boechera sparsiflora boechera pulchra, and

GENE EXPRESSION ANALYSIS OF HEAT-SHOCK PROTEINS IN

BOECHERA SPARSIFLORA, BOECHERA PULCHRA, AND

BOECHERA DEPAUPERATA WHEN EXPOSED TO

VARIOUS DEGREES OF HEAT STRESS

______________

A Thesis

Presented to the

Faculty of

San Diego State University

______________

In Partial Fulfillment

of the Requirements for the Degree

Master of Science in Biology

with a Concentration in

Molecular Biology

______________

by

Gillian Mary Halter

Summer 2012

iii

Copyright © 2012

by

Gillian Mary Halter

All Rights Reserved

iv

ABSTRACT OF THE THESIS

Gene Expression Analysis of Heat-Shock Proteins in Boechera sparsiflora, Boechera pulchra, and Boechera depauperata when

Exposed to Various Degrees of Heat Stress by

Gillian Mary Halter Master of Science in Biology with a Concentration in Molecular

Biology San Diego State University, 2012

Plants are frequently subjected to heat stress, and this stress is known to negatively

impact plant growth and agronomic yield. High temperature stress induces the heat shock proteins (HSPs). HSPs are molecular chaperones that aid other proteins so that they can function normally in stressful conditions. They assist other proteins with folding and prevent irreversible aggregation. This molecular machinery is vital for an organism to maintain homeostasis. It has been demonstrated that HSPs are expressed at higher levels in plants as they are exposed to higher levels of heat stress. The Boechera species are all found in California but have different distributions. B. sparsiflora is coastal, B. pulchra is a desert species, and B. depauperata is found in the mountains. Previous studies have found that the Boechera species vary in thermotolerance. The goal of this study is to examine the gene expression patterns of HSP genes in B. sparsiflora, B. pulchra, and B. depauperata. In order to more fully understand the role of the HSPs in thermotolerance I examined, with QPCR, the gene expression patterns of key genes and HSPs. The crucial genes that were examined include: HSFA3, HSP101, HSP20 I, HSP18.2 I, HSP17.7 II, HSP17.6 II, HSP21 CP, and RuBisCO activase. I generated gene expression profiles for these genes in A. thaliana and in the three Boechera species. I analyzed these results in light of previous studies demonstrating that each of these species have different levels of organismal thermotolerance. Here I present evidence that the Boechera species do not upregulate HSPs during heat stress to the same extent as A. thaliana. This suggests that Boechera has other mechanisms that provide thermotolerance.

v

TABLE OF CONTENTS

PAGE

ABSTRACT ............................................................................................................................. iv

LIST OF TABLES .................................................................................................................. vii

LIST OF FIGURES ............................................................................................................... viii

CHAPTER

INTRODUCTION .................................................................................................................... 1 Thermotolerance is Important in Our Warming World ...................................................... 1 The Cellular Response to Heat Stress ................................................................................. 1 Types of Heat Shock Proteins ............................................................................................. 3 Plant Heat Shock Proteins ................................................................................................... 3 Study Species ...................................................................................................................... 4 Genes Examined in This Study ........................................................................................... 5

MATERIAL AND METHODS ................................................................................................ 8 Growth of Plants ................................................................................................................. 8 Heat Shock Experiments ..................................................................................................... 8 RNA Isolations .................................................................................................................. 10 cDNA Production .............................................................................................................. 10 QPCR Primer Design ........................................................................................................ 14

B. sparsiflora ............................................................................................................... 16 B. pulchra .................................................................................................................... 16 B. depauperata ............................................................................................................ 16

QPCR Experimental Design ............................................................................................. 17 Reference Gene Analysis .................................................................................................. 18

RESULTS ............................................................................................................................... 23 HSFA3 .............................................................................................................................. 26 HSP101 ............................................................................................................................. 26 HSP20 I ............................................................................................................................. 28 HSP18.2 I .......................................................................................................................... 28

vi

HSP17.7 II ......................................................................................................................... 30 HSP17.6 II ......................................................................................................................... 31 HSP21 CP ......................................................................................................................... 32 RuBisCO Activase ............................................................................................................ 33

DISCUSSION ......................................................................................................................... 39 FUTURE DIRECTIONS ........................................................................................................ 45 REFERENCES ....................................................................................................................... 47

vii

LIST OF TABLES

PAGE

Table 1. A. thaliana Specific Genes Chosen for qRT-PCR Experiments, with TAIR Gene Identifier and Cellular Location .......................................................................... 6

Table 2. Eppendorf MasterCycler Gradient Thermal Cycler Protocol ................................... 14 Table 3. Arabidopsis Thaliana Specific Primers for qRT-PCR Experiments for each

Gene of Interest with Amplicon Size (bp) and Average Amplification Efficiency + SD ........................................................................................................... 15

Table 4. qPCR Protocol Used for BioRad IQ5 ThermaCycler ............................................... 17 Table 5. A. thaliana RNA Concentrations, Ratio of the Absorbance at 260 nm and

280 nm, and Ratio of the Absorbance at 260 nm and 230 nm .................................... 23 Table 6. B. sparsiflora RNA Concentrations, Ratio of the Absorbance at 260 nm and

280 nm, and Ratio of the Absorbance at 260 nm and 230 nm .................................... 24 Table 7. B. pulchra RNA Concentrations, Ratio of the Absorbance at 260 nm and

280 nm, and Ratio of the Absorbance at 260 nm and 230 nm .................................... 24 Table 8. B. depauperata RNA Concentrations, Ratio of the Absorbance at 260 nm

and 280 nm, and Ratio of the Absorbance at 260 nm and 230 nm ............................. 25 Table 9. HSFA3 Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures ..................... 27 Table 10. HSP101 Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures ................. 28 Table 11. HSP20 I Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures ................. 30 Table 12. HSP18.2 I Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures .............. 32 Table 13. HSP17.7 II Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures ............. 33 Table 14. HSP17.6 II Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures ............. 35 Table 15. HSP21 CP Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures .............. 36 Table 16. RuBisCO Activase Mean Fold Changes (ΔΔCt) ± SEM for Select

Temperatures ............................................................................................................... 38

viii

LIST OF FIGURES

PAGE

Figure 1. The role of HSPs in the cell. ...................................................................................... 2 Figure 2. Diagram of heat-shock experiments, showing both basal and acquired

heat-shock experiments. ................................................................................................ 9 Figure 3. Schematic of experimental process. .......................................................................... 9 Figure 4. BioAnalyzer results for A. thaliana RNA- basal heat-shock treatments. ................ 11 Figure 5. BioAnalyzer results for A. thaliana and B. depauperata RNA- acquired

heat-shock treatments. ................................................................................................. 11 Figure 6. BioAnalyzer results for B. depauperata RNA- basal heat-shock treatments. ......... 12 Figure 7. BioAnalyzer results for B. sparsiflora RNA- basal heat-shock treatments. ............ 12 Figure 8. BioAnalyzer results for B. sparsiflora and B. pulchra RNA- acquired

heat-shock treatments. ................................................................................................. 13 Figure 9. BioAnalyzer results for B. pulchra RNA- basal heat-shock treatments. ................. 13 Figure 10. Relative expression of reference genes in A. thaliana .......................................... 19 Figure 11. Relative expression of reference genes in B. sparsiflora ...................................... 20 Figure 12. Relative expression of reference genes in B. pulchra ........................................... 21 Figure 13. Relative expression of reference genes in B. depauperata .................................... 22 Figure 14. Relative expression of HSFA3 in (A) A. thaliana and (B) B. depauperata. ......... 26 Figure 15. Relative expression of HSP101 in (A) A. thaliana and (B) B. depauperata. ........ 27 Figure 16. Relative expression of HSP20 I in (A) A. thaliana, (B) B. sparsiflora,

(C) B. pulchra, and (D) B. depauperata ..................................................................... 29 Figure 17. Relative expression of HSP18.2 in (A) A. thaliana, (B) B. sparsiflora,

(C) B. pulchra, and (D) B. depauperata ..................................................................... 31 Figure 18. Relative expression of HSP17.7 II in (A) A. thaliana, (B) B. sparsiflora,

(C) B. pulchra, and (D) B. depauperata.. ................................................................... 34 Figure 19. Relative expression of HSP17.6 II in (A) A. thaliana and

(B) B. depauperata ...................................................................................................... 35 Figure 20. Relative expression of HSP21 CP in (A) A. thaliana, (B) B. sparsiflora,

(C) B. pulchra, and (D) B. depauperata. .................................................................... 37 Figure 21. Relative expression of RuBisCO activase in (A) A. thaliana and

(B) B. depauperata ...................................................................................................... 38

1

INTRODUCTION

THERMOTOLERANCE IS IMPORTANT IN OUR WARMING WORLD

There are many types of stressors that organism encounter which can compromise

their ability to maintain homeostasis. The fitness of an organism depends on its ability to

survive and to procreate in its environment. Organisms are also in competition with each

other to obtain resources. Adding an unexpected factor to their habitat may compromise the

ability of the organism to perform other important routine functions. It is crucial for

organisms to develop and to pass on genes that will be useful to them and their progeny in a

variable environment. Therefore, the organisms that have the best mechanisms to deal with

unexpected or extreme conditions have a better chance of surviving as a species in general

[1]. One of the most relevant stressors in our current ecosystem is heat stress. The global

environment is currently dealing with an increase in climate temperatures [2]. Adaptation to

these changes is possible via the aid and rescue of Heat Shock Proteins (HSPs).

THE CELLULAR RESPONSE TO HEAT STRESS An essential coping mechanism for all organisms during heat shock is the expression

of HSPs. These proteins are molecular chaperones, that is they assist other proteins in

maintaining their proper 3-dimensional structure so that they are able to carry out their

normal role within the organism [3]. It is known that HSPs are chaperones, that is they assist

in protein folding [4] (see Figure 1). In vitro studies have shown that some HSPs prevent

irreversible aggregation due to heat stress [5]. This is critical for protein processes such as

plasma membrane transport, oligomeric assembly, and regulation of receptor activity [6].

HSPs may become more frequently expressed in many species as global warming continues.

It is important that scientists continue to study the mechanism behind the HSPs as well as

how these proteins relate to the thermotolerance ability of different species. Still, there is

much work to be done on the behavior and mechanisms of heat-shock proteins.

Protein aggregation is problematic for any organism while trying to maintain

homeostasis. There are also various ways in which organisms deal with proteins that have

2

Figure 1. The role of HSPs in the cell. Source: Tyedmers J, Mogk A, Bukau B: Cellular strategies for controlling protein aggregation. Nat Rev Mol Cell 2010, 11:777-788.

been folded into their nonnative state. Bacteria have inclusion bodies that accumulate the

misfolded proteins during stressful situations. They can then properly dispose of the proteins

or use the assistance of the HSP system to disaggregate the protein [7]. Yeast has two

methods for processing aggregated proteins. Soluble, ubiquitylated proteins are disposed of

in the juxtanuclear quality-control compartment (JUNQ) and insoluble, irreversibly

aggregated proteins are disposed of in the perivacuolar insoluble protein deposit (IPOD) [7].

Mammals have an inclusion body called an aggresome, which is not constitutively expressed

in the cell and is induced by other distressed proteins [8]. Usually, misfolded proteins are

ubiquitylated before being transported to the aggresome, but this is not always the case.

Mutations in this machinery have been linked to the cause of several human diseases

including Alzheimers, Parkinson’s, and cystic fibrosis [9]. Overall, the chaperone system is a

necessary and conserved method responsible for the reactivation of aggregated proteins [7].

HSPs have been found in all organisms from bacteria to humans. They are an essential aid to

many plant species as well.

OligomerDimer

sHSP–substratecomplex

Disaggregation

Hsp70ClpB and Hsp70

Low substrateaffinity

High substrateaffinity

Heat shock

Heat shock

Heat shock

Misfolded protein Native protein

AutophagosomeA double-membrane vesicle in the cytoplasm that includes intracellular components for lysosomal degradation.

The ATP- and ubiquitin-dependent AAA+ chaperone valosin-containing protein (VCP; also known as p97) is another candidate for exerting disaggregation activity in the cytosol of animal cells (see TABLE 1). Like ClpB and Hsp104, VCP contains two ATPase domains and acts in numerous cellular activities by cooper ating with many adaptor proteins109. VCP mutations are linked to inclusion body myopathy with early-onset Paget’s disease and frontotemporal dementia (IBMPFD) and loss of VCP function in mammalian cells leads to the accumulation of insoluble ubiquitylated proteins110,111. VCP also associates with polyubiquitylated aggregates generated on proteasomal inhibition, and their sub-sequent solubilization requires VCP activity112. Direct evidence for a disaggregation activity of VCP is, how-ever, still missing. The potential function of VCP in aggregate clearance may relate to its role in aggresome formation113. Thus, VCP mutations can lead to changes in aggregate localization, thereby potentially affecting aggregate clearance.

