Asb-9 mediated degradation of CKB

ANKYRIN REPEAT AND SOCS BOX CONTAINING PROTEIN ASB-9 TARGETSCREATINE KINASE B FOR DEGRADATION

Running Title: Asb-9 mediated degradation of CKB

Marlyse A. Debrincat1,2,3, Jian-Guo Zhang1,2, Tracy A. Willson1,2, John Silke4, Lisa M.Connolly5, Richard J. Simpson5, Warren S. Alexander1, Nicos A. Nicola1 Benjamin T. Kile2, andDouglas J. Hilton2*

1Division of Cancer and Haematology, The Walter and Eliza Hall Institute of Medical Research, 1GRoyal Parade, Parkville, Victoria, 3050, Australia; 2Division of Molecular Medicine, The Walter andEliza Hall Institute of Medical Research, 1G Royal Parade, Parkville, Victoria, 3050, Australia; 3TheDepartment of Medical Biology, The University of Melbourne, Parkville 3010, Australia;4Department of Biochemistry, RL Reid Building, La Trobe University, Victoria 3086, Australia; 5TheJoint ProteomicS Laboratory of the Walter and Eliza Hall Institute and Ludwig Institute for CancerResearch, Royal Melbourne Hospital, Victoria 3050, Australia.

*To whom correspondence should be addressed. Mailing address: Division of Molecular Medicine,The Walter and Eliza Hall Institute of Medical Research, 1G Royal Parade, Parkville, Victoria, 3050,Australia. Tel.: + 61 3 9345 2555; Fax: + 61 3 9347 0852; E-mail: hilton@wehi.edu.au

1

http://www.jbc.org/cgi/doi/10.1074/jbc.M609164200The latest version is at JBC Papers in Press. Published on December 5, 2006 as Manuscript M609164200

Copyright 2006 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

SUMMARY

The suppressors of cytokine signaling (SOCS)proteins inhibit cytokine action by directinteraction with Janus kinases (JAKs) oractivated cytokine receptors. In addition tothe N-terminal and SH2 domains thatmediate these interactions, SOCS proteinscontain a C-terminal SOCS box. DNAdatabase searches have identified a number ofother protein families that possess a SOCSbox, of which, the ankyrin repeat and SOCSbox-containing (Asb) proteins constitute thelargest. While it is known that the SOCSproteins are involved in the negativeregulation of cytokine signaling, the biologicaland biochemical functions of the Asbs arelargely undefined. Using a proteomicsapproach, we demonstrate that creatinekinase B (CKB) interacts with Asb-9 in aspecific, SOCS box independent manner.T h i s i n t e r a c t i o n i n c r e a s e s t h epolyubiquitylation of CKB and decreasestotal CKB levels within the cell. Thetargeting of CKB for degradation by Asb-9was primarily SOCS box dependent andsuggests that Asb-9 acts as a specific ubiquitinligase regulating levels of this evolutionarilyconserved enzyme.

INTRODUCTION

The suppressor of cytokine signaling (SOCS)proteins function as part of a classical negativefeedback loop, attenuating cytokine actionthrough inhibition of the JAK/STAT signaltransduction pathway (1). The SOCS proteinshave an N-terminal region, a central SH2domain and a conserved C-terminal motif ofapproximately 40 amino acids, termed the SOCSbox. Structural and functional analyses haveshown that SOCS proteins mediate their effectsby direct interaction with activated JAKs andcytokine receptors via their N-terminal and SH2domains (2). Recent in vivo evidence revealed,however, that for a complete termination ofsignal transduction, the SOCS box is alsorequired (3).

The SOCS box was first identified in the SOCSproteins and has since been found in more than50 proteins across a range of species (4,5).These proteins have been sub-divided into ninedifferent families based on the type of domain ormotif they possess upstream of the SOCS box

and include the eight SOCS proteins, eighteenankyrin repeat-containing SOCS box proteins(Asbs), four SPRY-domain proteins with aSOCS box (SSBs) and two WD40-repeatproteins with a SOCS box (WSBs) (4,5). TheSOCS box from several of these familymembers binds Elongin C, which in turnassociates with a complex consisting of ElonginB, a cullin family member (Cullin-2 or Cullin-5)and a RING-finger protein called Roc1 or Rbx1(5-7). This protein complex constitutes an E3ubiquitin ligase termed the ECS (Elongin C-cullin-SOCS box) that, together with a ubiquitinactivating enzyme (E1) and a ubiquitinconjugating enzyme (E2), facilitates thepolyubiquitylation and proteasomal degradationof bound proteins, thereby regulating proteinlevels within the cell (8,9). Other studiessuggest an additional role for the SOCS box, inparticular that the SOCS box-Elongin B/Cinteraction may act to stabilize SOCS proteins,thereby protecting SOCS proteins fromdegradation (10-12).

The Asbs constitute the largest family of SOCSbox-containing proteins, with eighteen murineand human Asbs identified, yet their biologicaland biochemical functions have not beencompletely defined. The Asbs contain a proteininteraction motif upstream from the SOCS boxcomposed of a variable number of ankyrinrepeats. The ankyrin repeat consensus is 33amino acids in length and is found in eukaryotic,bacterial and viral proteins with variousfunctions including receptors, cell cycleregulators, secreted proteins, tumor suppressorsand transcription factors (13) (reviewed in (14)).Each ankyrin repeat comprises a V-shaped helix-turn-helix motif, linked together by loops. Therepeats are stacked in bundles providing a stableplatform for protein-protein interactions(reviewed in (15)).

The Asbs have been implicated in differentbiological processes; Asb-2 may regulatemyeloid cell proliferation and/or differentiation(16,17), Asb-5 plays a possible role in theinitiation of arteriogenesis (18), Asb-11 mayregulate the proliferation and differentiation ofthe developing nervous system (19) while Asb-15 has been reported to regulate muscle growthby acting as a negative regulator of proliferatingmuscle cells and by increasing the rate of proteinsynthesis in differentiated myoblasts (20,21).Asb-8 has been implicated in cancer, with Asb-8

2

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

expression undetectable in normal adult lungtissue but present in several lung carcinoma celllines. Transfection of a possible dominantnegative form of Asb-8 (human Asb-8 cDNAlacking the SOCS box), suppressed the growthof lung adenocarcinoma cells in vitro, implyingan association of Asb-8 with the development oflung cancer (22). The function of Asb-1 wasstudied by utilizing genetically modified mice.Although Asb-1 knock-out mice displayed sometesticular anomalies, it was concluded thatdeletion and over-expression of Asb-1 had noobvious effect on mouse development, thussuggesting a possible redundancy between Asbproteins (23).

