first exam gen notes

7/29/2019 First Exam Gen Notes

1/64

note: these notes are complete for chs 1,2, and 10 -15, and most of 15;Ch 15 is not on

the exam, but I lecture on it prior to Exam I.

Genetics: Introduction to the courseWELCOME to genetics! This is a course that some of you have been anticipating, and many

have been fearing. It is both a body of knowledge itself, and a way of studying other subjects.

As such, it has a GREAT deal of application to other subjects such as evolution, ecology, cellbiology, developmental biology, and cancer.

Today, were going to cover the main parts of the course, then get right into an overview ofgenetics.

I. What is genetics?

Organisms can be described in many ways: By their shapes and parts, by their activities; by their

reproduction. For all these things, there is a need forinformation: Information that told you,when you were embryo how to grow and change, so that you became a baby, then a child, then

an adult. Information that resulted in some cells becoming muscle, some skin, some bone cells.

Information that allows you to respond to your environment; and information that allows you to

reproduce. That information has to: 1) exist- its origins are outside the scope of this course, forthe most part;

2) be expressedproperly: The right information, expressed at the right time and place.

3) be stored properly: We take pains to keep our information from being damaged, although it

does happen.

4) It must be Transmitted in order to make new cells and organisms.

This is very much like a CD or DVD; both store information; and neither does you any goodunless you can express it properly- for that you need a CD or DVD player. And the information

in a CD can be reproduced- copied.

The study of biological information, its form, how it is expressed, stored, repaired, and

transmitted, is the science of genetics. Its usually called the study of heredity, but when you

think about it, heredity has to do with information.

While we will spend much time on the key information molecule, DNA, well also talk about

cases in which the information required for formation of an organism is not actually found in the

DNA- well discuss that later in the semester.

II. Four ways we study genetics: We can usually study genetics in four different ways;

however, these ways often overlap!

Transmission Genetics: How are traits transmitted from one generation to another?

(AKA MENDELIAN Genetics); describing an allele as dominant or recessive, a gene as sex-linked, would be describing how it is transmitted.

1


2/64

Molecular Genetics: What are genes made up of?

How are they duplicated?

How is the information in the genes expressed?

How are genes turned on and off?

Where are genes located?

Population Genetics: How do genes vary in a population? What causes this variation within

populations? How are populations affected by their genes, and vice versa?

Cytogenetics: This area has to do with the relationship between the chromosome and traits that

are exhibited. Generally involves changes that can be observed under the microscope to

chromosomes. It also is involved in the location of genes.

Most books, and most instructors, start with the transmission genetics, and then move on to the

molecular genetics, and this is the approach I used to take. However, Ive been teaching themolecular partsfirst. My thinking on this is that these parts of genetics are harder, and youre

fresher and more ready to learn in September than in November; so were going to again learn

about DNA before we learn about Mendel. However, well get a review of Mendelian genetics inlab as we do our fruit fly exercise.

2


3/64

Introduction: Chapters 1 & 2

I. A brief history:A. Prehistory: People have known for years organisms reproduced after their own kind. They

also knew that certain desirous traits were passed down from parents to offspring, and people

made use of that knowledge. They would save their best seed for new crops, and would usebreeding to develop new breeds of plants and animals. Often, however, people thought of genes

as if they were liquids, that blended, rather than discrete particles, that maintained their

identity.

B. Mendel: Laws of Segregation and Independent Assortment.

Mendel and those who rediscovered him showed that genes were inherited as if they were

"particles" that stayed intact, not "fluids" that blended.

Gregor Mendel: Monk in Czech Republic

Worked with true-breeding peas.

Published his results, but no one paid any attention until others did the same, 35 yrs later. Thosethree were Carl Correns, Hugo DeVries, and Eric Von Tschermak. Well come back to Mendel

later.

C. Thomas Hunt Morgan et al: Genes are on chromosomes; genes near each other on the

chromosome are linked. We now take this for granted, but it took some work to establish this asa fact. Morgan and his coworkers were the first to actually establish this fact.

D. Oswald Avery, et al: DNA is the genetic material. They worked with bacteria to show that

the transforming material was DNA.

E. Watson, Crick, Franklin, Wilkins: Structure of DNA. Watson and Crick used other peoples

data to figure out a way that DNA could exist in a form that could contain information, and be itsown template for replication.

F. Recent: Recombinant DNA allows the manipulation of genes. Since the 1950's, we'vediscovered a tremendous amount about how genes work, as well as discovering how to

manipulate them. Specifically, Herbert Boyer/Stanley Cohen discovered how to manipulate

genes in 1973.

G. More recent: DNA sequencing, especially the ability to sequence entire genomes, has

changed much of biology and genetics. Fred Sanger developed the basic method of sequencing

DNA that we use today, and J. Craig Venter developed methods for large-scale sequencing.

3


4/64

Chapter 2: GENETICS NOTES

Mitosis and Meiosis

This chapter reviews cell structure, and then reviews mitosis and meiosis.

I. Cell structure: Please review the Fig. 2.1 and 2.2; the prokaryote/eukaryote difference is

especially important.

II. Chromosomes- the highly coiled, visible forms of the genetic material. During most of the

cell cycle, the chromosomes are substantially uncoiled, and not distinguishable as separatechromosomes. The coiled form only appears during mitosis. Species have a variety of numbers

of chromosomes (Table 2.1). We use the term chromatin to refer to the chromosomal material.

Chromatin consists of both DNA and protein (mostly a particular type called histones), and well

discuss its structure later.

A. Gross structure: Chromosomes can be examined by karyotyping- picture of all the

chromosomes arranged by number. Typically, they have two chromatids when visible, because

the chromosome has already replicated. Youll get a chance to produce metaphase chromosomepreparations in cell biology.

parts: centromere: meta, submeta, acro, telocentric (Fig 2-3, 2-4)

telomeres

p and q arms, numbering:

secondary constrictions- rDNA/nucleolus

Diploid and haploid organisms, haploid cells, and homologous chromosomes: We are diploid-

4


5/64

we have two sets of chromosomes, one from Mom, one from Dad.

This works because our chromosomes come in pairs; they are called homologous chromosomes-similar, but not identical. One of each pair came from mom, one from dad. We arise from a

fusion of two haploid gametes-sex cells- that result in a new person, with a full set of

chromosomes.

Our Genes- the bits of DNA that code for the proteins (usually) that result in a trait, are found on

the chromosomes. The genes at a particular location on a chromosome can be identical, butdont have to be. Different forms of the same gene can be on homologous chromosomes; they

are called alleles- two different forms of the same gene. We often think of there being two

alleles, but there can be many, or in some cases only one type. Any given person will have, at

most two different alleles. The place where the gene is found on the chromosome is the locus

B. MITOSIS:

The cell cycle: M, G1,S, G2; the cell has already duplicated its DNA in S phase. We knowabout these, b/c 1) we can see mitosis under the microscope, and 2) we can radioactively label

cells that are replicating their DNA, and autoradiograph them- they, and only they, haveradioactive nuclei, which indicates S phase. Other, similar studies show that theres a gap before

and after S phase, during which growth occurs.

Theres a WHOLE lot we could say about the cell cycle, but well save most of it for our studyof cancer later in the course, and in cell biology.

BACK TO MITOSIS:Prophase: Chromosomes coil, become visible, centrioles divide, migrate to opposite sides;

cytoskeleton rearranges- the microtubules become spindle fibers, nuclear membrane

disintegrates, nucleoli disappear (have to, b/c the chromosomes are coiling).

