degradation of 2,3-dihydroxybenzoate by a novel …jb.asm.org/content/194/15/3851.full.pdf ·...

Degradation of 2,3-Dihydroxybenzoate by a Novel meta-CleavagePathway

Macarena Marín,* Iris Plumeier, and Dietmar H. Pieper

Microbial Interactions and Processes Research Group, HZI–Helmholtz Centre for Infection Research, Braunschweig, Germany

2,3-Dihydroxybenzoate is the precursor in the biosynthesis of several siderophores and an important plant secondary metabolitethat, in bacteria, can be degraded via meta-cleavage of the aromatic ring. The dhb cluster of Pseudomonas reinekei MT1 encodesa chimeric meta-cleavage pathway involved in the catabolism of 2,3-dihydroxybenzoate. While the first two enzymes, DhbA andDhbB, are phylogenetically related to those involved in 2,3-dihydroxy-p-cumate degradation, the subsequent steps are catalyzedby enzymes related to those involved in catechol degradation (DhbCDEFGH). Characterization of kinetic properties of DhbAextradiol dioxygenase identified 2,3-dihydroxybenzoate as the preferred substrate. Deletion of the encoding gene impedesgrowth of P. reinekei MT1 on 2,3-dihydroxybenzoate. DhbA catalyzes 3,4-dioxygenation with 2-hydroxy-3-carboxymuconate asthe product, which is then decarboxylated by DhbB to 2-hydroxymuconic semialdehyde. This compound is then subject to dehy-drogenation and further degraded to citrate cycle intermediates. Transcriptional analysis revealed genes of the dhB gene clusterto be highly expressed during growth with 2,3-dihydroxybenzoate, whereas a downstream-localized gene encoding 2-hydroxy-muconic semialdehyde hydrolase, dispensable for 2,3-dihydroxybenzoate metabolism but crucial for 2,3-dihydroxy-p-cumatedegradation, was only marginally expressed. This is the first report describing a gene cluster encoding enzymes for the degrada-tion of 2,3-dihydroxybenzoate.

Bacteria synthesize small iron-chelating molecules, called sid-erophores, to facilitate iron uptake. As the availability of this

element in many environments is limited, siderophores are crucialfor bacterial fitness and virulence (12). One of the best-studiedsiderophores is enterobactin, which is produced by enterobacteriasuch as Salmonella enterica and Escherichia coli (43). A centralintermediate in the synthesis of this siderophore is 2,3-dihydroxy-benzoate (2,3-DHB), which is also a precursor in the synthesis ofanguibactin and vibriobactin (12). Moreover, 2,3-DHB is recog-nized as an important plant secondary metabolite (5). However,despite its similarity to central intermediates of bacterial aromaticdegradative pathways, such as 3,4-dihydroxybenzoate (protocat-echuate), only limited information is available on 2,3-DHB deg-radation.

It has previously been shown that P. fluorescens 23D-1 can de-grade this compound (44), and that metabolism is initiated by anextradiol dioxygenase, probably cleaving the substrate betweenthe C-3 and C-4 carbon atoms (45). Extradiol (meta-) cleavage of2,3-DHB has also been observed in a Pseudomonas putida strain(3). However, whether the observed subsequent decarboxylationof the ring cleavage product to yield 2-hydroxymuconic semialde-hyde was spontaneous or enzyme catalyzed has not yet been elu-cidated. Alternative pathways have been described in fungi, suchas Trichosporum cutaneum, where 2,3-DHB degradation is initi-ated by a decarboxylase (2), or in plants such as Tecoma stans,where degradation proceeds via intradiol cleavage (49). In thecurrent report, we elucidated the degradation of 2,3-DHB byPseudomonas reinekei MT1 and were able to identify a gene clusterinvolved in this metabolic route.

MATERIALS AND METHODSBacterial strains, plasmids, and growth conditions. The bacterial strainsand plasmids used in this study are listed in Table 1. P. reinekei strain MT1was grown in minimal medium as previously described (39), with 2 mM2,3-dihydroxybenzoate as the sole carbon source. Luria-Bertani (LB) me-

dium was used as rich medium for E. coli and P. reinekei strains. Forselection of mutants, ABC medium (AB medium [11] supplemented withtrace metals [17] and 20 mM citrate) was used. For E. coli, the followingantibiotics were used: ampicillin (Ap; 200 �g/ml), carbenicillin (Cb; 100�g/ml), gentamicin (Gm; 10 �g/ml), and tetracycline (Tc, 10 �g/ml). ForP. reinekei, the antibiotics used were Gm (200 �g/ml) and Tc (15 �g/ml).

Sequencing and sequence analysis. The dhb gene cluster was localizedby sequencing downstream of the previously described sal cluster of P.reinekei MT1, which is harbored on a fosmid from a previously con-structed fosmid library (9). Direct sequencing was performed using theABI Prism BigDye Terminator v1.1 ready reaction cycle sequencing kit(Applied Biosystems, Foster City, CA) and an ABI Prism 3100 GeneticAnalyzer (Applied Biosystems, Foster City, CA). Raw sequence data fromboth strands were assembled manually. DNA and protein similaritysearches were performed using BLASTX and BLASTP programs from theNCBI website (1). Translated protein sequences were aligned withMUSCLE using default values (19). Phylogenetic trees were constructed withMEGA5 (53) using the neighbor-joining algorithm (47) with p-distance cor-rection and pairwise deletion of gaps and missing data. A total of 100 boot-strap replications were performed to test for branch robustness.

Construction of a dhbA deletion mutant. A deletion mutant of thedhbA gene, encoding 2,3-dihydroxybenzoate 3,4-dioxygenase, was con-structed with the previously described Flp-Flp recombination target (Flp-FRT) recombination strategy (29). PCR fragments were amplified usingprimer pairs upstream (KOC23OAF and KOC23OAR; Table 2) anddownstream (KOC23OBF and KOC23OBR3; Table 2) of the targetedgene (�700 bp) carrying PstI-BamHI and BamHI-Acc65l restriction sites,

Received 19 March 2012 Accepted 9 May 2012

Published ahead of print 18 May 2012

Address correspondence to Dietmar H. Pieper, [email protected].

* Present address: Macarena Marín, Institute of Genetics, LMU-University ofMunich, Martinsried, Germany.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.00430-12

August 2012 Volume 194 Number 15 Journal of Bacteriology p. 3851–3860 jb.asm.org 3851

on June 5, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

http://dx.doi.org/10.1128/JB.00430-12

http://jb.asm.org

http://jb.asm.org/

respectively. Subsequently, they were cloned into the PstI-Acc65l restric-tion site of the pEX18Ap vector, forming plasmid pABdhbA (Table 1). A1.8-kb BamHI fragment from pS858 plasmid carrying a green fluorescentprotein-tagged Gmr (Gmr-GFP) cassette was cloned into the BamHI re-striction site formed, resulting in the pAGBdhbA suicidal plasmid (Table1). This suicide plasmid was transferred to P. reinekei MT1 by biparentalmating using E. coli S17�pir as a donor strain. The transconjugants gen-erated by single crossover were selected on ABC medium supplementedwith Gm, and merodiploids were resolved by additional plating on ABCmedium supplemented with 5% sucrose. Deletion of the Gmr-GFP cas-

sette was achieved by conjugation of the Flp-expressing pBBFLP plasmidinto the resulting strains by biparental mating using E. coli CC118�pir asthe donor and selection on ABC medium containing Tc. Plasmid pBBFLPwas cured by streaking strains on ABC medium supplemented with 5%sucrose. The integrity of the mutant was verified by growth on ABC me-dium supplemented with different antibiotics, PCR amplification, andsequencing of regions flanking the deleted gene.