Distinct roles of the ubiquitin proteasome system in formation and clearance of protein aggregates. Degradation by cellular proteases is an alternative route for the elimination of protein aggregates. In view of the limited refolding activity found in higher eukaryotes, the degradation route might have gained increasing importance in multicellular organisms. The 26S pro-teasome is the central cellular machine responsible for the degradation of soluble, misfolded proteins, thereby preventing protein aggregation (TABLE 1). Inhibition of proteasomal degradation can cause neurodegenera-tion, underlining the crucial function of the ubiqui-tin proteasome system in protein degradation114, 115.

Misfolded proteins are recognized and marked for deg-radation by different specific E3 ubiquitin ligases, often in concert with Hsp70 chaperones. The most promi-nent examples of E3 ubiquitin ligases are C terminus of HSP70-interacting protein (CHIP) in mammals116, Ubr1 and San1 in yeast117–119,120, and HMG-CoA reduct-ase degradation protein 1 (Hrd1; also known as Der3) and Doa10 for proteins derived from the endoplasmic reticulum13.

A role of the ubiquitin proteasome system in the deg-radation of pre-existing protein aggregates is suggested by the presence of ubiquitylated proteins in protein inclusions, the frequent co-localization of the 26S pro-teasome with protein aggregates and the increased aggregate formation and delayed removal of aggre-gates on inhibition of proteasomal activity57,76,115,121–124. However, the involvement of the ubiquitin proteasome system in aggregate clearance may be less important than suggested by these observations. The 26S pro-teasome cannot degrade aggregates in vitro125,126, and aggregates even reduce proteasomal activity in vivo127 by irreversible sequestration of proteasomes or other effects128,129. Together, these findings do not support a major contribution of 26S protea somes in the removal of pre-existing aggregates. They also indicate that the increased levels of aggregated proteins observed on proteasomal inhibition are a consequence of increased levels of misfolded proteins caused by substrate stabi-lization and the obstruction of other quality-control pathways.

Aggregate clearance by autophagy

Macroautophagy uses specialized, cytosolic, double-membrane structures that engulf substrates to form autophagic vesicles that ultimately fuse with the lyso-some for degradation of their content19,20. It has tradi-tionally been viewed as a rather unspecific degradative pathway, in which cytosolic contents and organelles are turned over in a non-selective manner. More recently, however, a form of selective macroautophagy has been identified as a major contributor in the clearance of misfolded and aggregated proteins in the cytosol of mammalian cells14,18–20. Initially, aggregates of pro-teins involved in neurodegenerative disease, such as α-synuclein or mutant huntingtin, were identified as substrates for this type of autophagy130–132, which was regarded as a back-up system to complement protea-somal degradation when it is overwhelmed or incapable of dealing with specific aggregated substrates. In agree-ment with this, autophagy was also suggested to have a role in the clearance of aggresomes130,131,133,134 (FIG. 5). Interestingly, one of the main players of aggresome formation, HDAC6, also controls a step that is essen-tial for aggregate turn over by autophagy; the fusion of autophagosomes with lysosomes by the recruitment of the actin-remodelling machinery that is involved in this process135. An implication for autophagy in the clear-ance of misfolded proteins under more physiological conditions came from the observation that the con-ditional knock out of genes essential for autophagy, autophagy protein 5 (Atg5) and Atg7, in mouse liver and

Figure 4 | The role of small heat shock proteins in protein aggregation. Small heat shock

proteins (sHSPs) are in equilibrium between oligomeric structures and exchanging subunits.

They can exist in two states, with a low and high substrate affinity, respectively. During heat

shock, the equilibrium shifts towards the high affinity state, which can then form a stable

complex with substrates, such as the misfolded proteins that arise during the heat shock.

The stable sHSP–substrate complex is thought to prevent irreversible aggregation and

can facilitate the re-solubilization of aggregated proteins by the bi-chaperone system,

consisting of Hsp104 and the Hsp70 chaperone system, or by Hsp70 only.

REVIEWS

NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 11 | NOVEMBER 2010 | 783

© 20 Macmillan Publishers Limited. All rights reserved10

Tyedmers et al. 2010

3

TYPES OF HEAT SHOCK PROTEINS HSPs are organized into 5 superfamilies: HSP100, HSP90, HSP70, HSP60

(chaperonins), and the small Heat Shock Proteins. Each are classified based on their structure

and molecular weight [5]. Native proteins shield their hydrophobic areas on their interior so

that they do not bind with the hydrophilic cell. The outer part of the protein consists of

hydrophilic regions. The hydrophobic regions are exposed when the protein is folded into an

unnatural state due to a stressor. Chaperone protein synthesis occurs when the hydrophobic

amino-acid residues of a protein are accessed. The HSPs then rescue the deformed protein

during stressful conditions by refolding the protein into its native state [10].

Small HSPs (sHSPs) are a class of heat-shock proteins proven to assist in maintaining

homeostasis in the cell by preventing irreversible aggregation [11]. This cellular mechanism

has implications in the protection against oxidative stress and aging, heat stress, apoptosis, as

well as with neurological diseases. Small HSPs have also been found in all living organisms

with the exception of some pathogenic bacteria. These proteins are not constitutively active

and have found to be turned on during stressful situations. Research has shown that sHSPs

have different sequences as well as sizes among different species, however their activity

remains similar [4].

PLANT HEAT SHOCK PROTEINS HSPs work together as a molecular chaperone machine in order to aid a protein that

has been misfolded into its nonnative state (see Figure 1). HSP70’s are the first to interact

with aggregated proteins. They block proteases from binding to the misfolded protein and

they also facilitate the transport of the protein to the HSP100/ClpB complex [7]. The HSP100

family has been proven to be necessary in the thermotolerance of several organisms. The job

of the HSP100/ClpB family of proteins is to interact with aggregated proteins in order to

make the substrate on the nonnative protein exposed for HSP70 to then work with. Studies

have show that HSP101 is necessary for thermotolerance in a variety of species. Researchers

have conducted knock out studies of HSP101 in A. thaliana. These plants were able to grow

normally but had no tolerance of heat stress [12]. Interestingly, Tonsor et al. showed that

HSP101 is more highly expressed in populations at higher latitude [13]. The authors suggest

that HSP101 expression is important in emergency high-temperature tolerance. They also

4

reported that there were trade-offs to high expression of HSP101. These trade-offs include

reduced root growth and lower fruit production. Thus HSP101 expression can be costly to

plant growth and reproduction. Small HSPs are responsible for keeping the misfolded

proteins in a form in which they can be refolded [3]. A number of studies have found that

expression of sHSPs is correlated to thermotolerance [14]. However, plants can have more

than 30 sHSPs and no single sHSP has the same impact on thermotolerance that HSP101 has

been demonstrated to have. Together, all of the HSP families work together to assist and

support stressed proteins so that they may be refolded and are able to perform their metabolic

processes properly.

There are eleven classes of small HSPs in plants that are classified according to their

cellular location. Six of the classes are found in the cytosol and in the nucleus (class I-VI),

and the other three are localized in the plastids, the mitochondria, or the endoplasmic

reticulum [14]. The small HSPs are named so because of their low molecular weight of

15-43 kDa. All small HSPs have the same conserved 90-amino acid carboxyl-terminal

domain, also known as the heat shock domain. One of the main roles of the small HSPs is to

bind stressed proteins, prevent their further aggregation, and to then work with other HSPs to

refold the stressed protein back into their native state [3].

The sHSP families that are of interest to our lab include HSP20 cytosolic class I,

HSP18.2 cytosolic class I, HSP17.7 cytosolic class II, HSP17.6 cytosolic class II, and HSP21

chloroplast. HSP21 CP is an essential tool in maintaining the integrity of the chloroplast

during heat shock.

STUDY SPECIES Arabidopsis thaliana has been extensively studied as a plant model organism. There

have been many HSPs identified in A. thaliana; including Hsp100, Hsp70, HSP90, and small

HSPs. Like the other better-studied HSP chaperone families, the small HSP family has been

found to prevent the aggregation of other proteins in vitro [15]. They have also been

identified as support proteins involved in photosystem II [16]. Photosystem II is a protein

complex that assists in ATP generation during photosynthesis [17]. It has been hypothesized

that the main role of small HSPs (HSP21) is the protection of photosynthesis during heat

stress [15]. Photosynthesis is the process in which plants use energy from sunlight in order to

5

break down carbon dioxide into sugars and releasing oxygen into the atmosphere, which is an

essential nutrient to other life forms on Earth. Therefore, the role of small HSPs in the cell is

crucial for plant survival.

I am interested how these heat-shock proteins are expressed in Boechera

depauperata, Boechera pulchra, and Boechera sparsiflora. Arabidopsis thaliana is the plant

model organisms and is closely related to these four Boechera species. This makes it a useful

comparison species since it’s genome has been sequenced and is publicly accessible using

The Arabidopsis Information Resource (TAIR) website [18].

Boechera is a genus that is North American and is closely related to Arabidopsis.

Gene expression levels of HSPs have not yet been studied in Boechera. Therefore, I plan to

compare gene expression patterns of these HSP families in B. pulchra, B. depauperata, and

B. sparsiflora. These species are all found in California but have different distributions. One

is a coastal species (B. sparsiflora), one is a desert species (B. pulchra), and B. depauperata

is found in the mountains.

GENES EXAMINED IN THIS STUDY In this study I examined the gene expression patterns of the following genes: HSFA3,

HSP101, HSP20 I, HSP18.2 I, HSP17.7 II, HSP17.6 II, HSP21 CP, and RuBisCO Activase.

Table 1 shows the name of each gene with the TAIR gene identification number and the

cellular location of the gene. HSFA3 is a heat shock factor that is named AT-HSFA3 in the

A. thaliana genome (Table 1). There are 21 HSFs found in Arabidopsis. HSFA3 is a

transcriptional activator that is regulated by the transcription factor, Dehydration-Responsive

Element Binding Protein 2A (DREB2A). This transcription factor is the activator of many

heat shock genes. Transcription factors are transcribed in the nucleus and are translated in the

cytoplasm. HSFs transcriptionally regulate the heat shock genes by binding to HSEs, which

are dispersed throughout the genome. The HSFs recognize the sequence that encodes the

HSEs, thereby turning the heat shock genes on or off [19].

HSP101 [20] is one of the most studied heat-shock proteins in the HSP100 gene

family. This HSP is also located in the cytosol of cells. Previous research has shown that

HSP101 is necessary for heat tolerance in plants [21]. The activity of HSP101 is required for

survival during heat stress in A. thaliana. It has also been found that HSP101 is not necessary

6

Table 1. A. thaliana Specific Genes Chosen for qRT-PCR Experiments, with TAIR Gene Identifier and Cellular Location

Gene Description Gene Identifier Cellular Location 18S AT2G03810 ribosome Actin 3 AT3G53750 cell wall, cytoskeleton HSFA3 AT5G03720 nucleus HSP101 AT1G74310 cytosolic HSP20 I AT1G53540 cytosolic I HSP18.2 I AT5G59720 cytosolic I HSP17.7 II AT5G12030 cytosolic II HSP17.6 II AT5G12020 cytosolic II HSP21 CP AT4G27670 chloroplast RuBisCO Activase AT2G39730 chloroplast

in seed growth and development in A. thaliana [12]. This suggests that the primary role of

this HSP is in thermotolerance. HSP100 and HSP70 proteins assist with disaggregation using

a method that is still being investigated (see Figure 1). It is thought that the system unravels

the aggregated polypeptides. It then transfers them to the central channel in the Clp/HSP104

system where they are unfolded using ATP hydrolysis. The polypeptides are then freed and

refolded naturally or with the help of the HSPs [10].

HSP20 I (AT1G53540) is another cytosolic class I heat-shock protein that responds to

heat (Table 1). This gene is located on chromosome 1. It is phylogenetically related to

HSP18.2 I based on amino acid sequences [22]. HSP18.2 I is a small heat shock protein that

is induced by heat shock (Table 1). It is a class I cytosolic heat-shock protein and is located

on chromosome 5. HSP18.2 I is highly expressed in vegetative tissues, however, it is not

expressed during seed development [23].