5


6/64

Prometaphase: nuclear membrane has disappeared, chromosomes migrate to the equatorial

plane/metaphase plate. Prometaphase applies to the period when the chromosomes are moving.

They are moving, of course, b/c they have attached to spindle fibers, which are pulling themaround. We can talk about kinetochore spindle fibers, polar spindle fibers, and astral spindle

fiber.

Metaphase: chromosomes are lined up at the metaphase plate, centromeres are connected to

spindle fibers @ both sides through the kinetochore structure.

Anaphase- the spindle fibers pull the sister chromatids apart, and the two cells also move farther

apart- all of this due to the action of the spindle fibers and associated proteins. Anaphase doesnt

happen until ALL chromosomes are hooked up to spindle fibers. Once separated the chromatids

are now daughter chromosomes. The separation is called disjunction.

Telophase: Essentially a reversal of the previous steps- nuclear membrane forms, chromosomes

uncoil, nucleoli form. Included in telophase is cytokinesis- forming two cells. It happens in a

variety of ways, including the formation of a cell plate in plants, and a constriction in the middlein animal cells.

Cytokinesis:

C. MEIOSIS: . The basic purpose is to produce sex cells, with half the chromosome number,and exacely one of each pair of homologous chromosomes. This is where segregation and

independent assortment actually occur.

Overall Flow: Chromosome # and DNA content: the chromosome # is halved, while the amount

of DNA is of that of a cell prior to meiosis.

Bad picture! You cant seethe chromosomes in

6


7/64

Stages:- prior to meiosis, the cell has undergone S phase, so the chromosomes have doubled, and

are consist of two chromatids. This is key in understanding the fact that we produce FOUR cells

in meiosis.

PROPHASE I (2-11)

Leptotene- The chromosomes are coiling, as in mitotic prophase.

Zygotene- The paired chromosomes are called bivalents- = to the haploid number of

chromosomes. They essentially seek regions of homology, which makes for some interestingpairing when there have been rearrangements in the chromosomes.

Pachytene- Thick strands- the homologs are visible; recombination takes place, but isnt

visible. The paired chromosomes consist of four chromatids, two sets ofsister chromatids. Theyare called tetrads.

Diplotene- the pair of sister chromatids begins to separate, yet held together at chiasma- places

where the chromosomes have undergone recombination.

Diakinesis- final stage of prophase I- the chromosomes pull farther apart, except where theyrejoined at chiasmata, which move towards the telomeres- terminalization.

Metaphase I- The tetrads line up along an equatorial plane.

Anaphase I homologues separate from each other, producing dyads. This separation of

chromosomes from one another is also called disjunction.

Telophase I- This varies; some organisms re-form the nuclear membrane, others go right intoprophase II.

Meiosis IIProphase, metaphase, anaphase, telophase II: By the end of telophase I we have two haploid

cells, but each chromosome still consists of two chromatids. Meiosis II essentially takes the two

cells with chromosomes consisting of sister chromatids and produces FOUR cells with single

chromosomes.

Differences between sperm and eggs: Eggs and sperm are different from each other. Sperm are

basically mobile chromosome packages- the male contributes only his half chromosome set.The mother, on the other hand produces the egg- the actual cell that becomes the person or

organism. Typically, only one egg is produced- half the genetic material is discarded at each

meiotic step in the form of polar bodies.

The other difference is that there can be enormous time gaps between prophase I and ovum

formation. In women, their eggs hang around in prophase I. Ovulation stimulates completion of

Meiosis I, and what is fertilized is actually an egg that hasnt completed Meiosis; Meiosis II is7


8/64

completed after fertilization.

NOTES for CHs 1& 2 stop here

Chapter 10: DNA Structure and Analysis

In this part, we are switching to MOLECULAR GENETICS. We will be discussing the details

of the CENTRAL DOGMA OF MOLECULAR GENETICS:

DNA makes DNA (replication)

From Stem

Segregation andIndependent

8


9/64

DNA makes (carries the information to make)

RNA (transcription);

RNA makes (carries the information to make)

PROTEIN (translation) which contributes to a particular

TRAIT

Fig. 10-1

How do we know questions (p. 206)- we cover most of these, except for the question about

eukaryotes having DNA as their genetic material. That one may be extra credit.

Convincing you that DNA is the genetic material

Early- DNA=boring- just a scaffold for the more interesting proteins- a repeating A-T-C-G

structure.

Then, Chargaff- A=T, G=C, but the amounts of each type could vary quite a bit.

I. DNA as the genetic material: Avery, and Hershey/Chase,:

Avery showed that what Griffith found, transformation of rough Streptococcus ---->smooth, was

caused by DNA. Fig 10-2,3

The smooth phenotype was due to the presence of a capsule- made Strep pneumoniae resistant to

phagocytosis.

Smooth bacteria

recovered- IIR cellshad gained a capsule

9


10/64

2. Hershey/Chase: by labeling the DNA w/ 32P, and Protein with 35S, showed that only the DNA

entered the cell in a T2 infection. Fig. 10-4,5

II. Structure of DNA: Linear, double-stranded chains of deoxynucleotides:

deoxynucleotides: PO4, deoxyribose, and nitrogenous base: Adenine, thymine, cytosine,guanine; A-T, G=C; A,G are purines-short name, long structure; T,C, uracil are pyrimidines.

PO4 attached to the 5' C of deoxyribose; links to the 3'C of next molecule. found initially as

triphosphates prior to incorporation. The chains have polarity because of the linkage- a 5' and 3'end to each molecule.

Isolated DNAtransforms;inactivated by

10


11/64

11


12/64

The two chains are complementary, and antiparallel.:

5' ATGACCTTAGG3'

3' TACTGGAATCC5'

The helix is right-handed- your right hand when held upright, traces the curve; it has a major and

minor groove, which become important in DNA-protein interactions. There are 10 bp per turn.

Features that make DNA suitable as genetic material:

a. Strands are complementary: thus, each strand is the template, holds the information, for

the other strand; the pattern for replication is built-in.b. The bases allow for a three-base code: there are 64 possible combinations of three bases,

12


13/64

more than enough to code for all the amino acids.

c. The structure allows for both faithful duplication, and formutations that will then beperpetuated.

Structure of RNA:Ribose and uracil, not deoxyribose and thymine.

usually single stranded

can fold, to produce secondary structure

Three main types, but there are others: rRNA, mRNA, tRNA

III. Neat things you can do with DNA, and what it means:

A. Denaturation and renaturation: DNA can be denatured- rendered SS- by heat or NaOHtreatment. HOWEVER: upon heating to 68C, it will renature- find its complementary bases and

reform DS DNA.

B. hybridization: Because DNA can renature, you can prepare probes: labeled DNA that willhybridize to unlabeled target DNA, either in solution, or when the target is immobilized to paper.

A probe will find its complementary DNA rapidly, even in the midst of a vast excess of non-

target DNA. One application: FISH (10-15).

C. Determining its size

Gel electrophoresis: small DNA fragments migrate faster than large; rate is an inverse logfunction. Fig 10-19

Pulsed field gel electrophoresis: variation of electrophoresis that can separate large fragments ofDNA.

Electron microscopy: Opening figure of Ch. 11

13


14/64

14


15/64

DNA Replication

NOTE: Chapter 11 has a number of good how do we know

questions (box, p. 232); we will not deal with these for the most

part. They may show up as extra credit questions on the exam,however.