Recent studies propose that the Asbs perform ananalogous role to the SOCS proteins, regulatingvarious signaling pathways via an interactionbetween the SOCS box motif and the ElonginB/C complex to initiate ubiquitylation andproteasomal degradation of proteins bound to theankyrin repeat region. One study reported thatAsb-2 may target regulators of hematopoiesis fordegradation by assembling into an ECS-type E3ubiquitin ligase with the Elongin B/C complex,Cullin-5 and Rbx-1 (24). In a separate study,TNF-R2 mediated cellular responses to TNF-αwere negatively regulated by Asb-3. Down-regulation of Asb-3 by RNAi led to anaccumulation of TNF-R2 and TNF-R2associated cytotoxicity (25). Finally, Asb-6 wasfound to interact with the adaptor protein APS(adaptor protein with Pleckstrin homology andSH2 domain), which couples the insulin receptorto components of a glucose transport pathway.Following prolonged insulin stimulation, APSwas degraded when Asb-6 was over-expressed(26).

Creatine kinase, an evolutionarily conservedenzyme, is critical for the maintenance andregulation of cellular energy stores in tissueswith high and rapidly-changing energy demandssuch as skeletal and cardiac muscle and thebrain. In mammals, three cytosolic (CKM,CKB, CKMB) and two mitochondrial (CKMt1and CKMt2) isoforms of creatine kinase areexpressed. CKM is muscle specific, CKMB, aheterodimer of both muscle and brain subunits,is predominantly expressed in heart while thetwo mitochondrial creatine kinase isoforms,ubiquitous CKMt1 and sarcomeric CKMt2 arelocated in the mitochondrial intermembranespace and are often co-expressed with the

cytoplasmic creatine kinases. The brain-typecytosolic enzyme of creatine kinase, CKB, playsa major role in cellular energy metabolism ofnon-muscle cells. CKB is expressed in a rangeof tissues, mainly in the brain and retina, butalso in uterus, placenta, kidney and testes. Thereis ample evidence that the CK system is linkedwith brain and muscle function (reviewed in(27)). A number of neurological and musculardiseases display perturbations in CK activity andcreatine metabolism although the causalrelationships of many are not known. A role forCKB in brain function is further supported byaltered behavioural patterns observed in CKBknock-out mice (28).

Over-expression of CKB has been observed in anumber of tumors including neuroblastoma,small-cell lung carcinoma, colon and rectaladenocarcinoma and breast and prostatecarcinoma as well as some tumor cell lines(reviewed in (29) and (27)). Elevated CKBexpression was also reported in B-lineage cellsfrom patients with acute lymphoblasticleukaemia (30). Furthermore, CKB is inducedby the adenovirus E1a oncogene (31).Conversely, wild-type p53 repressed the CKBpromoter (32). In fact, many human small celllung carcinomas, which exhibit elevated CKBexpression, contain mutations in p53 alleles(reviewed in (27)).

As SOCS box-containing proteins target specificproteins for degradation via a SOCS boxdependent manner, we reasoned that the key toelucidating the function of the Asb proteinfamily is to study the proteins with which theyinteract. Here, we report the identification ofCKB as a specific binding partner of Asb-9 within vitro and in vivo confirmation of theinteraction in primary cells. We show that theinteraction leads to CKB ubiquitylation anddegradation in a SOCS box-dependent mannersuggesting that Asb-9 acts as a specific ubiquitinligase regulating CKB abundance.

3

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

EXPERIMENTAL PROCEDURES

Northern Hybridization. Tissues weredissected from 8 week-old C57BL/6 mice andimmediately snap frozen in liquid nitrogen.Total RNA was extracted from tissues usingTRIzol reagent according to the manufacturer’sinstructions (Invitrogen). Northern blots wereperformed after electrophoresis, as described(33). For Northern blot hybridization, the entirecoding region of the mouse Asb-9 cDNA wasused. The membrane was stripped and re-hybridized with a 1.2 kbp PstI fragment of thech i cken g lyce r a ldehyde -3 -phospha t edehydrogenase (GAPDH) cDNA to control forRNA loading and integrity.

Expression of Asb-9 and CKB in 293T cells.Total cellular RNA was isolated using TRIzolreagent (Invitrogen) as per manufacturer’sinstructions. First strand cDNA synthesis wasperformed using Superscript III RNAase H-

reverse transcriptase (Invitrogen). Forward (F)and reverse (R) oligonucleotides specific for thesequence of human Asb-9 and CKB wered e s i g n e d . A s b - 9 : ( F ) 5 ' -GAGTCAGGAGCGGACGTG-3' and (R) 5'-CGTTTGCCTTCAGCATTCTT-3'; CKB: (F)5'-CGGTATCTGGCACAATGACA-3' and (R)5'-GGGTGAACACCTCCTTCATGT-3'. PCRconditions were as follows: initial denaturationat 95˚C for 15 min, followed by 35 cycles of95˚C, 15 sec; 60˚C, 30 sec; 72˚C, 30 sec.

Expression Vectors for TransientTransfections. The cDNAs encoding Asb-1 toAsb-12, Asb-14, Asb-15, Asb-17, SOCS-3 andWSB-1 were obtained as described (2,4,34).Constructs encoding these proteins, with orwithout the SOCS box, with an N-terminalFLAG epitope tag (DYKDDDDK) weregenerated by PCR to give fragments with in-frame MluI restriction enzyme sites at both the Nand C-termini and were subcloned into themammalian expression vector pEF-FLAG-I.

Transfection of 293T Cells. Human embryonickidney 293T cells were plated at a density of 8 x106 cells per Nunclon 175 cm2 tissue cultureflask (Nalge Nunc International) or in 6 wellCostar plates (Corning Incorporated) at 0.5 x 106

cells/well and cultured in Dulbecco’s ModifiedEagle Medium (DMEM) supplemented with10% [v/v] fetal calf serum (HyCloneLaboratories). Cells were incubated overnight at

37˚C in an humidified atmosphere of 10% CO2

in air and transfected with a maximum of 2.5 µgof pEF-FLAG-I expression vector containing thecDNA of interest, using FuGene transfectionreagent (Roche) according to the manufacturer’sinstructions. Where indicated, the proteasomalinhibitor PS341 was used at a concentration of10 nM diluted in DMSO. Cells were treatedwith PS341 for 24 h.

