 0.8 15.6 ± 2.1
pPJAV626 N/A 1.7 ± 0.1 1.5 ± 0.1
pPJAV632 N/A 5.0 ± 1.0 17.3 ± 5.3
pPJAV361 182.2 ± 8.7 N/A 17.4 ± 5.3
pPJAV500 414.5 ± 64.1 N/A 25.4 ± 5.4
pPJAV361 + pPJAV626 296.4 ± 84.3 2.8 ± 0.7 30.3 ± 5.1
pPJAV361 + pPJAV632 93.9 ± 16.6 92.2 ± 15.5 13.9 ± 1.4
pPJAV500 + pPJAV626 237.7 ± 5.2 230.5 ± 6.4 19.0 ± 3.4
pPJAV500 + pPJAV632 199.0 ± 44.7 206.9 ± 34.8 20.1 ± 1.2
Liquid BG-11 Diazotrophy
Plasmids pDU1 Zeta-Sp/Km Native Zeta
pPJAV606 N/A 5.9 ± 0.7 1.5 ± 0.0
pPJAV626 N/A 2.4 ± 0.2 2.2 ± 0.0
pPJAV632 N/A 5.2 ± 0.4 2.2 ± 0.2
pPJAV361 3.1 ± 0.1 N/A 1.7 ± 0.0
pPJAV500 17.9 ± 1.4 N/A 1.9 ± 0.0
pPJAV361 + pPJAV626 6.7 ± 0.1 1.3 ± 0.1 1.9 ± 0.2
pPJAV361 + pPJAV632 13.0 ± 1.0 3.8 ± 0.4 2.0 ± 0.1
pPJAV500 + pPJAV626 2.9 ± 0.1 9.0 ± 2.3 1.5 ± 0.3
pPJAV500 + pPJAV632 7.4 ± 1.9 7.5 ± 1.1 1.4 ± 0.1
BG-11 Plates
Plasmids pDU1 Zeta-Sp/Km Native Zeta
pPJAV606 N/A 7.5 ± 1.5 1.9 ± 0.1
pPJAV626 N/A 4.2 ± 0.2 1.9 ± 0.1
pPJAV632 N/A 4.7 ± 0.6 1.4 ± 0.1
36
pPJAV361 2.8 ± 0.1 N/A 1.5 ± 0.01
pPJAV500 12.9 ± 0.3 N/A 1.4 ± 0.1
pPJAV361 + pPJAV626 2.7 ± 0.2 13.8 ± 0.1 1.7 ± 0.1
pPJAV361 + pPJAV632 1.8 ± 0.5 23.3 ± 1.7 1.3 ± 0.1
pPJAV500 + pPJAV626 1.9 ± 0.02 24.6 ± 1.9 1.1 ± 0.01
pPJAV500 + pPJAV632 2.2 ± 0.02 29.7 ± 1.0 1.2 ± 0.01
BG-11(NH4) Plates
Plasmids pDU1 Zeta-Sp/Km Native Zeta
pPJAV606 N/A 10.4 ± 5.3 1.3 ± 1.2
pPJAV626 N/A 1.1 ± 0.3 1.1 ± 1.0
pPJAV632 N/A 38.0 ± 0.1 1.9 ± 0.1
pPJAV361 99.5 ± 33.0 N/A 2.3 ± 0.2
pPJAV500 244.8 ± 12.8 N/A 5.6 ± 0.6
pPJAV361 + pPJAV626 203.4 ± 39.5 30.8 ± 1.2 3.5 ± 0.2
pPJAV361 + pPJAV632 493.7 ± 149.5 438.1 ± 56.4 1.5 ± 0.1
pPJAV500 + pPJAV626 692.7 ± 17.3 744.1 ± 2.9 1.7 ± 0.1
pPJAV500 + pPJAV632 763.7 ± 28.6 828.1 ± 77.0 1.8 ± 0.01
37
References
1. Dittmann, E.; Gugger, M.; Sivonen, K.; Fewer, D. P., Natural product
biosynthetic diversity and comparative genomics of the cyanobacteria. Trends Microbiol.
2015, 23 (10), 642-652.
2. Gerwick, William H.; Moore, Bradley S., Lessons from the past and charting the
future of marine natural products drug discovery and chemical biology. Chem. Biol.
2012, 19 (1), 85-98.
3. Kleigrewe, K.; Gerwick, L.; Sherman, D. H.; Gerwick, W. H., Unique marine
derived cyanobacterial biosynthetic genes for chemical diversity. Nat. Prod. Rep. 2016,
33 (2), 348-364.
4. Edwards, D. J.; Gerwick, W. H., Lyngbyatoxin biosynthesis: Sequence of
biosynthetic gene cluster and identification of a novel aromatic prenyltransferase. J. Am.
Chem. Soc. 2004, 126 (37), 11432-11433.
5. Cardellina, J. H., 2nd; Marner, F. J.; Moore, R. E., Seaweed dermatitis: structure
of lyngbyatoxin A. Science 1979, 204 (4389), 193-195.
6. Basu, A.; Kozikowski, A. P.; Lazo, J. S., Structural requirements of lyngbyatoxin
A for activation and downregulation of protein kinase C. Biochemistry 1992, 31 (15),
3824-3830.
7. Ma, J.; Zuo, D.; Song, Y.; Wang, B.; Huang, H.; Yao, Y.; Li, W.; Zhang, S.;
Zhang, C.; Ju, J., Characterization of a single gene cluster responsible for
methylpendolmycin and pendolmycin biosynthesis in the deep sea bacterium
Marinactinospora thermotolerans. ChemBioChem 2012, 13 (4), 547-552.
38
8. Yamashita, T.; Imoto, M.; Isshiki, K.; Sawa, T.; Naganawa, H.; Kurasawa, S.;
Zhu, B.-Q.; Umezawa, K., Isolation of a new indole alkaloid, pendolmycin, from
Nocardiopsis. J. Nat. Prod. 1988, 51 (6), 1184-1187.
9. Awakawa, T.; Zhang, L.; Wakimoto, T.; Hoshino, S.; Mori, T.; Ito, T.; Ishikawa,
J.; Tanner, M. E.; Abe, I., A methyltransferase initiates terpene cyclization in teleocidin B
biosynthesis. J. Am. Chem. Soc. 2014, 136 (28), 9910-9913.
10. Hitotsuyanagi, Y.; Fujiki, H.; Suganuma, M.; Aimi, N.; Sakai, S.; Endo, Y.;
Shudo, K.; Sugimura, T., Isolation and structure elucidation of teleocidin B-1, B-2, B-3,
and B-4. Chem Pharm Bull (Tokyo) 1984, 32 (10), 4233-4236.
11. Videau, P.; Wells, K. N.; Singh, A. J.; Gerwick, W. H.; Philmus, B., Assessment
of Anabaena sp. strain PCC 7120 as a heterologous expression host for cyanobacterial
natural products: Production of lyngbyatoxin A. ACS Synth. Biol. 2016, 5 (9), 978-988.
12. Jones, A. C.; Ottilie, S.; Eustáquio, A. S.; Edwards, D. J.; Gerwick, L.; Moore, B.
S.; Gerwick, W. H., Evaluation of Streptomyces coelicolor A3(2) as a heterologous
expression host for the cyanobacterial protein kinase C activator lyngbyatoxin A. FEBS J.
