gene expression - university of massachusetts · pdf filegene expression ......
TRANSCRIPT
![Page 1: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/1.jpg)
1
Gene Expression http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=mboc4.TOC&depth=2
Prokaryotic Translation is concurrent with
transcription No barrier restricts movement of
transcript to translation apparatus Single RNA polymerase
synthesizes all RNA species
Eukaryotic Transcript must be processed
Capping, splicing, polyA addition mRNA is sequestered as RNP in
the nucleus, must be transported to cytoplasm
Genes are often split - coding sequence is not contiguous
3 different RNA polymerases required to synthesize RNA classes
Polycistronic Transcripts
DNA
mRNA Polycistronic transcript multiple genes
Operon - gene cluster
Proteins perform a coordinated function
Examples: Carbohydrate degradation Amino acid biosynthesis
![Page 2: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/2.jpg)
2
Eukaryotic Transcripts
5’ 7-methylgaunosine cap structure Post-transcriptional modification - after ~ 25 nucleotides Prevents degradation by 5’ exonucleases Helps in the export from the nucleus
Poly-adenylated tail Post-transcriptional modification Helps in stability of the mRNA
Mature transcript
Kinetoplastid Transcription
![Page 3: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/3.jpg)
3
Alternative Splicing Discovered by D. Baltimore - immunoglobin heavy chain Increases the diversity of protein repertoire Improper alternative splicing can lead to disease
Cis-Splicing Mechanism
![Page 4: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/4.jpg)
4
• Several steps in the splicing reaction require ATP
Splicing is mediated by the Spliceosome
Splicesome mediated - simplified
Composed of snRNPs Small nuclear ribonucleoprotein
Small nuclear U-rich RNA (snRNA) Each complexed with ~ 7 proteins
1. U1 base-pairs with the 5’ splice-site 2. U2 binds/pairs with the branch point; also pairs
with U6 in the assembled spliceosome 3. U4 pairs with U6 in snRNPs, but releases during
spliceosome assembly 4. U5 interacts with both exons (only 1-2 nt adjacent
to intron); helps bring exons together 5. U6 displaces U1 at the 5’ splice-site (pairs with nt
in the intron); it also pairs with U2 in the catalytic center of the spliceosome
Highly simplified version
![Page 5: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/5.jpg)
5
Trans-splicing: 1st discovered in trypanosomes
Gene A Gene B Gene C Gene D Gene E
DNA
Polycistronic transcript
AAAA
AAAA AAAA
AAAA
AAAA
SL RNA
No evidence of operons
Trans-splicing Polyadenylation
Individual mRNAs each with a SL and poly A tail
To date: ALL but 2 coding sequences are trans-spliced!
Comparison of cis- and trans-splicing
Lariat intermediate
Y-branch intermediate
transesterification
transesterification
Intramolecular Intermolecular
![Page 6: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/6.jpg)
6
Comparison of Spliceosomes
New Technology - SMaRT Defects in alternative splicing can lead to human disease Use of artificial trans-splicing to “repair” and give rise to a
functional mRNA
www.intronn.com
Correcting at the pre-mRNA level!
Spliceosome-mediated RNA Trans-splicing
![Page 7: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/7.jpg)
7
kDNA - organized in a disk structure
Kinetoplast
Kinetoplast is always associated with the flagellar basal body
kDNA
Nucleus
Mitochondrion
kDNA components
Two types of catenated ring circles
1. Maxicircle: ~23kb, 25
• Encode electron transport subunits.
• Require extensive posttranscriptional editing
3. Minicircle: 1kb, 5000
• Heterogeneous, 250 classes
• Encode guide RNAs. 500nm
500nm
kDNA network
Minicircle Maxicircle
kDNA is essential for the parasite survival
![Page 8: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/8.jpg)
8
kDNA Replication Model
SSE1
?
Primase
UMSBP
kDNA disk
DNA ligase kβ
Pol β -PAK DNA Ligase kα
Topo II
DNA Pol β
Pol IC
Pol IB
Pol IA
Pol ID
kDNA repair?
recruitment?