Transfection of HeLa Cells with Asb-9.Human epitheloid cervical carcinoma HeLa cellswere plated in 6 well Costar plates as describedfor the 293T cells. HeLa cells were transfectedwith 0-2.5 µg of empty vector and pEF-FLAG-Asb-9 or pEF-FLAG-Asb-9 lacking the SOCSbox (/∆SB) using the Lipofectamine transfectionreagent (Invitrogen) according to themanufacturer’s instructions.

Constructs for Stable Cell Lines. H A -ubiquitin N-terminus FLAG was amplified frompcDNA5 FRT TO HA-ubiquitin as describedelsewhere (35) with oligonucleotides (5'-GCTGATGCGCGGCCGCTTAGCTAGCCAGGCGCGCCGCGGATCCCTTGTCATCGTCGTCCTTGTAGTCAGTTGCCCCACCTCTGAG–3 ' ) a n d ( 5 ' -CGCGGTACCACCATGGCAAGCTACCCTTATGACGTCCC–3'), digested with KpnI andNotI and inserted into pcDNA5 FRT TOdigested with KpnI and NotI to create pcDNA5FRT TO HA-ubiquitin N-FLAG. This vectorwas digested with AscI and the Asb-9 and Asb-9/ΔSB inserts were cloned in with AscI and MluIfrom pEF-Asb-9 and pEF-Asb-9/Δ SB. Allconstructs were verified by sequencingthroughout the complete coding sequence.

Generation of Stable Cell Lines. Stable celllines were established by transiently transfectingthe Flp-In™ T-REx™ 293 cell line (Invitrogen)with pcDNA5 FRT TO constructs (Invitrogen)with the recommended amount of pOG44. 24 hafter transfection cells were split into 15 cmtissue culture plates and selected with 500µg/mL Hygromycin (Invitrogen) in DMEsupplemented with 10% FCS (Gibco). After 1week, individual colonies were picked, thenexpanded and tested for doxycyclin (Sigma)regulated expression of the relevant construct,using protein separation on SDS-PAGE gelsfollowed by Western blot analysis.

4

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

Cell Lysis and Affinity Purification. Cellswere lysed in NP-40 buffer (0.5% [v/v] NonidetP-40, 10 mM Tris-HCl [pH 7.5], 150 mM NaCl,1 mM EDTA, 10% glycerol) containing proteaseinhibitors (Complete cocktail tablets, Roche) for30 min on ice. For the ubiquitylation studies,cells were treated with KALB lysis buffer (150mM NaCl, 50 mM Tris [pH 7.5], 1% [v/v]Triton X-100, 1 mM EDTA, 1 mM Na3VO4, 10mM NaF) containing protease inhibitors(Complete cocktail tablets, Roche). For large-scale affinity purification, clarified lysates wereincubated with anti-FLAG M2 resin for 3-4 h at4˚C and then poured into Poly-prepchromatography columns (BioRad) to recoverthe M2 beads. The affinity resin was thensubjected to 5 x 2 mL washes with lysis buffer.Bound proteins were subsequently eluted with 8x 0.2 mL of 200 µg/mL FLAG peptide. Eluateswere pooled and concentrated to 40 µL using aMillipore concentration unit (molecular weightcut-off of 10,000), mixed with 15 µL of 4x SDSsample buffer containing 0.2 M DTT andresolved on a 4-20% gradient gel (Novex). Thegel was stained with 0.1% Coomassie Blue(Pierce) in 50% [v/v] methanol and destained in12% [v/v] methanol and 7% [v/v] acetic acid.

Preparation of Tissue Lysates andQuantification of Protein. Tissues to beanalyzed were dissected from mice andimmediately snap frozen in liquid nitrogen. Forcollection of bone marrow, one femur wasflushed into DME supplemented with 10% FCS.Cells were pelleted at 450 g for 3 min. Cellpellet and tissues were stored at –70˚C untillysis. Bone marrow cells were lysed in 200 µLof NP40 lysis buffer on ice. Tissues were lysedby dounce homogenisation in lysis buffer.Insoluble material was removed bycentrifugation and protein quantitated using aBCA protein assay kit (Pierce) as permanufacturer’s instructions.

Protein Identification by Tryptic Digest andMass Spectrometry. Protein bands wereexcised and digested in situ using trypsin (36).Peptides were separated by capillarychromatography (37) and sequenced using anon-line electrospray ionization ion-trap massspectrometer (ESI-IT-MS) (LCQ Thermo-Finnigan, San Jose, CA, USA). Operatingconditions for ESI-IT-MS and MS data analysisare described elsewhere (38). Automatically

selected tryptic peptide ions were identifiedusing the SEQUEST algorithm incorporated intothe Finnigan XcaliburTM software (39). A non-redundant protein database produced by theOffice of Information Technology of the LudwigInstitute for Cancer Research was used.

Western Blot Analysis. Proteins were resolvedby SDS-PAGE, transferred to PVDF-Plusmembranes and blocked for 1 h in 5% [w/v]skim milk powder. Primary antibody wasdiluted in blocking solution and incubated withthe membrane for 1 h. FLAG-tagged proteinswere detected by rat anti-FLAG antibody (9H1)(40), while endogenous CKB was detected byantibody raised against a peptide mapping at theamino terminus of CKB (sc-15157, Santa-Cruz)or a rabbit anti-CKB polyclonal antibody (70-XR43, Fitzgerald). Endogenous Asb-9 wasdetected using an in-house rabbit polyclonalantibody raised against full-length Asb-9 or amouse monoclonal antibody, 5D3, which wasgenerated as detailed below. Antibody bindingwas visualized using appropriate HRP-conjugated secondary antibodies and theenhanced chemiluminescence (ECL) system(Amersham) according to the manufacturer’sinstructions.