2012, 279 (7), 1243-1251.
13. Ongley, S. E.; Bian, X.; Zhang, Y.; Chau, R.; Gerwick, W. H.; Müller, R.; Neilan,
B. A., High-titer heterologous production in E. coli of lyngbyatoxin, a protein kinase C
activator from an uncultured marine cyanobacterium. ACS Chem. Biol. 2013, 8 (9), 1888-
1893.
14. Stebegg, R.; Wurzinger, B.; Mikulic, M.; Schmetterer, G., Chemoheterotrophic
growth of the cyanobacterium Anabaena sp. strain PCC 7120 dependent on a functional
cytochrome c oxidase. J. Bacteriol. 2012, 194 (17), 4601-4607.
39
15. Mori, T.; Zhang, L.; Awakawa, T.; Hoshino, S.; Okada, M.; Morita, H.; Abe, I.,
Manipulation of prenylation reactions by structure-based engineering of bacterial
indolactam prenyltransferases. Nat. Commun. 2016, 7 (EARLY EDITION).
16. Wolk, C. P.; Vonshak, A.; Kehoe, P.; Elhai, J., Construction of shuttle vectors
capable of conjugative transfer from Escherichia coli to nitrogen-fixing filamentous
cyanobacteria. Proc. Natl. Acad. Sci. U. S. A. 1984, 81 (5), 1561-1565.
17. Chen, Y.; Taton, A.; Go, M.; London, R. E.; Pieper, L. M.; Golden, S. S.; Golden,
J. W., Self-replicating shuttle vectors based on pANS, a small endogenous plasmid of the
unicellular cyanobacterium Synechococcus elongatus PCC 7942. Microbiology 2016, 162
(12), 2029-2041.
18. Anderson, E. S.; Lewis, M. J., Characterization of a transfer factor associated with
drug resistance in Salmonella typhimurium. Nature 1965, 208 (5013), 843-849.
19. Wolk, C. P.; Fan, Q.; Zhou, R.; Huang, G.; Lechno-Yossef, S.; Kuritz, T.;
Wojciuch, E., Paired cloning vectors for complementation of mutations in the
cyanobacterium Anabaena sp. strain PCC 7120. Arch. Microbiol. 2007, 188 (6), 551-563.
20. Fan, Q.; Huang, G.; Lechno-Yossef, S.; Wolk, C. P.; Kaneko, T.; Tabata, S.,
Clustered genes required for synthesis and deposition of envelope glycolipids in
Anabaena sp. strain PCC 7120. Mol. Microbiol. 2005, 58 (1), 227-243.
21. Kaneko, T.; Nakamura, Y.; Wolk, C. P.; Kuritz, T.; Sasamoto, S.; Watanabe, A.;
Iriguchi, M.; Ishikawa, A.; Kawashima, K.; Kimura, T.; Kishida, Y.; Kohara, M.;
Matsumoto, M.; Matsuno, A.; Muraki, A.; Nakazaki, N.; Shimpo, S.; Sugimoto, M.;
Takazawa, M.; Yamada, M.; Yasuda, M.; Tabata, S., Complete genomic sequence of the
40
filamentous nitrogen-fixing cyanobacterium Anabaena sp. strain PCC 7120. DNA Res.
2001, 8 (5), 205-213.
22. Lee, M. H.; Scherer, M.; Rigali, S.; Golden, J. W., PlmA, a new member of the
GntR family, has plasmid maintenance functions in Anabaena sp. strain PCC 7120. J.
Bacteriol. 2003, 185 (15), 4315-4325.
23. Lang, J. D.; Haselkorn, R., A vector for analysis of promoters in the
cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol. 1991, 173 (8), 2729-2731.
24. Chalmers, R. M.; Kleckner, N., IS10/Tn10 transposition efficiently
accommodates diverse transposon end configurations. EMBO J. 1996, 15 (18), 5112-
5122.
25. del Solar, G.; Hernández-Arriaga, A. M.; Gomis-Rüth, F. X.; Coll, M.; Espinosa,
M., A genetically economical family of plasmid-encoded transcriptional repressors
involved in control of plasmid copy number. J. Bacteriol. 2002, 184 (18), 4943-4951.
26. Yang, Y.; Huang, X.-Z.; Wang, L.; Risoul, V.; Zhang, C.-C.; Chen, W.-L.,
Phenotypic variation caused by variation in the relative copy number of pDU1-based
plasmids expressing the GAF domain of Pkn41 or Pkn42 in Anabaena sp. PCC 7120.
Res. Microbiol. 2013, 164 (2), 127-135.
27. Elhai, J.; Wolk, C. P., [83] Conjugal transfer of DNA to cyanobacteria. In
Methods Enzymol., Academic Press: 1988; Vol. Volume 167, pp 747-754.
28. Figurski, D. H.; Helinski, D. R., Replication of an origin-containing derivative of
plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci.
U. S. A. 1979, 76 (4), 1648-1652.
41
29. Liang, J.; Scappino, L.; Haselkorn, R., The patB gene product, required for
growth of the cyanobacterium Anabaena sp. strain PCC 7120 under nitrogen-limiting
conditions, contains ferredoxin and helix-turn-helix domains. J. Bacteriol. 1993, 175 (6),
1697-1704.
30. Mitschke, J.; Vioque, A.; Haas, F.; Hess, W. R.; Muro-Pastor, A. M., Dynamics
of transcriptional start site selection during nitrogen stress-induced cell differentiation in
Anabaena sp. PCC 7120. Proc. Natl. Acad. Sci. U. S. A. 2011, 108 (50), 20130-20135.
31. Elhai, J.; Vepritskiy, A.; Muro-Pastor, A. M.; Flores, E.; Wolk, C. P., Reduction
of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC
7120. J. Bacteriol. 1997, 179 (6), 1998-2005.
32. Sambrook, J.; Russell, D., Molecular Cloning: A Laboratory Manual. Cold
Spring Harbor Labs Publishing: Cold Spring Harbor, N.Y, 2001; p 2344.
33. Datsenko, K. A.; Wanner, B. L., One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 2000, 97 (12),
6640-6645.
34. Wei, T. F.; Ramasubramanian, T. S.; Golden, J. W., Anabaena sp. strain PCC
7120 ntcA gene required for growth on nitrate and heterocyst development. J. Bacteriol.
1994, 176 (15), 4473-4482.
35. Higuchi, R.; Krummel, B.; Saiki, R., A general method of in vitro preparation and
specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic
Acids Res. 1988, 16 (15), 7351-7367.
42
36. Wei, T. F.; Ramasubramanian, T. S.; Pu, F.; Golden, J. W., Anabaena sp. strain
PCC 7120 bifA gene encoding a sequence-specific DNA-binding protein cloned by in
vivo transcriptional interference selection. J. Bacteriol. 1993, 175 (13), 4025-4035.
37. Golden, J. W.; Wiest, D. R., Genome rearrangement and nitrogen fixation in
Anabaena blocked by inactivation of xisA gene. Science 1988, 242 (4884), 1421-1423.
38. Smith, R. J.; Carr, N. G., An investigation of RNA synthesis in Anacystis nidulans
during exponential growth using techniques of RNA-DNA hybridization. J. Gen.
Microbiol. 1977, 98 (2), 559-567.