I. Replication is:

SEMICONSERVATIVE

BIDIRECTIONAL

SEMIDISCONTINUOUS

A. Semiconservative: Fig. 11.3, 11.4

Proven by Messelsohn-Stahl experiment: Heavy (15N)

DNA-----> HL, then LL,

with a fixed amount of HL remaining. Separation is by CsCl

density gradient centrifugaton. (Also Taylor, Woods, Hughes)

B. BIDIRECTIONAL: Figs 11-6; Low 3H thymidine pulse is

followed by high 3H thymidine pulse; results after


16/64

autoradiography is a set of symmetrical dark bands.

Bacterial spores- germinate, resulting in synchronous

initiation of DNA replication pulse with low 3H thymidine

pulse high3

H thymidine pulse autoradiography. The resultsshow symmetrical lines of thymidine incorporation into the

DNA: (See Q. 32 in your text)

C. Semidiscontinuous: Fig. 11.11 One strand is made

continuously, one strand discontinuously

II. Process of replication: AS WITH ALLMACROMOLECULAR SYNTHESIS: INITIATION,

ELONGATION, TERMINATION.

Cool video of the process- an animation:

http://www.wehi.edu.au/education/wehi-tv/dna/replication.html

The process of DNA replication is driven by 1) antiparallel

nature of DNA 2) the nature of DNA polymerases: a) ONLY

elongate from a 3'-OH, i.e., only replicate in a 5'-3'direction; DO

NOT initiate, ONLY elongate.

Bacterial DNA polymerases are VERY fast: 1000 bp/sec!

+ pppdG3'OH

5'---------------T3'OH3'---------------ACGGATCGAGAG-----------------5'

5'---------------TG3'OH +pppdC3'OH

3'---------------ACGGATCGAGAG-----------------5'
http://www.wehi.edu.au/education/wehi-tv/dna/replication.htmlhttp://www.wehi.edu.au/education/wehi-tv/dna/replication.html


17/64

5'---------------TGC3'OH + pppdC3'OH

3'---------------ACGGATCGAGAG-----------------5'

etc.

A. INITIATION: BEGINS at a particular location, the origin-

signaled by the cell. Prokaryotes have a single origin,

eukaryotes have many. Replication is initiated by an increase in

cell mass, triggered by signals received from the cell. Initiationproteins open up the helix at the origin. Key protein: Dna A.

Fig. 11-9. A region replicated by a single origin is a replicon.

Bacteria usually have one, euk. have many hundreds of

replicons.


18/64

Because the DNA pol III is unable to initiate, replication begins

with an RNA PRIMER made by PRIMASE. DNA pol III can

then elongate off the primer. 11-10, 11

B. ELONGATION: once synthesis has begun, it usually

proceeds bidirectionally. Because synthesis is always 5'-3',

synthesis tends to be CONTINUOUS on one strand of a

replication fork, and DISCONTINUOUS on the other strand of

the fork. Primase, with the help of the mobile promoter &

helicase, theDNA BC complex, moves down the lagging

strand, laying down primer for DNA pol to use. Lagging strand

synthesis produces short fragments of 1-2K bases, calledOkazaki fragments. (Fig 11-11)

To finish the process, DNA Pol I then removes the RNA

primers, replacing them with DNA. This STILL leaves nicks in

the DNA, which are sealed by LIGASE.

C. HOW WE KNOW THIS: Labeling experiments withreplicating viruses; if you label replicating DNA with a short

pulse of radioactivity, you will label short (Okazaki) fragments,

and longer continuous strand fragments, that can be separated by

an alkaline sucrose density gradient

D. Other players: Helicase: again, the DnaBC complex helps

primase get started, and also separates the strands to allow

replication; DNA gyrase: Introduces negative supercoils, acting

to allow the DNA to swivel, preventing overwinding of the

helix. Theres also a single-stranded binding protein (SSBP)

that, well, binds single stranded DNA- keeping it SS as needed.


19/64

E. Completing the job: the problem of ends.

Fig. 11-16, 17: circles do not present a problem for termination;two circles are made. Linear DNA does present a problem, b/c

of the gap left by the lack of primer at the 5' end of the new

DNA. In Eukaryotes, the problem is solved by TELOMERASE.

Telomerase gets involved in cancer- apparently normal cells that

cant divide have low or no telomerase. A cancerous cell has

high levels.

Other forms of replication: rolling circle; Some viruses

replicate from a nick in the DNA; the new DNA unwinds one

parental strand, that then replicates by lagging strand synthesis.This produces a CONCATEMER of DNA that is then

processed.


20/64

Proofreading: fidelity of replication is enhanced by

proofreading. If the wrong base is put in, the mismatch is

removed before replication continues. This enhances the

accuracy of replication.

+ pppdG3'OH

5'--------------AC3'OH3'--------------TACGGATCGAGAG-----------------5'

Oops! MISMATCH!!!!

3-5 exonuclease activity removes mismatch

5'-------------AC3'OH

3'-------------TACGGATCGAGAG-----------------5'

+ pppdT3'OH

5'------------- A3'OH + pdC3OH

3'--------------TAGGATCGAGAG-----------------5'

Replication continues


21/64

Recombination: What, Why and how

What: breaking and rejoining two pieces of DNA

AAAAAAAAAAAAAAAAAAAAAAAA ->

BBBBBBBBBBBBBBBBBBBBBBBBBB

AAAAAAAAAABBBBBBBBBBBBBBB

BBBBBBBBBBBAAAAAAAAAAAAAA

Or sometimes an insertion:

AAAAAAAAAAAAAAAAAAAAAAAA + BBBBBB ->

AAAAAAAAAA BBBBBB AAAAAAAAAAAAAA

Why: 1) promotes genetic exchange (so- why should an

organism want this??)

2) Repair: Rec- mutants in bacteria are UV sensitive, die easily,

dont mutagenize well- the major reason for a cell.

Three types:

1. Site specific: 2 regions of short homology:

=======-----====================

=======--------------------------------------------------=============

2. Illegitimate: Transposons can insert anywhere;

~ 20 bp of homology


22/64

3. Homologous recombination: the main type.

HOW of homologous: fig 11-18

Enzymes of recombination:

recA: Causes synapsis of DNA, and displacement loop

formation.

recBCD: helicase, exonuclease, endonuclease that cuts at

specific sites.

SS DNA is highly recombinogenic!


23/64

Gene Conversion and Mismatch Repair

Def: One allele is converted to another. Thought to occur during

heteroduplex formation in recombination, followed by mismatch

repair. Fig. 11-19.

============== AA============== -> at heteroduplex:

============== aa==============

============== aA==============

============== aA==============

Repair converts one allele to another:

============== AA==============

============== aA

==============


24/64


25/64

Chapter 13- the Genetic Code and Transcription.

Review: the central dogma of molecular biology/genetics:

DNA---->RNA----->Protein. We've seen how DNA is replicated. This chapter discusses thecode, and transcription. For some reason, it discusses the code first, then transcription, which I

dont understand (the order of presentation, that is!). Well cover these in a more typical fashion.

Well leave Chapter 12 for later.

Prokaryotic & Eukaryotic Transcription: DNA---->RNA

I. What: making an RNA copy of one strand of DNA:

3'ATAGCCTAGCCGTTAG5' (template, anticoding, antisense strand)5'TATCGGATCGGCAATC3' (partner, coding, sense strand)

|transcription

|

5'UAUCGGAUCGGCAAUC3'II. Importance:

A. Link to Translation;

B. Gene regulation: genes are turned on and off mainly by

transcription.


26/64

III. Main player(s): RNA polymerases: enzymes that cause

transcription.

components: (prokaryote- eukaryotes MUCH more complicated)core: ,,

---------

,,;

holoenzyme

Core: non-specific binding to DNA and transcription of nicked

DNA.