Immunof luorescence . 293T cells weretransfected then replated onto fibronectin coated8 well glass slides (Nalgene) at 1 x 106 cells/mL.The cells were cultured for 24 h in 500 µl ofmedium then fixed in 4% PFA for 15 min. Cellswere washed twice with PBS, permeabilizedwith ice-cold methanol for 10 min, washed withPBS a second time then blocked with PBS/1%BSA for 30 min at room temperature. Primaryantibody was added and incubated for 1 h. Cellswere washed three times with PBS/1%BSA andincubated with a secondary antibody for 30 min.Cells were counterstained with DAPI (0.5mg/mL) for 15 min, washed then coverslippedfollowing mounting with anti-fade media(DakoCytomation). The primary antibodies thatwere used were rat anti-FLAG 9H1 at 1:200 andrabbit anti-CKB (Fitzgerald) 1:1000. Secondaryantibodies used were Alexa Fluor 488 goat anti-rabbit polyclonal (Molecular Probes) at 1:1000and Cy5 goat anti-rat (Jackson Labs) at 1:500.

Generation of MYC tagged CKB andDetection of Ubiquitylated Protein. A cDNAclone encoding creatine kinase B in a pCMV-SPORT6 vector was purchased from the

5

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

I.M.A.G.E Consortium (supplied by the MRCGeneService) (ID 4225384). Oligonucleotides(5'-ACGTGGCGCGCCAGCCCTTCTCCAACAGC C A T A A T A C G - 3 ' ) a n d ( 5 ' -ACGTACGCGTCTGGGCCGGCATGAGGTCATC-3') were used to amplify the CKB codingsequence with in frame AscI and MluI sites atthe 5' and 3' ends. The PCR-generated fragmentwas digested with AscI and MluI then subclonedinto pEF-MYC-I to generate a CKB constructwith a C-terminal MYC (DQKLISEEDL) tag.The MYC-tagged CKB plasmid, a HA-taggedubiquitin plasmid and a FLAG-tagged Asb-9plasmid or its deleted SOCS box form weretransfected into 293T cells as described above.Clarified cell extracts were immunoprecipitatedwith anti-MYC antibody and ubiquitylatedprotein detected by anti-HA antibody (Roche).

Pulse Chase Analysis of Creatine Kinase B.293T cells were transfected with the MYC-tagged CKB plasmid and either the pEFBOSexpression vector, FLAG-Asb-9 or FLAG-Asb-9/ΔSB plasmids as described above. At 48 hpost-transfection, cells were rinsed withmethionine-free DMEM supplemented with0.1% BSA (AlbuMAX I 10% solution,GibcoBRL). Cells were radiolabeled for 1 hwith 0.1 mCi [35S] methionine–cysteine mixture(NEG-072, Perkin-Elmer) per mL ofmethionine-free culture medium. Cells werethen rinsed to remove pulse-labeling mediumand chased in normal culture medium. Celllysates were immunoprecipitated with anti-MYCantibody as described. Protein was eluted with40 µL of SDS loading buffer, separated by SDS-PAGE and transferred onto PVDF-Plusmembranes. The [35S]-labeled MYC-taggedCKB protein was detected using aPhosphorImager (Molecular Dynamics) andquantified using ImageQuant software (version5.0). The fraction of [35S]-labeled MYC-CKBremaining at each time point was then calculatedto allow the half-life of the protein to beestimated.

Generation of Anti-Asb-9 MonoclonalAntibodies. For the generation of anti-Asb-9monoclonal antibodies, BALB/c mice wereimmunized with glutathione S-transferase(GST)-tagged Asb-9 and His-tagged Asb-9recombinant proteins. To produce GST-Asb-9protein, the cDNA of murine Asb-9 wassubcloned into a modified pGEX-2T vector

(Amersham Biosciences) as a GST fusionprotein. The GST-Asb-9 was expressed inE.coli strain NM522 cells and purified accordingto the manufacturer’s instructions with minormodifications. Briefly, the IPTG-induced E.colipellets were lysed on ice for 1 h in 20 mL lysisbuffer (1% (v/v) Triton X-100, 0.2 mg/mLlysozyme (Sigma), 1 mM PMSF, 30 µg/mLDNase I (Roche) in PBS. Lysates weresubjected to centrifugation at 20,000 g for 15min. The bacterial lysate was incubated withGlutathione Sepharose 4B beads (Amersham)for 1 h at 4˚C. Beads were washed with 1%(v/v) Triton X-100 in PBS and then 1% (v/v)Triton X-100 in 50 mM Tris-HCl, pH 8.0, 150mM NaCl (TBS). Bound GST-Asb-9 was elutedin 10 x 1 mL fractions with 50 mM glutathionein 1% Triton X-100 in TBS. Fractionscontaining the GST-fusion protein were pooledand dialyzed against PBS overnight at 4˚C.Murine Asb-9 was also cloned into a pET15bvector (Novagen) and expressed as a hexa-histidine tagged protein in BL21 DE3 pLysSE.coli (Stratagene). The His-tagged Asb-9protein was expressed predominantly as aninsoluble protein and purified using Ni-NTAresin (GIAGEN) under denaturing conditionsaccording to manufacturer’s instructions.Fractions containing the His-tagged proteineluted in 6 M guanidine-HCl, 100 mMNaH2PO4, 10 mM Tris-HCl, pH 4.5, werepooled and purified further by reversed-phaseHPLC on a 100 mm x 7.5 mm i.d. Vydac C4column with a 60-min linear gradient of 0-100%acetonitrile in 0.085% (v/v) trifluoroacetic acid,lyophilized, and reconstituted in Milli-Q water.

BALB/c mice were immunized with 30 µg GST-Asb-9 in Freund’s complete adjuvant and werethen boosted with 30 µg GST-Asb-9 in Freund’sincomplete adjuvant. A final antigen challengewith 30 µg His-Asb-9 in Freund’s incompleteadjuvant was administered three days beforespleens were removed. Spleen cells were fusedwith the SP2/O mouse myeloma cell line.Hybridomas, for which anti-Asb-9 reactivity wasdetected, were cloned by limiting dilution andsupernatants from hybridoma clones werescreened by ELISA for their ability to recogniseboth GST-Asb-9 and His-Asb-9. Thesesupernatants were re-screened by ELISA to testfor their ability to bind to protein G in order toselect for supernatants containing IgGantibodies, which are most suitable for their

6

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

d o w n s t r e a m a p p l i c a t i o n s n a m e l y ,immunoprecipitation and Western blotting.