39. Craig, I. W.; Leach, C. K.; Carr, N. G., Studies with deoxyribonucleic acid from
blue-green algae. Arch. Microbiol. 1969, 65 (3), 218-227.
40. Pigott, G. H.; Midgley, J. E., Characterization of rapidly labelled ribonucleic acid
in Escherichia coli by deoxyribonucleic acid-ribonucleic acid hybridization. Biochem. J.
1968, 110 (2), 251-263.
41. Bancroft, I.; Wolk, C. P., Characterization of an insertion sequence (IS891) of
novel structure from the cyanobacterium Anabaena sp. strain M-131. J. Bacteriol. 1989,
171 (11), 5949-5954.
43
Table of Content Graphic
download fileview on ChemRxivCombiBiosynth-Anabaena__2019December03.pdf (632.96 KiB)
S1
Supporting Information for:
Expanding the Natural Products Heterologous Expression Repertoire in the Model
Cyanobacterium Anabaena sp. Strain PCC 7120: Production of Pendolmycin and the
Teleocidin B-4.
Patrick Videau,†,§ Kaitlyn N. Wells,‡,† Arun J. Singh,† Jessie Eiting,† Philip J. Proteau,† Benjamin
Philmus†,*
†Department of Pharmaceutical Sciences, College of Pharmacy, Oregon State University,
Corvallis, OR 97331
‡Undergraduate Honors College, Oregon State University, Corvallis, OR 97331
Present address: §Department of Biology, Southern Oregon University, Ashland, OR 97520
Email: [email protected]
S2
Table of Contents
1. Figure S1: MS/MS spectra (positive ionization mode, 438.3, collision energy, 45.0) of
lyngbyatoxin A (2) produced by Anabaena 7120 containing pPJAV642...................... S3
2. Figure S2: 1H NMR spectrum (500 MHz) of lyngbyatoxin A (2) isolated from Anabaena
7120 containing pPJAV647 (PglnA-ltxABtleC) .............................................................. S4
3. Figure S3: UV spectra of the four compounds produced by Anabaena 7120 containing
pPJAV644 (PltxA-ltxABC-tleD) ....................................................................................... S5
4. Figure S4: High resolution ESIMS spectra (positive ionization mode) for the four
compounds produced by Anabaena 7120 containing pPJAV644 (PltxA-ltxABC-tleD) .. S6
5. Figure S5: MS/MS spectra (positive ionization mode, 452.3, collision energy, 45.0) for
the four compounds produced by Anabaena 7120 containing pPJAV644 (PltxA-ltxABC-
tleD) ............................................................................................................................... S7
6. Figure S6: 1H NMR spectrum (500 MHz) of teleocidin B-4 isolated from Anabaena
7120 containing pPJAV644 (PltxA-ltxABC-tleD) ............................................................ S8
7. Figure S7: Representative LCMS chromatogram demonstrating the ratio of teleocidin B-
like compounds produced in Anabaena 7120 containing pPJAV644 (PltxA-ltxABC-tleD).
........................................................................................................................................ S9
8. Figure S8: Potential structures of the shunt metabolites resulting from methylation by
TleD followed by deprotonation .................................................................................... S9
9. Figure S9: Representative LCMS chromatogram demonstrating the production of
compounds with an m/z of 452 compared to m/z 436 produced by Anabaena 7120
containing pPJAV644 (PltxA-ltxABC-tleD) .................................................................. S10
10. Figure S10: A. High resolution ESIMS spectra (positive ionization mode) for compound
7; B. UV-vis spectrum of compound 8 ........................................................................ S10
11. Figure S11: 1H NMR (800 MHz) spectra of compound 8 .......................................... S11
12. Figure S12: 1H-13C HSQC spectra of compound 8..................................................... S12
13. Figure S13: 1H-13C HMBC spectra of compound 8 ................................................... S13
14. Figure S14: 1H-1H COSY spectra of compound 8 ...................................................... S14
15. Figure S15: 1H-1H NOESY (600 ms mixing time) spectra of compound 8 ............... S15
16. Figure S16: Structure of the isolated degradation product (8) derived from teleocidin B-4
with atom numbering ................................................................................................... S16
17. Figure S17: Proposed mechanism for the degradation of O-desmethylolivoretin C to
compound 8 .................................................................................................................. S16
18. Figure S18: A. High resolution ESIMS spectra (positive ionization mode) for
pendolmycin produced by Anabaena 7120 containing pPJAV643 (PltxA-ltxAB-mpnD).
...................................................................................................................................... S16
19. Figure S19: MS/MS spectra of ESIMS spectra (positive ionization mode, 370.3, CE
45.0) for pendolmycin (3) produced by Anabaena 7120 containing pPJAV643 (PltxA-
ltxAB-mpnD) ............................................................................................................... S17
20. Figure S20: 1H NMR spectrum (500 MHz) of pendolmycin isolated from Anabaena
7120 containing pPJAV659 (PglnA-ltxAB-mpnD). ..................................................... S18
21. Figure S21: Diagram of plasmids created to define the pCC7120ζ origin of replication
(oriV)............................................................................................................................ S19
22. Figure S22: Figure demonstrating the stability of pPJAV655, which contains a large
(~40 kb) insert. ............................................................................................................. S20
S3
23. Table S1: NMR data (500 MHz) for teleocidin B-4 (4) collected from Anabaena 7120
containing pPJAV657 (PglnA-ltxABC-tleD) in CDCl3. ................................................. S21
24. Table S2: LCMS determined yields of teleocidin B-like compounds in Anabaena 7120
...................................................................................................................................... S22
25. Table S3: Production of lyngbyatoxin A (2) in Anabaena 7120 ................................ S23
26. Table S4: Dried cell mass values obtained during growth of Anabaena 7120 ........... S24
27. Table S5: NMR data (800 MHz) for compound 8 in CDCl3 purified from collected from
Anabaena 7120 containing pPJAV657 (PglnA-ltxABC-tleD) ........................................ S25
28. Table S6: NMR data (500 MHz) for pendolmycin (3) in CDCl3 ............................... S26
29. Table S7: Efficiency of plasmid introduction into Anabaena 7120............................ S27
30. Supplemental discussion ............................................................................................ S27
31. Table S8: Strains and plasmids utilized in this study.................................................. S28
32. Table S9: Oligonucleotide primers used in this study. ............................................... S30
33. References ................................................................................................................... S32
Figure S1: MS/MS spectra (positive ionization mode, 438.3, collision energy, 45.0) of
lyngbyatoxin A produced by Anabaena 7120 containing pPJAV642.
50 150 250 350 450
m/z
410.5
393.5
351.5
S4
Figure S2: 1H NMR spectrum (500 MHz) of lyngbyatoxin A isolated from Anabaena 7120 containing pPJAV647 (PglnA-ltxABtleC).
9.59.0
8.58.0
7.57.0
6.56.0
5.55.0
4.54.0
3.53.0
2.52.0
1.51.0
ppm
S5
Figure S3: UV spectra of the four compounds produced by Anabaena 7120 containing
pPJAV644 (PltxA-ltxABC-tleD). The numbers indicate the order of elution seen in Figure S7.
1 2
3 4
S6
Figure S4: High resolution ESIMS spectra (positive ionization mode) for the four compounds produced by Anabaena 7120 containing
pPJAV644 (PltxA-ltxABC-tleD). The numbers indicate the order of elution seen in Figure S7.
