decision support systems for e-commerce

31
Decision Decision support systems support systems for E-commerce for E-commerce

Upload: kareem-carter

Post on 30-Dec-2015

43 views

Category:

Documents


1 download

DESCRIPTION

Decision support systems for E-commerce. Working Definition of DSS. A DSS is an integrated, interactive computer system, consisting of analytical tools and information management capabilities, designed to aid decision makers in solving relatively large, unstructured problems - PowerPoint PPT Presentation

TRANSCRIPT

Decision support Decision support systems for E-systems for E-

commercecommerce

Working Definition of DSSWorking Definition of DSS

A DSS is an integrated, interactive computer system, A DSS is an integrated, interactive computer system, consisting of analytical tools and information management consisting of analytical tools and information management capabilities, designed to aid decision makers in solving capabilities, designed to aid decision makers in solving relatively large, unstructured problemsrelatively large, unstructured problems

Decision Making samplesDecision Making samples

what were the sales volumes by region and product what were the sales volumes by region and product category for the last year?category for the last year?

How did the share price of computer manufacturers correlate How did the share price of computer manufacturers correlate with quarterly profits over the past 10 years?with quarterly profits over the past 10 years?

Central Issue in DSSCentral Issue in DSSsupport and improvement of decision makingsupport and improvement of decision making

Management Decision MakingManagement Decision MakingStrategicStrategic CEO, board of directors, top executivesCEO, board of directors, top executives Develop overall strategies of organizationDevelop overall strategies of organization

TacticalTactical Regional managers, plant managers, division Regional managers, plant managers, division

supervisorssupervisors Carry out strategic managers plansCarry out strategic managers plans

OperationalOperational Direct managers, team leadersDirect managers, team leaders Carry out tactical managers plansCarry out tactical managers plans

Different Technologies are invented to Different Technologies are invented to meet different Decision Making Goals!meet different Decision Making Goals!

The Big Picture: DBs, Data Warehouse, The Big Picture: DBs, Data Warehouse, & OLAP, Data Mining & OLAP, Data Mining

DataWarehouse

ExtractTransformLoadRefresh

OLAP Engine

AnalysisQueryReportsData miningServe

Operational DBs

other sources

Data Storage

OLAP Server

Front-End Tools

Evolutionary StepEvolutionary Step TechnologiesTechnologies ProvidersProviders

Data CollectionData Collection

(1960s)(1960s)

Computers, tapes, Computers, tapes, disksdisks

IBM, CDCIBM, CDC

Data AccessData Access

(1980s)(1980s)

Relational Relational databases, SQL, databases, SQL, ODBCODBC

Oracle, Sybase, Oracle, Sybase, Informix, IBM, Informix, IBM, MicrosoftMicrosoft

Data Warehousing Data Warehousing & Decision Support & Decision Support systemssystems

(1990s)(1990s)

On-line analytic On-line analytic Processing (OLAP), Processing (OLAP), Multidimensional Multidimensional databases (Cubes)databases (Cubes)

Cognos, Arbor, Cognos, Arbor, Pilot, Microstrategy, Pilot, Microstrategy, ORACLE, IBMORACLE, IBM

Data MiningData Mining

(Present)(Present)

Statistics, Machine Statistics, Machine Learning, AILearning, AI

SAS, SPSS, IBM, SAS, SPSS, IBM, ORACLE, Cognos, ORACLE, Cognos, MicrosoftMicrosoft

Why Build a Data Warehouse?Why Build a Data Warehouse?

Separate transactional and analysis systems :Separate transactional and analysis systems :

to make to make Tactical Tactical or evenor even Strategic decisions Strategic decisions for for Regional managers or CEOsRegional managers or CEOs

Easy formulation of complex queriesEasy formulation of complex queries Access to historical data (not in operational Access to historical data (not in operational

systems)systems) Improved data quality (fewer errors and missing Improved data quality (fewer errors and missing

values)values) Access to data from multiple sources, have a Access to data from multiple sources, have a

comprehensive data collectioncomprehensive data collection

Potential Applications of Data Potential Applications of Data Warehousing and Mining in ECWarehousing and Mining in EC