HSP17.7 II (AT5G12030) is a cytosolic class II small heat shock protein that is

activated during heat stress as well as osmotic stress (Table 1). It was shown that this

molecular chaperone was induced during mild heat-shock (37°C) in A. thaliana cells. The

same study also found an inhibitory effect of these two HSPs when the plants were treated

with Salicylic Acid [24]. Both HSP17.7 II and HSP17.6 II are induced by osmotic stress as

well as heat stress [14]. HSP17.6 II (At5g12020) is another cytosolic class II small HSP that

is also located on chromosome 5. It is a sister protein to HSP17.7 II when phylogenetically

comparing amino acid sequences. It is classified as an HSP20-like chaperone protein [22]. It

7

is expressed during heat stress and is not known to be expressed under control or

non-stressed conditions.

HSP21 CP (AT4G27670) is a small heat shock protein located in the chloroplast of

plant cells and is 21kDa in size. It is located on chromosome 4 [22]. This protein accumulates

in the presence of a stressor and is not found in the cell during homeostasis. It is also stable

during recovery conditions, having a half-life of more than 50 hours. There has been

evidence of HSP21 CP functioning to protect photosystem II in the chloroplast [3].

RuBisCO activase is a chaperone protein that aids the RuBisCO (Ribulose-1,

5-biphosphate carboxylase oxygenase) protein, which is also involved in the photosynthetic

process. It is an enzyme that is highly involved in catalyzing photosynthesis in plants.

Previous studies have shown that the deactivation of this enzyme occurs at temperatures

above 30-32°C and that RuBisCO activase gene expression is altered during heat stress [25].

The goal of this project is to see how these HSPs and RuBisCO Activase are

expressed in A. thaliana, B. sparsiflora, B. pulchra, and B. depauperata. I would like to find

the maximum temperature at which these genes are expressed in A. thaliana as well as

B. sparsiflora, B. pulchra, and B. depauperata. The expression levels of these genes and the

patterns of expression along varying temperatures will only further our understanding of heat

tolerance in plants. Studying the expression of the small HSPs as well as HSP101 will help

us to gain insight into the genetic mechanism underlying the different thermotolerance

abilities in these four species.

8

MATERIAL AND METHODS

GROWTH OF PLANTS The Boechera plants were grown at San Diego State University to produce bulk seed.

The seed sources are described in Leann Ortmann’s thesis [26]. Seeds were then sterilized

using the ARBC guidelines [27]. They were then plated on MS agar plates with 10 seeds per

plate, 5 plates per treatment for each species in order to grow enough tissue for each

heat-treated sample [27]. The seeds were vernalized for 4 days at 4°C before being placed

into the growth chamber at 22°C. However, B. depauperata requires a 12-15 day

vernalization period. The seeds were then grown for 10-12 days before heat-shock

experiments were performed. They were grown in an E-36L Percival growth chamber with a

light intensity of 150µE.

HEAT SHOCK EXPERIMENTS Ten-day old seedlings were treated with a basal heat-shock or an acquired heat-shock

(Figure 2).

Basal heat-shock was performed by taking the seedlings from their optimal growth

temperature of 22°C and placed into a heat-shock chamber set at one of the following

temperatures for 2 hours: 30°C, 32°C, 34°C, 36°C, 38°C, 40°C, or 42°C. Our initial

A. thaliana basal heat-shock experiments were performed at 34°C, 35°C, 36°C, 38°C, 39°C,

40°C, 41°C, and 42°C for 2 hours.

Acquired heat-shock occurs when an organism is exposed to an hour of heat-shock at

38°C followed by an hour at their optimal temperature of 22°C for a short recovery period,

and then another heat-shock treatment of two hours at a temperature above 38°C. I examined

gene expression after the following acquired treatments of 2 hours at 40°C, 41°C, or 42°C.

Samples were also taken during the pretreatment and recovery periods of the heat-shock

experiment in order to understand more about the acquired behavior of these plants

(Figure 2). The plant tissue was flash frozen in liquid nitrogen for future analysis. The

experimental plan is as shown in Figure 3.

9

Figure 2. Diagram of heat-shock experiments, showing both basal and acquired heat-shock experiments.

Figure 3. Schematic of experimental process.

Basal heat shock:

Acquired heat shock:

10-12 day tissue growth 2 hour H-S

(22°C) (30 - 42°C)

Flash freeze

10-12 day tissue growth 1 hour 1 hour 2 hour H-S

(22°C) (38°C) (22°C) (39 - 45°C)

Flash freeze

Figure 2: Schematic of Heat Shock Experiments

Figure 3: Schematic of the Experimental Process

Heat-Shock Tissue

- basal and acquired (@various temperatures)

Isolate RNA - DNAse treatment

BioAnalyzer quality check

cDNA synthesis

quantitative-PCR

Data analysis

Grow tissue

10

RNA ISOLATIONS After subjecting the seedlings to heat-shock, they were pulled from the agar plates

and flash frozen in liquid Nitrogen in order to freeze the cells right at the point of heat-stress.

Tissue was stored in the -80°C freezer and was then ground into a fine powder for 5-10

minutes using a chilled mortar and pestle as well as liquid Nitrogen. About 100 mg of ground

tissue was used for each sample in order to isolate enough messenger RNA to use for the

cDNA synthesis. RNA extractions were performed using the Ambion RNAqueous® 4-PCR

kit along with Plant RNA Isolation Aid. The RNA was also treated with the Ambion

DNA-freeTM kit in order to in order to eliminate any DNA contaminants including genomic

DNA or DNAses. This was done to ensure that I was amplifying the protein encoding part of

the gene (cDNA) during the Reverse Transcription step.

RNA concentrations were measured using the Implen NanoPhotometer® Pearl using

1uL of RNA in elution buffer in order to obtain concentrations as well as RNA quality.

Isolated RNA was used for the rest of the workflow only if the 260/280 ratios were between

1.8 and 2.4 to ensure that I was using pure RNA that was not contaminated with protein. All

samples had a 260/230 ratio over 1.1 in order to make sure the DNAse treatment successfully

removed the genomic DNA. Concentrations, 260/280 ratios, and 260/230 ratios can be seen

in Tables 5-8 in Results Section. RNA samples were then tested on the Agilent 2100

BioAnalyzer in order to again verify RNA quality. Good quality plant RNA usually has an

RNA Integrity Number (RIN) of about 6.0 to 10.0 (Figures 4-9). The Electropherogram is

used to visualize the integrity of the RNA for each sample. The first peaks show the

chloroplast ribosomal RNAs before the larger 18S and 25S peaks. All electropherograms

show clear peaks. If there were degradation of any samples, the peaks would look wider than

those in Figure 4-9. The gel images obtained from the Agilent BioAnalyzer show clear bands

at the 18S and 25S ribosomal subunits. Signs of RNA degradation would show a smeared

band in the gel image for a sample instead of the clear bands seen in Figure 4-9. Therefore, it

was determined that this RNA is of good quality to convert into cDNA.

CDNA PRODUCTION Reverse Transcriptase PCR (RT-PCR) was performed using the Applied Biosystems

High-Capacity cDNA Reverse Transcription kit in order to convert the mRNA into cDNA.

11

Figure 4. BioAnalyzer results for A. thaliana RNA- basal heat-shock treatments.

Figure 5. BioAnalyzer results for A. thaliana and B. depauperata RNA- acquired heat-shock treatments.

Electropherogram:

Gel Image:

Electropherogram:

Gel Image:

12

Figure 6. BioAnalyzer results for B. depauperata RNA- basal heat-shock treatments.

Figure 7. BioAnalyzer results for B. sparsiflora RNA- basal heat-shock treatments.

Electropherogram:

Gel Image:

Electropherogram:

Gel Image:

13

Figure 8. BioAnalyzer results for B. sparsiflora and B. pulchra RNA- acquired heat-shock treatments.

Figure 9. BioAnalyzer results for B. pulchra RNA- basal heat-shock treatments.

Electropherogram:

Gel Image:

Electropherogram:

Gel Image:

14

Components used to perform the RT-PCR included 5µL RNase Inhibitor, 5 µL

Multiscribe™ Reverse Transcriptase, 10µL 10X RT Random Primers, 4µL 25X dNTP Mix

(100mM), and 10µL 10XRT Buffer along with a 16µL dilution of RNA and nuclease-free

H2O. RNA dilutions were calculated using the RNA concentrations and then diluting each

sample so that it was the same concentration as the lowest concentrated RNA sample. The

RT-PCR was performed in an Eppendorf MasterCycler Gradient thermal cycler. The thermal

cycler was set to the conditions found in Table 2.

Table 2. Eppendorf MasterCycler Gradient Thermal Cycler Protocol

Step 1 Step 2 Step 3 Step 4 Temperature (°C) 25 37 85 4 Time (minutes) 10 120 5 ∞

QPCR PRIMER DESIGN QPCR primers were designed using the PrimerQuest℠ PCR Design Tool on the

Integrated DNA Technologies website. All primer sets that were chosen had a melting

temperature (Tm) around 60°C and an amplicon size between 100 and 150 base pairs. Most

of the primers were designed using the A. thaliana gene sequences from the TAIR database

(see Table 3) [18]. The primers were then evaluated using the Primer Blast program on the

National Center for Biotechnology Information (NCBI) website [28]. This was done in order

to assure that the primers were annealing to the gene of interest and not a different gene in

the A. thaliana genome.

I decided to obtain the HSP21 CP sequences for all of the Boechera species so that I

could perform a comparative sequence analysis against the known A. thaliana HSP21 CP

sequence. DNA was extracted from seedlings using the DNEasy Plant Mini kit or the Qiagen

Qiaquick Gel Extraction kit. The DNA was then purified using a Qiagen Qiaquick PCR

purification kit. After clean, good quality DNA was obtained it was sequenced. It was found

that all four HSP21 CP sequences from the Boechera species were very similar. There were

2 nucleotides that were different on the sequence that was complementary to the forward

primer. There was only 1 nucleotide that was different in the sequence complementary to the

reverse primer sequence (see Table 3). Using this data, I could design species-specific

15

Table 3. Arabidopsis Thaliana Specific Primers for qRT-PCR Experiments for each Gene of Interest with Amplicon Size (bp) and Average Amplification Efficiency + SD

Gene Description

Primer Sequences (5’-3’ Forward/Reverse)

Amplicon Size (bp)

Average Amplification

Efficiency ± SD*

18S AATGATCACGCGCTTGGTAACTCG TTTCCGGGACCTTTAGCTCTGCAT

106 107.73 ± 9.98

Actin 3 ACCCAAAGGCTAACCGTGAGAAGA ACACCATCTCCAGAGTCAAGCACA

145 95.02 ± 5.51

HSFA3 ATCGTCGTCGATCACCACAATCCA ACCATTTCCTCCATCAATGCACGC

133 91.85 ± 2.29

HSP101 ATAGATGCAGGCGCTGGTGATCTT TCACTTCTCTTTGGCCCGTTAGCA

124 100.5 ± 8.14

HSP20 I ATGGATGTGGCAGCGTTCACAAAC TGCCATCCTCAACCTCCACTTTCA

124 92.44 ± 4.02

HSP18.2 I TTCTTCACGCCATCTTCTGCGTTG CTGGCAAGTCCGCTTTGAACACAT

124 92.98 ± 6.85

HSP17.7 II TACACCAGCTGACGTTATCGAGCA ACCACAAGCACGTTCTCGTTCTCT

114 94.3 ± 5.72

HSP17.6II TCACGAGTTTACATGCGAGACGCT AGCACATTGTCGTTCTCGACCTGA

146 103.39 ± 22.63

HSP21 CP TCACCAATGAGGACGATGCGACAA TGCACGAATCTCTGACACTCCACT

109 95.95 ± 5.09

**B. pulchra and B. depauperata- F TCACCAATGAGGACAATGCGGCAA

**B. sparsiflora and B. pulchra- R TGCACGAATTTCTGACACTCCACT

109 n/a

RuBisCO Activase

TGCTTTGGGAGACGCAAACGCTGA TCGTCACTTCTAGCCGTTGGATCA

141 86.81 ± 11.35

*Primer efficiencies were calculated with the following formula: E=[10^(-1/slope)]/2 **Species-specific HSP21 primers for B. depauperata, B. pulchra, and B. sparsiflora, with nucleotide differences highlighted in red

primers for the HSP21 CP gene. After discovering highly conserved sequences among all

five species, I decided to design primers using the A. thaliana genome. I then used these

primers for the qPCR experiments for the Boechera species. If the primers were not found to

be efficient, I would discard this data. These are the HSP21 CP sequences obtained for

Boechera species, regions where primers were designed are in bold and red nucleotides are

those that are different from the A. thaliana primer regions.

16

B. sparsiflora HSP21 sequence obtained for B. sparsiflora, with primer annealing regions in bold

and nucleotide differences within primer regions shown in red.