To purify anti-Asb-9 antibodies, hybridomasupernatant was passed though a protein Gcolumn (Amersham) and antibody was elutedwith 0.1 M glycine buffer (pH 2.7). The elutedantibody solution was neutralized with theaddition of Tris pH 8 to a final concentration of0.1 M. To assess the purity of the antibodies,approximately 0.5 µg antibody was separated bySDS-PAGE under both reducing and non-reducing conditions. The clone 5D3 was used todetect endogenous Asb-9 where indicated in thisstudy.

RESULTS

Expression of Asb-9 in vivo. In the adultmouse, Asb-9 mRNA expression was detectedpredominantly in the testes and kidney, with lowexpression observed in the heart and liver(Figure 1). Asb-9 expression was undetectablein all other tissues examined. As Asb-9 mRNAwas normally expressed in the kidney, weutilized the human embryonic kidney 293T cellline to examine possible interactions ofendogenous proteins with Asb-9 in addition tothe standard over-expression studies.

Identification of CKB as an Asb-9 SpecificInteracting Protein. Proteins that associatewith Asb-9 were purified from 293T cellsexpressing FLAG-tagged Asb-9 using anti-FLAG M2 affinity resin and resolved by SDSpolyacrylamide gel electrophoresis (Figure 2).Various proteins were observed to co-immunoprecipitate with Asb-9, that were absentin immunoprecipitates from control 293T cells(compare Lanes 1 and 2; Figure 2). Theseproteins were excised from the gel, digested withtrypsin in situ and identified by massspectrometry (Table 1). Consistent withexperiments of other SOCS box-containingproteins, Elongins B and C (18 kDa and 15 kDa,respectively) and Cullin-5 (90 kDa), co-immunoprecipitated with Asb-9. In contrast,creatine kinase B had not been previouslyidentified in SOCS protein immunoprecipitationexperiments and therefore interacted with Asb-9in an apparently specific manner.

Expression of Asb-9 and CKB in 293T cells.The expression of endogenous Asb-9 and CKBin 293T cells at the mRNA and protein level was

examined by RT-PCR and Western blot. Asb-9was expressed at low levels in 293T cells andwas detected by RT-PCR and by Western blotusing a rabbit polyclonal antibody raised againstAsb-9. In contrast, creatine kinase B mRNA andprotein was abundant in 293T cells (Figure 3).As a consequence of the low basal expression ofAsb-9, it was over-expressed for further analysisof the Asb-9-CKB interaction in 293T cells.

Specificity of Asb-9-CKB Interaction. Thespecificity of the Asb-9-CKB interaction wasfurther examined by testing the interaction ofCKB with nearly all the known Asb proteins aswell as SOCS-3 and WSB-1. The FLAG-taggedAsb proteins were immunoprecipitated andassociation with endogenous CKB was detectedby Western blot with anti-CKB antibody. CKBwas only detected in immunoprecipitations fromcells transfected with Asb-9 and none of theother Asbs, suggesting that the CKB interactionwas highly specific to Asb-9 (Figure 4A and4B). Unsurprisingly, less related proteins suchas SSB-2, WSB-2 and the ankyrin repeatproteins Gankyrin and Harp (data not shown)did not interact with CKB.

SOCS Box Dependent and IndependentInteractions. In order to explore the basis of theAsb-9 and CKB interaction, full-length FLAG-Asb-9 or Asb-9 lacking the SOCS box (Asb-9/ΔSB) was transiently expressed in 293T cellsand the interaction with CKB examined. Asshown in Figure 5A, both Asb-9 and Asb-9/ΔSBreadily interacted with endogenous CKB,suggesting that the binding of the putativesubstrate CKB to Asb-9 occurs independently ofthe SOCS box. As expected, however, theSOCS box was critical for interactions withElongins B and C (Figure 5C) and Cullin-5(Figure 5D) (Figure 2) (6,10).

Asb-9 Targets CKB For Degradation in aSOCS Box Dependent Manner. To examinethe consequences of the interaction betweenAsb-9 and CKB, 293T cells were transfectedwith increasing concentrations (0-2.5 µg) ofFLAG-tagged Asb-9 or FLAG-tagged Asb-9/ΔSB constructs. Total cell lysates wereanalyzed by Western blot with an anti-CKBantibody. As the concentration of transfectedAsb-9 increased (top left panel; Figure 6A),levels of endogenous CKB decreased,suggesting that Asb-9 may play a role in

7

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

regulating the levels of CKB within the cell. Incontrast, the levels of endogenous CKB wereunaffected in cells expressing Asb-9/ΔSB (topright panel; Figure 6A), indicating that, whilethe binding of CKB by Asb-9 occurs via theankyrin repeat, the effect on CKB protein levelsis dependent on an intact SOCS box. Theconsequence of Asb-9 over-expression onendogenous CKB levels was also examined inthe HeLa cell line. Similar to the 293Texperiments, over-expression of Asb-9 resultedin a SOCS box dependent reduction in cellularCKB protein (Figure 6B).

A similar but more complete degradation wasobserved using isogenic cell lines that stably andinducibly express Asb-9 or Asb-9/ΔSB. Uponinduction of full-length Asb-9 by doxycyclin, noendogenous CKB could be detected via Westernblot (Figure 6C). This was also observed inseveral independent cell lines (data not shown).Consistent with the transient transfection results,CKB levels remained unchanged when Asb-9/ΔSB was induced. The reduction of the CKBprotein was greater in the stable lines comparedto the transient expression system probablybecause all cells in the inducible stable cell linesexpressed the construct whereas transienttransfection could only target a fraction of thetotal number of cells. A similar completedegradation of a target protein by a RING fingercontaining E3 ligase has been previouslyobserved using this inducible system astransfection is often not 100% efficient in atransient expression system (41).By immunofluorescence and confocalmicroscopy, the localization of CKB and variousFLAG-tagged Asb and SOCS proteins in 293Tcells was examined (Figure 7). CKB isexpressed in the cytoplasm of 293T cells andwas easily visualized using an anti-CKBantibody (top row; Figure 7). Over-expressedFLAG-tagged proteins were detected using ananti-FLAG antibody. CKB shared a cytoplasmiclocation with Asb-9/ΔSB as well as FLAG-tagged Asb-3 and SOCS-3 proteins in 293Tcells. Entirely consistent with results presentedin Figure 6, endogenous CKB was undetectablein cells that expressed FLAG-Asb-9 (secondrow; Figure 7) while levels and location of CKBwere unaffected by any of the other SOCS boxcontaining proteins tested (rows 3-5; Figure 7).This highlights the reproducibility of thisinteraction at the single cell level.