Cloning of the dhbA gene and expression of the encoded protein. A995-bp region harboring the dhbA gene was PCR amplified using primerspGC23OR and pGC23OF (Table 2) and cloned in the pGEM-T Easy vec-

TABLE 1 Strains and plasmids used in this work

Bacterial strain orplasmid Relevant description

Source orreference

E. coliJM109 e14� (McrA�) recA1 endA1 gyrA96 thi-1 hsdR17(rK

� mK�) supE44 relA1 �(lac-proAB) [F= traD36 proAB

lacIqZ�M15]Stratagene

S17�pir Tpr Smr recA thi pro(rK� mK

�) RP4:2-Tc:MuKm Tn7 pir 15CC118�pir (ara-leu) araD lacX74 galE galK phoA20 thi-1 rpsE rpoB argE(Am) recA1 pir 27

P. reinekeiMT1 Wild type 10MT1�dhbA Deletion mutant with a 872-bp excision in gene dhbA This study

PlasmidspEX18Ap Apr; oriT� sacB�, gene replacement vector with multiple cloning site from pUC18 29pPS858 Apr, Gmr; blunt-ended pPS747 PstI-XbaI fragment ligated into the blunt-ended EcoRI site of pPS856;

carries a Gmr-GFP cassette29

pBBFLP Tcr; source of inducible FLP recombinase 14, 29pABdhbA Apr; pEX18Ap derivative with PCR-amplified regions flanking the dhbA gene (696 bp upstream and 660 bp

downstream) cloned in Acc65l/PstI restriction site.This study

pAGBdhbA Apr, Gmr; pABmmlC derivative with Gmr-GFP cassette cloned between PCR-amplified regions flankingthe dhbA gene

This study

pGEM-T Easy Apr; cloning vector PromegapC23Ohis218 pGEM-T Easy derivative containing the catechol 2,3-dioxygenase encoding gene from Pseudomonas veronii

1YdBTEX232

pGC23O Apr; pGEM-T Easy derivative with a 995-bp PCR-amplified region containing the dhbA gene cloned in theT overhangs

This study

TABLE 2 Primers used in this study

Primer Sequence Product size (bp) Target

KOC23OAF GGAGACTGCAGGCGCACTTGTACATGTT 718 dhbRKOC23OAR GAGAGGGATCCGCGGCCTCGAACGTTATKOC23OBF GGAGAGGATCCGTGACCGCCACGGC 682 dhbBKOC23OBR3 GAGAGGGTACCGGCAGTGAGGTAATCCCpGC23OR TCACGCCACTCACGAACGG 995 dhbApGC23OF TCAGATCGGTTTTCATGGGRT_rpsL_F ATGGCAACTATCAACCAGCTG 280 rpsLRT_rpsL_R ACCCGGAAGGTCTTTTACACRT_mmlL_F CCAGATGCAGTAACCGGAGT 400 mmlLRT_mmlL_R GGTCATCACCCACCTTCACTRT_dhbI_F AGGTGTTCGCCTATGACCAG 199 dhbIRT_dhbI_R CGTCACGACCATGAATCAACRT_orf4_F TCTATCGTCAACACGGCATC 205 orf4RT_orf4_R TTGGCAAAGTTGTCTTCCTGRT_dhbE_F TTGAGGTCGAAGCGAAAGTT 395 dhbERT_dhbE_R GTGGCCGTGACCAAAATAACRT_dhbH_F CGGAGTAAGTCGCTCGTTGT 392 dhbHRT_dhbH_R GCAGATCTATCAGCGTCGTGRT_dhbA_F CATGATGTCATCGACGGTTT 389 dhbART_dhbA_R CGCAGGTGCTCGAAGATAAT

Marín et al.

3852 jb.asm.org Journal of Bacteriology


.org/D

ownloaded from

http://jb.asm.org

http://jb.asm.org/

tor (Promega, Germany), generating plasmid pGC23O. The plasmid wasused to transform E. coli JM109, and positive clones were selected byresistance to ampicillin. A clone termed E. coli JM109(pGC23O) was se-lected, and the integrity of the insert was verified by sequencing. E. coliJM109(pGC23O) was grown at 37°C in LB medium containing 200 mgampicillin ml�1. For induction, isopropyl-�-D-thiogalactopyranoside(IPTG; 0.5 mM) was added when cultures reached an A600 of 0.6. Cellswere harvested after 2 h of incubation at 37°C, and the cell pellet wasresuspended in 50 mM phosphate buffer (pH 8.0).

Real-time PCR. P. reinekei MT1 was grown overnight in minimalmedium with 10 mM gluconate or 2 mM 2,3-DHB as a carbon source.During exponential growth (A600 of 0.8 in the case of growth with gluco-nate and 70% reduction of 2,3-DHB, as determined by high-performanceliquid chromatography [HPLC] analysis during growth on 2,3-DHB),three 2-ml aliquots were pelleted and supplemented with 1 ml ofRNAprotect (Qiagen). Total RNA was isolated using the RNeasy minikit(Qiagen) according to the manufacturer’s instructions. The resultingRNA was treated with the Turbo DNase kit (Ambion, Austin, TX) toremove any DNA contamination and was quantified using a Nanodrop2000c (Peqlab). cDNA was synthesized from 230 to 580 ng total RNAusing SuperScript III reverse transcriptase (Invitrogen) according to theprocedure from the manufacturer, followed by purification of cDNA us-ing a Qiaquick PCR purification kit (Qiagen).

Transcripts of dhbA, dhbE, dhbH, dhbI, mmlL, and orf4 were quanti-fied with the primer pairs given in Table 2, and the ribosomal rpsL genewas chosen as a housekeeping reference gene (9). Each reaction was per-formed in duplicate in a final volume of 20 �l containing 2.5 �l of eachprimer (10 pmol), 10 �l QuantiTect SYBR green PCR Master mix(Qiagen), and 5 �l of cDNA template (corresponding to 1 to 10 ng).Amplification was carried out in a LightCycler 480 real-time PCR systemprogrammed to hold at 95°C for 10 min and then to complete 50 cycles of94°C for 15 s, 57°C for 40 s, and 72°C for 40 s. The PCR results wereanalyzed by LightCycler 480 software (Roche Applied Science). Standardcurves were generated from serial dilutions of known concentrations of P.reinekei MT1 genomic DNA (containing between 2 and 2 � 106 copies ofthe target gene �l�1) by plotting threshold cycles (CT values) versus copynumber, assuming that 1 ng of DNA contains 9.8 � 105 copies of theentire P. reinekei MT1 genome (estimated as 6 Mbp based on reportedgenome sizes of sequenced Pseudomonas strains), where the target genesare assumed to be present as a single copy.