NNNNNNNNNNNNNNNNNNNTCCTCTGCCTCNTCCAATCCACTTCGCCGTTTCACTGTCGCCTTCCCACGGATGATGCCTAGTCGGATCAGAGCTGAAGACCAGAGAGAAAACTCCATTGATGTTGTTAACCAAGGACAACACAAAGGGAATGGAGGATCTAGCGTACAAAAAAGACCTCAACAACGCTTAGCCATGGACGCTTCGCCTTTCGGTACGTTGTTGAACTAATAAAAACTCGTTTGTATAACTCGAAACCTCTTCCTCTACTCACACAATTGACCTTTTTTTTATCACAACGACAGGACTGTTGGATCCTTTGTCACCAATGAGGACAATGCGGCAAATGCTGGACACCATGGACAGGATGTTCGAAGACGTTATGCCTGTCTCAGGAAGAAACAGAGGAGGAAGTGGAGTGTCAGAAATTCGTGCACCATGGGACATCAAAGAGGAAGAACATGAGATTAAGATGCGTTTTGACATGCCTGGTCTCTCCAAAGAAGACGTAAAAATCTCTGTCGAAGATAACGTCCTTGTAATCAAAGGAGAGCAGGAGAAGGAAGACGATAATGATTCTTGGTCTGGAAGGAGTGTTAGCTCTTATGGAACACGACTTCAGCTTCCAGACAACTGNGANAAAGACAAGATCAGAGCTGAGCTCAAGAACGGAGTCCTGTTTATCACTGTCCCTAAAACCAAAGTCGAACGCAANNNNNNNNNNNNNNNCNNN

B. pulchra HSP21 sequence obtained for B. pulchra, with primer annealing regions in bold and

nucleotide differences within primer regions shown in red.

TTNNNNNNCNCTCTCGCTCGATCTCNCTCTGCCTCATCCAAATCCACTTCGCCGTTCTCTGTCGCCTTCCCACGGATGATGCCTAGTCGGATCAGAGCTGAAGACCAGAGAGAAAACTCCATTGATGTTGTTAACCAAGGACAACACAAAGGGAATGGAGGATCTAGCGTACAAAAAAGACCTCAACAACGCTTAGCCATGGACGCTTCGCCTTTCGGACTGTTGGATCCTTTGTCACCAATGAGGACAATGCGGCAAATGCTGGACACCATGGACAGGATGTTCGAAGACGTTATGCCTGTCTCAGGAAGAAACAGAGGAGGAAGTGGAGTGTCAGAAATTCGTGCACCATGGGACATCAAAGAGGAAGAACATGAGATTAAGATGCGTTTTGACATGCCTGGTCTCTCCAAAGAAGACGTAAAAATCTCTGTCNAAGATAACGTCCTTGTAATCAAAGGAGAGCAGGNNNGGANNNNGATNNNNNTTGGTTNNNNGCCCNGAGGGNNTTTTTCTTCTGTNTGGAACTCTNTTTCCCNNNCANNNNCCTGNGGGAAGANAAGAANAAACCNAANANAAGATTGGGGTCNGGTTNTNCTGTCCCCAAAAACCANATTTAANCCAATCCTCCAAANTCAAAAATAT

B. depauperata HSP21 sequence obtained for B. depauperata, with primer annealing regions in bold

and nucleotide differences within primer regions shown in red.

17

NNNNNNNNNNNNNNNTCCTCTGCCTCATCCNNTCCACTTCGCCGTTCTCTGTCGCCTTCCCACGGAGGAAGCCTAGTCGGATCAGAGCTGAAGACCAGAGAGAAAACTCCATTGATGTTGTTAACCAAGGACAACACAAAGGGAATGGAGGATCTAGCGTACAAAAAAGACCTCAACAACGCTTAGCCATGGACGTTTCGCCTTTCGGACTGTTGGATCCTTTGTCACCAATGAGGACAATGCGGCAAATGCTGGACACCATGGACAGGATGTTCGAAGACGTTATGCCTGTCTCAGGAAGAAACAGAGGAGGAAGTGGAGTGTCAGAGATTCGTGCACCATGGGACATCAAAGAGGAAGAACATGAGATTAAGATGCGTTTTGACATGCCTGGTCTCTCCAAAGAAGACGTAAAAATCTCTGTCGAAGATAACGTCCTTGTAATCAAAGGAGACCAGGAGAAGGAAGACGATAATGATTCTTGGTCTGGAAGAAGCGTTAGCTCTTATGGAACACGACTTCAGCTTCCAGACAACTGTGAGAAAGACAAGATCAAAGCTGAGCTCAAGAACGGAGTCCTGTTTATCACTGTCCCTAAAACCAAAGTCGAACGCAAANNNNNNNAATGTCCA

QPCR EXPERIMENTAL DESIGN The Bio-Rad iQ5 qrt-PCR instrument uses fluorescence in order to measure the

average amplification from each sample. Qrt-PCR was chosen in order to measure gene

expression because it is a quantitative method of analysis. It is a more sensitive assay and is

the ultimate objective of this gene expression project. The experiment was performed on a

96-well plate. The Quanta Plus Melt Curve that was used can be found in Table 4. Qrt-PCR

was then conducted in order to obtain threshold cycle (Ct) values for gene expression

analysis. The ΔΔCt method was used to obtain fold averages for each sample and the Act3

gene was used as a reference gene. This was performed in Microsoft Excel in order to

accurately calculate the thermotolerance in these plant species.

Table 4. qPCR Protocol Used for BioRad IQ5 ThermaCycler

Cycle 1 2 3 4 5 6 Repeats 0 0 45 0 0 81 Step 1 1 1 2 1 1 1 Set Point (°C) 50.0 95.0 94.0 55.0 94.0 55.0 55.0 Dwell Time (minutes)

2:00 5:00 0:15 0:30 1:00 1:00 0:10

Real-Time Melt Curve

Enzyme Activation

Denaturation Data Collection

18

Each sample was run in triplicate and was prepared in a 1:40 dilution of cDNA to

RNAse and DNAse-free water. The cDNA for each sample was diluted 1:40 using 4uL of

cDNA to 156uL of water. This was used to run four plates over the course of one day, with

two primer sets per plate and a total of six genes of interest and two reference genes tested in

one day. Two plates were run per gene of interest and per reference gene, using different

aliquots of cDNA per qPCR run. This was done in order to perform technical replicates of

the samples.

Primers were tested for their efficiency using a standard curve with standards run in

duplicates using the 36°C sample for each species. It was important to use this sample in

order to test the primer efficiencies since I knew that the heat-shock proteins were expressed

at this temperature. The standards were prepared as 1:4, 1:40, 1:400, and 1:4000 dilutions. A

no-template control well was also prepared using the master mix and the RNAse and

DNAse-free water in order to test for contamination. The averages for each standard dilution

were calculated by the Bio-Rad iQ5 and were plotted in Microsoft Excel in order to calculate

the primer efficiencies. The slope was taken from a linear regression graph of the average

values from each standard dilution, which was graphed in Microsoft Excel. The standards

were then plotted and a linear regression line was used to obtain the slope (R2). The

following formula, E=[10^(-1/R2)]/2 x 100, was used in order to obtain a primer efficiency

for each primer set that was tested. Primer efficiencies between the values of 80 and 120 are

considered of good quality.

REFERENCE GENE ANALYSIS Several analyses were performed in order to compare the reference genes against each

other. One of the reference genes was treated as the gene of interest in order to compare the

difference in the Ct values for each reference gene. In order to test the difference from plate

to plate for each reference gene, an analysis was also done in which the values for the first

plate was treated as the gene of interest and the reference gene values for the second plate

were used as the reference gene (see Figures 10-13).

There were no significant differences when comparing the genes of interest to each

other in A. thaliana (see Figure 10). 18S and Act3 only had a fold change of about 4 as the

highest fold change value in A. thaliana. When comparing the reference gene fold changes

19

Figure 10. Relative expression of reference genes in A. thaliana (A) 18S expression levels using Act3 as reference gene (n=6), (B) Act3 expression levels using 18S as reference gene (n=6), (C) 18S expression levels using 18S as the reference gene (n=3). (D) Act3 expression levels using Act3 as the reference gene (n=3). Bars show mean values with standard error of the mean. X axes indicate temperature of either basal or acquired heat-shock.

from one plate to the next, most of the temperatures were stable in the A. thaliana samples,

except Act3 had a difference of 6 in fold change for its 36°C basal treatment. When using

this reference gene data to analyze the genes of interest with fold changes in the thousands to

the millions, this difference of 6 in fold change is insignificant. This will not alter the ΔΔCt

values when calculating the relative expression levels.

Figure 11 shows the relative gene expression of 18S and Act3 reference genes in

B. sparsiflora. The fold changes are not significantly different when analyzing one reference

gene compared to the other. The highest fold change in the 18S gene expression is about

3 and the highest fold change in the Act3 gene expression is only 2. Also, when graphing the

Act3 Gene Expression in Arabidopsis thaliana

22 34 35 36 38 39 40 41 42 39 40 41 420

2

4

6

Act

3 E

xp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

Act3 Gene Expression in Arabidopsis thaliana

Temperature (°C)

Act

3 E

xp

ress

ion

Lev

el (!!

Ct)

22 34 35 36 38 39 40 41 42 39 40 41 420

2

4

6

8

Basal Acquired

18S Gene Expression in Arabidopsis thaliana

22 34 35 36 38 39 40 41 42 39 40 41 420

1

2

3

18S

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

18S Gene Expression in Arabidopsis thaliana

22 34 35 36 38 39 40 41 42 39 40 41 420

2

4

6

18S

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

!" #"

$" %"

Figure 6: Relative expression of reference genes in A. thaliana (A) 18S expression levels using Act3 as the reference gene (n=6) (B) Act3

expression levels using 18S as the reference gene (n=6) (C) 18S expression levels using 18S as the reference gene (n=3) and (D) Act3

expression levels using Act3 as the reference gene (n=3). Bars show the mean values with the standard error of the mean. X axes indicate the

temperature of either basal or acquired heat-shock.

20

Figure 11. Relative expression of reference genes in B. sparsiflora (A) 18S expression levels using Act3 as the reference gene (n=6), (B) Act3 expression levels using 18S as the reference gene (n=6), (C) 18S expression levels using 18S as the reference gene (n=3), (D) Act3 expression levels using Act3 as the reference gene (n=3). Bars show mean values with standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments.

reference genes against themselves comparing one plate to the next, the levels are very

stable.

Figure 12 shows the expression levels of 18S and Act 3 in the heat-shocked

B. pulchra samples. The fold changes look relatively stable. The expression levels of 18S

when using Act3 as the reference gene are slightly higher, but this is due to the 18S

expression being lower than the Act3 expression levels in the B. pulchra species. The bars

still look relatively even on the 18S gene expression graph.

Act3 Gene Expression in Boechera sparsiflora

22 30 32 34 36 38 40 42 38 22 40 41 420

1

2

3

HS

P17.6

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

Act3 Gene Expression in Boechera sparsiflora

22 30 32 34 36 38 40 42 38 22 40 41 420.0

0.5

1.0

1.5

Act

3 E

xp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

18S Gene Expression in Boechera sparsiflora

22 30 32 34 36 38 40 42 38 22 40 41 420.0

0.5

1.0

1.5

18S

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

18S Gene Expression in Boechera sparsiflora

22 30 32 34 36 38 40 42 38 22 40 41 420

1

2

3

4

5

Temperature (°C)

18S

Exp

ress

ion

Lev

el (!!

Ct)

Basal Acquired

!" #"

$" %"

Figure 7: Relative expression of reference genes in B. sparsiflora (A) 18S expression levels using Act3 as the reference gene (n=6) (B) Act3



temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the

acquired heat-shock experiments.

21

Figure 12. Relative expression of reference genes in B. pulchra (A) 18S expression levels using Act3 as the reference gene (n=6), (B) Act3 expression levels using 18S as the reference gene (n=6), (C) 18S expression levels using 18S as the reference gene (n=3), (D) Act3 expression levels using Act3 as the reference gene (n=3). Bars show mean values with standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments.

The reference gene analysis in B. depauperata also confirmed that 18S and Act3 were

stable throughout our heat-shock samples. The samples were relatively stable when

comparing the 18S to the Act3 values as well as when comparing the reference gene plates to

each other. At most, the fold change differences were about a 2-fold difference. Figure 13

shows the relative stability of these genes when compared together.

