brief overview of mutation
DESCRIPTION
Mutation and its types.....TRANSCRIPT
![Page 1: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/1.jpg)
MutatioMutationsns
![Page 2: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/2.jpg)
What Are Mutations?What Are Mutations?
• Changes in the nucleotide sequence of DNA
• May occur in somatic cells (aren’t passed to offspring)
• May occur in gametes (eggs & sperm) and be passed to offspring
![Page 3: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/3.jpg)
Types of Mutations
![Page 4: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/4.jpg)
![Page 5: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/5.jpg)
Gene Mutations
• Change in the nucleotide sequence of a gene
• May only involve a single nucleotide
• May be due to copying errors, chemicals, viruses, etc.
![Page 6: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/6.jpg)
At nucleotide level :
1. Insertion (One or more nucleotides may be inserted in a DNA sequence)
2. Deletion (One or more nucleotides may be deleted from DNA sequence)
3. Indels (insertions of some bases and deletions of others)
4. Transition (CT or TC ---or AG or GA substitution)
5. Transversion (GC or CG ---or AT or TA substitution)
These mutations can be anywhere in the genome, coding or non-coding
![Page 7: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/7.jpg)
Mutations in coding region by effect
![Page 8: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/8.jpg)
Point Mutation
• Change of a single nucleotide
• Includes the deletion, insertion, or substitution of ONE nucleotide in a gene
![Page 9: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/9.jpg)
Point Mutation
•Sickle Cell disease is the result of one nucleotide substitution
• Occurs in the hemoglobin gene
![Page 10: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/10.jpg)
Chromosome Mutations
• May Involve:– Changing
the structure of a chromosome
– The loss or gain of part of a chromosome
![Page 11: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/11.jpg)
Chromosome Mutations
• Five types exist:–Deletion– Inversion–Translocation–Nondisjunction
–Duplication
![Page 12: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/12.jpg)
Deletion
• Due to breakage• A piece of a
chromosome is lost
![Page 13: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/13.jpg)
Inversion
• Chromosome segment breaks off
• Segment flips around backwards
• Segment reattaches
![Page 14: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/14.jpg)
Duplication
• Occurs when a gene sequence is repeated
![Page 15: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/15.jpg)
Translocation
• Involves two chromosomes that aren’t homologous
•Part of one chromosome is transferred to another chromosomes
![Page 16: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/16.jpg)
Translocation
![Page 17: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/17.jpg)
Nondisjunction•Failure of chromosomes to
separate during meiosis• Causes gamete to have too many or
too few chromosomes•Disorders:
– Down Syndrome – three 21st chromosomes
– Turner Syndrome – single X chromosome– Klinefelter’s Syndrome – XXY
chromosomes
![Page 18: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/18.jpg)
![Page 19: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/19.jpg)
WHEN IS A MUTATION NOT A MUTATION?
When it is sufficiently common in a population that it cannot be explained by recurring mutation. It is a polymorphism
![Page 20: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/20.jpg)
SNP• Single nucleotide polymorphisms (SNP)
ACGGGGGTTTCCCACGGGGGTTTCCGCoding SNPsNon coding SNPs
A SNP can change recognition sequence in a DNA for a Restriction enzyme, so that it can no longer be recognized by it
A SNP can create a new site for Restriction Enzyme
• Restriction fragment length polymophisms (RFLP) Length of a restriction fragment changes. Detected by Southern blotting and now typed by PCR
![Page 21: brief overview of Mutation](https://reader036.vdocuments.us/reader036/viewer/2022062406/5592de641a28abea3b8b479d/html5/thumbnails/21.jpg)
Thanku : )