Enzymatic assays. Cell extracts of P. reinekei MT1 and of E. coliJM109(pGC23O) were prepared as previously described (39). Catalyticactivities were recorded at 25°C in 50 mM air-saturated phosphate buffer(pH 8.0) on a UV 2100 spectrophotometer (Shimadzu Corporation). 2,3-DHB 3,4-dioxygenase activity was followed by measuring the transforma-tion of catechol or 3-methylcatechol to 2-hydroxymuconic semialdehyde(HMS; ε375, 36,000 M�1 cm�1) or 2-hydroxy-6-oxo-2,4-heptadienoate(HOPDA; ε388, 13,800 M�1 cm�1), respectively. Extinction coefficients ofthe ring cleavage products of 2,3-DHB or 2,3-dihydroxy-p-cumate weredetermined as a ε343 of 31,600 M�1 cm�1 or ε347 of 7,400 M�1 cm�1,respectively, after incubation of 25 to 50 �M substrate with cell extractuntil complete turnover. Activities with protocatechuate and pyrogallolwere monitored by recording changes in UV-visible spectra (250 to 400nm) after the addition of cell extract for up to 30 min. Catalytic activitiesof 2-hydroxy-3-carboxymuconic semialdehyde (HCMS) decarboxylasewere recorded at 375 nm based on the difference in extinction at 375 nmof the substrate (ε375, 16,400 M�1 cm�1) and that of the HMS product.HMS hydrolase activity was measured by determining the NAD�-inde-pendent decrease in concentration of HOPDA at 388 nm. HMS dehydro-genase activity was measured by determining the NAD�-dependent de-crease in concentration of HMS at 375 nm. NAD� was added to a finalconcentration of 0.5 mM. Specific activities are expressed as units pergram of protein. Vmax and Km values were determined using 1 to 100 �M(2,3-DHB dioxygenase) or 0.2 to 10 �M substrate (2-hydroxy-3-carboxy-muconic semialdehyde decarboxylase and HMS dehydrogenase) in air-saturated buffer, and kinetic data were calculated from the initial veloci-ties using the Michaelis-Menten equation by nonlinear regression(KaleidaGraph; Synergy Software).

Analytical methods. Transformation of 2,3-DHB was monitored byHPLC analysis. Aliquots of 10 ml of cell-free supernatants were analyzedwith a Shimadzu HPLC system (LC-10AD liquid chromatograph, DGU-3A degasser, SPD-M10A diode array detector, and FCV-10AL solventmixer) equipped with a Lichrospher RP8 column (125 by 4.6 mm;Bischoff, Leonberg, Germany) using an aqueous solvent system (flow rate,1 ml min�1) containing 0.01% (vol/vol) H3PO4 (87%, wt/vol in H2O) and40% (vol/vol) methanol, and 2,3-DHB exhibited a retention volume of3.0 ml.

For 1H nuclear magnetic resonance (NMR) analysis, the 2,3-DHB ringcleavage product was prepared by quantitative transformation of 1 mM2,3-DHB in 50 mM phosphate buffer (pH 8.0) with cell extract of E. coli

FIG 1 Chimeric organization of the dhb gene cluster. Organization and comparison of the dhb gene cluster of P. reinekei MT1 to the cmt cluster of P. putida F1and the phenol catabolic gene cluster comprising meta-cleavage pathway genes of C. necator H16. Genes with high similarity to those of the dhb gene cluster areframed in boldface. HMS, 2-hydroxymuconic semialdehyde; HCOMODA, 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate.

Degradation of 2,3-Dihydroxybenzoate

August 2012 Volume 194 Number 15 jb.asm.org 3853


.org/D

ownloaded from

http://jb.asm.org

http://jb.asm.org/

JM109(pGC23O) preinduced for the induction of DhbA. After completesubstrate transformation, as evidenced by HPLC, 0.56 ml of the reactionmixture was supplemented with 0.14 ml of D2O. One-dimensional andtwo-dimensional correlation spectroscopy (COSY) 1H NMR spectra wererecorded at 300 K on an Avance DMX 600 NMR spectrometer (Bruker,Rheinstetten, Germany). The center of the suppressed water signal ( 4.80 ppm) was used as an internal reference.

Chemicals. 2,3-Dihydroxy-p-cumate was a kind gift from RichardEaton (18). 2-Hydroxy-3-carboxymuconic semialdehyde and 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate were prepared in situ by in-cubation of a solution containing 0.1 mM 2,3-dihydroxybenzoate or 2,3-dihydroxy-p-cumate in 50 mM phosphate buffer (pH 8.0) with cell extractof E. coli JM109(pGC23O) preinduced for the induction of DhbA,whereas HMS and HOPDA (0.1 mM) were prepared with cell extracts ofE. coli JM109(pC23Ohis218) expressing catechol 2,3-dioxygenase (32).

Nucleotide sequence accession number. The nucleotide sequence re-ported in this study has been deposited in the GenBank database underaccession number JN638999.

RESULTSIdentification and analysis ORFs involved in 2,3-dihydroxyben-zoate degradation in P. reinekei MT1. P. reinekei MT1 is able togrow on 2,3-DHB as the sole carbon source. Analysis of a 20.2-kbregion of the P. reinekei MT1 genome revealed the presence of 19hitherto-unknown open reading frames (ORFs). This region isframed by the previously described mmlI and sal gene clusters andis located upstream of a previously identified ORF encoding aputative HMS hydrolase (9, 38) (Fig. 1 and Table 3), now termeddhbI. Eight of the identified ORFs can be assumed to encode pro-teins homologous to those involved in the degradation of dihy-droxylated aromatics via meta-cleavage. The first ORF identifiedin this cluster, termed dhbR, is transcribed in the direction oppo-site that of the following structural genes and encodes a putativeLysR-type transcriptional regulator. The following gene, dhbA,encodes an extradiol dioxygenase belonging to the type I extradiol

TABLE 3 ORFs and genes of the dhb gene cluster of P. reinekei MT1 and surrounding regionsa

dhb gene cluster Related gene products

GeneGene productsize (aa) Putative function of gene product Name and size (aa) Organism