Act3 Gene Expression in Boechera pulchra

22 30 32 34 36 38 40 42 38 22 40 41 420.0

0.5

1.0

1.5

2.0

Act

3 E

xp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

18S Gene Expression in Boechera pulchra

22 30 32 34 36 38 40 42 38 22 40 41 420

1

2

3

18S

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

!" #"

$" %"

18S Gene Expression in Boechera pulchra

22 30 32 34 36 38 40 42 38 22 40 41 420

5

10

15

18S

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

Act3 Gene Expression in Boechera pulchra

22 30 32 34 36 38 40 42 38 22 40 41 420

2

4

6

Act

3 E

xp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

Figure 8: Relative expression of reference genes in B. pulchra (A) 18S expression levels using Act3 as the reference gene (n=6) (B) Act3





22

Figure 13. Relative expression of reference genes in B. depauperata (A) 18S expression levels using Act3 as the reference gene (n=6), (B) Act3 expression levels using 18S as the reference gene (n=6), (C) 18S expression levels using 18S as the reference gene (n=3), (D) Act3 expression levels using 18S as the reference gene (n=3). Bars show mean values with standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments.

Act3 Gene Expression in Boechera depauperata

22 30 32 34 36 38 40 42 38 22 40 41 420.0

0.5

1.0

1.5

2.0

2.5

Act

3 E

xp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

18S Gene Expression in Boechera depauperata

22 30 32 34 36 38 40 42 38 22 40 41 420

1

2

3

4

18S

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

Act3 Gene Expression in Boechera depauperata

Temperature (°C)

Act

3 E

xp

ress

ion

Lev

el (!!

Ct)

22 30 32 34 36 38 40 42 38 22 40 41 420.0

0.5

1.0

1.5

Basal Acquired

18S Gene Expression in Boechera depauperata

22 30 32 34 36 38 40 42 38 22 40 41 420.0

0.5

1.0

1.5

2.0

18S

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

Figure 9: Relative expression of reference genes in B. depauperata (A) 18S expression levels using Act3 as the reference gene (n=6) (B) Act3





!" #"

$" %"

23

RESULTS

RNA concentrations and quality was obtained for each species using the Implen

NanoPhotometer. The RNA concentrations, 260/280 ratios, and 260/230 ratios can be seen in

Tables 5-8. Concentrations were used to calculate RNA dilutions for the RT-PCR assay.

Table 5. A. thaliana RNA Concentrations, Ratio of the Absorbance at 260 nm and 280 nm, and Ratio of the Absorbance at 260 nm and 230 nm

Sample Concentration (ng/µL) 260/280 260/230 22°C control 129.0 2.110 1.633 34°C basal 72.0 2.155 1.240 35°C basal 145.0 2.110 1.763 36°C basal 60.0 2.127 0.239 38°C basal 23.1 2.148 0.935 39°C basal 51.7 2.063 1.757 40°C basal 44.1 2.135 1.734 41°C basal 48.5 2.103 1.627 42°C basal 85.9 2.097 2.000 39°C acquired 40.6 2.125 0.313 40°C acquired 59.2 2.099 1.221 41°C acquired 76.7 2.075 0.704 42°C acquired 99.0 2.075 4.446

The first goal of this project was to choose several reference genes that had good

primer efficiencies and were stable in the A. thaliana heat-shock samples. I chose the 18S

pre-ribosomal (At2g03810) gene based on other qPCR studies found in the literature [29].

The 18S ribosomal gene turned out to be a reliable reference gene when tested. I decided

choose the 18S ribosomal gene as the reference gene for the first set of qPCR experiments.

Actin 3 was also chosen as a second reference gene in order to analyze the genes of interest.

It is another housekeeping gene that was found to be stable in A. thaliana [30].

After demonstrating the ability to obtain gene expression levels in A. thaliana, our

model organism, I evaluated these HSPs in B. sparsiflora, B. pulchra, and B. depauperata

using qPCR. Gene expression levels were obtained for HSP20 I, HSP18.2 I, HSP17.7 II,

24

Table 6. B. sparsiflora RNA Concentrations, Ratio of the Absorbance at 260 nm and 280 nm, and Ratio of the Absorbance at 260 nm and 230 nm

Sample Concentration (ng/µL) 260/280 260/230 22°C- control 189.0 2.154 1.845 30°C- basal 51.7 1.940 5.200 32°C- basal 97.4 2.207 1.551 34°C- basal 90.7 2.214 1.490 36°C- basal 64.4 2.250 1.110 38°C- basal 142.0 2.023 2.760 40°C- basal 173.0 2.028 2.952 42°C- basal 73.6 2.229 1.164 38°C- pretreatment 81.5 2.253 1.185 22°C- recovery 120.0 2.196 1.530 40°C- acquired 136.0 2.030 1.183 41°C- acquired 200.0 2.163 1.762 42°C- acquired 113.0 2.007 2.948

Table 7. B. pulchra RNA Concentrations, Ratio of the Absorbance at 260 nm and 280 nm, and Ratio of the Absorbance at 260 nm and 230 nm


25

Table 8. B. depauperata RNA Concentrations, Ratio of the Absorbance at 260 nm and 280 nm, and Ratio of the Absorbance at 260 nm and 230 nm


HSP17.6 II, and HSP21 CP during basal and acquired heat-shock in these three Boechera

species. The following genes were successfully analyzed in A. thaliana and B. depauperata:

HSFA3, HSP101, and RuBisCO activase. I performed both basal and acquired heat-shock

treatments, but the heat shock temperatures were slightly different from the Arabidopsis

samples. I decided to use the 22°C (control), 30°C, 32°C, 34°C, 36°C, 38°C, 40°C, 42°C

basal temperatures and 40°C, 41°C, and 42°C acquired temperatures. In order to understand

more about the acquired heat stress, I also took samples after the 38°C pretreatment and the

22°C recovery treatments that are performed during the acquired heat shock.

It should be noted that the scales in each figure are different for each species. Each

graph (A, B, C, or D) per figure (14, 15, 16, 17, 18. 19, 20, 21) is in a different scale due to

the fold change differences amongst the four species. The scales also differ between different

gene graphs for each species. Each species expresses each HSP at different levels. No two

graphs were exactly the same as a result of this study. The data is also displayed in tables so

that absolute values of expression can be easily compared across species.

The reference genes had the following primer efficiencies; 18S was 107.73 with a

standard deviation of 9.98 and the Actin 3 efficiency was 95.02 with a standard deviation of

5.51. The gray bars in the Boechera bar graphs represent the samples taken during the

26

acquired pretreatments. These samples were not taken for the A. thaliana data since this was

a part of the preliminary data collection.

HSFA3 QPCR was used to test HSFA3 in the A. thaliana and B. depauperata species. The

average primer efficiency for the HSFA3 gene for these two species was 91.85 with a

standard deviation of 2.29 (see Table 2). This gene was only run as a single plate for each

species with each sample run in triplicate. The gene expression pattern for this transcription

factor is similar to the pattern seen in the HSP pattern for the A. thaliana species. The

HSFA3 expression pattern in B. depauperata is also similar to the HSP101 pattern for this

species (see Figures 14 and 15). The fold changes are much lower in the B. depauperata

species compared to the fold changes in A. thaliana (see Table 9).

Figure 14. Relative expression of HSFA3 in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is 6 replicates.

HSP101 HSP101 has a primer efficiency of 100.50 with a standard deviation of 8.14. This

amplification efficiency is only calculated from the A. thaliana and B. depauperata samples.

The primers that were designed using the A. thaliana HSP101 sequence were not efficient for

!" #"

Figure 10: Relative expression of HSFA3 in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using

both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of

either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock

experiments. N for each sample for each graph is 6 replicates.

HSFA3 Gene Expression in Boechera depauperata

22 30 32 34 36 38 40 42 38 22 40 41 420

20

40

60

80

100H

SF

A3 E

xp

ressio

n L

evel

(!!

Ct)

Temperature (°C)

Basal Acquired

AT-HSFA3 Gene Expression in Arabidopsis thaliana

Temperature (°C)

AT

-HS

FA

3 E

xp

ressio

n L

evel

(!!

Ct)

22 34 35 36 38 39 40 41 42 39 40 41 420

100

200

300

400

500

Basal Acquired

!"

27

Figure 15. Relative expression of HSP101 in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 10-12 replicates.

Table 9. HSFA3 Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures

Species Temperature (°C) A. thaliana B. depauperata 22 control 2.20 ± 0.90 2.20 ± 0.86 Basal Heat-Shock 34 basal 7.90 ± 2.90 11.90 ± 4.90 36 basal 37.90 ± 14.42 20.90 ± 6.99 38 basal 298.90 ± 130.54 30.10 ± 10.41 40 basal 10.10 ± 4.34 55.30 ± 22.00 42 basal 12.10 ± 5.59 2.10 ± 0.97 Acquired Heat-Shock 40 acquired 43.60 ± 18.00 41.60 ± 15.39 41 acquired 28.40 ± 40.09 53.90 ± 13.22 42 acquired 29.70 ± 12.57 53.10 ± 20.70

Note: Highest fold change is bolded for each species.

B. sparsiflora and B. pulchra. There is a much higher expression of HSP101 in A. thaliana

than in B. depauperata (see Table 10 and Figure 15). The highest expression of HSP101 is at

the 39°C basal treatment in A. thaliana (9,164.70 ± 3,974.86) and at the 42°C basal treatment

in B. depauperata (249.57 ± 74.27).

HSP101 Gene Expression in Arabidopsis thaliana

22 34 35 36 38 39 40 41 42 39 40 41 420

5000

10000

15000

HS

P101 E

xp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

!" #"

Figure 11: Relative expression of HSP101 in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using

both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of

either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock

experiments. N for each sample for each graph is from 10-12 replicates.

HSP101 Gene Expression in Boechera depauperata

Temperature (°C)

HS

P101 E

xp

ress

ion

Lev

el (!!

Ct)

22 30 32 34 36 38 40 42 38 22 40 41 420

100

200

300

400

Basal Acquired

28

Table 10. HSP101 Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures

Species Temperature (°C) A. thaliana B. depauperata 22 control 2.27 ± 0.67 2.92 ± 0.92 Basal Heat-Shock 34 basal 88.38 ± 35.31 39.59 ± 12.04 36 basal 906.57 ± 389.09 105.77 ± 8.90 38 basal 6,903.77 ± 2,860.78 138.50 ± 35.67 39 basal 9,164.70 ± 3,974.86 n/a 40 basal 4,807.47 ± 2,21.70 188.00 ± 56.64 42 basal 3,087.72 ± 1,268.62 249.57 ± 74.27 Acquired Heat-Shock 40 acquired 1,141.30 ± 484.31 117.20 ± 31.16 41 acquired 1,371.61 ± 596.00 176.09 ± 43.55 42 acquired 1,020.01 ± 438.65 225.25 ± 61.80


HSP20 I The expression levels for HSP20 I are the highest levels for all four species among all

genes of interest. The efficiency for this gene was 92.44 with a standard deviation of 4.02.

Again, the 38°C basal fold change in A. thaliana was the highest expression value

(1,343,677.00 ± 276,441.60) overall for HSP20 I. B. sparsiflora had the highest expression

level at the 36°C basal (120,448.30 ± 29,384.10) out of all four species. B. depauperata also

had the highest values for the 41°C and 42°C acquired treatments among all four species. It is

important to note that for HSP20 I, the scales are different on the graphs for each species,

which can be seen in Figure 16. However, when looking at the raw data, there are some

samples that have similar fold changes at certain temperatures. For instance, B. depauperata

and A. thaliana have relatively close expression values for the 34°C, 36°C, and 42°C basal

samples as well as the 41°C acquired sample (see Table 11).

HSP18.2 I The HSP18.2 I expression levels can be seen in Figure 17. Overall, HSP18.2 I has the

highest values in A. thaliana. Again, the expression pattern for A. thaliana has the highest

expression at the 38°C basal treatment. However, B. depauperata expresses HSP18.2 I

29

Figure 16. Relative expression of HSP20 I in (A) A. thaliana, (B) B. sparsiflora, (C) B. pulchra, and (D) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 11-12 replicates.

higher than the other species for the 34°C basal treatment. The 38°C basal treatments are

similar to the 38°C pretreatment values in both B. pulchra and B. sparsiflora. There is

relatively high expression for HSP18.2 I for B. depauperata and B. sparsiflora when

comparing this gene to the other genes for these species. There is also slightly higher

expression in the B. pulchra acquired samples compared to the basal samples for HSP18.2 I

(see Table 12). The scales are different on the HSP18.2 I graphs for each species, however,

when looking at the raw data- there are some samples that had similar fold changes at certain

temperatures. For instance, B. depauperata and A. thaliana have relatively close expression

values for the 34°C, 36°C, and 42°C basal samples.