What are the specialized roles?
Minicircle Replication
+
UMS
UMS
Unknown replicase proteins
Singly and Multiply Gapped Progeny
Leading (L) strand
Lagging (H) strand
UMSBP
![Page 9: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/9.jpg)
9
kDNA Replication Model
Trypanosomatid Mitochondrial RNA editing
Single mitochondrion Unique mitochondrial DNA
Catenated structure composed of mini- and maxicircles
Size of molecules varies with species (15-80 kb) (1 - 2.5 kb)
50 maxicircles/network 5000-10,000 minicircles/network Minicircles were initially thought
to be nonfunctional, just a structural component
Maxicircle 20 kb
Minicircle 1 kb
![Page 10: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/10.jpg)
10
Maxicircle sequence Initial sequencing of the T. brucei maxicircles demonstrated that it
encoded apocytochrome b, subunits 1 and 2 of cytochrome c oxidase (cox) and some unassigned reading frames (MURFs) (some later turned out to be subunits of NADH dehydrogenase).
However some pseudogene features – e.g. cox2 had a –1 frameshift and this was conserved between kinetoplastid species.
Sequence determination of cox2 cDNA in 1984 showed an insertion at the precise position of the frameshift converting GA to UUGUAU.
This wasn’t accepted at first – there were 50 maxicircles and maybe one had the difference or the gene was encoded in the nucleus.
Extensive analysis showed no conventional cox2 genes existed in the nucleus or mitochondrion but a mechanism of adding in U’s was way too outlandish to be accepted at that time.
Maxicircle Sequence
Sequencing of other mitochondrial cDNAs and their comparison to the genomic sequence showed not only the addition of U’s but also their deletion.
In 1986 the first CAUTIOUS paper on a “co- or post-transcriptional nucleotide insertion process” was published (Benne et al.,1986 Cell 46, 819-826 - 18 page paper).
Although the data showed deletion of one U, the authors didn’t dare to conclude that this form of editing could also occur.
Other groups of investigators found similar editing processes and the number of edited trypanosomatid RNAs expanded.
The mystery of missing AUG translational start codons was solved as these are provided by RNA editing by both addition and deletion of U’s
![Page 11: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/11.jpg)
11
Mitochondrial RNA editing
*
**
** ** ****
***
***
****
***
**
*
*
*
** ** **
**
*** **
*** *
***
***
**
***** *
*** *
*** ********
******
**
*
**
*
Cell
Edited T. brucei ND7 mRNA
Cryptic mRNAs produced mRNA sequence DOES NOT exactly
correspond with genomic DNA sequence Requires insertion of uridine residues
(u) or deletion (*) to create a functional ORF
Extreme example is ND7 >90% of mRNA is edited
Process is more active in procyclic form parasites
Minicircles encode gRNAs (guide RNAs) that act as templates for insertion and deletion (1991)
Process is essential (2001) Demonstrated by gene silencing in
bloodstream form parasites
Maxicircle Comparison Ribosomal RNA sequences ARE NOT edited
![Page 12: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/12.jpg)
12
Insertional RNA editing
GCGGAGAAAAAAUGAAAUGUGUUGUCUUUUAAUG ::|:||||||||||||||:|||||||||||||3'-UUUUUUUUUUUUUACUUUAUACAACAGAAAAUUACppp5'
(A)n 5'
Edited mRNA Editing
GCGGAGAAAAAAGAAAGGGUCUUUUAAUG ::|:|||| ||:||||||||3'-UUUUUUUUUU CAGAAAAUUACppp5'
(A)n 5'
U U U A C U U U A
U A C A
A Guide RNA
Anchor Poly(U) tail
Primary transcript (Maxicircle encoded)
(Minicircle encoded)
Pan-editing of the L. tarentolae A6 mRNA
Precursor mRNA
Precursor mRNA
Precursor mRNA
Precursor mRNA
Edited mRNA
Edited mRNA
Edited mRNA
Edited mRNA
![Page 13: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/13.jpg)
13
Mechanism of RNA Editing Insertion Deletion
RNA Editing Proteins
![Page 14: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/14.jpg)
14
Mediated by Protein Complex
T. brucei Life Cycle =
non-dividing fuel=glucose
VSG coat mito=“low”
Bloodstream form dividing
fuel=glucose VSG coat
mito=“off”
non-dividing fuel=?
mVSG coat mito=?