Core + (holoenzyme): specific transcription from promoters

Process: fig 13.8: Initiation, Elongation, termination

Initiation:

Loose binding to DNA (not at promoter)

Binding to promoter (closed promoter); helix is unwound

tight binding to promoter (open promoter- the DNA is opened!)

Note that open is tighter than closed!

First base added, complementary to the anticoding strand.

Many promoters have been sequenced:

-35 -10 -1|1

======TTGACa=========TAtAaT====AorG=======

upstream (purine) downstream


27/64

Promoter strength: strong and weak promoters, up and down

mutations.

There is control over amount of a protein by the strength of the

promoter. This isnt the only control, however!

Elongation: more bases added to the chain, using the anticoding

strand as the template. Goes @ 50 nucleotides/sec.

Termination: Termination signals- poly U + hairpin loop:

5'TACGAATTCGTATTTTTTTTTTT3'

3'ATGCTTAAGCATAAAAAAAAA5' transcript forms a

hairpin:

---------- --------5'UACGAAUUCGUAUUUUUUUUUUU3'

3'AUGCUU|


28/64

The hairpin seems to dislodge the RNA pol; some terminators

aided by protein rho.

Prokaryotic transcripts are polycistronic: they can code formany proteins. This is b/c the pro. Ribosome can start in the

middle of a mRNA strand. Euk. Ribosomes can only start at the

5 end of mRNA.

Eukaryotic mRNA transcripts are monocistronic: code for only

one protein; however, there are some interesting modifications

that they can also do, that well talk about later.

Replication vs transcription:

replication

entire replicon replicated

both strands

Transcription

only certain genes; the ones transcribed vary

with the type of cell, and environmental

conditions

only one strand; the transcribed strand varies

Transcription in Eukaryotes

In the nucleus; three separate RNA polymerases, for the three

major types of RNA- Table 13.6

I- rRNA; II- mRNA; III- 5S rRNA, tRNA

A LOT more complicated at the start!

Upstream regulatory sequences- TATA boxes, CAAT

boxes, enhancers- cis acting elements- need to be on the

same piece of DNA to have an effect.

transcription factors: LOTS of stuff needs to be at the


29/64

promoter, to get things started! These are needed for the

proper binding of the RNA polymerase to the promoter.

More cool videos at the DNA replication site on transcription.

http://www.wehi.edu.au/education/wehi-tv/dna/replication.html

Processing: Caps and tails and splicing and termination.

Initial product is a lot longer than the final product-

hnRNA/hnRNPs. This is then processed to produce the

mRNA product that is transported to the cytoplasm.

As it is being produced, the RNA is capped with a 7-methyl

guanosine cap- protects from degradation!

terminates strangely- the growing transcript is cut as its

being made! the RNA pol is destabilized, and eventually

falls off.

the 3 end is then polyadenylated- a poly A tail- 70- 250AAAAAs!

Its also processed by splicing- see below.

Introns are a LOT

70-250 As
http://www.wehi.edu.au/education/wehi-tv/dna/replication.htmlhttp://www.wehi.edu.au/education/wehi-tv/dna/replication.html


30/64

Splicing: MAJOR difference between pro and euk.

Process: snRNP=s (snurps) recognize the borders of an intron:

Exon / intron /Exon

5'-------cAG/GUaAGU------YnNAG/G------------------3'

a g

Y=9 pyrimidines (C/U); lariats are formed!

The process: fig 13-13: SNRNPs bind at the 5 and branch point,

catalyze the splicing, resulting in 2 exons ligated and a lariat-

shaped intron.


31/64

This is another opportunity for error- thalassemias, muscular

dystrophy are splicing errors.

Proof: hybridization of DNA w/mRNA, Fig 13-10;cloning/sequencing of genomic and cDNA.

Termination: Poly A tails; no real termination; RNA cut, then

tail added. Polymerase is destabilized and eventually falls off.

Heres a web site thats got a good illustration of splicing:

http://www.web-books.com/MoBio/Free/Ch5A4.htm

Caps: methyl guanosine, added 5'-5', is at the 5'end. Fig 13-9Cap provides protection of mRNA, proper initiation of

translation.

Types of gene control in eukaryotes:

Transcriptional control- the usual; cells respond to

signals=hormones, growth factors, etc. affecting transcriptionfactors. much more positive control.

Posttranscriptional control: variable half-life;
http://www.web-books.com/MoBio/Free/Ch5A4.htmhttp://www.web-books.com/MoBio/Free/Ch5A4.htm


32/64

OK, back to the start of CH 13:

The overall scheme: 13-1: DNA makes RNA makes protein. The A,U,C,G code turns into an

amino acid code for the protein: 4 letter code 20 AA code. As you see, the RNA is read in

triplet.

Key points about the code:

read as triplet codons.

unambiguous: each triplet stands for only one AA

however, its also degenerate: more than one codon can code for any particular AA

It has start and stop signals, but no internal punctuation (commaless).

(usually) non-overlapping- in theory, you could get three proteins (six, if you read it in both

directions!) out of an RNA sequence, but you usually dont- some minor exceptions in bacterial

viruses.

code is universal, with a few exceptions.

The code: fig 13-7 The code is the informational link between the RNAsequence and the protein sequence. There are 4 bases, and 20 AA's;

therefore, a single base cannot code for only one AA; even two can have a

maximum of 16 (4x4) 3 bases can have a maximum of 64, however. Becauseof this excess, the code is degenerate: a triplet can only code for one

AA (unambiguous), but several codons code for the same AA. These codons pair with the

anticodons on the tRNA. Does this mean that there are 61 tRNA's? No-


33/64

some tRNA's will be used for a codon that it pairs with in only 2 of 3

spaces.

Look at the code: Note that, for all AA's the variation is in the last base- This has led to the

theory that the first two bases are the most important, and that the last base is less important. In

fact, the third base on the codon may be able to vary, and pair with the same tRNA. This isbecause of wobble in the base-pairing- the pairing can vary, from normal, since only 3 base pairs

are involved- one variation is to have a G on the anticodon pair with a U, as well as a

C; also, Inosine, similar to G, can pair with A, U, or C. So AAC and AAU (asn) could both pairwith an anticodon 3'UUG5', and 3'CGI5' could pair with 3 of the ala codons: GCC, GCU, GCA;

you would only need 3'CGC5' (to pair with GCG) and 3'CGI5' (to pair with the rest) as tRNAs

for alanine.

Because the bases aren't held in place as rigidly as in a full helix, there is room for this sort of

variation, or wobble. If inosine were used, it could pair with A, C, or U. E.G., 3'-UAI-5' would

pair with all of the isoleucine codons: AUU, AUC, and AUA.


34/64

Starting and stopping: AS well see, starting is at AUG, or methionine. Bacteria have a

modified met- N-formyl met- that they use; we use a regular met to start things off.

Stopping: this uses stop codons, that do not code for any AA.

Now, on to Ch. 14: Translation and proteins. Were going to cover some of the basics oftranslation, and then some of the results, in terms of proteins and their modifications.

The key players: the mRNA, the ribosome, and the tRNA. Weve just looked at the mRNA, solets look at the other two:

Ribosome: The death star of enzymes. 21/2 million m.w. of a prokaryote!