HSP20 I Gene Expression in Boechera sparsiflora

22 30 32 34 36 38 40 42 38 22 40 41 420

50000

100000

150000

200000

Temperature (°C)

HS

P20 I

Exp

ress

ion

Lev

el (!!

Ct)

Basal Acquired

HSP20 I Gene Expression in Boechera depauperata

22 30 32 34 36 38 40 42 38 22 40 41 420

50000

100000

150000

200000

250000

HS

P20 I

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

HSP20 I Gene Expression in Boechera pulchra

Temperature (°C)

HS

P20 I

Exp

ress

ion

Lev

el (!!

Ct)

22 30 32 34 36 38 40 42 38 22 40 41 420

5000

10000

15000

20000

25000

Basal Acquired

HSP20 I Gene Expression in Arabidopsis thaliana

22 34 35 36 38 39 40 41 42 39 40 41 420

500000

1000000

1500000

2000000

HS

P20 I

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

!" #"

$" %"

30

Table 11. HSP20 I Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures

Species Temperature (°C) A. thaliana B. sparsiflora B. pulchra B. depauperata 22 control 1.56 ± 0.38 3.22 ± 1.06 1.25 ± 0.21 3.50 ± 1.38

Basal Heat-Shock 34 basal 23,701.81 ±

5,326.34 8,075.29 ± 2,452.56

2,276.00 ± 257.04

19,791.58 ± 6,899.50

36 basal 115,375.20 ± 41,993.70

120,448.30 ± 29,384.10

3,953.09 ± 673.55

90,660.07 ± 19,356.23

38 basal 1,343,677.00 ± 276,441.60

37,997.77 ± 10,758.44

9,488.79 ± 1,353.22

92,070.03 ± 36,974.26

40 basal 137,251.80 ± 39,495.07

45,416.39 ± 14,184.60

11,257.97 ± 1,363.96

90,207.50 ± 29,345.96

42 basal 54,398.40 ± 15,574.75

20,507.49 ± 7,170.61

5,487.10 ± 701.49

36,608.50 ± 14,088.38

Acquired Heat-Shock 40 acquired 104,462.30 ±

29,220.30 32,850.72 ±

8,739.90 6,673.84 ±

796.35 70,974.29 ± 21,845.94

41 acquired 131,229.80 ± 36,614,69

44,829.37 ± 13,288.17

12,348.92 ± 1,572.58

135,646.80 ± 45,287.96

42 acquired 66,051.76 ± 18,413.45

46,466.22 ± 13,328.38

17,252.14 ± 2,215.76

144,148.10 ± 48,493.63


HSP17.7 II The average primer efficiency for the HSP17.7 II gene for all of the species was 94.3

with a standard deviation of 5.72 (see Table 2). HSP17.7 II had the highest relative

expression for the 38°C sample in A. thaliana. B. sparsiflora had a high amount of

expression (11,610.97 fold change ± 1,666.83) for the 36°C basal temperature, compared to

the other expression values for this species (see Table 13). This is similar to the pattern seen

for 38°C basal (626,365.28 fold change ± 166,848.18) in A. thaliana. However, the overall

fold changes were much lower for all of the B. sparsiflora heat-shock treatment samples (see

Figure 18). B. pulchra had the lowest expression levels overall for all temperatures. The

highest expression level of HSP17.7 II for B. pulchra was at the 42°C acquired treatment

(1,899.86 ± 255.73). B. depauperata also had the highest expression level of HSP17.7 II at

the 42°C acquired treatment (3,550.37 ± 1,135.11) compared to the other samples for this

species.

31

Figure 17. Relative expression of HSP18.2 in (A) A. thaliana, (B) B. sparsiflora, (C) B. pulchra, and (D) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 8-12 replicates.

HSP17.6 II The primers that were designed for HSP17.6 II were designed based on the

A. thaliana HSP17.6 II sequence. However, these primers had inefficient amplification in

both the B. pulchra and B. sparsiflora species and for one of the B. depauperata plates. The

primer efficiencies for the B. pulchra plates were 111.77 and 145.80, for B. sparsiflora they

were 140.15 and 169. 48, and B. depauperata was 108.42 and 133.24. The poor efficiencies

were a result of two qPCR runs, proving that the bad efficiencies were a result of the primers

not annealing properly and not due to another experimental error. These efficiencies were not

HSP18.2 I Gene Expression in Boechera depauperata

22 30 32 34 36 38 40 42 38 22 40 41 420

20000

40000

60000

80000

100000

Temperature (°C)

HS

P18.2

I E

xp

ress

ion

Lev

el (!!

Ct)

Basal Acquired

HSP18.2 I Gene Expression in Boechera pulchra

Temperature (°C)

HS

P18.2

I E

xp

ress

ion

Lev

el (!!

Ct)

22 30 32 34 36 38 40 42 38 22 40 41 420

5000

10000

15000

20000

Basal Acquired

HSP18.2 I Gene Expression in Arabidopsis thaliana

22 34 35 36 38 39 40 41 42 39 40 41 420

100000

200000

300000

400000

500000H

SP

18.2

I E

xp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

!" #"

$" %"

HSP18.2 I Gene Expression in Boechera sparsiflora

22 30 32 34 36 38 40 42 38 22 40 41 420

50000

100000

150000

Temperature (°C)

HS

P18.2

I E

xp

ress

ion

Lev

el (!!

Ct)

Basal Acquired

32

Table 12. HSP18.2 I Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures



2,457.00 4,010.63 ±

1113.64 2,501.09 ±

306.24 10,281 ± 4360.84

36 basal 85,989.38 ± 35,317.52

79,075.72 ± 16,519.14

4,323.81 ± 772.54

66,068.78 ± 16,719.03

38 basal 405,097.20 ± 68,186.77

15,051.32 ± 3,660.11

8,323.66 ± 1,181.00

54,915.11 ± 21,900.79

40 basal 43,121.56 ± 18,210.39

19,596.54 ± 5,664.69

9,084.96 ± 1,077.91

27,380.30 ± 9526.93

42 basal 13,563.86 ± 5742.12

10,881.55 ± 3,316.64

4,759.99 ± 597.88

12,758.0 ± 4,994.48

Acquired Heat-Shock 40 acquired 54,704,34 ±

22,748.30 17,369.80 ±

4,250.33 6,918.49 ± 1,031.22

39,525.90 ± 14,006.72

41 acquired 65,179.59 ± 28,407.21

20,677.74 ± 5,538.52

11,704.04 ± 1,431.70

48,144.70 ± 17,715.21

42 acquired 41,818.17 ± 18,515.61

22,740.33 ± 7,514.08

14,808.97 ± 1,878.60

5,6974.71 ± 22,760.05


included in the Table 2 since they were above the range that is considered efficient

amplification.

The HSP17.6 II expression levels can be seen in Figure 19. The average primer

efficiency for the HSP17.6 II gene for A. thaliana and B. depauperata was 103.39

with a standard deviation of 22.63 (see Table 2). The A. thaliana samples had much

higher expression of HSP17.6 II when compared to B. depauperata (see Table 14).

A. thaliana had its highest fold change at the 38°C basal treatment (2,436,996.00 ±

712,817.40). B. depauperata has its highest fold change at the 42°C acquired treatment

(309.13 ± 85.12).

HSP21 CP HSP21 CP has a primer efficiency of 95.95 with a standard deviation of 5.09. The

A. thaliana 38°C basal treatment had the highest expression value (see Table 15). This

species also expressed the HSPs at a much higher level in comparison to the Boechera

33

Table 13. HSP17.7 II Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures



2,340.14 1,095.91 ±

332.98 348.16 ±

44.74 714.97 ± 256.23

36 basal 49,984.72 ± 15,716.26

11,610.97 ± 1,666.83

496.31 ± 82.71 2,627.23 ± 250.20

38 basal 626,365.28 ± 166,848.18

3,681.62 ± 946.51

1,331.00 ± 250.39

2,992.02 ± 777.92

40 basal 67,463.04 ± 21,376.08

4,659.03 ± 1,308.97

1,516.97 ± 238.52

3,104.60 ± 1,067.72

42 basal 27,297.20 ± 8,515.65

2,014.94 ± 580.07

724.27 ± 135.25

1,252.75 ± 393.75


75,71.82 4,158.80 ± 1,055.92

1,252.18 ± 210.94

2,517.56 ± 752.14

41 acquired 36,214.06 ± 10,778.17

5,427.83 ± 1,514.58

1,830.68 ± 254.58

3,279.68 ± 901.35

42 acquired 22,508.56 ± 6,237.58

5,556.17 ± 1,504.21

1,899.86 ± 255.73

3,550.37 ± 1,135.11


species. The HSP21 CP expression pattern seen in B. sparsiflora is very similar to the one

found for the HSP17.7 II gene. The 36°C basal treatment had the highest expression level

(8,635.26 ± 1,382.70) for this species. B. pulchra had the lowest HSP21 CP expression

values out of all four species (see Figure 20). The highest expression level for B. pulchra was

at the 42°C acquired treatment (1,822.42 ± 332.45). B. depauperata also had a spike at the

36°C basal treatment for HSP21 CP expression (19,293.47 ± 4,206.38).

RUBISCO ACTIVASE RuBisCO activase was only tested using one technical replicate (with three replicates

on one plate) in A. thaliana and B. depauperata as a preliminary screen for the activity of this

protein. Its expression was very low for both the A. thaliana and B. depauperata species (see

Figure 21). The expression levels only reached a fold change of (5.70 ± 2.63) in the 38°C

34

Figure 18. Relative expression of HSP17.7 II in (A) A. thaliana, (B) B. sparsiflora, (C) B. pulchra, and (D) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 11-12 replicates.

basal treatment in A. thaliana. The highest expression level for B. depauperata was at the

34°C basal treatment (3.30 ± 1.47), which can be seen in Table 16. Overall, expression levels

were around 1 or 2 in both species for most treatments. This led us to the decision to stop

further experiments with this gene, since the expression was so low.

HSP17.7 II Gene Expression in Boechera pulchra

22 30 32 34 36 38 40 42 38 22 40 41 420

500

1000

1500

2000

2500

HS

P17.7

II

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

HSP17.7 II Gene Expression in Boechera sparsiflora

Temperature (°C)

HS

P17.7

II

Exp

ress

ion

Lev

el (!!

Ct)

22 30 32 34 36 38 40 42 38 22 40 41 420

5000

10000

15000

Basal Acquired

HSP17.7 II Gene Expression in Arabidopsis thaliana

22 34 35 36 38 39 40 41 42 39 40 41 420

200000

400000

600000

800000

1000000

HS

P17.7

II

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

!" #"

$" %"

HSP17.7 II Gene Expression in Boechera depauperata

22 30 32 34 36 38 40 42 38 22 40 41 420

1000

2000

3000

4000

5000

HS

P17.7

II

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

35

Figure 19. Relative expression of HSP17.6 II in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 11-12 replicates.

Table 14. HSP17.6 II Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures

Species Temperature (°C) A. thaliana B. depauperata 22 control 3.93 ± 1.76 3.41 ± 1.28 Basal Heat-Shock 34 basal 59,529.06 ± 25,406.13 49.49 ± 15.58 36 basal 462,618.30 ± 215,576.00 203.91 ± 26.45 38 basal 2,436,996.00 ± 712,817.40 247.64 ± 82.64 40 basal 352,336.70 ± 169,024.08 201.14 ± 55.43 42 basal 136,560.60 ± 66,570.27 98.92 ± 51.41 Acquired Heat-Shock 40 acquired 270,412.60 ± 126,709.90 191.92 ± 51.41 41 acquired 344,648.90 ± 163,931.80 259.93 ± 73.36 42 acquired 202,124.50 ± 95,387.89 309.13 ± 85.12


HSP17.6 II Gene Expression in Boechera depauperata

22 30 32 34 36 38 40 42 38 22 40 41 420

100

200

300

400

500

HS

P17.6

II

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

HSP17.6 II Gene Expression in Arabidopsis thaliana

22 34 35 36 38 39 40 41 42 39 40 41 420

1000000

2000000

3000000

4000000H

SP

17.6

II

Exp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

!" #"

36

Table 15. HSP21 CP Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures



2,861.62 920.27 ± 294.35

398.98 ± 66.30

3,198.80 ± 1,066.53

36 basal 44,283.34 ± 18,819.12

8,635.26 ± 1,382.70

577.23 ± 86.68

19,293.47 ± 4,206.38

38 basal 572,746.10 ± 212,141.10

2,456.53 ± 630.32

1,195.34 ± 248.02

12,595.66 ± 4,030.11

40 basal 36,610.95 ± 14,145.15

3,809.90 ± 1,069.05

1,160.94 ± 191.77

13,128.87 ± 5,002.76

42 basal 33,309.65 ± 13,946.74

1,943.66 ± 565.59

763.54 ± 137.36

4,192.34 ± 1,440.00


14,145.15 3, 509.17 ±

913.67 1,263.64 ±

284.37 13,147.54 ±

4,230.31 41 acquired 49,817.86 ±

21,629.48 6,442.17 ±

1971.75 1,812.00 ±

381.93 13,402.79 ±

4,069.93 42 acquired 33,309.65 ±

13,946.74 6,160.31 ± 1,630.01

1,822.42 ± 332.45

14,981.81 ± 5,140.74


37

Figure 20. Relative expression of HSP21 CP in (A) A. thaliana, (B) B. sparsiflora, (C) B. pulchra, and (D) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 11-12 replicates.