1 2
3 4
S7
Figure S5: MS/MS spectra (positive ionization mode, 452.3, collision energy, 45.0) for the four compounds produced by Anabaena 7120
containing pPJAV644 (PltxA-ltxABC-tleD). The numbers indicate the order of elution seen in Figure S7.
50 150 250 350 450
m/z
424.5
407.6
365.6
50 150 250 350 450
m/z
424.5
407.6
365.6
50 150 250 350 450
m/z
424.5
407.5365.5
50 150 250 350 450
m/z
424.4
407.5
365.6
1
3
2
4
S8
Figure S6: 1H NMR spectrum (500 MHz) of teleocidin B-4 (4) isolated from Anabaena 7120 containing pPJAV644 (PltxA-ltxABC-tleD).
9.59.0
8.58.0
7.57.0
6.56.0
5.55.0
4.54.0
3.53.0
2.52.0
1.51.0
ppm
S9
Figure S7: Representative LCMS chromatogram demonstrating the ratio of compounds
produced in Anabaena 7120 containing pPJAV644 (PltxA-ltxABC-tleD). The extracted ion
chromatogram was generated from the MS/MS transition established for teleocidin B (m/z
452.3→ 424.3). This is representative chromatogram from a single analysis, but the additional
replicate runs appear similar.
-5.0E+00
1.0E+04
2.0E+04
3.0E+04
4.0E+04
5.0E+04
6.0E+04
7.0E+04
8.0E+04
0 10 20 30
Ion
co
un
ts (
ab
s.)
time (min)
MRM (m/z 452.3-->424.3)
1
4
Figure S8: Potential structures of the shunt metabolites resulting from methylation by
TleD followed by deprotonation.
S10
Figure S9: Representative LCMS chromatogram demonstrating the production of compounds
with a m/z of 452 compared to m/z 436 produced by Anabaena 7120 containing pPJAV644 (PltxA-
ltxABC-tleD). A. Total ion current chromatogram. B. Extracted ion chromatogram for
“teleocidin B” (m/z 451.5-452.5), black trace; and “imido-teleocidin B” (m/z 435.5-436.5), red
trace. Insert is the zoomed in region of panel B from 28-33 min.
Figure S10: A. High resolution ESIMS spectra (positive ionization mode) for compound 8; B.
UV-vis spectrum of compound 8.
-5.0E+00
2.0E+08
4.0E+08
6.0E+08
8.0E+08
1.0E+09
1.2E+09
1.4E+09
1.6E+09
0 10 20 30
Ion
co
un
ts (
ab
s.)
time (min)
TIC
-5.0E+00
1.0E+07
2.0E+07
3.0E+07
4.0E+07
5.0E+07
6.0E+07
7.0E+07
8.0E+07
9.0E+07
1.0E+08
0 10 20 30
Ion
co
un
ts (
ab
s.)
time (min)
EIC (m/z 451.5-452.5)
EIC (m/z 435.5-436.5)
A
B
A B
0.0E+00
1.0E+06
2.0E+06
3.0E+06
4.0E+06
5.0E+06
6.0E+06
7.0E+06
-5.0E+00
1.0E+07
2.0E+07
3.0E+07
4.0E+07
5.0E+07
6.0E+07
7.0E+07
8.0E+07
9.0E+07
1.0E+08
28 29 30 31 32 33
Ion
co
un
ts (
ab
s.)
fo
r E
IC (
435
.5-
43
6.5
)
Ion
co
un
ts (
ab
s.)
fo
r E
IC (
451
.1-
45
2.5
)
time (min)
EIC (m/z 451.5-452.5)
EIC (m/z 435.5-436.5)
S11
Figure S11: 1H NMR (800 MHz) spectra of compound 8.
9.59.0
8.58.0
7.57.0
6.56.0
5.55.0
4.54.0
3.53.0
2.52.0
1.51.0
ppm
S12
Figure S12: 1H-13C HSQC spectra of compound 8.
9.59.0
8.58.0
7.57.0
6.56.0
5.55.0
4.54.0
3.53.0
2.52.0
1.51.0
0.5ppm
160
140
120
100 80 60 40 20
ppm
S13
Figure S13: 1H-13C HMBC spectra of compound 8.
9.59.0
8.58.0
7.57.0
6.56.0
5.55.0
4.54.0
3.53.0
2.52.0
1.51.0
0.5ppm
160
140
120
100 80 60 40 20
ppm
S14
Figure S14: 1H-1H COSY spectra of compound 8.
109
87
65
43
21
ppm
10 9 8 7 6 5 4 3 2 1 ppm
S15
Figure S15: 1H-1H NOESY spectra (mixing time, 600 ms) of compound 8.
F2 [ppm] 8 6 4 2
F1
[p
pm
] 8
6
4
2
BJ's sample
09/10/2019
20190910_philmus 3 1 "C:\Users\Lab User\Desktop\BJ NMR data\Teleocidin paper"
S16
Figure S16: Structure of the isolated degradation product (8) derived from teleocidin B-4 with
atom numbering (panel A); major HMBC (red) and COSY (black) correlations observed (panel
B); and key NOESY correlations observed (panel C).
Figure S17: Proposed mechanism for the degradation of teleocidin B-4 (4) to compound 8.
Figure S18: High resolution ESIMS spectra (positive ionization mode) for pendolmycin
produced by Anabaena 7120 containing pPJAV643 (PltxA-ltxAB-mpnD).
S17
Figure S19: A. MS/MS spectra of ESIMS spectra (positive ionization mode, 370.3, CE 45.0) for
pendolmycin (3) produced by Anabaena 7120 containing pPJAV643 (PltxA-ltxAB-mpnD).
50 150 250 350 450
m/z
342.4
325.5
253.6
S18
Figure S20: 1H NMR spectrum (500 MHz) of pendolmycin (3) isolated from Anabaena 7120 containing pPJAV659 (PglnA-ltxAB-mpnD).
9.59.0
8.58.0
7.57.0
6.56.0
5.55.0
4.54.0
3.53.0
2.52.0
1.51.0
ppm
S19
Figure S21: Diagram of plasmids created to define the pCC7120ζ origin of replication (oriV).
pCC7120ζ is presented with the primers (small arrows labeled 1F/R through 4F/R; the primer
names begin with zeta-SmaI followed by the number in Table S9) utilized to cut the pCC7120ζ
into sections (A). Reverse primer names include the last nucleotide they amplify. The colors of
sections correspond with the colors of the primers and are maintained throughout the figure for
the portions capable of replication in Anabaena 7120. The starting point of the nucleic acid
numbering on pCC7120ζ is denoted by a 1. Annotated gene names are given outside the plasmid.
pPJAV579 was reisolated from Anabaena 7120 based on its ability to replicate in the host (B).
pPJAV579 was subcloned into pPJAV606 (C) and pPJAV607 (D) in which part of the
pCC7120ζ DNA was removed along with the proximal insertion sequence (IS-1 or IS-2). Origin
of transfer (oriT); Sp/Sm Interposon (spectinomycin and streptomycin resistance from pDW9).