14-1:

Bacterial: 50S (23S rRNA 5S rRNA + 31 proteins) + 30S (16SrRNA + 21 proteins)= 70Sribosome.

eukaryotic: 60S (28S rRNA + 5& 5.8SrRNA + 49 proteins) + 40S (18S rRNA + 33 proteins)=80S ribosome.

rRNAs: are mostly on one transcript thats processed, not spliced.They are found in multiple copies, up to 500 in a frog, and more in frog eggs- you need

multiple copies to make all the copies needed in a typical cell (10K in a bacterial cell, over 10million in one of your liver cells!). Like the cool picture at the start of CH 13- we make massive

amounts of rRNA! Most of the segments are on a single transcript, which are then processed

into smaller pieces.

Assembly: they are assembled in the nucleolus. The rRNAs are made there, the proteinsimported, and they are assembled.


35/64

Transfer RNA:

tRNA is shaped like a cloverleaf when hydrogen bonded, and like an r or L (or a foot!)

when fully folded. (14-3,4,5) They have about 70 bases, many of which are modified

after being made- the modifications are necessary to its function.

Important parts: 1) the anticodon: this region is the part that interfaces with the mRNA; we've

discussed its wobble possibilities already.2) the 3' end and acceptor stem: the AA is attached by the COOH group to the 3'end which is

always 5'-CCA-3'. There's a special enzyme, aminoacyl-tRNA synthetase, that does this(13-5).

It costs one ATP (used to charge the COOH, making a hi-energy bond), and results in a charged

tRNA. There is a single aminoacyl-tRNA synthetase for each amino acid. The specificity ofeach is in its ability to recognize certain sequences in the acceptor stem. These enzymes are

important: a mutation in one of these would cause a global change in the genetic code! It would

be like a global find and replace in a document.

Translation: Figs 14-6,7. Once again, you have initiation, elongation, and termination:

Initiation: In prokaryotes, there is a sequence at the 5' end that is untranslated, and allows

binding of the ribosome- ribosome binding site.

COOH of amino acid joinedto 3OH of tRNA- ester


36/64

Eukaryotes, there is a "cap"- a reversed, methylated guanosine- that indicates that an mRNA is

supposed to be translated, and also a small region in front of the 1st AUG.

There is no punctuation in the code, so the start and end are critical;

initiation always begins with an AUG-methionine-codon. In prokaryotes, the 1st one is an

N-formyl-Methionyl-tRNA. An initiation complex forms,with the small subunit, the tRNA-fMet, and 3 initiation factors, all on the mRNA. The small

subunit in Prokaryotes recognizes the ribosome binding site- 3-6 bases complementary to the 3'

end of the 16S portion of the rRNA of the small subunit (see above).

Elongation: the ribosome has a A,P, and E sites; the tRNA-met is in the P (peptidyl)

site. the next tRNA-aa then comes in (aided by an elongation factor) to the A (amino) site..

The ribosome then catalyzes the transfer of the methionine from the tRNA to the amino group ofthe next aa; the ester bond is broken, and a new peptide bond formed. The uncharged tRNA

stops briefly at the E (exit) site, before leaving. This is the heart of what the ribosome does.

The ribosome then moves- the tRNA holding the dipeptide is shifted to the P site, and a new

aa-tRNA can move in, allowing the process to continue. The stop codons cause termination,using release factors.

The Klug/Cummings web site has a good animationwww.prenhall.com/klug

Another good animation, on a bunch of stuff:http://vcell.ndsu.nodak.edu/animations/home.htm

Protein function and heredity: DNA RNA Protein trait (or contribute to the trait).

Mutations in the DNA can result in changes in the protein, often with bad consequences.

Proteins are usually enzymes, which do things. When they undergo mutation, then they cancease to function, and disease can result. We have thousands of different enzymes doing things.

In some cases, a loss of function would kill us; in other cases, it causes disease.

Some reminders of things youve had in the past:

Amino acids, peptide bonds, amino and carboxy termini, primary, secondary, tertiary, quaternarystructure of a protein. While we say that the primary structure drives all the other features, two

proteins can look a LOT alike, and still be quite different- below are two proteins that only share

15-20% homology, and they are impressively similar.
http://www.prenhall.com/klughttp://www.prenhall.com/klughttp://vcell.ndsu.nodak.edu/animations/home.htmhttp://www.prenhall.com/klughttp://vcell.ndsu.nodak.edu/animations/home.htm


37/64

Your book gives several examples; lots of history that makes a good read, but we dont havetime for.

Fig. 14-10, and 14: A mutation in a gene, affects the amino acid sequence of a protein, reducingor eliminating its function, resulting in a mutant trait. Alkaptonuria, Albinism, Phenylketonuria,

and sickle cell anemia are all the result of mutation.

MUTATIONS: Translation allows for many of the classes of mutations to be produced. all are

"point" mutations, affecting one or only a few bases. These are in the category of basesubstitutions.

Fig. 15-4:


38/64

Substitutions:

Synonymous: changing a codon for 1 AA for a codon for the same AA. E.g.- UUU-UUC- both

code for phe.

Non-synonymous:

MISSENSE: A single base change changes one AA to another in a protein. e.g.: the sickle cellanemia story: one base change one AA change- glutamine to valine- big change!

purine-purine AT GC;

These can vary; some do nothing, some small changes, others can inactivate an enzyme.

NONSENSE: Changing a sense to a nonsense codon results in premature termination

Frameshift: adding or subtracting one or two bases alters the reading frame for the rest of the

protein. These are almost always serious. In practice, they result in stop codons showing up and

stopping translation.

MUTATIONS

UNMUTATED-WILD-TYPE

5'TTTTATAAATG-CGA-GAC-TAC-GAA-GAA-TTT-CCT-TGC-TTA-AAT-CCT-AAC-TGA

MET-ARG-ASP-TYR-GLU-GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP

synonymous substitution (actually very common)G

5'TTTTATAAATG-CGA-GAC-TAC-GAA-GAA-TTT-CCC-TGC-TTA-AAT-CCT-AAC-TGAMET-ARG-ASP-TYR-GLU-GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP

missense- with change- non-synonymous substitution

C5'TTTTATAAATG-CGA-GAC-TAC-GAA-GAA-TTT-GCC-TGC-TTA-AAT-CCT-AAC-TGA

MET-ARG-HIS- TYR-GLU-GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP

FrameshiftSER-ARG LEU ARG ARG ILE SER LEU

T | | | | | | | | |

5'TTTTATAAATG-CGA-GAC-TAC-GAA-GAA-TTT-CCT-TGC-TTA-AAT-CCT-AAC-TGA

MET-ARG-ASP-TYR-GLU- GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP

Nonsense STOP

T5'TTTTATAAATG-CGA-GAC-TAC-GAA-GAA-TTT-CCT-TGC-TTA-AAT-CCT-AAC-TGA

MET-ARG-ASP-TYR-GLU- GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP


39/64

(Added material- not testable at this point)

Nonsense suppressed by a suppressor tRNA:ACCtrp

|

ACUtrp

5'TTTTATAAATG-TGA-GAC-TAC-GAA-UAA-TTT-CCT-TGC-TTA-AAT-CCT-AAC-TGA

MET-TRP-ASP-TYR-GLU- GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP


40/64

REVERSION: a second mutation can correct the effects of the first. This is especially true for

frameshifts, in which adding or removing 1 or two bases can restore the original reading frame,with few or no changes to the original sequence.

Suppressor mutation: if a sense tRNA is mutated to code for a nonsense codon, the mutatedtRNA can fill in for the nonsense codon, allowing synthesis to continue. The resulting protein is

often changed by a single AA, which may or may not make a difference. Suppressor mutations

will often correct several nonsense mutations, since they can fill in any stop codon with an AA.They aren't lethal because often real stop codons occur in pairs.