% aaidentity

Accession no.(reference)

dhbR 320 LysR-type transcriptional regulator CNE_BB1p12040 (301) C. necator N-1 55 YP_004688643NahR (300) P. fluorescens Cg5 33 AAM09546 (40)

dhbA 287 2,3-DHB 3,4-dioxygenase AXYL_02525 (313) A. xylosoxidans A8 71 YP_003978561PsbC2 (283) R. palustris no. 7 56 BAA82122 (42)

dhbB 233 2-Hydroxy-3-carboxy-muconicsemialdehyde decarboxylase

AXYL_02526 (236) A. xylosoxidans A8 65 YP_003978562

CmtD (243) P. putida F1 54 AAB62290 (18)dhbC 489 2-Hydroxymuconic semialdehyde

dehydrogenaseH16_B0547 (492) C. necator H16 80 YP_728709

NahI (486) P. stutzeri AN10 70 AAD02149 (6)dhbD 260 2-Oxopent-4-enoate hydratase H16_B0548 (260) C. necator H16 77 YP_728710

AphE (260) C. testosteroni TA441 68 BAA88502 (4)dhbE 266 4-Oxalocrotonate decarboxylase H16_B0549 (262) C. necator H16 82 YP_728711

XylI (264) P. putida mt2 63 AAA25693 (26)dhbF 63 4-Oxalocrotonate tautomerase CNE_BB1p11970 (63) C. necator N-1 75 YP_004688636

NahJ (63) P. stutzeri AN10 58 Q9ZI54 (6)dhbG 312 Acetaldehyde dehydrogenase MhpF1 (312) P. putida GJ31 78 Q49KG0 (34)

dhbH 345 4-Hydroxy-2-ketovalerate aldolase Avin_42120 (340) A. vinelandii DJ 88 YP_002801314XylK (345) P. putida mt2 86 P51019 (26)

orf1 130 Hypothetical protein SrosDRAFT_45540 (120) S. roseum DSM 43021 39 ZP_04473974orf2 302 LysR-type transcriptional regulator SalR1 (308) Pseudomonas reinekei

MT166 ABH07018 (9)

HybH (231) P. aeruginosa JB2 52 AAC69490 (28)orf3 312 LysR-type transcriptional regulator Mmc1_0773 (315) Magnetococcus sp. strain

MC-151 YP_864700

A1S_2405 (306) A. baumannii ATCC17978

36 ABO12824 (52)

orf4 253 Short chain dehydrogenase Arad_7279 (254) A. radiobacter K84 51 YP_002540411LinC (250) S. paucimobilis 49 AAZ14097 (35)

orf5 152 Hypothetical protein Arad_7278 (151) A. radiobacter K84 39 YP_002540410orf6 254 Short chain dehydrogenase Arad_7275 (256) A. radiobacter K84 57 YP_002540408orf7 563 Hypothetical protein CNE_BB2p00960 (549) C. necator N-1 61 YP_004682758orf8 458 Hypothetical protein CNE_BB2p00970 (460) C. necator N-1 65 YP_004682759orf9 366 Hypothetical protein PRK13684 (360) P. fluorescens 49 BAD11010orf10 831 RND family transporter CNE_BB2p00990 (813) C. necator N-1 68 YP_004682761dhbI 276 2-Hydroxymuconic semialdehyde

hydrolaseDaro_3786 (274) D. aromatica RCB 65 YP_286985

TadF (286) D. tsuruhatensis AD9 62 AAX47253 (36)a The gene product with the highest amino acid sequence identity and the most closely related gene product of validated function are given.

Marín et al.



.org/D

ownloaded from

http://www.ncbi.nlm.nih.gov/nuccore?term=JN638999

http://jb.asm.org

http://jb.asm.org/

dioxygenase family (DhbA). DhbA is homologous to PsbC2, the2,3-dihydroxy-p-cumate-3,4-dioxygenase from R. palustris (56%identity) (42), and is also related to other proteins previously iden-tified as 2,3-dihydroxy-p-cumate-3,4-dioxygenases (18) (Table 3and Fig. 2A). dhbB encodes a protein of the aldolase II superfamily(cl00214) homologous to CmtD proteins from Burkholderia xeno-vorans LB400 (YP_557489; 55% identity) and Pseudomonasputida F1 (AAB62290; 54% identity), which catalyze the decar-boxylation of the 2,3-dihydroxy-p-cumate ring cleavage product(2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate) to 2-hydroxy-6-oxo-7-methylocta-2,4-dienoate (18). DhbB is dis-tantly related to 3,4-dihydroxyphthalate 2-decarboxylases (18)(Table 3 and Fig. 2B). The putative functions and phylogeneticrelationship of DhbA and DhbB suggest that these enzymes areinvolved in the degradation of a carboxylated catechol, which issubject to ring cleavage followed by decarboxylation.

The following ORFs (dhbCDEFGH) encode enzymes homolo-

gous to those involved in catechol meta-cleavage pathwaysand evidently encode HMS dehydrogenase (DhbC), 2-oxopent-4-enoate hydratase (DhbD), 4-oxalocrotonate decarboxylase(DhbE), 4-oxalocrotonate tautomerase (DhbF), acetaldehyde de-hydrogenase (DhbG), and 4-hydroxy-2-ketovalerate aldolase(DhbH), respectively (Table 3 and Fig. 2C and D). Such enzymesare necessary to achieve degradation of catechols via the so-calleddehydrogenase branch of the meta-cleavage pathway, which chan-nels catechol via HMS, 2-hydroxymuconate, and 4-oxalocroto-nate to 2-oxopent-4-enoate (Fig. 3) (25).

This is in contrast to the organization of the gene clusters for2,3-dihydroxy-p-cumate degradation of P. putida F1 (18) and B.xenovorans LB400 (CP000270; Bxe_A3546 to Bxe_A3554), wheregenes encoding HMS dehydrogenase, 4-oxalocrotonate decar-boxylase, and 4-oxalocrotonate tautomerase were absent (Fig. 1).The alternative branch of catechol degradation involves an HMShydrolase (25). Degradation via this branch is necessary for the

FIG 2 Dendrograms showing the relatedness of Dhb enzymes. (A) Extradiol dioxygenases; (B) decarboxylases of the class II aldolase family acting in aromaticmetabolism; (C) 2-oxopent-4-enoate hydratase and 4-oxocrotonate decarboxylase; (D) acetaldehyde dehydrogenase; and (E) 2-hydroxymuconic semialdehydehydrolases. The evolutionary history was inferred using the neighbor-joining method and the p-distance model after alignment of sequences using MUSCLE(19). All positions containing alignment gaps and missing data were eliminated only in pairwise sequence comparisons. Phylogenetic analyses were conductedin MEGA5 (53).




.org/D

ownloaded from

http://jb.asm.org

http://jb.asm.org/

degradation of 3-alkyl-substituted catechols, where the ring cleav-age product is a ketone, which cannot be subjected to dehydroge-nation, as in 2,3-dihydroxy-p-cumate degradation (Fig. 3) (18).

A gene encoding a putative HMS hydrolase (DhbI) was local-ized 10.7 kb downstream of dhbH (Fig. 1). DhbI is clearly distinctfrom other hydrolases, such as CmtE, which is involved in thetransformation of 2-hydroxy-6-oxo-7-methylocta-2,4-dienoate(24 to 27% identity) (18), BphD, transforming 2-hydroxy-6-phe-nylhexa-2,4-dienoate (33), or MhpC, transforming 2-hydroxy-6-ketonona-2,4-dienedioic acid (up to 35% identity) (16). It is,however, related to HMS hydrolases of catechol meta-cleavagepathways, such as XylF of P. putida mt2 (�50% identity) (31)(Table 3 and Fig. 2D).