Analysis of user access patterns and buying patternsAnalysis of user access patterns and buying patternsCustomer segmentation and target marketingCustomer segmentation and target marketingCross selling and improved Web advertisementCross selling and improved Web advertisementPersonalizationPersonalizationAssociation (link) analysisAssociation (link) analysisCustomer classification and predictionCustomer classification and prediction

Time-series analysisTime-series analysis Typical event sequence and user behavior pattern Typical event sequence and user behavior pattern analysisanalysisTransition and trend analysisTransition and trend analysis

Data WarehousingData WarehousingThe phrase data warehouse was coined by The phrase data warehouse was coined by William Inmon in 1990William Inmon in 1990Data Warehouse is a decision support Data Warehouse is a decision support database that is maintained separately from database that is maintained separately from the organization’s operational databasethe organization’s operational databaseDefinition: A DW is a repository of integrated Definition: A DW is a repository of integrated information from distributed, autonomous, and information from distributed, autonomous, and possibly heterogeneous information sources possibly heterogeneous information sources for query, analysis, decision support, and data for query, analysis, decision support, and data mining purposesmining purposes

Characteristics (cont’d)Characteristics (cont’d)

IntegratedIntegrated No consistency in encoding, naming conventions, No consistency in encoding, naming conventions,

… among different application-oriented data from … among different application-oriented data from different legacy systems, different heterogeneous different legacy systems, different heterogeneous data sourcesdata sources

When data is moved to the warehouse, it is When data is moved to the warehouse, it is consolidated converted, and encodedconsolidated converted, and encoded

Characteristics (cont’d)Characteristics (cont’d)

Non-volatileNon-volatile New data is always appended to the New data is always appended to the

database, rather than replaceddatabase, rather than replaced The database continually absorbs new data, The database continually absorbs new data,

integrating it with the previous dataintegrating it with the previous data In contrast, operational data is regularly In contrast, operational data is regularly

accessed and manipulated a record at a time accessed and manipulated a record at a time and update is done to data in the operational and update is done to data in the operational environmentenvironment

Characteristics (cont’d)Characteristics (cont’d)Time-variantTime-variant

Operational database contain current value data. Operational database contain current value data. Operational data is valid only at the moment of access-Operational data is valid only at the moment of access-

capturing a moment in time. capturing a moment in time.

The time horizon for the data warehouse is significantly The time horizon for the data warehouse is significantly longer than that of operational systems.longer than that of operational systems.

Data warehouse data is nothing more than a sophisticated Data warehouse data is nothing more than a sophisticated series of snapshots, taken as of some moment in time.series of snapshots, taken as of some moment in time.

System ArchitectureSystem Architecture

Detector Detector Detector Detector

End UserEnd User

LegacyLegacy Flat-fileFlat-file RDBMSRDBMS OODBMSOODBMS. . .. . .

Analysis, Query Reports,Analysis, Query Reports,Data MiningData Mining

Data Warehouse Back-End Tools and UtilitiesData Warehouse Back-End Tools and Utilities

Data extraction:Data extraction: Extract data from multiple, heterogeneous, and external Extract data from multiple, heterogeneous, and external

sourcessources

Data cleaning (scrubbing):Data cleaning (scrubbing): Detect errors in the data and rectify them when possibleDetect errors in the data and rectify them when possible

Data converting:Data converting: Convert data from legacy or host format to warehouse Convert data from legacy or host format to warehouse

formatformat

Transforming:Transforming: Sort, summarize, compute views, check integrity, and Sort, summarize, compute views, check integrity, and

build indicesbuild indices

Refresh:Refresh: Propagate the updates from the data sources to the Propagate the updates from the data sources to the

warehousewarehouse

On-Line Analytical Processing (OLAP)On-Line Analytical Processing (OLAP)

Front-end to the data warehouse. Allowing Front-end to the data warehouse. Allowing easy data manipulation easy data manipulation

Allows conducting inquiries over the data at Allows conducting inquiries over the data at various levels of abstractionsvarious levels of abstractions

FastFast and and easyeasy because some aggregations because some aggregations

are computed in advance are computed in advance No need to formulate entire queryNo need to formulate entire query

OLAP: Data CubeOLAP: Data CubeOLAP uses data in multidimensional format (e.g., data cubes) OLAP uses data in multidimensional format (e.g., data cubes)

to facilitate query and response time.to facilitate query and response time.