END OF NOTES FOR EXAM I.


41/64

Mutations: Chapter 15.

Mutation: Chromosomal changes: Ch. 4; but also gene

mutations (this chapter)

I. Types: Spontaneous : natural (even if naturally induced?)

induced- artificial production, due to a mutagen.

Somatic vs germ line; somatics produce cancer!

Dominant autosomal: dominant mutation in a non-sexchromosome; expresses when heterozygous; overproduction or

gain of function.

Recessive: expressed when homozygous- usually a loss of

function.

X-linked recessive- recessive in females, dominant in males

cause of only one X chr.

Other categories:

Morphological

Nutritional: prototroph vs auxotroph

Lethal

Conditional: ts and nonsense mutations that are suppressible


42/64

These types are not necessarily mutually exclusive- eg

conditional nutritional mutations.

II. Finding mutants (NOTE: mutant is the organism with amutation in its gene(s)): Geneticists LOVE to make mutants!

The trick is finding them! This is a very tricky business!

Some examples from the bacterial world:

Bacteria: gain of function mutants can be found by selection:

antibiotic resistance

auxotrophprototroph

ability to use a new food source: xylitol utilizers from ribitol

utilizing strains.

Other traits are found by screening:

prototroph auxotroph

With plants/animals being diploid makes things harder, since

recessive mutations are masked. But, geneticists have their

tricks!

III. How they are produced:

I. Spontaneous-infrequent. one natural cause:


43/64

A. tautomerization-fig 15-5

B. Deamination: cytosine-->uracil; adenine--->hypoxanthine,acts like a G.

D. Environmental effects: sunlight, cosmic rays (?)

E. Transposons- jumping genes

II. Measuring mutation rates: frequency/generation- haploid

organisms;

Diploid: Frequency per gamete. W/ Dominant mutations, =

frequency in the population/2, or frequency in the # live births/2

III. Induced mutations:

A. chemicals:

1. Base analogs: increase in tautomeric shifts, 5-Br uracil

2. Alkylating agents: change H-bonding, labile bonds with the

sugar; induce SOS response, which is mutagenic

3. Intercalating agents: acridine dyes- increased rate of

frameshift mutations

B. Radiation:

1. UV light- Thymine dimers- fig11.20; again, repair can be


44/64

mutagenic

2. gamma, X rays- DS and single-stranded breaks; often

deletions.

IV. Detecting mutagens: Ames test, Fig 14.12.

his- ----> his+ reversions by Salmonella strains. Strains are

specific for point or frameshift mutagens, and are designed to be

sensitive to reversion by mutagens.

DNA REPAIR

Normally, DNA is the ONLY molecule repaired!

All mechanisms require enzymes!

I. Photoreactivation- fixed T-T dimers:

II. Excision repair- (14-14, 15) Repairing the mistake;

Base excision repair, and nucleotide excision repair.

Mismatch---glycosylase--AP site-----5'AP endonuclease---->

----fill in/ligate

Nucleotide: cut out the damaged/mismatched bases with


45/64

endonucleases and exonucleases; fill in and ligate.

Mismatch repair: mistake in replication, leaving a mismatch;

parental strand is methylated, thus telling the glycosylase whichbase to remove.


46/64

Recombination or Post replication repair: Recombination by-

passes damage w/o actual repair.

Error-Prone Repair- SOS system induces an error-prone DNA

repair that bypasses damage, but produces mistakes.

cells w/o this system often can=t be mutagenized! they just die!

Errors are BAD for you: cancer, etc. Blooms disease: ligase

defect; Xeroderma pigmentosum: excision repair

SOME EXTRA TERMS:

site-directed mutagenesis: changing a one or a few specific

bases

knockout organism:

transgenic organism:

Mobile Genetic Elements: The short course.

Definition: DNA that can move to a new location, w/o regard to

sequence homology (illegitimate recombination).

Movement is usually accompanied by replication.

Movement is usually a rare event

Included: Insertion sequences (IS's), Transposons (Tn's)


47/64

Overall- fig 14.21 the element "jumps"

These jumps can be CONSERVATIVE, or REPLICATIVE(draw on board)

They are found in bacteria and eukaryotes. Well studied in corn

(Ac and DS elements), Drosophila (copia and P elements), and

in people (Alu sequences- 500,000 copies in our DNA!)

Why we need to know about them:

1. They are mutagenic; this has been of GREAT use in the study

of genes in bacteria. Book has example of hemophilia caused by

one of these!

2. They are the main reason bacteria are antibiotic resistant-

TNs carry antibiotic resistance genes, which are why they are

great for making mutants, but also why they spread antibiotic

resistance in people and animals.


48/64

III. Chromosomal changes

A. Chromosomal Structure: duplications:

Deletions

Inversions

Translocations

All of these events cause strange things to happen when the chromosomes pair in meiosis.Translocations, in particular, can result in duplications and deletions during meiosis.

B. Chromosomal number

euploid: changes in chromosome sets

aneuploid: changes in chromosome numbers.

Polyploidy: auto and allopolyploids

Aneuploidy: trisomies and monosomies: Down's, Turner's, Klinefelter's syndromes.

Down: Trisomy 21

Turners: monosomy X; XO

Klinefelters: XXYXYY:

Finding these: Barr body


49/64

Fundamentals of Mendelian Genetics

A. Law of segregation: Two copies of each gene, only one of which is found in a gamete.Genes segregate during gamete formation. Mendel discovered these by doing monohybrid

crosses. Example, p. 22. Genes are found in pairs. Different types of the same gene are alleles.

the pairs segregate during meiosis, to produce gametes that have only one of the two genes. In

the cross shown, the F1 generation is heterozygous. When crossed with itself, it produces 3/4round, 1/4 wrinkled. Of the round, 2/3 are heterozygous, 1/3 homo. This is shown by a

backcross or testcross with a recessive parent.

Important terms:

allele

heterozygous

homozygous

genotype

phenotype

How do you tell the genotype of an individual? Homozygous recessives are obvious; To

determine if an individual is homo- or heterozygous for a dominant trait, do a test cross.

Probability: Product rule and sum rule: Product: Pr (RR) = Pr (R)X Pr (R)= 0.5X 0.5= 0.25

Both/and

SUM: Pr(Rr or rR)= Pr(Rr) + Pr(rR)= .25 +.25; either Rr or rR

B. Independent Assortment: Genes on different chromosomes sort independently. Shown bydihybrid crosses. Example, p. 24. Each trait is inherited, in the F2 generation, in a 1:2:1 pattern.

Analyze: each is a 3:1. Pr (R-)= 3/4, Pr.(Y-)= 3/4; Pr(R-Y-)= 9/16.


50/64

Pr. (R-)= 3/4, Pr. yy= 1/4, Pr (R-,yy)= 3/16

Pr (rr)= 1/4, Pr (Y-)= 3/4, Pr (rrY-) = 3/16

Pr (rr)= 1/4, Pr (yy)= 1/4, Pr (rry-) = 1/16

C. Crosses with three or more traits: use the forked-line approach. Ex. fig 2.12; ex., problem

12, p 43

C. Crosses with three or more traits: use the forked-line approach. Ex. fig 2.12; ex., problem12, p 43

D. Goodness of fit: Use the Chi-square analysis to determine if the results can be expected on

the basis of chance, if the hypothesis is correct.

What does the Chi2 value mean? It means that the probability of obtaining a value that large (or

larger?) by chance.

E. Inheritance in humans: If we assume that inheritance in humans also follows Mendelian

patterns, then we can determine the genotypes of parents, children, and the probable genotypes

of future children.