HSP21 CP Gene Expression in Boechera pulchra

Temperature (°C)

HS

P21 C

P E

xp

ress

ion

Lev

el (!!

Ct)

22 30 32 34 36 38 40 42 38 22 40 41 420

500

1000

1500

2000

2500

Basal Acquired

HSP21 CP Gene Expression in Boechera depauperata

22 30 32 34 36 38 40 42 38 22 40 41 420

5000

10000

15000

20000

25000

HS

P21 C

P E

xp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

HSP21 CP Gene Expression in Boechera sparsiflora

Temperature (°C)

HS

P21 C

P E

xp

ress

ion

Lev

el (!!

Ct)

22 30 32 34 36 38 40 42 38 22 40 41 420

5000

10000

15000

Basal Acquired

HSP21 CP Gene Expression in Arabidopsis thaliana

22 34 35 36 38 39 40 41 42 39 40 41 420

200000

400000

600000

800000

1000000H

SP

21 C

P E

xp

ress

ion

Lev

el (!!

Ct)

Temperature (°C)

Basal Acquired

!" #"

$" %"

38

Figure 21. Relative expression of RuBisCO activase in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the temperature of either basal or acquired heat-shock, gray bars indicate the 38°C pretreatment and 22°C recovery samples taken during the acquired heat-shock experiments. N for each sample for each graph is from 6 replicates.

Table 16. RuBisCO Activase Mean Fold Changes (ΔΔCt) ± SEM for Select Temperatures

Species Temperature (°C) A. thaliana B. depauperata 22 control 2.80 ± 1.61 2.20 ± 0.85 Basal Heat-Shock 34 basal 1.70 ± 0.64 3.30 ± 1.47 36 basal 1.00 ± 0.39 2.40 ± 0.80 38 basal 5.70 ± 2.63 0.90 ± 0.31 40 basal 2.20 ± 0.96 0.50 ± 0.20 42 basal 2.90 ± 1.26 2.70 ± 1.31 Acquired Heat-Shock 40 acquired 1.40 ± 0.61 1.10 ± 0.45 41 acquired 0.90 ± 0.90 0.30 ± 0.31 42 acquired 1.50 ± 0.64 0.30 ± 0.12


RuBisCO Activase Gene Expression in Arabidopsis thaliana

Temperature (°C)

RA

Exp

ress

ion

Lev

el (!!

Ct)

22 34 35 36 38 39 40 41 42 39 40 41 420

2

4

6

8

10

Basal Acquired

!" #"

Figure 17: Relative expression of RuBisCO activase in (A) A. thaliana and (B) B. depauperata. Each graph includes the gene of interest

analyzed using both 18S and Act3 as reference genes. Bars show the mean values with the standard error of the mean. X axes indicate the


acquired heat-shock experiments. N for each sample for each graph is from 6 replicates.

RuBisCO Activase Gene Expression in Boechera depauperata

Temperature (°C)

RA

Exp

ress

ion

Lev

el (!!

Ct)

22 30 32 34 36 38 40 42 38 22 40 41 420

2

4

6

Basal Acquired

39

DISCUSSION

The gene expression experiments performed in this study have provided us with a

more quantitative understanding about the expression patterns for HSP genes in the

A. thaliana, B. sparsiflora, B. pulchra, and B. depauperata species. Considerable information

is available about the general expression patterns and function of these proteins but this is the

first study using qPCR to analyze these genes in A. thaliana and the first to examine HSP

expression with any gene expression technique in Boechera.

Previous studies of the comparative thermotolerance in Boechera and A. thaliana has

shown that the species B. depauperata has a much higher tolerance for high temperature

stress. The Waters lab has demonstrated that B. depauperata not only displays a higher

tolerance in terms of less chlorosis and plant death but that B. depauperata is able to continue

to photosynthesize even at temperatures at or above 45°C. The Waters lab also demonstrated

that the other Boechera species examined: B. pulchra and B. sparsiflora were more tolerant

to heat stress than A. thaliana but were not as thermotolerant as B. depauperata [26]. The

goals of my work were to establish gene expression patterns for key genes involved in

thermotolerance and to interpret these results in light of the comparative thermotolerance

data.

From the qPCR data that was collected, we can see some very interesting and

significant patterns. Most importantly, I have shown that A. thaliana has the highest

expression levels across all of the HSP genes examined. The pattern of high A. thaliana HSP

expression is seen for all of the heat shock genes examined: HSP101, HSP20 I, HSP18.2 I,

HSP17.7 II, Hsp17.6 II, and HSP21 CP. The extremely high expression of the HSP genes in

A. thaliana has been demonstrated by other methods most recently by gene chip analysis

[22], [31] and my findings are consistent with these previous studies.

In all of the A. thaliana genes examined, the highest expression was seen at 38°C

basal exposure. For example, A. thaliana had a fold change of about 2.5 million at the 38°C

basal treatment for HSP17.6 II. The other small HSP genes had similar high expression levels

at this heat-shock temperature, ranging from 400,000 (HSP18.2 II) at the low end to

1.3 million [32]. It is interesting to note how the HSP17.7 II and HSP21 CP genes had similar

40

fold changes of around 600,000. Even at the lowest basal treatments A. thaliana still

expressed the small HSPs at high levels, ranging from 7,000 (HSP21 CP and HSP18.2 II) at

the 34°C basal treatment to as high as 460,000 at the 36°C basal treatment in HSP17.6 II. We

can see that in the acquired heat-shock treatments, the HSP genes are expressed in

A. thaliana but not to the extremely high level seen at the 38°C basal treatment. These fold

changes range from 22,000 for the 42°C acquired treatment in HSP17.7 II to 344,000 for the

42°C acquired treatment in HSP17.6 II.

A. thaliana does not have the same gene expression pattern for HSP101 as it does for

the small HSPs. The fold changes are much lower for this protein with the 39°C basal

treatment being the highest of about 9,000. Also, the basal treatments are similar to some of

the acquired treatments for this A. thaliana gene 906.57 (36°C basal) to 1,300 (42°C

acquired). Overall, HSP101 expression in A. thaliana is not as high as it is in the small HSPs.

The coastal species, B. sparsiflora also has a clear expression pattern amongst the

small HSPs. There is a spike on the graphs for the 36°C basal treatment in HSP20 I, HSP18.2

I, HSP17.7 II, HSP17.6 II, and HSP21 CP. This pattern is similar to the one seen in

A. thaliana, however, it is seen at a lower temperature (36°C vs. 38°C for A. thaliana). The

36°C basal values in B. sparsiflora range from about 8,000 for HSP21 CP, 11,000 for

HSP17.7 II, 80,000 for HSP18.2 I, and 120,000 for HSP20 I. These values were nowhere

near as high as the values for the A. thaliana 38°C basal treatment. Which had a range of

400,000 for HSP18.2 I to 2.5 million fold change for HSP17.6 II. So, the highest 36°C basal

treatment for B. sparsiflora was much lower than the lowest 38°C basal treatment in

A. thaliana. Most of the values in the acquired treatments are a fourth to a tenth lower in

B. sparsiflora compared to A. thaliana. These values show that A. thaliana expresses all of

the small HSPs at a much larger rate than does B. sparsiflora.

The desert species, B. pulchra, also has a distinct pattern that is different than that

seen in A. thaliana and B. sparsiflora. Overall, B. pulchra has the lowest expression levels in

comparison to the 3 other species for all small HSP genes. Across all of the small HSPs, this

species had the highest expression levels for the 42°C acquired treatment. Overall, the pattern

is that the 41°C and 42°C acquired treatments were found to be higher in this species

compared to its basal treatments. For example, the 42°C acquired treatments range from

41

1,800 (HSP21 CP) to the highest at 17,000 (HSP20 I). The highest fold change out of all of

the small HSPs in A. thaliana was about 2.5 million at the 38°C basal treatment for

HSP17.6 II. The highest fold change found in B. sparsiflora was 120,000 at the 36°C basal

treatment in HSP20 I. Whereas the expression level range for the basal treatments are from

about 350 for the 34°C basal sample in HSP17.7 II to 11,000 for the 40°C basal sample in

HSP20 I. Also, the 38°C basal samples are very close in their values to the 40°C basal

samples. HSP 20 I had values with only a 2,000 fold change difference, HSP18.2 I had

values of only a 1,000 fold change difference, and HSP 17.7 II and HSP21 CP had almost

exactly the same fold changes differences for these two basal temperatures.

Examination of the expression of the HSF gene is highly informative. HSFA3 is one

of the heat-shock transcription factors and it plays an important role in inducing the

expression of the heat shock genes. All heat-inducible heat shock genes have heat shock

elements in the upstream region of the gene. During heat stress the HSFs bind to the heat

shock elements and the heat shock genes are expressed. From an examination of the HSF

expression patterns we see that A. thaliana has a very high expression level at 38°C and

lower levels in the acquired samples. It is important to note that the levels in the controls are

the same. In B. depauperata for basal stress the highest expression is not at 38°C but at 40°C

and that the levels of expression are very low for both species at control temps.

B. depauperata has higher levels of expression in the acquired 41°C and 42°C treatments.

An understanding of the expression patterns of HSFA3 is important because it and the

other HSFs control the expression of the heat shock genes. From this data we might expect

that the genes regulated by HSFA3 will have different patterns in A. thaliana and

B. depauperata and in fact we do see very different patterns of gene expression in

B. depauperata and the other two Boechera species compared to A. thaliana.

The mountainous species, B. depauperata, had similar levels in its basal treatments

versus its acquired treatments for the small HSP genes. Again, these levels were not as high

as those found in the A. thaliana HSPs. The HSFA3 expression levels for this species also

correlate to the expression levels in the HSPs. The expression levels are much lower in this

HSF and most of the basal and acquired levels are around a 30 to 50-fold change. There is a

low expression level of HSFA3 at the 42°C basal treatment of only 2.10. Perhaps, the HSFs

are not able to function at their optimum at this high temperature. This also correlates with

42

the small HSP gene data for B. depauperata, since the 42°C basal samples are lower than the

other heat-shock samples.

The small HSP pattern for B. depauperata is much different than the ones found in

A. thaliana, B. sparsiflora, and B. pulchra. There is no one temperature that has the highest

expression in all small HSPs for this species. Although, the basal treatments are expressed at

similar levels to the acquired treatments expressed in B. depauperata. For example, the

HSP17.7 II gene has expression levels of 600,000 for A. thaliana and is only at 3,500 for

B. depauperata. In HSP 20 I, the highest expression level in A. thaliana is 1.3 million at the

38°C basal treatment and the highest fold change in B. depauperata is only 150,000 at the

42°C acquired temperature. For HSP18.2 I, A. thaliana has a fold change of 400,000 at the

38°C basal treatment and B. depauperata has a fold change of about 66,000. The HSP17.6 II

expression level is highest in the 42°C acquired treatment in B. depauperata at around 300,

whereas the highest level in A. thaliana is at 2.5 million for the 38°C basal sample. Finally,

the HSP21 CP values are 600,000 for the A. thaliana 38°C basal sample and 20,000 for the

B. depauperata sample. These values are on different orders of magnitude. This just shows

the huge difference in expression of these genes in B. depauperata species compared to

A. thaliana.

HSP101 also shows a similar pattern to that seen with the small HSPs for

B. depauperata. The basal and acquired levels are expressed relatively the same. The levels

are also much lower than the levels seen for HSP101 in A. thaliana. The highest level of

expression in A. thaliana is about 7,000 at the 38°C basal treatment and for B. depauperata it

is only a 250-fold change for the 42°C basal treatment.

In summary, there are unique gene patterns for each species. There was high spike in

fold change for the A. thaliana 38°C basal and the B. sparsiflora 36°C basal samples

compared to the other temperatures in each of these species. Perhaps, this is the last

temperature each species can withstand before all cellular mechanisms begin to degrade. This

would explain the high expression level at this temperature and the drop in gene expression

when the temperature is increased thereafter.

