BiotechnologyBiotechnology

Use of Natural Biological Use of Natural Biological Systems to Produce a ProductSystems to Produce a Productor Provide a Desired Process or Provide a Desired Process

Recombinant DNA TechnologyRecombinant DNA Technology

• A set of techniques used to A set of techniques used to produce large quantities of a gene produce large quantities of a gene and its productand its product

• Recombinant DNA = DNA Recombinant DNA = DNA produced by joining segments of produced by joining segments of DNA from different sourcesDNA from different sources• eg. To produce human insulin, eg. To produce human insulin,

scientists have combined bacterial scientists have combined bacterial DNA + human DNA DNA + human DNA

Tools for Producing Tools for Producing Recombinant DNARecombinant DNA

Restriction enzymes: enzymes that Restriction enzymes: enzymes that cleave the DNA double helix at cleave the DNA double helix at specific nucleotide sequencesspecific nucleotide sequences

Use of the Restriction Enzyme Use of the Restriction Enzyme Bam H1Bam H1

5’— G G A T C C — 3’5’— G G A T C C — 3’ 3’— C C T A G G — 5’3’— C C T A G G — 5’

5’— G G A T C C — 3’5’— G G A T C C — 3’ 3’— C C T A G G — 5’3’— C C T A G G — 5’

sticky endsticky end

sticky endsticky end

Results inResults in

Tools for Producing Tools for Producing Recombinant DNARecombinant DNA

Vector: carrier of DNA; can be virus or plasmid Vector: carrier of DNA; can be virus or plasmid

Plasmid: extrachromosomal, independently Plasmid: extrachromosomal, independently replicating, small circular DNA moleculereplicating, small circular DNA molecule

Producing Recombinant DNAProducing Recombinant DNA

restriction enzyme

Treat source Treat source DNA with DNA with restrictionrestrictionenzymeenzyme

Treat plasmid Treat plasmid DNA with DNA with same enzymesame enzyme

restriction enzyme

Mix togetherMix togetherAdd DNA LigaseAdd DNA Ligase

Many recombinant DNAMany recombinant DNAmolecules are produced,molecules are produced,each with a different each with a different piece of source DNA piece of source DNA

TransformTransform bacterial cells bacterial cells

Each bacterial cellEach bacterial cellcarries a different carries a different recombinant plasmidrecombinant plasmid

Tools for Producing Tools for Producing Recombinant DNARecombinant DNA

Probe: sequence of DNA that is Probe: sequence of DNA that is complementary to the gene of interest; complementary to the gene of interest; Used to locate a copy of the gene by Used to locate a copy of the gene by hybridizationhybridization

Add ProbeAdd ProbeProbe Binds to gene Probe Binds to gene

AGCTTAGCGATAGCTTAGCGATTCGAATCGCTATCGAATCGCTA

AATCGCAGCTTAGCGATAGCTTAGCGAT

TCGAATCGCTATCGAATCGCTA

Denature DNA by heatingDenature DNA by heating

Using the Probe to Find the Gene of Interest

Biotechnological Methods: PCRBiotechnological Methods: PCRhttp://www.dnalc.org/resources/animations/pcr.htmlhttp://www.dnalc.org/resources/animations/pcr.html

PCR = Polymerase Chain Reaction PCR = Polymerase Chain Reaction

Amplifies a specific region in the DNAAmplifies a specific region in the DNA Used for identification, especiallyUsed for identification, especially if the amount of DNA is small if the amount of DNA is small Uses repeated cycles of heating to Uses repeated cycles of heating to denature DNA and cooling to synthesize denature DNA and cooling to synthesize new DNA new DNAInvolves the use of Involves the use of

---Taq polymerase (a DNA polymerase ---Taq polymerase (a DNA polymerase that withstands heat) that withstands heat)

---primers to begin synthesis---primers to begin synthesis

DNA Fingerprinting with PCRDNA Fingerprinting with PCR

DNA Fingerprinting for Paternity TestingDNA Fingerprinting for Paternity Testing

CC  SSRR  CCII  EE

MM  NNEE  EE

DNA Fingerprinting in ForensicsDNA Fingerprinting in Forensics

11 22 33 44 55 66 77

SuspectsSuspects SuspectsSuspects

Biotechnological MethodsBiotechnological MethodsDNA Sequencing: Determining the Order of NucleotidesDNA Sequencing: Determining the Order of Nucleotides

DNA sequence for geneDNA sequence for gene from cress plant from cress plant Arrows show differences Arrows show differences

in DNA sequences related in DNA sequences related to inherited breast cancerto inherited breast cancer

Human Genome ProjectHuman Genome Project

• An effort to determine the sequences of An effort to determine the sequences of all human genesall human genes– Genomics: study of DNA sequencesGenomics: study of DNA sequences– Proteomics: study of proteins produced in Proteomics: study of proteins produced in

a specific organism or cell typea specific organism or cell type– Bioinformatics: using computer databases Bioinformatics: using computer databases

to store and analyze sequence informationto store and analyze sequence information

Applications of BiotechnologyApplications of BiotechnologyTransgenic BacteriaTransgenic Bacteria

Transgenic: organism that contains a Transgenic: organism that contains a gene from another species in all of its gene from another species in all of its cellscells

Transgenic bacteria that produceTransgenic bacteria that produceHuman InsulinHuman InsulinHuman growth factorHuman growth factortissue plasminogen activator (t-PA)tissue plasminogen activator (t-PA)hepatitis B vaccinehepatitis B vaccine

Applications of BiotechnologyApplications of Biotechnology Transgenic Plants Transgenic Plants

Bt Corn: ProducesBt Corn: Producesits own Pesticideits own Pesticide

““Golden” rice with Golden” rice with beta-carotene and beta-carotene and extra ironextra iron

Roundup Ready SoybeansRoundup Ready Soybeansare resistant to herbicideare resistant to herbicide

Applications of BiotechnologyApplications of Biotechnology Transgenic Animals Make Human Gene ProductsTransgenic Animals Make Human Gene Products

Human gene

product will be released

in milk

Applications of BiotechnologyApplications of Biotechnology Transgenic Animals as Models of Human DiseasesTransgenic Animals as Models of Human Diseases

Transgenic Mouse with

defective human

hormone gene

interfering with growth

Same type of mouse “rescued”

by blocking action of

human gene

Gene Therapy Gene Therapy for SCIDfor SCID

Andrew GobeaEx vivo: Gene is

introduced into cells

outside the body

In vivoIn vivo Gene TherapyGene Therapy

Blindness: Leber’s Congenital Amaurosis (LCA)Blindness: Leber’s Congenital Amaurosis (LCA)

Cystic FibrosisCystic Fibrosis

Aerosol spray

delivers gene

Injection of gene