A B
C D
pCC7120ζ
(5.58 kb)
pPJAV579
(8.65 kb)
pPJAV606
(7.74 kb)
pPJAV607
(6.75 kb)
S20
Figure S22: Depiction of pPJAV655 (pPJAV606 with the entire Moorea producens fragment
from fos-DE3-86; lane 3) and pPJAV626 (the vector used for cloning; lane 1) as compared to the
Quick-Load 1 kb DNA Ladder (New England Biolabs; lane 2) run on a 0.6% agarose gel. The
bands of the ladder from top to bottom: 10 kb, 8 kb, 6 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1.5 kb, 1 kb.
The plasmid DNA was isolated from E. coli MCR.
Wells
pPJAV655
(~50 kb)
pPJAV626
(~8 kb)
Lanes 1 2 3
S21
Table S1: NMR data (500 MHz) for teleocidin B-4 (4) collected from Anabaena 7120
containing pPJAV657 (PglnA-ltxABC-tleD) in CDCl3 ( in ppm, J in Hz).
a 13C NMR shifts determined through use of an 1H-13C HSQC experiment; -, no HSQC signal observed due to the fact that this is a nitrogen bound hydrogen.
Atom
number H (this work) C (this work)a H (from ref. 1) C (from ref. 1)
1 8.67 (s) - 8.65 (s) -
2 6.77 (s) 120.8 6.76 (s) 120.8
5 6.52 (s) 106.2 6.49 (s) 106.2
8a 3.05 (dd, 14.6, 5.0) 33.3 3.11 (br d, 17.2) 33.8
8b 2.98 (dd, 18.0, 8.7) 2.94 (dd, 17.7, 4.0)
9 4.34 (m) 55.7 4.30 (m) 55.8
10 7.02 (s) - 7.00 (s) -
12 4.22 (m) 70.5 4.28 (m) 70.7
14a 3.72 (11.3, 3.9) 64.3 3.70 (dd, 11.45, 4.0) 65.1
14b 3.54 (10.7, 8.8) 3.50 (dd, 11.45, 8.6)
15 2.63 (m) 28.1 2.60 (m) 28.4
16 0.69 (d, 6.83) 19.5 0.67 (d, 6.85) 19.6
17 0.92 (6.56) 21.4 0.89 (d, 6.3) 21.6
18 2.75 (s) 35.2 2.88 (s) 32.9
20 1.50 (s) 21.4 1.49 (s) 21.5
21 6.15 (dd, 10.4, 17.5) 151.5 6.14 (dd, 10.8, 18.0) 151.8
22a 5.41(d, 17.5) 111.3 5.39 (d, 18.0) 111.3
22b 5.25 (d, 10.6) 5.22 (d, 10.8)
23 1.90 (m), 1.45 (m) 34.6 1.90 (m), 1.47 (m) 34.7
24 1.90 (m), 1.42 (m) 24.7 1.90 (m), 1.42 (m) 24.9
26 2.25 (m) 37.5 2.23 (m) 37.8
27 0.55 (d, 6.8) 17.7 0.52 (d, 6.85) 17.9
28 1.02 (d, 6.7) 16.7 0.99 (d, 6.85) 16.9
29 1.35 (s) 29.0 1.33 (s) 29.1
S22
Table S2: Production of lyngbyatoxin A (2) in Anabaena 7120. Values are given as ng/mg dried
cell mass standard deviation. Each replicate culture was grown on BG-11 agar media
containing 1.5% agar (1 plate = approximately 40 mL).
BG-11(NH4+) BG-11(Nit)
361 0 0
361 fruc 0 0
Zeta 0 0
Zeta fruc 0 0
LtxABC 49.0 12.1 7.2 2.0
LtxABC fruc 98.1 13.1 8.5 6.5
LtxAB-TleC 47.8 21.1 9.2 3.2
LtxAB-TleC fruc 88.0 28.0 n.o.
PglnA LtxABC 252.5 34.7 203.1 176.6
PglnA LtxABC fruc 181.9 15.7 96.8 53.4
PglnA LtxAB-TleC 71.0 35.8 240.6 104.6
PglnA LtxAB-TleC fruc 313.3 64.1 174.3 114.3
PglnA LtxABC-TleD 47.8 15.2 74.9 8.1
PglnA LtxABC-TleD fruc 20.3 5.5 143.8 52.5
LtxABC zeta-TleD — 7.4 4.7
fruca, denotes media containing 50 mM fructose; —, none observed. BG-11(NH4+), BG-11 media with ammonium chloride as the nitrogen source; BG-11(Nit), BG-11 media with sodium nitrate as the nitrogen source.
S23
Table S3: Production of the individual teleocidin B-like compounds in Anabaena 7120. Values
are given as ng/mg dried cell mass standard deviation. Each replicate culture was grown on
BG-11 agar media containing 1.5% agar (1 plate = approximately 40 mL) with the nitrogen
source listed in the table column.
BG-11(NH4+) BG-11(Nit)
Plasmid introduced Peak 1 Peak 2 Peak 3 Peak 4 Peak 1 Peak 2 Peak 3 Peak 4
361 0 0 0 0 0 0 0 0
361 fruca 0 0 0 0 0 0 0 0
Zeta 0 0 0 0 0 0 0 0
Zeta fruc 0 0 0 0 0 0 0 0
LtxABC-TleD 9.8
7.3
10.1
4.1
14.1
12.3
22.3
8.8
12.2
1.2
8.3
2.0
7.6
1.2
11.1
2.2
LtxABC-TleD fruca 19.6
4.0
17.2
7.5
1.3
2.3
39.8
10.2
18.9
20.3
17.0
8.8
16.5
7.0
18.5
6.9
LtxABC zeta-TleD 32.6
15.5
7.9
10.8
1.9
3.3
59.0
10.0
13.2
22.9 0
25.2
15.1
5.1
8.8
LtxABC zeta-TleD fruca 55.4
21.8
4.6
8.0
8.5
2.5
69.2
11.2 0 0 0
2.7
2.6
PglnA LtxABC-TleD 249.0
68.6
141.8
45.8
98.4
54.5
546.5
23.3
133.9
116.5
84.6
29.6
76.3
19.3
453.0
108.7
PglnA LtxABC-TleD
fruca 54.5
8.4
21.4
3.3
29.6
16.0
137.7
11.2
277.4
47.0
102.1
6.9
55.5
16.9
101.0
34.3
fruca, denotes media containing 50 mM fructose. BG-11(NH4+), BG-11 media with ammonium chloride as the nitrogen source; BG-11(Nit), BG-11 media with sodium nitrate as the nitrogen source.
S24
Table S4: Dried cell mass values obtained during growth of Anabaena 7120. Each replicate
culture was grown on BG-11 agar media containing 1.5% agar (1 plate = approximately 40 mL)
with the nitrogen source listed in the table column.
Strain BG-11(NH4+)
Dried cell mass (mg) ± S.D.