The 10 ORFs localized between dhbH and dhbI exhibited noevident function related to aromatic degradation. Interestingly,genes similar to orf4 to orf6 were observed in an identical arrange-ment in the genomes of Agrobacterium radiobacter K84(NC_011983; Arad_7275 to Arad_7279), while genes related toorf7 to orf10 are present in Methylibium petroliphilum PM1(YP_001020161; Mpe_A0964 to Mpe_A0967) and Leptothrixcholdni SP-6 (YP_001791193; Lcho_2162 to Lcho_2165). Never-theless, they are separated from the meta-pathway gene clustersharbored in these strains (Table 3 and Fig. 1).

The dhbA gene is essential for growth of P. reinekei MT1 on2,3-dihydroxybenzoate. Based on the putative function and thephylogeny of the enzymes encoded by the dhb cluster, as well as onthe gene cluster organization, it was deduced that this clustercould be involved in both 2,3-dihydroxy-p-cumate and 2,3-DHBdegradation. As P. reinekei MT1 is not capable of growing onp-cumate, the role of the dhb cluster in the degradation of 2,3-DHB was analyzed. Directed deletion of dhbA, the gene encodinga putative 2,3-DHB 3,4-dioxygenase, was performed. MT1�dhbAwas unable to grow on 2,3-DHB as the only carbon source, con-firming the crucial role of DhbA for degradation of this com-pound.

DhbA catalyzes ring cleavage of 2,3-dihydroxybenzoate. Thetransformation of 2,3-DHB by cell extracts of 2,3-DHB-degradingPseudomonas strains has previously been described to result in theformation of HMS by ring cleavage and subsequent decarboxyl-ation (3, 45). Transformation of 2,3-DHB by recombinant DhbAresulted in the formation of a product with an absorption maxi-mum (�max) of 343 nm (Fig. 4), which is clearly different from thatof HMS (�max of 375 nm) but similar to that of 2-hydroxy-3-

carboxy-6-oxo-7-methylocta-2,4-dienoate formed by extradiolring cleavage of 2,3-dihydroxy-p-cumate (�max of 346 nm) (18).This indicates that decarboxylation of the 2,3-DHB ring cleavageproduct does not occur spontaneously but most probably is cata-lyzed by DhbB.

To identify its structure, the reaction product formed by re-combinant DhbA was analyzed by 1H NMR analysis (Fig. 4). Onlytwo coupled olefinic protons ( of 6.69 and 7.52 ppm) were pres-ent in the product, excluding that a 1,2-dioxygenation with 2-hy-droxy-6-oxohepta-2,4-dienoate as the product had occurred. Thevicinal coupling of 14.5 Hz observed for the olefinic unit is char-acteristic of a trans configuration in an open-chain system (46).An aldehydic proton resonates at 9.03 ppm and shows a couplingof 8.9 Hz with the olefinic proton at 6.69 ppm. These characteris-tics are in accordance with the 2-hydroxy-3-carboxymuconatestructure and are proof that DhbA catalyzes a 3,4-dioxygenationand that a decarboxylation of the ring cleavage product does notoccur spontaneously.

FIG 3 Proposed pathway for 2,3-DHB degradation by P. reinekei MT1. A putative route for 2,3-dihydroxy-p-cumate metabolism is also shown. Enzymes usedinclude the following: DhbA, 2,3-DHB 3,4-dioxygenase; DhbB, 2-hydroxy-3-carboxymuconic semialdehyde decarboxylase; DhbC, 2-hydroxymuconic semial-dehyde dehydrogenase; DhbD, 2-oxopent-4-enoate hydratase; DhbE, 4-oxalocrotonate decarboxylase; DhbF, 4-oxalocrotonate isomerase; DhbG, acetaldehydedehydrogenase; DhbH, 4-hydroxy-2-oxovalerate aldolase; and DhbI, 2-hydroxymuconic semialdehyde hydrolase.

FIG 4 Conversion of 2,3-DHB by extracts of E. coli JM109(pGC23O) andstructure of the ring cleavage product as deduced by 1H NMR analysis. Thesample for photometric analysis contained 50 mM phosphate buffer (pH8.0) and 50 �M 2,3-DHB. Spectra were recorded before the addition of 15�l of cell extract for 20 min at 2-min intervals. 1H NMR analysis wasperformed after transformation of 1 mM 2,3-DHB in 50 mM phosphatebuffer (pH 8.0).

Marín et al.



.org/D

ownloaded from

http://jb.asm.org

http://jb.asm.org/

DhbA is specialized in 2,3-dihydroxybenzoate ring cleavage.The activity of recombinant DhbA was assessed against differentdihydroxylated aromatic compounds (Table 4). The highest levelof activity was observed with 2,3-DHB. 2,3-Dihydroxy-p-cumatewas also transformed at a rate of approximately 30% of that of2,3-DHB. Of the other substrates tested, only catechol was trans-formed. Analysis of kinetic parameters revealed a Km for 2,3-DHBof 2.9 �M, roughly half of that for 2,3-dihydroxy-p-cumate. Ac-cordingly, the comparison of specificity constants (Vmax/Km)showed 2,3-DHB to be the preferred substrate (Table 4).

Transformation of 2,3-DHB by cell extracts of 2,3-DHB-grown cells of P. reinekei MT1 showed transformation into a prod-uct with an �max of 375 nm without any indication of accumula-tion of 2-hydroxy-3-carboxymuconic semialdehyde (�max, 343nm; see above). In accordance, 2-hydroxy-3-carboxymuconicsemialdehyde was transformed rapidly by the extract with a Vmax

of 731 � 17 U/g protein into the product with an absorptionmaximum at 375 nm, indicating decarboxylation of the productto form HMS. Thus, the observed rate of formation of HMS from2,3-DHB of 37 U/g protein by cell extracts seems to be limited by2,3-DHB dioxygenase and indicate the activity of this protein inthe cell extract. Whereas the activity of HMS hydrolase was belowthe detection limit, HMS dehydrogenase was active in cell extracts(Table 5).

Real-time PCR analysis of MT1 transcripts. To confirm thatthe dhb genes are specifically transcribed during 2,3-DHB degra-dation, accumulation of transcripts of dhbA, dhbE, and dhbH ob-viously localized in the same catabolic gene cluster was measuredduring growth on 2,3-DHB as well as on gluconate as a noninduc-ing negative control. To analyze how far genes downstream of thedhb gene cluster were transcribed, orf4 and dhbI were also in-cluded in the analysis. mmlL, encoding 4-methyl-3-oxoadipateenol-lactone hydrolase, a key enzyme in the degradation ofmethylaromatics by P. reinekei MT1 (38), was used as a negativecontrol. Transcript levels during growth on gluconate were gen-erally low ( 100/ng of cDNA; Fig. 5) for all genes of the dhb genecluster, and only mmlL showed slightly higher transcript levels.Significantly elevated dhbA, dhbE, and dhbH transcript levels wereobserved in 2,3-DHB-grown cells. When the relative expressionlevels between the target and the reference gene (rpsL) were com-pared to those under noninducing conditions (at a ratio of 1),approximately 500- to 1,500-fold higher levels of transcripts wereobserved (Fig. 5). In contrast, expression levels of orf4 and dhbIwere increased only approximately 15-fold, whereas mmlL wasnot induced (Fig. 5).