Recessive traits: Show pedigree analysis. Trait appears suddenly, in unaffected parents. 25%

chance of inheritance with heterozygous parents.

Dominant traits: Trait appears in parents. 50% chance of inheritance with an affected parent.


51/64

Binomial formula helps determine the probability of having affected offspring, once the parentalgenotypes is known.

Pr (x type one events out of N total events)= Cp xq(N-x). E.g, the probability of having two boys

out of 6 kids. Pr (boy) = 0.5, Pr (girl)= 0.5. 0.520.54 gives the probabiltiy of having oneparticular pattern of two boys and 4 girls, say, bbgggg. C tells how many different ways you can

get 2 b and 4 G. C= N!/x!(N-x)!


52/64

EXTENSIONS AND APPLICATIONS OF MENDELIAN GENETICS

This is kind of a boring chapter, but hang in there- its needed to explain the wealth of exceptionsto the typical Mendelian story.

First- dominant and recessive- the recessive can be thought of as an absence of a trait; the protein

is missing or nonfunctional. e.g.- albinism- the color isnt there; If we think of genes making aproduct, then some of the variations make sense.

INCOMPLETE DOMINANCE: Here the amount of a product influences the phenotype, and aheterozygote will have half the product of a homozygote: twice the gene dosage. Fig 3.1; R1R1=

RED R1R2=PINK; R2R2=white. Again, R2 is not functioning, but the amount of red is

influenced by gene dosage.

Effect upon inheritance: 1:2:1 ratio

CODOMINANCE: sometimes two proteins can both be expressed, alleles of the same gene.BLOOD: RBCs can have both A and B alleles, as well as an O allele. So people can be AB as

well as A,B, and O.

Effect upon inheritance: with codominant alleles, at least three genotypes: A,B, AB.

LETHALS: A genetic defect that causes 100% mortality. Usually, the mortality prevents a live

birth or the organism dies shortly after birth; (Obviously, the definition can affect how we viewlife(which is 100% fatal), and diseases such as Down syndrome or Huntingtons, which reduce

life expectancy but dont kill you right away.

Effect upon inheritance: 2:1 ratio, with The yello mouse story:

fig3.2; manx cats, fig 3.3.

CONDITIONAL LETHAL/MUTATION: sometimes a gene is inactive at a higher temperature;e.g.: TS mutations in genes; extremely important in studying essential genes;

Siamese cats: TS gene for coat color expression- only in cooler areas. Cat gets darker in winter,

as more extremities are cooled.

PLEIOTROPY: Multiple effects of a single mutation

EG: PKU; recombination defects in bacteria make it sensitive to radiation as well.

PENETRANCE AND EXPRESSIVITY:PENETRANCE: Sometime, a person may have the gene, but not the trait; PENETRANCE= #showing trait/#with phenotype.

e.g.: retinoblastoma- tumors of the eye; 90% penetrant; needs a second mutation, which happens

most of the time, but occasionally doesnt.If a disease takes a while to develop, and someone dies young, but still reproduces, the disease

may appear to skip a generation. generation.


53/64

If penetrance measures whether the gene is expressed at all, EXPRESSIVITY= LEVEL OF

EXPRESSION

E.G: coat color in mice; age at Huntingtons onset.

Why? other genes; environmental modifiers- (a genetic predisposition to heart attacks can be

modified by exercise, or worsened by a lack of it or diet).

MULTIPLE ALLELES

theres no reason why you cant have numerous alleles of a locus. Important examples in the

HLA blood typing, with many loci having 20 or more alleles.

Blood: ABO: 6 different genotypes, three different heterozygotes.

total genotypes = n(n+1)/2

total heterozygotes= n(n-1)/2

Blood types are due to the presence of sugar molecules on certain RBC proteins. If you have the

protein, you dont make Abs against it; you tend to make abs against those you dont have.

O- universal donor- doesnt react to anyone, no surface sugars

AB-universal recipient- no antibodies, since they have both sugars.

HLA A= 59; HLA B= 111; thus, # A genotypes = 1711; # B genotypes=6105; total

combinations=10,455,655! This is why organ transplants are often hard to match. (says nothing

about frequency, however)

SEX LINKED GENES:

These are gene on the X chromosome; in us and most mammals, males are XY, females XX.Males are thus short one x chromosome, so recessive diseases show up much more frequently in

males.

ex: hemophilia, color blindness

effect on inheritance: Pedigree, fig. 3.15: The trait tends to skip a generation, since its passed on

by the mother. A mother carrier will produce affected sons, and carrier daughters.

SEX INFLUENCED: male pattern baldness: influenced by testoterone. trait is dominant in

males, recessive in females; even when homozygous, tends to be less expressed in females.

MULTIPLE GENES AND EPISTASIS: Different genes can often interact; thus, the final

phenotype is the result of the interactions of multiple genes=EPISTASIS.

Some types: complementary gene action: Fig 3.19: two whites produce a purple.9:7 ratio of

purple:white in F2


54/64

DUPLICATE GENE ACTION: 2 genes; actually, if they are incompletely dominant, you get the

sort of thing seen in fig3.29.

DOMINANCE OF ONE GENE OVER ANOTHER: with coat color in mice, three genes

interact. Two produce a total of three types of color, if the C- is present. if the mouse is cc,

theres NO color produced AT ALL. Table 3.5, p.58

GENOTYPE-PHENOTYPE RELATIONSHIPS

What else affect our phenotype besides our genotype? our ENVIRONMENT, of course! Theseinteract extensively; its the basis of the nature vs nurture debate. Newsweek just before

Clinton-

Many traits, such a crop yield, intelligence, height, etc. are QUANTITATIVE TRAITS: traits

that can be measured; vary continuously; opposite of qualitative traits, that come in major

categories, e.g., round and wrinkled.

Shows the influence of multiple genes, as well as environmental influences-polygenic.

SEPARATING NATURE FROM NURTURE: With people, this is a hard question to answer;with model systems, its possible: simply take genetically identical individuals, and put them in

different environments. The way phenotype varies with environment is the NORM OF THE

REACTION.

Fig 3.27; Prone to heart attack/ effects of exercise thought experiment.

OR- effects of altitude on various potentillas- when ones from different altitudes are raised at the

SAME altitude, this becomes a COMMON GARDEN EXPERIMENT.

MEASURING THE INFLUENCE OF GENOTYPIC VARIATION ON THE TOTALPHENOTYPIC VARIATION IN A POPULATION: HERITABILITY.

VARIANCE: IN A POPULATION, youll have variation: measured by variance:

Find the mean.

subtract the difference between the mean and the value of each sample.square it

ADD THEM UP

divide it by the # of samples -1.STANDARD DEVIATION= square root of the variance.

if you have a whole population, you use n, not n-1.

A trait varies by a NORMAL distribution (bell curve), if 95% of the population is within 2

standard deviations of the mean.


55/64

For a given phenotype, the phenotype is the result of the genotype, and the environment, and the

interactions of the environment with the genotype.

The genotype will be influenced when there arent dominant traits that influence

h2= VA/Vp.

Estimates: using mono/dizygotic twins.

h2=2(rM-rD); doubled because dizygotc twin share half their genes anyway.selective differential

h2= R/S

R=RESPONSE to differential breedingS=selection differential; how big is the difference between the mean and the group selected for

breeding.

PRACTICAL GENETICS: COUNSELING

empirical recurrance risk: The risk from disease with a gentic component, but where there is not

a single-gene mode of inheritance. Risk is calculated from data gathered from a large # of cases.

paternity exclusion: HLA and DNA typing.: fig 3.38. for a man to be someones father, it must

have been possible for him to contribute both HLA alleles to the child.