Date

Product

Countrysum

sum TV

VCRPC

1Qtr 2Qtr 3Qtr 4Qtr

U.S.A

Canada

Mexico

sum

Overall sales of TV’s in the USin 3rd quarter

OLAP: Data Cube OperationsOLAP: Data Cube Operations

SlicingSlicing: : Selecting the dimensions of the cube to be viewed. Selecting the dimensions of the cube to be viewed.

Example: View “Sales volume” as a function of “Example: View “Sales volume” as a function of “Product ”Product ” by by ““CountryCountry “by “ “by “Quarter”Quarter”

DicingDicing: : Specifying the values along one or more Specifying the values along one or more

dimensions.dimensions. Example: View “Example: View “Sales volume” for “Product=PC” by Sales volume” for “Product=PC” by

““CountryCountry “by “Q “by “Quarter”uarter”

OLAP: Data Cube OperationsOLAP: Data Cube Operations

Drilling downDrilling down: : from higher level from higher level aggregation to lower level aggregation or aggregation to lower level aggregation or detailed data (Viewing by detailed data (Viewing by “state” after “state” after viewing by “region” )viewing by “region” )

Rolling-upRolling-up: Summarize data by climbing : Summarize data by climbing up hierarchy or by dimension reduction up hierarchy or by dimension reduction (E.g., viewing by “region” instead of by (E.g., viewing by “region” instead of by “state”)“state”)

Cube Operations IllustratedCube Operations Illustrated

Rolling up

Drilling down

Actual ApplicationActual Application

Com.1

Query:Query: ““overall & detail production performance”overall & detail production performance”

• manufacturer: Com1manufacturer: Com1

• products: all productsproducts: all products

• date interval: 01-Jan-94 until 01-Jan-1999date interval: 01-Jan-94 until 01-Jan-1999

• source: USDAsource: USDA

Com.1

Com.1

Com.1

Lot#1

Lot#2

Lot#3

Contract Number 1

Contract Number 2

Contract Number 3

Data MiningData Mining

“Data Mining is the exploration and analysis

by automatic or semi-automatic means,

of large or small quantities of data

in order to discover meaningful patterns, trends and rules.”

Data Mining

Data Analysis Database

Statistics AI & ML Data Warehouse OLAP

Data AnalysisData Analysis

Classification

Regression

Clustering

Association

Sequence Analysis

Data Analysis (cont.)Data Analysis (cont.)

fX1

X2

X3

Y2

Input Variablesor

Independent Variablesor

Attributes or Descriptors

Output Variablesor

Dependent Variablesor

Classes or Targets

Y1

Y3

Numeric

Categorical

Crisp

Numeric

Categorical

Crisp

Regression

Classification

3, 4.5, 102, …

hot, cold, high, low, …

0, 1, yes, no, …

Modeling

Linear Modelsor

Non-linear Modelsor

A set of rules

Data Analysis (cont.)Data Analysis (cont.)

Age

Income

Clustering

1, chips, coke, chocolate2, gum, chips3, chips, coke4, …

Probability (chips, coke) ?Probability (chips, gum) ?

Association

Sequence Analysis

…ATCTTTAAGGGACTAAAATGCCATAAAAATCCATGGGAGAGACCCAAAAAA…

Xt-1 XtT

Data Analysis (cont.)Data Analysis (cont.)

Linear Discriminant Analysis Naïve Bayes / Bayesian Network OneR Neural Networks Decision Tree (ID3, C4.5, …) K-Nearest Neighbors (IB) Support Vector Machines (SVM) …

K-Mean Clustering Self Organizing Map Bayesian Clustering COBWEB…

Multiple Linear Regression Principal Components Regression Partial Least Square Neural Networks Regression Tree (CART, MARS, …) K-Nearest Neighbors (LWR) Support Vector Machines (SVR) …

A Priori Markov Chain Hidden Markov Models …

Classification Regression

Clustering Association & Sequence Analysis

ChallengesChallenges

Faster, more accurate and more scalable techniques

Incremental, on-line and real-time learning algorithms

Parallel and distributed data processing techniques

Data mining is an exciting and challenging field with the ability to solve many complex scientific and business problems.

OpportunitiesOpportunities

Data mining is a ‘top ten’ emerging technology

Data mining is finding increasing acceptance in science and business areas which need to analyze large amounts of data to discover trends and patterns which they could not otherwise find.