DISCUSSION

Throughout this study, we have been able to demonstrate that P.reinekei MT1 is able to degrade 2,3-DHB using a meta-cleavagepathway encoded by the dhb cluster. DhbA catalyzes the ringcleavage of 2,3-DHB and is a type I extradiol dioxygenase of thevicinal oxygen chelate family (21). This family is composed ofenzymes which are well known for being involved in the degrada-tion of catechol or alkyl-substituted catechols and of bicyclic di-hydroxylated aromatics like 2,3-dihydroxybiphenyl (25). En-zymes acting on carboxylated catechols, such as CmtC of P. putidaF1 (18) or DhbA described here, evidently form novel branches inthe phylogeny of type I extradiol dioxygenases (20). Whether en-zymes of this branch are generally of broad substrate specificityand accept differently substituted 3-carboxycatechols as sub-strates, as indicated for an enzyme of p-cymene-grown P. putidaPL-W and as shown here for DhbA, remains to be elucidated (13).The channeling of the ring cleavage products of 2,3-DHB and2,3-dihydroxy-p-cumate into well-documented meta-cleavagepathways is catalyzed by decarboxylases of the class II aldolasefamily, forming HMS or 2-hydroxy-6-oxo-7-methylocta-2,4-di-enoate, respectively. The exploration of currently published ge-nomes revealed that at least A. radiobacter K84, Ralstonia so-lanacearum GMI1000, Achromobacter xylosoxidans A8, andCupriavidus necator N-1 also harbor both genes (Fig. 2) and mayalso be capable of degrading carboxy-substituted catechols.

After extradiol cleavage, the ring cleavage products are typi-cally processed by one of two distinct meta-cleavage pathwaybranches. If the ring cleavage product is an aldehyde (HMS in thecase of 2,3-DHB), the pathway proceeds via the dehydrogenasebranch via dehydrogenation, isomerization, and decarboxylation(Fig. 3), leading to the formation of 2-oxopenta-4-enoate as thecentral intermediate. In contrast, if the ring cleavage product is aketone (2-hydroxy-6-oxo-7-methylocta-2,4-dienoate in case of2,3-dihydroxy-p-cumate metabolism), the pathway proceeds viathe hydrolytic branch, where the ketone is hydrolyzed to give2-oxopenta-4-enoate and an acid. Further transformation of2-oxopenta-4-enoate, the common intermediate of the hydrolyticand dehydrogenase branches, proceeds by a 2-oxopent-4-enoatehydratase, leading to the formation of 4-hydroxy-2-oxovalerate,which is subsequently converted into pyruvate and acetaldehydeby a 4-hydroxy-2-oxovalerate aldolase (51). Finally, these prod-ucts can enter the citrate cycle (Fig. 3).

Various meta-cleavage pathway gene clusters have been de-scribed in the literature. The most extensively studied meta-cleav-age pathway is the one located on the TOL plasmid pWW0 (8, 23),which harbors genes encoding a ferredoxin (xylT), a catechol 2,3-dioxygenase (C23O) (xylE), and both the hydrolytic (xylF) and the

TABLE 4 Substrate specificity of DhbA

SubstrateSp acta

(U/g protein) Km (�M)Vmax

(U/g protein)Vmax/Km

(relative)

2,3-DHB 93.8 2.9 � 0.2 96.3 � 2.0 12,3-DH-p-cumate 32.7 5.9 � 0.7 32.7 � 1.0 0.167Catechol 6.8 NDb ND ND3-Methylcatechol 1 ND ND NDProtocatechuate 1 ND ND NDPyrogallol 1 ND ND NDa The specific activity was determined at a concentration of 100 �M substrate inphosphate buffer (50 mM, pH 8).b ND, not determined.

TABLE 5 Enzyme activities in cell extracts of P. reinekei MT1 grown on2,3-DHB

Enzyme SubstrateSp acta

(U/g protein) Km (�M)Vmax

(U/g protein)

2,3-DHB dioxygenase 2,3-DHB 37 NDb NDHCMS decarboxylase HCMS 640 0.74 � 0.05 731 � 17HMS dehydrogenase HMS 141 1.2 � 0.2 170 � 7HMS hydrolase HOPDA 5 ND NDa The specific activity was determined in phosphate buffer (50 mM, pH 8) at aconcentration of 100 �M 2,3-DHB and 5 �M HCMS or HMS.b ND, not determined.




.org/D

ownloaded from

http://jb.asm.org

http://jb.asm.org/

dehydrogenase (xylG, xylH, and xylI) branch of the meta-cleavagepathway (22, 50). Although a similar structure is maintained invarious catechol meta-cleavage pathway gene clusters, several oth-ers, such as those involved in the degradation of biphenyl, whichrequire the hydrolytic branch, are devoid of genes encoding thedehydrogenase branch (30). Similarly, the 2,3-dihydroxy-p-cum-ate degradation gene clusters of both P. putida F1 and B. xeno-vorans LB400 are devoid of genes encoding enzymes of this branchand thus are not appropriate to ensure 2,3-DHB degradation(CP000270; Bxe_A3546 to Bxe_A3554) (18). The fact that, likeCmtC-like extradiol dioxygenases (Fig. 2A), CmtE-like hydrolasesconstitute a separate branch in their phylogeny (Fig. 3E) indicatescoevolution of genes of the cmt gene clusters for the degradation ofp-cumate.

In contrast, the dhb cluster described here more likely repre-sents a chimeric gene cluster composed of genes encoding en-zymes specialized for channeling 2,3-DHB into the meta-cleavageroute clustered with genes closely resembling those of archetype

meta-cleavage pathway gene clusters. While DhbC, DhbD, andDhbE are most closely related to proteins encoded by meta-cleav-age pathway clusters involved in phenol degradation by Burkhold-eriales bacteria, specifically C. necator H16 (h16_B0546 toh16_B0552), Verminephrobacter eiseniae EF01-2 (Veis_2781 toVeis_2787), Leptothrix cholodnii SP-6 (Lcho_3340 to Lcho_3356),or Methylibium petrophilum PM1 (Mpe_A2266 to Mpe_A2277)(Fig. 2C), DhbG and DhbH are more closely related to enzymesencoded by 2,3-dihydroxyphenylpropionate catabolic gene clus-ters (Fig. 2D), possibly indicating different origins of these genesas well.