To assess further the effect of Asb-9 on CKBdegradation, the turnover of the CKB proteinwas determined via pulse-chase analysis. 293Tcells were co-transfected with a MYC-taggedCKB plasmid and either a pEFBOS vectorcontrol, FLAG-tagged Asb-9 or FLAG-taggedAsb-9/ΔSB plasmids. Transfected cells werepulse-labeled with [35S]-methionine and thenchased for various time periods in normalculture medium containing unlabeled methionine(Figure 8). MYC-tagged CKB wasimmunoprecipitated with anti-MYC antibodyand labelled proteins were visualized using aPhosphorImager. As before, turnover of CKBwas accelerated by co-expression of Asb-9 andthe SOCS box was required for this effect, asCKB half-life was similar in the presence orabsence of Asb-9/ΔSB (refer to panel 4 and 2,Figure 8A and 8B). Finally, treatment with theproteasomal inhibitor PS341 prolonged CKBhalf-life (Figure 8B). These results indicate thatAsb-9 promotes the degradation of CKB, thedegradation is SOCS box dependent and ismediated by the proteasome.

Asb-9 Induces SOCS Box-DependentUbiquitylation of CKB. SOCS proteins havebeen reported to induce proteasome-dependentdegradation of their target proteins (42,43). Toinvestigate whether Asb-9-induced reduction ofCKB levels was due to SOCS box-mediatedubiquitylation of CKB, we co-expressed MYC-CKB with full-length Asb-9 or Asb-9/ΔSB aswell as HA-ubiquitin. As shown in Figure 9A,little basal polyubiquitylation of CKB wasobserved (Lane 3); however, co-expression ofAsb-9 (Lane 4) but not Asb-9/ΔSB (Lane 5)resulted in enhanced polyubiquitylation of CKB.Upon treatment of cultures with the proteasomalinhibitor PS341, a markedly increased level ofpolyubiquitylated CKB was observed (Lanes 6,7 and 8). Importantly, the ubiquitylation ofCKB was substantially enhanced on co-expression with Asb-9 (Lane 7), but to a reducedextent with over-expressed Asb-9/∆SB,supporting our previous observations. Toconfirm that the ubiquitylated protein smearsobserved in the Asb-9 co-transfections (Lanes 4and 7) were due to modification of the MYC-tagged CKB protein by ubiquitin, the blot wasstripped and re-probed with anti-MYC (panelB). The re-probe shows a strong band that mostlikely corresponds to a mono-ubiquitylated form

8

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

of CKB, and was predominant when Asb-9 wasco-expressed. As expected, the band appearedmore intense following treatment with PS341.Unmodified MYC-CKB protein was easilydetected and no obvious differences in levelswere observed in the untreated versus PS341treated samples. This may be attributed to theimmunoprecipitation process, as an increase inMYC-tagged CKB protein levels upon PS341treatment was observed when total cell lysatewas examined via immunoblot with anti-MYC(panel D).

Asb-9 and Creatine Kinase B Interact inPrimary Cells. Some of the limiting factors indetermining if two proteins interact in vivo arethe availability of antibodies and the capacity ofantibodies to detect proteins at the endogenouslevel. Asb-9 is expressed in a limited range oftissues, whereas CKB displays a moreubiquitous expression profile. One tissue whereboth proteins are expressed and where themonoclonal anti-Asb-9 antibody is effective indetecting the endogenous protein is the testis.Lysate was prepared from the testes of C57BL/6mice and immunoprecipitated with anti-CKBantibody. Following SDS-PAGE, the membranewas immunoblotted with anti-Asb-9. As shownin Figure 10, the anti-Asb-9 antibody detectedthe positive control FLAG-tagged Asb-9 (Lane1) and endogenous Asb-9 in testes (Lane 2).Importantly, an interaction between Asb-9 andCKB was a l so obse rved , s inceimmunoprecipitation with anti-CKB antibodyfollowed by Western blot with anti-Asb-9antibody revealed that Asb-9 co-precipitatedwith CKB (Lane 5) but was not brought downby an unrelated antibody or protein G (Lanes3,4; Figure 10).

DISCUSSION

Using a proteomic approach, we identifiedcreatine kinase B (CKB) as a protein capable ofspecifically interacting with Asb-9. CKB is akey cytosolic enzyme in cell energy metabolism(reviewed in (44)); reversibly catalyzing theATP-dependent phosphorylation of creatine andhence, provides an ATP buffering system fortissues requiring large amounts of energy.Subsequent experiments established that theinteraction was unique to Asb-9 and that theankyrin repeat region was the likely binding sitefor CKB as binding was not affected when theSOCS box was removed. The identification of

CKB as a possible target protein of Asb-9, thepresence of Elongins B and C and Cullin-5 andthe proposed function of the Asbs as ECS-typeE3 ubiqutin ligases prompted further analysisinto the biochemical consequences of the Asb-9-CKB interaction. Using transient and stabletransfection techniques as well asimmunofluorescence and confocal microscopy,we established that Asb-9 over-expressiondramatically reduced endogenous CKB protein.Furthermore, the interaction resulted in theSOCS-box dependent ubiquitination andproteasomal degradation of CKB. These resultssuggested that Asb-9 may co-ordinate a novelmolecular mechanism for the post-translationalregulation of cellular CKB.

Asb-9 is one of eighteen members of the ankyrinrepeat-containing SOCS box protein family(Asbs). The amino acid sequence of murineAsb-9 predicts a 290 amino acid peptide,composed of a short N-terminal region ofapproximately 30 amino acids, followed by aseries of six ankyrin repeats (aa 31-223) and aC-terminal SOCS box (aa 236-290). Althoughthe Asb family represents the largest family ofall SOCS box-containing proteins, theirbiological and biochemical functions remainpoorly defined. Ankyrin repeats are a structuralmotif involved in protein-protein interactions(reviewed in (15)) whereas the SOCS boxinteracts specifically with Elongin C. SeveralSOCS box-containing proteins act as part of anE3 ubiquitin ligase complex with the specificityof the complex determined by the proteininteraction motif located upstream from theSOCS box (reviewed in (5)).