There are some patterns that are consistent in one species for all HSP genes. First of

all, the expression pattern for A. thaliana was consistent for all of the genes analyzed.

43

Overall, A. thaliana had higher expression levels for all six HSPs that were evaluated as well

as for HSFA3, when compared to the three Boechera species. This is also consistent with the

phenotypic data previously obtained in the Waters lab [31].

The phenotypic thermotolerance data shows that the Boechera species can survive a

much longer duration of heat stress and at higher temperatures. The HSP20 and HSP18.2

genes had the highest levels of expression in the Boechera species. Perhaps these HSPs are

the most helpful for these species during heat stress.

It is also interesting to note how HSP17.7 II and HSP21 have similar patterns and

expression levels for A. thaliana, B. pulchra, and B. sparsiflora. This is a fascinating finding

especially since HSP17.7 is a cytosolic class II protein and HSP21 is a chloroplast protein.

Perhaps the two work together in some way in order to prevent further aggregation of

nonnative proteins.

There were tissue samples taken for all of the Boechera species during the

pretreatment procedure for the acquired heat-shock experiments. These species seem to have

similar gene expression levels when comparing the 38°C basal treatment with the 38°C

acquired pretreatment values. This is true of HSP20 I, HSP18.2 I, and HSP17.7 II. The

difference between these treatments is that the basal treatment is a 2-hour heat-shock, while

the 38°C acquired pretreatment was only a 1-hour heat-shock. This could infer that the HSP

genes are fully expressed after only 1 hour of heat-shock. It also seems that they are still fully

expressed at this level an hour later.

The RuBisCO activase data for A. thaliana and B. depauperata is consistent with data

found in the literature. Previous research has stated that RuBisCO Activase is sensitive to

temperatures as low as 30°C [27]. It would be interesting to perform a mild heat shock on the

species of interest in order to monitor the expressions levels of RuBisCO activase. Then I

may be able to detect the temperature in which this protein begins to degrade. This could also

be correlated with the onset of expression of HSPs. Perhaps, the HSPs allow RuBisCO

Activase to function at certain temperatures.

The gene expression analysis of the reference genes was performed as a second check

to make sure that the levels of these genes were consistent throughout the heat-shock

samples. There were no major discrepancies with either of the reference genes when

comparing them to each other or when comparing each reference gene against itself. This

44

assures that pipetting was relatively accurate, since the fold changes are stable for each

species.

The data generated here strongly suggest that the increased thermotolerance in all

Boechera species and in particular in B. depauperata is not due to elevated HSP expression.

The Boechera species express all of the small HSPs as well as HSP101 at a much lower level

in comparison to A. thaliana. The gene expression data also correlates with the climate,

which is inhabited by each of these different species. A. thaliana is found in a temperate

climate in Eastern Europe and therefore is used to a mild heat conditions. Therefore, it may

need the aid of the HSPs to help it survive when exposed to extreme heat stress.

B. sparsiflora is found on the coast of California and is used to moderate heat with less

variable temperature conditions. Therefore, it may need less help from the HSPs, but is more

sensitive to stress at a lower temperature than the other Boechera species. B. pulchra is a

California desert species and is therefore used to hot conditions with less variability in

temperature. Perhaps, the small HSPs do aid this plant in times of heat upregulation. Finally,

B. depauperata is found in the mountains of Northern California at a high altitude with

varying temperature. It has been found to have the highest thermotolerance using the

phenotypic data. This is also shown in the gene expression patterns, where this species

expresses these genes at a relatively stable level across treatments.

With this data as well as the knowledge that the Boechera species are phenotypically

more thermotolerant than A. thaliana, I can infer that there may be another system in the

Boechera species that is aiding these species during heat stress. Perhaps the Boechera species

have proteins that are less prone to aggregation due to the habitat in which they live.

Therefore, they do not need the help of the HSPs to deal with environmental stressors as

much as species like A. thaliana.

Reasons for the high thermotolerance of B. depauperata are still unknown but may be

due the climate that this species inhabits. This species grows at a higher altitude and in a

temperate climate. Perhaps, B. depauperata is more accustomed to variable living conditions.

We can infer from both studies that the patterns correlate when looking at both phenotypic

thermotolerance and gene expression data.

45

FUTURE DIRECTIONS

This study has answered a number of important questions, but it also raises other

questions worth of study. First, it would be interesting to test these HSPs in other species that

exist in similar habitats to the four species we have already tested. This will show whether

the gene expression patterns are specific to each species, or if it is indicative of the

environment in which they inhabit. The Waters lab has phenotypic thermotolerance data for

the B. perennans species, so it will be interesting to analyze the gene expression patterns for

this dessert species as well. There was a shortage of B. perennans seeds in order to perform

heat-shock experiments, so we have been collecting more seeds recently for this species. The

rest of the heat-shock experiments for this species will be performed soon, so we should be

able to move forward with plans to obtain data for this species as well. Then, I can compare

this desert species to the B. pulchra data to see if the patterns are similar.

The design of gene specific primers for the B. pulchra, B. perennans, and

B. sparsiflora species to re-test HSP101 and HSP17.6II genes using qPCR would provide

valuable information. This will be done using the same or similar procedure as was

previously performed in order to sequence HSP21 genes for all of the species. It will be

interesting to obtain data for the other species for the HSFA gene in order to see if the gene

expression patterns match the HSP expression patterns like they did in A. thaliana and

B. depauperata. It would also be interesting to examine other HSFs in order to correlate the

expression patterns of these HSFs to the HSP genes that they induce.

Another possibility for future work is to re-test the acquired heat-shock in

B. sparsiflora using 36°C as the pretreatment temperature instead of 38°C. This may alter the

acquired gene expression levels in this species. The choice of using the 38°C temperature as

a pretreatment for the other species was based on previous heat-shock experiments in the

literature.

After performing several qPCR experiments, I have learned several ways in order to

reduce the standard error values in my data. If I test only 5 temperatures per species, I will be

able to run more genes on one plate to be assayed during the same run. This should reduce

any variation I found from one plate to another plate. I can also test 6 genes of interest and

46

2 reference genes on two plates. Running each plate in triplicate will also decrease the

standard error values and assure that the data is accurate. I would also like to make a larger

pool of diluted cDNA in order to use across all plates. There are other HSPs that we may

choose to analyze in the future, so cutting down on the number of temperatures to run will

allow more genes to be analyzed on a single plate.

Analyzing a wider range of species with similar habitats to A. thaliana, B. sparsiflora,

B. pulchra, and B. depauperata will also expand our knowledge on the behavior of HSPs.

There are more Boechera species that the Waters lab is interested in researching. Examining

the thermotolerance of these species using a similar gene expression analysis will provide us

with a further understanding of the correlation between HSP gene expression and the climate

these plant species inhabit.

47

REFERENCES

[1] Lawlor DW: Musings about the effects of environment on photosynthesis. Ann Bot 2009, 103:543-549.

[2] Somero GN: The physiology of climate change: how potentials for acclimatization and genetic adaptation will determine ‘winners’ and ‘losers’. J Exp Biol 2010, 213:912-920.

[3] Boston RS, Viitanen PV, Vierling E: Molecular chaperones and protein folding in plants. Plant Mol Biol 1996, 32:191-222.

[4] Haslbeck M, Franzmann T, Weinfurtner D, Buchner J: Some like it hot: the structure and function of small heat-shock proteins. Nat Struct Mol Biol 2005, 12:842-846.

[5] Vierling E: The small heat shock proteins in plants are members of an ancient family of heat induced proteins. Acta Physiol Plant 1997, 19:539-547.

[6] Vierling E: The roles of heat shock proteins in plants. In Briggs, W R. 1991: 579-620: Annual Review of Plant Physiology and Plant Molecular Biology.

[7] Tyedmers J, Mogk A, Bukau B: Cellular strategies for controlling protein aggregation. Nat Rev Mol Cell 2010, 11:777-788.

[8] Johnston JA, Ward CL, Kopito RR: Aggresomes: A cellular response to misfolded proteins. J Cell Biol 1998, 143:1883-1898.

[9] Chen B, Retzlaff M, Roos T, Frydman J: Cellular strategies of protein quality control. Cold Spring Harbor Perspect Biol 2011, 3:14.

[10] Liberek K, Lewandowska A, Zietkiewicz S: Chaperones in control of protein disaggregation. EMBO J 2008, 27:328-335.

[11] Eyles SJ, Gierasch LM: Nature’s molecular sponges: small heat shock proteins grow into their chaperone roles. PNAS USA 2010, 107:2727-2728.

[12] Hong SW, Vierling E: Hsp101 is necessary for heat tolerance but dispensable for development and germination in the absence of stress. Plant J 2001, 27:25-35.

[13] Tonsor SJ, Scott C, Boumaza I, Liss TR, Brodsky JL, Vierling E: Heat shock protein 101 effects in A. thaliana: genetic variation, fitness and pleiotropy in controlled temperature conditions. Mol Ecol 2008, 17:1614-1626.

[14] Sun WN, Van Montagu M, Verbruggen N: Small heat shock proteins and stress tolerance in plants. BBA-Gene Struct Expr 2002, 1577:1-9.

[15] Waters ER, Lee GJ, Vierling E: Evolution, structure and function of the small heat shock proteins in plants. J Exp Bot 1996, 47:325-338.

48

[16] Neta-Sharir I, Isaacson T, Lurie S, Weiss D: Dual role for tomato heat shock protein 21: protecting photosystem II from oxidative stress and promoting color changes during fruit maturation. Plant Cell 2005, 17:1829-1838.

[17] Kotak S, Larkindale J, Lee U, von Koskull-Doering P, Vierling E, Scharf K-D: Complexity of the heat stress response in plants. Curr Opin Plant Biol 2007, 10:310-316.

[18] The Arabidopsis Information Resource (TAIR). www.tair.org. [19] Yoshida T, Ohama N, Nakajima J, Kidokoro S, Mizoi J, Nakashima K, Maruyama K,

Kim JM, Seki M, Todaka D, et al: Arabidopsis HsfA1 transcription factors function as the main positive regulators in heat shock-responsive gene expression. Mol Genet Genomics 2011, 286:321-332.

[20] Agarwal M, Katiyar-Agarwal S, Sahi C, Gallie DR, Grover A: Arabidopsis thaliana Hsp100 proteins: kith and kin. Cell Stress Chaperones 2001, 6:219-224.

[21] Larkindale J, Vierling E: Core genome responses involved in acclimation to high temperature. Plant Physiol 2008, 146:748-761.

[22] Waters ER, Aevermann BD, Sanders-Reed Z: Comparative analysis of the small heat shock proteins in three angiosperm genomes identifies new subfamilies and reveals diverse evolutionary patterns. Cell Stress Chaperones 2008, 13:127-142.

[23] Wehmeyer N, Vierling E: The expression of small heat shock proteins in seeds responds to discrete developmental signals and suggests a general protective role in desiccation tolerance. Plant Physiol 2000, 122:1099-1108.

[24] Pavlova EL, Rikhvanov EG, Tauson EL, Varakina NN, Gamburg KZ, Rusaleva TM, Borovskii GB, Voinikov VK: Effect of salicylic acid on the development of induced Thermotolerance and induction of heat shock protein synthesis in the Arabidopsis thaliana cell culture. Russian J Plant Physiol 2009, 56:68-73.

[25] DeRidder BP, Salvucci ME: Modulation of Rubisco activase gene expression during heat stress in cotton (Gossypium hirsutum L.) involves post-transcriptional mechanisms. Plant Science 2007, 172:246-254.

[26] The Arabidopsis Biological Resource Center. www.osu.abrc.edu. [27] Ortmann, L.M (2009). Comparative thermotolerance in the genus Boechera

(Master’s thesis). San Diego State University, San Diego, CA. [28] National Center for Biotechnology Information (NCBI). www.ncbi.nlm.nih.gov.

[29] Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR: Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol 2005, 139:5-17.

[30] Siddique M, Gernhard S, von Koskull-Doering P, Vierling E, Scharf K-D: The plant sHSP superfamily: five new members in Arabidopsis thaliana with unexpected properties. Cell Stress Chaperones 2008, 13:183-197.

49

[31] Swindell WR, Huebner M, Weber AP: Transcriptional profiling of Arabidopsis heat shock proteins and transcription factors reveals extensive overlap between heat and non-heat stress response pathways. BMC Genomics 2007, 8.

[32] Barta C, Dunkle AM, Wachter RM, Salvucci ME: Structural changes associated with the acute thermal instability of Rubisco activase. Arch Biochem Biophysics 2010, 499:17-25.

boechera sparsiflora boechera pulchra, and

Documents