Investigation of bacterial genomes showed that catabolic geneclusters of a structure identical to that of the dhb gene clusterstructure are present in R. solanacearum GMI1000 (RSp0888 toRSp0895), C. necator N-1 (CNE_BB1p13310 to CNE_BB1p13240and CNE_p112030 to CNE_p12140), and A. radiobacter K84(Arad_7255 to Arad_7275). As in P. reinekei MT1, both of thesegene clusters are devoid of a gene encoding an HMS hydrolase.

FIG 5 Absolute (top) and relative (bottom) expression levels of catabolic genes in 2,3-DHB-grown cells of P. reinekei MT1 as determined by quantitativereal-time PCR. The number of transcripts/ng of cDNA in gluconate (light gray bars) and 2,3-DHB-grown cells (dark gray bars) is shown (top). The error barsindicate standard deviations. Relative expression values (bottom) represent n-fold changes in the ratio of gene expression between the target gene and thereference gene (rpsL) compared to expression under noninducing conditions (for rpsL, this ratio was set as 1).

Marín et al.



.org/D

ownloaded from

http://jb.asm.org

http://jb.asm.org/

Similar gene clusters are also present in the genomes of Achromo-bacter xylosooxidans A8 and Agrobacterium radiobacter K84. It canthus be speculated that these strains have the capability of miner-alizing 2,3-DHB and that the dhb-type gene cluster is highly ap-propriate for 2,3-DHB mineralization and, thus, is wide spreadamong bacteria.

Although a gene encoding an HMS hydrolase is not present in theP. reinekei MT1 dhb gene cluster, such a gene, termed dhbI, was lo-cated in its proximity, and expression was observed during growth on2,3-DHB. Whether dhbI encodes a functional hydrolase which servesto extend the range of substrates that can be used by P. reinekei MT1,from which it may have been recruited, and whether orf4 throughorf10 form a transcriptional unit together with dhbI are under inves-tigation. The observed gene organization of P. reinekei MT1 thus maystill be in evolution to ensure the degradation of various environmen-tally relevant carboxylated aromatics.

ACKNOWLEDGMENTS

We thank R. Eaton for kindly supplying 2,3-dihydroxy-p-cumate, V. Wrayfor support in the interpretation of 1H NMR spectra, C. Kakoschke and B.Jaschok-Kentner for meticulous technical assistance, and R. Vilchez-Vargasand M. Wos-Oxley for support with real-time PCR experiments.

This work was supported by the DFG-European Graduate College 653.

REFERENCES1. Altschul SF, et al. 1997. Gapped BLAST and PSI-BLAST: a new genera-

tion of protein database search programs. Nucleic Acids Res. 25:3389 –3402.

2. Anderson JJ, Dagley S. 1981. Catabolism of tryptophan, anthranilate, and2,3-dihydroxybenzoate in Trichosporon cutaneum. J. Bacteriol. 146:291–297.

3. Andreoni V, Canonica L, Galli E, Gennari C, Treccani V. 1981. 2,3-Dihydroxybenzoate pathway in Pseudomonas putida. 1H n.m.r. study onthe ring-cleavage site. Biochem. J. 194:607– 610.

4. Arai H, Ohishi T, Chang MY, Kudo T. 2000. Arrangement and regula-tion of the genes for meta-pathway enzymes required for degradation ofphenol in Comamonas testosteroni TA441. Microbiology 146:1707–1715.

5. Bartsch M, et al. 2010. Accumulation of isochorismate-derived 2,3-dihydroxybenzoic 3-O-�-D-xyloside in Arabidopsis resistance to patho-gens and ageing of leaves. J. Biol. Chem. 285:25654 –25665.

6. Bosch R, Garcia-Valdes E, Moore ER. 2000. Complete nucleotide se-quence and evolutionary significance of a chromosomally encoded naph-thalene-degradation lower pathway from Pseudomonas stutzeri AN10.Gene 245:65–74.

7. Reference deleted.8. Burlage RS, Hooper SW, Sayler GS. 1989. The TOL (pWW0) catabolic

plasmid. Appl. Environ. Microbiol. 55:1323–1328.9. Camara B, et al. 2007. A gene cluster involved in degradation of substi-

tuted salicylates via ortho cleavage in Pseudomonas sp. strain MT1 encodesenzymes specifically adapted for transformation of 4-methylcatechol and3-methylmuconate. J. Bacteriol. 189:1664 –1674.

10. Camara B, et al. 2007. Pseudomonas reinekei sp. nov., Pseudomonasmoorei sp. nov. and Pseudomonas mohnii sp. nov., novel species capable ofdegrading chlorosalicylates or isopimaric acid. Int. J. Syst. Evol. Microbiol.57:923–931.

11. Clark J, Maaloe O. 1967. DNA replication and the division cycle inEscherichia coli. J. Mol. Biol. 23:99 –112.

12. Crosa JH, Walsh CT. 2002. Genetics and assembly line enzymology of sid-erophore biosynthesis in bacteria. Microbiol. Mol. Biol. Rev. 66:223–249.

13. DeFrank JJ, Ribbons DW. 1977. p-Cymene pathway in Pseudomonasputida: ring cleavage of 2,3-dihydroxy-p-cumate and subsequent reac-tions. J. Bacteriol. 129:1365–1374.

14. de las Heras A, Carreno CA, de Lorenzo V. 2008. Stable implantation oforthogonal sensor circuits in Gram-negative bacteria for environmentalrelease. Environ. Microbiol. 10:3305–3316.

15. de Lorenzo V, Timmis KN. 1994. Analysis and construction of stablephenotypes in gram-negative bacteria with Tn5- and Tn10-derived mini-transposons. Methods Enzymol. 235:386 – 405.

16. Diaz E, Ferrandez A, Prieto MA, Garcia JL. 2001. Biodegradation ofaromatic compounds by Escherichia coli. Microbiol. Mol. Biol. Rev. 65:523–569.

17. Dorn E, Hellwig M, Reineke W, Knackmuss H-J. 1974. Isolation andcharacterization of a 3-chlorobenzoate degrading pseudomonad. Arch.Microbiol. 99:61–70.

18. Eaton RW. 1996. p-Cumate catabolic pathway in Pseudomonas putida F1:cloning and characterization of DNA carrying the cmt operon. J. Bacteriol.178:1351–1362.

19. Edgar RC. 2004. MUSCLE: a multiple sequence alignment method withreduced time and space complexity. BMC Bioinformatics 5:113.

20. Eltis LD, Bolin JT. 1996. Evolutionary relationships among extradioldioxygenases. J. Bacteriol. 178:5930 –5937.

21. Gerlt JA, Babbitt PC. 2001. Divergent evolution of enzymatic function:mechanistically diverse superfamilies and functionally distinct suprafami-lies. Annu. Rev. Biochem. 70:209 –246.

22. Ghosal D, You IS, Gunsalus IC. 1987. Nucleotide sequence and expres-sion of gene nahH of plasmid NAH7 and homology with gene xylE of TOLpWWO. Gene 55:19 –28.