Asb-9 appears to function in a similar way toSH2-containing SOCS proteins since the keyplayers that are involved in the SOCS-mediatedprotein degradation pathway are also present inthe Asb-9-CKB interaction, specifically Cullin-5and Elongins B and C. The SH2-containingSOCS proteins target key signaling proteins,such as the JAKs and receptors for degradationby the proteasome, thereby attenuating cytokineand tyrosine kinase receptor signaling. Ourresults demonstrate that similarly to the otherSOCS box containing proteins, specificinteraction between Asb-9 and CKB occursindependently of the SOCS box and that theinteraction of Asb-9 with CKB leads to a SOCSbox-dependent polyubiquitylation of CKB anddecline in cellular CKB levels. Furthermore,

9

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

recent studies suggest that Asb proteins regulatea number of biological processes by thismechanism (25,26). For example, Asb-3 wasreported to attenuate TNF-R2 signaling bydirectly targeting TNF-R2 for ubiquitination andproteasomal degradation. Cellular responsessuch as TNF-R2-mediated Jun N-terminal kinase(JNK) activation and apoptosis in response toTNF-α were inhibited by Asb-3 (25).

In this paper, we report that Asb-9 is expressedin murine testes and kidneys with lowexpression in heart and liver. The expressionpattern of CKB overlaps with that of Asb-9 insome tissues, but is most highly expressed intissues with high and fluctuating energydemands such as the brain. We could not detectAsb-9 mRNA in murine brain in our studies,although expression has been reported in thehypothalamus (GenBank Accession No.BB173163.1). Interestingly, a detailedinvestigation examining creatine kinase isoformsin the brain revealed that CKB was expressedselectively in astrocytes among glial populationsand was exclusive to inhibitory neurons amongneuronal populations (45). CKB expression wasvery low in excitatory neurons. It was proposedthat low CKB expression in excitatory neuronscould be due to an increased turnover rate ofCKB in these cells (45). It remains to beexamined whether Asb-9 contributes to thishighly regulated cellular distribution of creatinekinase enzymes. Antibodies generated in thisstudy could be further optimized to allow theanalysis of possible interactions between Asb-9and CKB in brain as well as other tissues.

CKB is over-expressed in a wide range of solidtumors and tumor cell lines and has been used asa prognostic marker of cancer and metastasis,although this application remains controversial(27). The CKB gene is positively regulated bythe oncogene E1a and negatively regulated bythe tumor suppressor gene, p53 (29,32). Also,many growth factors and hormones such asestrogen stimulate CKB activity and expression(46,47). Estrogen has been shown to highlyinduce expression of creatine kinase B in thefemale rat reproductive tract, as well as inhuman breast tumors and tissues (48). It is notknown which factors induce the expression ofAsb-9 but it is possible that regulators of CKBmight also exert effects on Asb-9 activity andexpression. It has been proposed that the CKsystem is involved in tumor growth through

regulation of ATP production or modulation inas yet an undefined manner. Molecules thatdisrupt this system may have an impact on tumorgrowth or progression. Given the interaction ofAsb-9 with CKB and implied roles of Asb-2 andAsb-8 in cancer, it is tempting to speculate thatAsb-9 may also have a role in tumordevelopment but this will require further study.

It is clear that the physiological significance ofthe Asb-9-CKB interaction needs to be furtherexamined. A thorough in vivo investigationutilizing genetically modified mouse models willextend the biochemical analyses presented inthis paper. This work is currently in progressand will be essential in defining the biologicalsetting of this novel interplay between Asb-9and creatine kinase B.

10

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

REFERENCES

1. Yoshimura, A., Ohkubo, T., Kiguchi, T., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., Hara,T., and Miyajima, A. (1995) Embo J 14, 2816-2826

2. Nicholson, S. E., Willson, T. A., Farley, A., Starr, R., Zhang, J. G., Baca, M., Alexander, W.S., Metcalf, D., Hilton, D. J., and Nicola, N. A. (1999) Embo J 18, 375-385

3. Zhang, J. G., Metcalf, D., Rakar, S., Asimakis, M., Greenhalgh, C. J., Willson, T. A., Starr,R., Nicholson, S. E., Carter, W., Alexander, W. S., Hilton, D. J., and Nicola, N. A. (2001)Proc Natl Acad Sci U S A 98, 13261-13265

4. Hilton, D. J., Richardson, R. T., Alexander, W. S., Viney, E. M., Willson, T. A., Sprigg, N.S., Starr, R., Nicholson, S. E., Metcalf, D., and Nicola, N. A. (1998) Proc Natl Acad Sci U SA 95, 114-119

5. Kile, B. T., Schulman, B. A., Alexander, W. S., Nicola, N. A., Martin, H. M., and Hilton, D.J. (2002) Trends Biochem Sci 27, 235-241

6. Zhang, J. G., Farley, A., Nicholson, S. E., Willson, T. A., Zugaro, L. M., Simpson, R. J.,Moritz, R. L., Cary, D., Richardson, R., Hausmann, G., Kile, B. J., Kent, S. B., Alexander, W.S., Metcalf, D., Hilton, D. J., Nicola, N. A., and Baca, M. (1999) Proc Natl Acad Sci U S A96, 2071-2076

7. Kamura, T., Burian, D., Yan, Q., Schmidt, S. L., Lane, W. S., Querido, E., Branton, P. E.,Shilatifard, A., Conaway, R. C., and Conaway, J. W. (2001) J Biol Chem 276, 29748-29753

8. De Sepulveda, P., Ilangumaran, S., and Rottapel, R. (2000) J Biol Chem 275, 14005-140089. Kamizono, S., Hanada, T., Yasukawa, H., Minoguchi, S., Kato, R., Minoguchi, M., Hattori,

K., Hatakeyama, S., Yada, M., Morita, S., Kitamura, T., Kato, H., Nakayama, K., andYoshimura, A. (2001) J Biol Chem 276, 12530-12538