56/64

Genotype-Phenotype relationships

1. Phenotype influenced by the environment as well as genes- nature

and nurture.

2. Many traits are QUANTITATIVE

Polygenic

influenced by environment

3. Separating nature from nurture:

Norm of the reaction: Similar genotypes in different environments

Common garden experiment: Fig 3.27

4. Heritability:

a.: variance:

For a given phenotype, the phenotype is the result of the genotype, theenvironment, and the interactions of genotype with environment.

The genotype will be influenced when there arent dominant traits that

influence

h2= VA/Vp.

Estimates: using mono/dizygotic twins.

h2=2(rM-rD); doubled because dizygotc twin share half their genes

anyway.

selective differential

h2= R/S


57/64

R=RESPONSE to differential breeding

S=selection differential; how big is the difference between the mean and

the group selected for breeding.

PRACTICAL GENETICS: COUNSELING

empirical recurrance risk: The risk from disease with a gentic

component, but where there is not a single-gene mode of inheritance.

Risk is calculated from data gathered from a large # of cases.

paternity exclusion: HLA and DNA typing.: fig 3.38. for a man to be

someones father, it must have been possible for him to contribute both

HLA alleles to the child.


58/64


59/64

Chapter 5:

Genetic Linkage

We now know how traits are transmitted from one generation to another; and we know

something about chromosomes;

It also seems that there ought to be THOUSANDS of genes; so you would expect that each

chromosome would contain many genes.

If this is so, you would expect some genes to be inherited together- NOT sorting independently.

Lets look at a situation in which two genes sort independently: an AaBb dihybrid crossed withan aabb testcross. Youd expect = #s of the four types of offspring, based on the four types of

gametes produced by the AaBb parent: AB, Ab, aB, and ab gametes, and AaBb, Aabb, aaBb, and

aabb offspring.

HOWEVER: if the A and B genetic loci (i.e., where the genes are located) are near each other on

the same chromosome, AND IF THERE WAS NO RECOMBINATION, you would expect the

AaBb individual to produce only AB gametes or ab gametes; the other possibilities wouldnthappen. So, youd expect to get AaBb and aabb individuals only.

HOWEVER: we know that recombination does take place, during pachytene in prophase I.Thus, youd expect some Ab and aB gametes, but far fewer that AB and ab gametes. This is

illustrated by fig. 5.3, with purple eyes and vestigial wings. The eye and wings are linked. The

actual results are shown on Table 5.2.

SOME TERMS: If two recessive alleles are both on the same chromosome, and the two

dominant alleles are also on the other chromosome, the genes are in COUPLING. If the

chromosome has one dominant and one recessive allele, the alleles are in REPULSION.

If two genes are close to each other on the chromosome, youd expect to have few

recombinant/non-parental offspring. The further two genes are from each other, the morerecombinant offspring you would expect.

In Summary:1. Chromosomes have thousands

This is what Bateson and Punnet found early on with 2 traits in sweet peas: flower color and

pollen shape. They found that the traits were LINKED:

PPLLX ppll:

F1: PpLl: Purple, longF2: NOT 9:3:3:1.

P-L-: 296


60/64

P-ll: 19

ppL-: 27

ppll: 85.

X2 was astronomical- >200.

The explanation was that the traits are LINKED- close to each other on the chromosome.

The best way to examine is with testcrosses with a recessive parent. Fig 5-3.

Some terms:

parental chromosomal types (non-recombinant)

non-parental chromosomal types (recombinant)

Note that you get different results, depending on the nature of the parental types: Tables 5.2, and

5.3.

Coupling and repulsion: when the dominant are on one chromosome and recessive on the other-

coupled. vice versa= repulsion.

Recombination frequency: # recombinants/total offspring.

map unit: 1% recombination

THE DREADED THREE POINT CROSS:

When two genes are close to each other, its hard to place a third gene, relative to the first two,

by recombination frequency. Here we rely on the THREE POINT CROSS: Fig 5.5, 5.6:

The least frequent recombinant will be the result of a double crossover!!

Work Problems.

INTERFERENCE: When genes are close together, the frequency of double recombinants may be

less than expected.

INTERFERENCE: I= 1- observed frequ. double recombinants

expected frequ. double recomb.

Note that if the observed is as expected, I=0; as it gets less, I approaches 1.You can also get hot spots, regions of LOTS of recombination; so I is


61/64

2) Somatic cell hybridization: put mouse & human cells together, and select for a human gene;

often done by nutritional requirements. The common chromosome retained is the one on whichthe gene is located (fig. 5.12)

Today, because of cloning, you can often identify a gene, and using hybridization to

chromosomes, locate the gene on a particular chromosome: cover, p 105.

TETRAD ANALYSIS:

Neurospora This fungus mates, producing spores in a sac, or ascus; the spores reflect the order of

meiosis, and actually show the results of crossover.

Rules of crossovers:

If you have 2 genes, a crossover between the genes shows the order; the gene nearest the

centromere has parental allele from the original chromatid, and the recombinant allele for thesecond gene.

Chapter 2: Fundamentals of Mendelian Genetics

A. Law of segregation: Alleles segregate during gamete formation.

p. 22: monohybrid cross:


62/64

Important terms:

allele

heterozygous

homozygous

genotype

phenotype

How do you tell the genotype of an individual? Homozygous recessives are obvious; Todetermine if an individual is homo- or heterozygous for a dominant trait, do a test cross.

Probability: Product rule and sum rule: Pr (RR) = Pr (R)X Pr (R)= 0.5X 0.5= 0.25 both/and

Pr (Rr or rR)= [Pr(Rr)+ Pr(rR)]= .25 + .25 = .5

B. Independent Assortment: Genes on different chromosomes sort independently. Shown by

dihybrid crosses. Example, p. 24. Each trait is inherited, in the F2 generation, in a 1RR:2rR:1rrpattern.

Analyze: each is a 3:1. Pr (R-)= 3/4, Pr.(Y-)= 3/4; Pr(R-Y-)= 9/16.

Pr. (R-)= 3/4, Pr. yy= 1/4, Pr (R-,yy)= 3/16

Pr (rr)= 1/4, Pr (Y-)= 3/4, Pr (rrY-) = 3/16

Pr (rr)= 1/4, Pr (yy)= 1/4, Pr (rry-) = 1/16


63/64

C. Crosses with three or more traits: use the forked-line approach. Ex. fig 2.12; ex., problem

12, p 43

D. Goodness of fit: Use the Chi-square analysis to determine if the results can be expected onthe basis of chance, if the hypothesis is correct.

What does the Chi2 value mean?

E. Inheritance in humans: If we assume that inheritance in humans also follows Mendelianpatterns, then we can determine the genotypes of parents, children, and the probable genotypes

of future children. Symbols, p. 33.

Recessive traits: pedigree analysis.

Dominant traits: pedigree analysis

Binomial formula helps determine the probability of having affected offspring, once the parental

genotypes is known.

Pr (x type one events out of N total events)= Cp xq(N-x). E.g, the probabiltiy of having two boys

out of 6 kids. Pr (boy) = 0.5, Pr (girl)= 0.5. 0.520.54 gives the probabiltiy of having one

particular pattern of two boys and 4 girls, say, bbgggg. C tells how many different ways you canget 2 b and 4 G. C= N!/x!(N-x)!


64/64

Instructor notes, Ch 1&2

first exam gen notes

Documents