BG-11(Nit)
Dried cell mass (mg) ± S.D.
pPJAV361 (empty vector) 22.9 ± 4.0 156.2 ± 77.8
pPJAV361 (empty vector) fruca 27.8 ± 3.1 149.9 ± 18.4
Zeta (empty vector) 29.5 ± 4.1 33.2 ± 4.3
Zeta (empty vector) fruca 33.7 ± 6.1 87.5 ± 14.0
LtxABC 15.8 ± 5.5 108.5 ± 65.0
LtxABC fruca 25.6 ± 6.6 128.6 ± 27.5
LtxABC-TleD 25.1 ± 7.5 120.8 ± 57.1
LtxABC-TleD fruca 15.4 ± 6.2 71.9 ± 22.4
LtxABC zeta-TleD 25.5 ± 7.3 49.7 ± 24.9
LtxABC zeta-TleD fruca 30.2 ± 3.8 122.1 ± 7.1
PglnA LtxABC-TleD 28.9 ± 11.7 51.3 ± 32.3
PglnA LtxABC-TleD fruca 44.7 ± 3.9 106.8 ± 11.0
PglnA LtxAB-TleC-TleD 51.5 ± 4.1 45.1 ± 9.8
LtxAB-MpnD 11.5 ± 8.0 82.1 ± 13.3
LtxAB-MpnD fruca 13.4 ± 0.8 174.6 ± 65.2
LtxAB-MpnD-TleD 13.7 ± 1.6 103.8 ± 20.7
LtxAB-MpnD-TleD fruca 13.6 ± 6.0 52.3 ± 12.8
PglnA LtxAB-MpnD 19.1 ± 2.1 34.0 ± 5.2
PglnA LtxAB-MpnD fruca 46.1 ± 4.1 82.9 ± 20.2
BG-11(NH4+), BG-11 media with ammonium chloride as the nitrogen source; BG-11(Nit), BG-11 media with sodium nitrate as the nitrogen source.
S25
Table S5: NMR data (800 MHz) for compound 8 in CDCl3 ( in ppm, J in Hz) purified from
collected from Anabaena 7120 containing pPJAV657 (PglnA-ltxABC-tleD).
a 13C NMR shifts determined through use of an 1H-13C HSQC experiment; b 13C NMR shifts determined through use of an 1H-13C HMBC experiment; -, no signal observed.
Atom
number H Ca,b HMBC (to C#) COSY (to H#)
1 8.85 (1H, br s) - - 2
2 7.03 (1H, s) 123.3a 3, 3a, 7a 1
3 - 106.4b - -
3a - 116.8b - -
4 - 144.4b - -
5 6.52 (1H, s) 106.9a 3a, 4, 6 -
6 - 118.6.b - -
7 - 138.6b - -
7a - 137.4b - -
8a 4.29 (1H, d, 14.6) 38.2a 2, 3, 9 8b
8b 3.9 (1H, d, 14.6) 2, 3, 3a, 9 8a
9 - 172.9b - -
10 7.50 (1H, br s) - - -
11 - 173.8b - -
12 4.67 (1H, d, 9.9) 72.7a 4, 11, 14, 16, 17 14
14 2.64 (1H, m) 28.2a 12, 15, 16 12, 15, 16
15 0.98 (3H, d, 6.4) 21.3a 12, 14, 16 14
16 0.82 (3H, d, 6.4) 19.3a 12, 14 14
17 2.82 (3H, s) 32.2a 4, 12 -
18 - 39.6b - -
19 1.53 (3H, s) 21.8a 6, 18, 20, 22 -
20 6.16 (1H, dd, 17.6, 10.6) 151.5a 6, 18, 19 21a, 21b
21a 5.43 (1H, dd,17.6, 0.96) 111.4a 18, 20 20 21b 5.27, (1H, dd, 10.9,
0.96)
18 20
22 1.90 (m), 1.47 (1H, m) 34.6a 6, 18, 19 23
23 1.90 (m), 1.43 (1H, m) 24.7a 7, 24, 28 22
24 - 39.9b -
25 2.23 (1H, m or p) 37.6a 24, 26, 28 26, 27
26 1.02 (3H, d, 6.8) 17.0a 24, 25, 27 25
27 0.55 (3H, d, 6.4) 18.0a 24, 25, 26 25
28 1.34 (3, s) 29.1 7, 23, 24, 25 -
S26
Table S6: NMR data (500 MHz) for pendolmycin (3) in CDCl3 ( in ppm, J in Hz).
Atom number H (this work) C (this work)a H (from ref. 2) C (from
ref. 2)
1 8.47 -b 8.48 (br s) -
2 6.83 120.8 6.84 (br s) 121.1
5 6.49 (d, 8.3) 106.2 6.48 (d, 8.0) 106.4
6 7.00 (d, 7.7) 119.1 7.00 (d, 8.0) 119.1
8a 2.99 (dd, 3.7, 16.7) 33.8 3.04 (dd, 4.0, 17.5) 33.9
8b 3.17 (br d, 17.8) 33.8 3.15 (br d, 17.5) 33.9
9 4.43 (m) 54.6 4.32 (m) 55.8
10 7.47 (br s) - 7.50 (br s) -
12 4.34 (d, 10.0) 71.1 4.34 (d, 10.0) 71.1
14a 3.53 (dd, 9.7, 10.3) 65.0 3.56 (br dt, 12.0, 3.0) 65.1
14b 3.74 (dd, 4.0, 11.0) 65.0 3.74 (br dt, 12.0, 7.0) 65.1
14-OH n.o.c - 3.34 (br s) -
15 2.61 (m) 28.3 2.59 (m, 7.0, 10.0) 28.6
16 0.65 (d, 6.7) 19.4 0.65 (d, 7.0) 19.6
17 0.92 (d, 6.4) 21.4 0.92 (d, 7.0) 21.6
18 2.92 (s) 32.8 2.90 (s) 33.1
20 6.19 (dd, 10.5, 17.5) 149.2 6.19 (dd, 11.0, 17.5) 149.5
21a 5.21 (br d, 10.8) 111.1 5.21 (dd, 1.5, 11.0) 111.3
21b 5.32 (br d, 17.6) 111.1 5.31 (dd, 1.5, 17.5) 111.3
22 1.48 (s) 26.9 1.47 (s) 27.2
23 1.51 (s) 26.7 1.51 (s) 26.8
a 13C NMR shifts determined through use of an 1H-13C HSQC experiment; b -, no HSQC signal observed due to the fact that this is a nitrogen bound hydrogen, c n.o., not observed due to exchange with water.
S27
Table S7: Efficiency of plasmid introduction into Anabaena 7120. A culture of Anabaena 7120
was prepared for conjugation, serial dilutions were plated and colonies counted. Conjugation
mixes were prepared, serial dilutions were plated on selection, and the colonies were counted.
The total colonies counted from selection divided by the possible total that could grow is
presented as efficiency. Each efficiency calculation is presented as the average of three
replicates.
Type of
Conjugation
Plasmid 1 Plasmid 2 Efficiency
Bi- pPJAV361 N/A 1 x 10-2
Bi- pPJAV500 N/A 6.9 x 10-3
Bi- pPJAV626 N/A 4.4 x 10-3
Bi- pPJAV632 N/A 5.8 x 10-5
Tri- pPJAV361 N/A 1.1 x 10-3
Tri- pPJAV500 N/A 6.1 x 10-4
Tri- pPJAV626 N/A 6.4 x 10-6
Tri- pPJAV632 N/A 6.5 x 10-6
Tri- pPJAV361 pPJAV626 2.3 x 10-3
Tri- pPJAV500 pPJAV632 8.7 x 10-7
Quad- pPJAV361 pPJAV626 2.4 x 10-7
Quad- pPJAV500 pPJAV632 5.4 x 10-8
Bi-, biparental conjugation; Tri-, triparental conjugation; and Quad-, quadriparental conjugation;
N/A, a second plasmid was not introduced in these experiments.