Procyclic form dividing
fuel=amino acids Procyclin coat mito=“on”
Metabolicadaptation
![Page 15: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/15.jpg)
15
Trypanosomatid Metabolism
Cooperation among organelles for central metabolism
Important Players Glycosomes Mitochondrion Cytoplasm Acidocalicosomes
Abundant microbodies = glycosome
Bloodstream form metabolism
Glycosomes What?
Microbody - single membrane Divergent peroxisomes
Peroxisomal metabolic diversity Contains most enzymes of
glycolysis - unique Low permeability of membrane
When? Not found in closest relative -
Euglena sp. Why?
Metabolic flexibility How?
Complicated - multiple mechanisms likely Purine salvage
Glycolysis
Glycosomes are essential for both BSF and Procyclics
BSF - 90% of proteins content is glycolytic
![Page 16: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/16.jpg)
16
Bloodstream Form Metabolism Most simplified form of metabolism in
trypanosomes Glucose (sugars) are main source of
energy Consumption and production of ATP is
balanced INSIDE the glycosome Net ATP production occurs outside of
the glycosome Major end-product - pyruvate Hexokinase (1), Phosphofructokinase (3)
steps ARE NOT regulated Pyruvate kinase IS regulated (12) GPO/GAPDH shuttle - maintains redox
balance Alternative Oxidase (CN- insensitive) * Pyruvate excreted in
host bloodstream
Procyclic Form Metabolism
Previously, thought there was complete TCA cycle function.
Aconitase Knockout cell lines - aconitase is non-essential!!
Glucose and amino acids (Pro, Thr) as energy source
End products - Succinate, Acetate, Alanine
Phosphoglycerate kinase is now cytosolic.
Incomplete TCA cycle - no complete oxidation to CO2
Branched electron transport - classical Cytochrome oxidase + alternative oxidase
![Page 17: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/17.jpg)
17
Added complexity Anabolic functions as well
Fatty acid synthesis Gluconeogenesis
Branched electron transport Cytochrome oxidase
Cyanide sensitive Alternative oxidase
Cyanide insensitive gluco- neogenesis
Fatty Acid Synthesis - Primer Iterative elongation of
acyl chains Growth of chain by 2 C
Type I (Eukaryotic) Multiple enzymatic
activities on a single large multifunctional protein
Type II (Prokaryotic) Each activity is on a
separate polypeptide
Dr. Kim Paul
![Page 18: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/18.jpg)
18
The Fatty Acid Dilemma BSF cannot incorporate [14C]-
acetate in FA.
Parasite salvages FA, however free FA are not abundant in serum.
Also enormous requirement for myristate (C14) for VSG GPI anchor structure.
More classical Type II - synthesis of lipoic acid (α-keto DH complexes)
Third Mechanism - Elongation
![Page 19: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/19.jpg)
19
Acidocalcisomes What?
Membrane bound - acidic compartment Calcium storage Polyphosphate storage
When? Multiple lineages contain these organelles Trypanosomatids, Apicomplexans, fungi,
algae, bacteria Mammals lack these organelles!
Why? Potential role is for response to
environmental stress Additional production of energy
Storage and Energy Generation?
![Page 20: Gene Expression - University of Massachusetts · PDF fileGene Expression ... Post-transcriptional modification - after ~ 25 nucleotides ... 12590Lect12.ppt Author: Michele Klingbeil](https://reader031.vdocuments.us/reader031/viewer/2022030506/5ab440967f8b9adc638bdc09/html5/thumbnails/20.jpg)
20
RNAi in protist parasites Comparative biology reveals RNAi machinery in only a subset of
protozoan parasites