23. Greated A, Lambertsen L, Williams PA, Thomas CM. 2002. Completesequence of the IncP-9 TOL plasmid pWW0 from Pseudomonas putida.Environ. Microbiol. 4:856 – 871.

24. Reference deleted.25. Harayama S, Mermod N, Rekik M, Lehrbach PR, Timmis KN. 1987.

Roles of the divergent branches of the meta-cleavage pathway in the deg-radation of benzoate and substituted benzoates. J. Bacteriol. 169:558 –564.

26. Harayama S, Rekik M. 1993. Comparison of the nucleotide sequences ofthe meta-cleavage pathway genes of TOL plasmid pWW0 from Pseudomo-nas putida with other meta-cleavage genes suggests that both single andmultiple nucleotide substitutions contribute to enzyme evolution. Mol.Gen. Genet. 239:81– 89.

27. Herrero M, de Lorenzo V, Timmis KN. 1990. Transposon vectors con-taining non-antibiotic resistance selection markers for cloning and stablechromosomal insertion of foreign genes in gram-negative bacteria. J. Bac-teriol. 172:6557– 6567.

28. Hickey WJ, Sabat G, Yuroff AS, Arment AR, Perez-Lesher J. 2001.Cloning, nucleotide sequencing, and functional analysis of a novel, mobilecluster of biodegradation genes from Pseudomonas aeruginosa strain JB2.Appl. Environ. Microbiol. 67:4603– 4609.

29. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. 1998.A broad-host-range Flp-FRT recombination system for site-specific exci-sion of chromosomally-located DNA sequences: application for isolationof unmarked Pseudomonas aeruginosa mutants. Gene 212:77– 86.

30. Hofer B, Backhaus S, Timmis KN. 1994. The biphenyl/poychlorinatedbiphenyl-degradation locus (bph) of Pseudomonas sp. LB400 encodes fouradditional metabolic enzymes. Gene 144:9 –16.

31. Horn JM, Harayama S, Timmis KN. 1991. DNA sequence determinationof the TOL plasmid (pWWO) xylGFJ genes of Pseudomonas putida: im-plications for the evolution of aromatic catabolism. Mol. Microbiol.5:2459 –2474.

32. Junca H, Plumeier I, Hecht HJ, Pieper DH. 2004. Difference in kineticbehaviour of catechol 2,3-dioxygenase variants from a polluted environ-ment. Microbiology 150:4181– 4187.

33. Kimbara K, et al. 1989. Cloning and sequencing of two tandem genesinvolved in degradation of 2,3-dihydroxybiphenyl to benzoic acid in thepolychlorinated biphenyl-degrading soil bacterium Pseudomonas sp.strain KKS102. J. Bacteriol. 171:2740 –2747.

34. Kunze M, et al. 2009. Degradation of chloroaromatics by Pseudomonasputida GJ31: assembled route for chlorobenzene degradation encoded byclusters on plasmid pKW1 and the chromosome. Microbiology 155:4069 – 4083.

35. Lal R, Dogra C, Malhotra S, Sharma P, Pal R. 2006. Diversity, distribu-tion and divergence of lin genes in hexachlorocyclohexane-degrading sph-ingomonads. Trends Biotechnol. 24:121–130.

36. Liang Q, et al. 2005. Chromosome-encoded gene cluster for the meta-bolic pathway that converts aniline to TCA-cycle intermediates in Delftiatsuruhatensis AD9. Microbiology 151:3435–3446.

37. Reference deleted.38. Marín M, et al. 2010. Modified 3-oxoadipate pathway for the biodegra-

dation of methylaromatics in Pseudomonas reinekei MT1. J. Bacteriol. 192:1543–1552.




.org/D

ownloaded from

http://jb.asm.org

http://jb.asm.org/

39. Nikodem P, Hecht V, Schlomann M, Pieper DH. 2003. New bacterialpathway for 4- and 5-chlorosalicylate degradation via 4-chlorocatechol andmaleylacetate in Pseudomonas sp. strain MT1. J. Bacteriol. 185:6790–6800.

40. Park W, Padmanabhan P, Padmanabhan S, Zylstra GJ, Madsen EL.2002. nahR, encoding a LysR-type transcriptional regulator, is highly con-served among naphthalene-degrading bacteria isolated from a coal tarwaste-contaminated site and in extracted community DNA. Microbiology148:2319 –2329.

41. Reference deleted.42. Puskas LG, Inui M, Kele Z, Yukawa H. 2000. Cloning of genes partici-

pating in aerobic biodegradation of p-cumate from Rhodopseudomonaspalustris. DNA Seq. 11:9 –20.

43. Raymond KN, Dertz EA, Kim SS. 2003. Enterobactin: an archetype formicrobial iron transport. Proc. Natl. Acad. Sci. USA 100:3584 –3588.

44. Ribbons DW. 1966. Bacterial oxydation of 2,3-dihydroxybenzoic acid-anew oxygenase. Biochem. J. 99:30P–31P.

45. Ribbons DW, Senior PJ. 1970. 2,3-Dihydroxybenzoate 3,4-oxygenasefrom Pseudomonas fluorescens: determination of the site of ring cleavagewith a substrate analogue. Biochem. J. 117:28P–29P.

46. Riegert U, Heiss G, Fischer P, Stolz A. 1998. Distal cleavage of 3-chlo-

rocatechol by an extradiol dioxygenase to 3-chloro-2-hydroxymuconicsemialdehyde. J. Bacteriol. 180:2849 –2853.

47. Saitou N, Nei M. 1987. The neighbor-joining method: a new method forreconstructing phylogenetic trees. Mol. Biol. Evol. 4:406 – 425.

48. Reference deleted.49. Sharma HK, Vaidyanathan CS. 1975. A new mode of ring cleavage of

2,3-dihydroxybenzoic acid in Tecoma stans (L.). Partial purification andproperties of 2,3-dihydroxybenzoate 2,3-oxygenase. Eur. J. Biochem. 56:163–171.

50. Shingler V, Franklin FC, Tsuda M, Holroyd D, Bagdasarian M. 1989.Molecular analysis of a plasmid-encoded phenol hydroxylase from Pseu-domonas CF600. J. Gen. Microbiol. 135:1083–1092.

51. Shingler V, Powlowski J, Marklund U. 1992. Nucleotide sequence andfunctional analysis of the complete phenol/3,4-dimethylphenol catabolicpathway of Pseudomonas sp. strain CF600. J. Bacteriol. 174:711–724.

52. Smith MG, et al. 2007. New insights into Acinetobacter baumannii patho-genesis revealed by high-density pyrosequencing and transposon mu-tagenesis. Genes Dev. 21:601– 614.

53. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: molecular evo-lutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol.24:1596 –1599.

Marín et al.



.org/D

ownloaded from

http://jb.asm.org

http://jb.asm.org/

degradation of 2,3-dihydroxybenzoate by a novel …jb.asm.org/content/194/15/3851.full.pdf ·...

Documents