Supplemental Discussion: Using these types of conjugation mix, it is therefore theoretically
possible to introduce two plasmids into Anabaena 7120 simultaneously; as a triparental mating,
where both plasmids are carried by E. coli strain UC585, or as a quadriparental mating, where E. coli
strain JCM113 is mixed with two E. coli strains each harboring only a single plasmid for transfer. To
determine the relative efficiency of conjugation and selection, bi-, tri-, and quadriparental matings
were carried out to introduce pPJAV361 (empty vector, SmSp resistant), pPJAV500 (harboring
ltxABC, SmSp resistant),11 pPJAV626 (empty vector, Neo resistant), and pPJAV632 (harboring
PltxD-tleD, Neo resistant) into Anabaena 7120 singly or in combinations of two plasmids with
different selectable markers (Neor or Sp/Smr).
Following culture preparation, conjugation mixes were prepared, and serial dilutions were plated
onto selection to determine the number of viable conjugal events. These data were then compared to
colony counts from the same culture of Anabaena 7120 prepared but not utilized for conjugation.
This comparison is presented because it provides a more realistic number of colonies produced from
the protocol rather than a theoretical conjugal efficiency. In every case, plasmids based on
pPJAV361 were singly introduced with a higher efficiency than those based on pPJAV626 (Table
S7). When the introduction efficiency of the same plasmids was compared between bi- and
triparental conjugations, biparental conjugations displayed higher efficiencies than did triparental
conjugations by at least an order of magnitude. The lowest frequency of single introduction was
observed from pPJAV632. Assessment of the simultaneous conjugation of two plasmids showed that
triparental introduction of pPJAV361 and pPJAV626 displayed a similar efficiency to the triparental
introduction of pPJAV626 singly. Because biparental conjugation of pPJAV361 displayed the
highest efficiency, it is likely that co-introduction with pPJAV626 is the factor hampering the
observed efficiency. Interestingly, co-conjugation of pPJAV632 with pPJAV500 displayed a greatly
S28
decreased efficiency (>2,800-fold) in triparental mating with E. coli UC585 when compared to
pPJAV361 introduced under identical conditions. We hypothesize that this is due to the larger size of
pPJAV500 (22.4 kb) compared to pPJAV361 (11.2 kb). Efficiency of the simultaneous introduction
of two plasmids was higher from triparental conjugations than quadraparental mixes. These results
are consistent with the number of steps necessary to move all three plasmids into one E. coli cell.
The bi- and triparental efficiencies are higher for single and double plasmid introductions than the
analogous tri- and quadraparental mixes, respectively, because all three plasmids begin in the same
cell rather than requiring a conjugal event to occur prior to introduction into Anabaena 7120. It is
possible that the efficiencies decrease for pPJAV500 and pPJAV632 over pPJAV361 and pPJAV626
because they are larger and may cause a metabolic strain on Anabaena 7120, which could decrease
the total number of colonies produced from each conjugation mix.
Table S8: Strains and plasmids utilized in this study.
Strain or plasmid Characteristic(s)* Source or reference
Anabaena sp.
PCC 7120 Wild type Pasteur Culture
Collection
E. coli
NEB10β Cloning strain New England
Biolabs
DH5αMCR Cloning strain ΔmcrBCΔecoK New England
Biolabs
BW25113 Strain for lambda red recombination 3
JCM113 HB101 with pRL528 and pRK2013 Gift of J. C. Meeks
UC585 MC1061 with pRL528 and pRK24 4
Plasmids
pBlueScript SK+ Cloning vector, Apr Agilent
pACYC184 E. coli cloning vector, Cmr Tetr 5
pAM504 Shuttle vector for replication in E. coli and
Anabaena; Kmr Nmr
6
pDW9 Source of the Spr/Smr Ω interposon 7
fos-DE3-86 Fosmid containing ltxA-D from Moorea
producens; Cmr
8
pKD46 Temperature-sensitive /Red recombination
plasmid; Apr
9
pPJAV361 pAM504 with Spr/Smr Ω interposon replacing
nptII
10
pPJAV500 pPJAV361 with PltxA-ltxA-C 10
pPJAV503 pPJAV361 with PglnA-ltxA-C 10
pUC57-tleC Source of codon optimized tleC; Apr This study
pUC57-tleD Source of codon optimized tleD; Apr This study
pUC57-mpnD Source of codon optimized mpnD; Apr This study
pPJAV504 pPJAV361 with half of the Zeta plasmid,
amplified with the primers zeta-SmaI-3F and zeta-
SmaI-1R, replacing the pDU1 oriV
This study
S29
pPJAV505 pPJAV361 with half of the Zeta plasmid,
amplified with the primers zeta-SmaI-1F and zeta-
SmaI-3R, replacing the pDU1 oriV
This study
pPJAV506 pPJAV361 with three-quarters of the Zeta
plasmid, amplified with the primers zeta-SmaI-2F
and zeta-SmaI-1R, replacing the pDU1 oriV
This study
pPJAV579 pPJAV504 reisolated from Anabaena 7120 with a
transposon insertion in the Zeta oriV
This study
pPJAV580 pPJAV504 reisolated from Anabaena 7120 with a
transposon insertion in the Zeta oriV
This study
pPJAV606 pPJAV579 with upstream half of the Zeta oriV
removed
This study
pPJAV607 pPJAV579 with downstream half of the Zeta oriV
removed
This study
pPJAV626 pAM504 with the upstream half of the Zeta oriV
from pPJAV606 replacing the pDU1 oriV
This study
pPJAV631 pBlueScript SK+ carrying PltxA This study
pPJAV632 pPJAV626 carrying PltxD-tleD This study
pPJAV642 pPJAV361 carrying PltxA-ltxAB-tleC This study
pPJAV643 pPJAV361 carrying PltxA-ltxAB-mpnD This study
pPJAV644 pPJAV361 carrying PltxA-ltxABC-tleD This study
pPJAV645 pPJAV361 carrying PltxA-ltxAB-mpnD-tleD This study
pPJAV647 pPJAV361 carrying PglnA-ltxAB-tleC This study
pPJAV650 pPJAV361 carrying PglnA-ltxAB-mpnD-tleD This study
pPJAV653 pAM504 carrying the hetR coding region and a
Spr/Smr Ω interposon
This study
pPJAV655 pPJAV606 carrying the entire M. producens
portion of fos-DE3-86
This study
pPJAV657 pPJAV361 carrying PglnA-ltxABC-tleD This study
pPJAV659 pPJAV361 carrying PglnA-ltxAB-mpnD This study
* Km, kanamycin; Nm, neomycin; Sp, spectinomycin; Sm, streptomycin; Ap, ampicillin; Cm,
chloramphenicol; Tet, tetracycline
S30
Table S9: Oligonucleotide primers used in this study. Underlined bases indicate restriction enzyme
recognition sequences, while italicized bases indicate additional random bases added to increase
restriction enzyme efficiency.
Primer Name Sequence (5’ to 3’)
505-BamHI CTACGGGGTCTGACGCTCAGTGG
505-Sac GTCGAACTGCGCGCTAACTATTC
aadA1-F GCAATGACATTCTTGCAGGT
aadA1-R ACCTACCAAGGCAACGCTAT
AMO-645 TGCTTTACTCTGGCACGGTGAC
AMO-646 TAAGTCCGCTCTTGGTCGTCTG
AMO-679 AGCTGTGCTCGACGTTGTCA
AMO-680 GCAGGAGCAAGGTGAGATGA
CAT-SacI-R TATATGAGCTCTTACGCCCCGCCCTGCCACTCATCG
fos-up-F GGCTGCATCCGATGCAAGTGTGTCGCTG
fos-up-BamHI-R ATATAGGATCCTTCGTATAATGTATGCTATACGAAGTTATTAGCG
fos-dn-BamHI-F ATATAGGATCCGGTGTAACAAGGGTGAACACTATCCCATATC
fos-dn-EcoRI-R TATATGAATTCGAGCTTATCGCGAATAAATACCTGTGACGG
ltxA-int-SmaI-R ATATACCCGGGTGACATATGTGGTGGTCTCTGTAG
ltxB-int-NdeI-F ATCGATATCTCATATGCTATTCCAGCTGAAGAAGTGCCATGGC
HetR-NdeI-F CATATGAGTAACGACATCGATCTGATCAAGCG
HetR-R TTAATCTTCTTTTCTACCAAACACCATTTGTAAAATCATGG
mpnD-ltxB-red-F TTTTATCTGTCCTTTATCTCTGTAAATTGGAGTGTTTTCTTATGGC
TGGAGATCCATTTG
mpnD-R TTAGCGGTATAAACCTGGGGCTACATAGCATG
pAM504Ecoliup-R GTGATGCGCCCACTGCGCATAG
pAM504-pBR-F ATCGTCCATTCCGACAGCATCGCCAG
pAM504-pBR-R CTGCGCGCTAACTATTCTCGACCTGC
Pcat-F GCCGCGGCCCTCTCACTTCCCTG
PglnA-XhoI-F ATATACTCGAGCGCAGATAGTAGTCCATATCTCGTAAAC
Pltx-R AGGGGGATAATTTTATCTAGCCCTC
PlxtA-XhoI-F ATATACTCGAGTTCACCTTCTGTCTAGAATTACAGTTTGAGG
PltxD-mpnD-red-F CCGATTTGCATGCTATGTAGCCCCAGGTTTATACCGCTAAACTCT
AGGAAAAAAACATGG
PltxD-tleC-red-F TTAGCGTTTATTTAGCTCCCGGTGTATACCGTGAAGCATAAACTC
TAGGAAAAAAACATG
PltxD-R TAGACATCTCCAATAATAAAAAATAAAATCAATTATCCCAGAG
tleC-ltxB-red-F TTTTATCTGTCCTTTATCTCTGTAAATTGGAGTGTTTTCTTATGGA
ATCAGCTGGTCCTG
tleC-R TTATGCTTCACGGTATACACCGGGAGC
tleD-PltxD-OEX-F ATTATTGGAGATGTCTAATGCCACAAGAAGCCCGTACTCCTC
tleD-R TTATACTGCTGGTTTTCTTAAAGTAGCC
Tnp-int-F GGTGGATACACATCTTGTCATATGATC
Tnp-int-R GAGCTAGTAGGGTTGCAGCCACGAG
Zeta2-1-walk1-F CAACAAAGAAGGCATAGAAGC
Zeta2-1-walk1-R CTCCATCAGCCCGTGAGGTG
Zeta-qPCR-F CAATCTGGCAAGTATCGAGCG
S31
Zeta-qPCR-R GACTATCAAGCAACCTCGTGTG
zeta-SmaI-1F ATATACCCGGGGTTTAGGCTATGTTCTGCTGTTCACCTTC
zeta-SmaI-1R ATATACCCGGGGTTATCATTCACCCCCCAATCTACCTACTTG
zeta-SmaI-2F ATATACCCGGGTTATGGCATTGTCTACCAGTTTAAGC
zeta-SmaI-2R ATATACCCGGGAAGCCAGCCTACCTGATGCCCACCCAATAAAGCG
zeta-SmaI-3F ATATACCCGGGCCATAGAAACATGAGTAGCGGAGGCTTTTGACC
zeta-SmaI-3R ATATACCCGGGCATGGATAGGCACTCGTAGGCACTCCG
zeta-SmaI-4F ATATACCCGGGTCAATCAATTTTGGATTCTAGAGATAGCAG
zeta-SmaI-4R ATATACCCGGGGCAACATCATTGCATCCTTATCACCCGTG
S32
References
(1) Awakawa, T.; Zhang, L.; Wakimoto, T.; Hoshino, S.; Mori, T.; Ito, T.; Ishikawa, J.;
Tanner, M. E.; Abe, I., A methyltransferase initiates terpene cyclization in teleocidin B
biosynthesis. J. Am. Chem. Soc. 2014, 136, (28), 9910-9913.
(2) Yamashita, T.; Imoto, M.; Isshiki, K.; Sawa, T.; Naganawa, H.; Kurasawa, S.; Zhu, B.-
Q.; Umezawa, K., Isolation of a new indole alkaloid, pendolmycin, from Nocardiopsis. J.
Nat. Prod. 1988, 51, (6), 1184-1187.
(3) Datsenko, K. A.; Wanner, B. L., One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 2000, 97, (12),
6640-6645.
(4) Liang, J.; Scappino, L.; Haselkorn, R., The patB gene product, required for growth of the
cyanobacterium Anabaena sp. strain PCC 7120 under nitrogen-limiting conditions,
contains ferredoxin and helix-turn-helix domains. J. Bacteriol. 1993, 175, (6), 1697-
1704.
(5) Rose, R. E., The nucleotide sequence of pACYC184. Nucleic Acids Res. 1988, 16, (1),
355.
(6) Wei, T. F.; Ramasubramanian, T. S.; Golden, J. W., Anabaena sp. strain PCC 7120 ntcA
gene required for growth on nitrate and heterocyst development. J. Bacteriol. 1994, 176,
(15), 4473-4482.
(7) Golden, J. W.; Wiest, D. R., Genome rearrangement and nitrogen fixation in Anabaena
blocked by inactivation of xisA gene. Science 1988, 242, (4884), 1421-1423.
(8) Edwards, D. J.; Gerwick, W. H., Lyngbyatoxin biosynthesis: Sequence of biosynthetic
gene cluster and identification of a novel aromatic prenyltransferase. J. Am. Chem. Soc.
2004, 126, (37), 11432-11433.
(9) Baba, T.; Ara, T.; Hasegawa, M.; Takai, Y.; Okumura, Y.; Baba, M.; Datsenko, K. A.;
Tomita, M.; Wanner, B. L.; Mori, H., Construction of Escherichia coli K‐12 in‐frame,
single‐gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2006, 2, (1),
2006.0008.
(10) Videau, P.; Wells, K. N.; Singh, A. J.; Gerwick, W. H.; Philmus, B., Assessment of
Anabaena sp. strain PCC 7120 as a heterologous expression host for cyanobacterial
natural products: Production of lyngbyatoxin A. ACS Synth. Biol. 2016, 5, (9), 978-988.
download fileview on ChemRxivCombiBiosynth-Anabaena_SI_2019December03.pdf (3.26 MiB)