10. Kamura, T., Sato, S., Haque, D., Liu, L., Kaelin, W. G., Jr., Conaway, R. C., and Conaway, J.W. (1998) Genes Dev 12, 3872-3881

11. Haan, S., Ferguson, P., Sommer, U., Hiremath, M., McVicar, D. W., Heinrich, P. C.,Johnston, J. A., and Cacalano, N. A. (2003) J Biol Chem 278, 31972-31979

12. Kaelin, W. G., Jr. (2002) Nat Rev Cancer 2, 673-68213. Kile, B. T., Viney, E. M., Willson, T. A., Brodnicki, T. C., Cancilla, M. R., Herlihy, A. S.,

Croker, B. A., Baca, M., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2000) Gene 258,31-41

14. Bork, P. (1993) Proteins 17, 363-37415. Sedgwick, S. G., and Smerdon, S. J. (1999) Trends Biochem Sci 24, 311-31616. Guibal, F. C., Moog-Lutz, C., Smolewski, P., Di Gioia, Y., Darzynkiewicz, Z., Lutz, P. G.,

and Cayre, Y. E. (2002) J Biol Chem 277, 218-22417. Kohroki, J., Fujita, S., Itoh, N., Yamada, Y., Imai, H., Yumoto, N., Nakanishi, T., and

Tanaka, K. (2001) FEBS Lett 505, 223-22818. Boengler, K., Pipp, F., Fernandez, B., Richter, A., Schaper, W., and Deindl, E. (2003)

Biochem Biophys Res Commun 302, 17-2219. Diks, S. H., Bink, R. J., van de Water, S., Joore, J., van Rooijen, C., Verbeek, F. J., den

Hertog, J., Peppelenbosch, M. P., and Zivkovic, D. (2006) J Cell Biol 174, 581-59220. McDaneld, T. G., Hancock, D. L., and Moody, D. E. (2004) Physiol Genomics 16, 275-28321. McDaneld, T. G., Hannon, K., and Moody, D. E. (2006) Am J Physiol Regul Integr Comp

Physiol22. Liu, Y., Li, J., Zhang, F., Qin, W., Yao, G., He, X., Xue, P., Ge, C., Wan, D., and Gu, J.

(2003) Biochem Biophys Res Commun 300, 972-97923. Kile, B. T., Metcalf, D., Mifsud, S., DiRago, L., Nicola, N. A., Hilton, D. J., and Alexander,

W. S. (2001) Mol Cell Biol 21, 6189-619724. Heuze, M. L., Guibal, F. C., Banks, C. A., Conaway, J. W., Conaway, R. C., Cayre, Y. E.,

Benecke, A., and Lutz, P. G. (2005) J Biol Chem 280, 5468-547425. Chung, A. S., Guan, Y. J., Yuan, Z. L., Albina, J. E., and Chin, Y. E. (2005) Mol Cell Biol 25,

4716-4726

11

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

26. Wilcox, A., Katsanakis, K. D., Bheda, F., and Pillay, T. S. (2004) J Biol Chem 279, 38881-38888

27. Wyss, M., and Kaddurah-Daouk, R. (2000) Physiol Rev 80, 1107-121328. Jost, C. R., Van Der Zee, C. E., In 't Zandt, H. J., Oerlemans, F., Verheij, M., Streijger, F.,

Fransen, J., Heerschap, A., Cools, A. R., and Wieringa, B. (2002) Eur J Neurosci 15, 1692-1706

29. Wallimann, T., and Hemmer, W. (1994) Mol Cell Biochem 133-134, 193-22030. Chen, J. S., Coustan-Smith, E., Suzuki, T., Neale, G. A., Mihara, K., Pui, C. H., and

Campana, D. (2001) Blood 97, 2115-212031. Kaddurah-Daouk, R., Lillie, J. W., Daouk, G. H., Green, M. R., Kingston, R., and Schimmel,

P. (1990) Mol Cell Biol 10, 1476-148332. Zhao, J., Schmieg, F. I., Simmons, D. T., and Molloy, G. R. (1994) Mol Cell Biol 14, 8483-

849233. Alexander, W. S., Metcalf, D., and Dunn, A. R. (1995) Embo J 14, 5569-557834. Starr, R., Willson, T. A., Viney, E. M., Murray, L. J., Rayner, J. R., Jenkins, B. J., Gonda, T.

J., Alexander, W. S., Metcalf, D., Nicola, N. A., and Hilton, D. J. (1997) Nature 387, 917-92135. Silke, J., Kratina, T., Ekert, P. G., Pakusch, M., and Vaux, D. L. (2004) J Biol Chem 279,

4313-432136. Moritz, R. L., Eddes, J. S., Reid, G. E., and Simpson, R. J. (1996) Electrophoresis 17, 907-

91737. Moritz, R. L., and Simpson, R. J. (1992) J Chromatogr 599, 119-13038. Simpson, R. J., Connolly, L. M., Eddes, J. S., Pereira, J. J., Moritz, R. L., and Reid, G. E.

(2000) Electrophoresis 21, 1707-173239. Eng, J. K., McCormack, A. L., and Yates, J. R. (1994) Journal of American Society of Mass

Spectrometry 5, 976-98940. Wilson-Annan, J., O'Reilly, L. A., Crawford, S. A., Hausmann, G., Beaumont, J. G., Parma,

L. P., Chen, L., Lackmann, M., Lithgow, T., Hinds, M. G., Day, C. L., Adams, J. M., andHuang, D. C. (2003) J Cell Biol 162, 877-887

41. Silke, J., Kratina, T., Chu, D., Ekert, P. G., Day, C. L., Pakusch, M., Huang, D. C., and Vaux,D. L. (2005) Proc Natl Acad Sci U S A 102, 16182-16187

42. Frantsve, J., Schwaller, J., Sternberg, D. W., Kutok, J., and Gilliland, D. G. (2001) Mol CellBiol 21, 3547-3557

43. Ungureanu, D., Saharinen, P., Junttila, I., Hilton, D. J., and Silvennoinen, O. (2002) Mol CellBiol 22, 3316-3326

44. Wallimann, T., Wyss, M., Brdiczka, D., Nicolay, K., and Eppenberger, H. M. (1992) BiochemJ 281 ( Pt 1), 21-40

45. Tachikawa, M., Fukaya, M., Terasaki, T., Ohtsuki, S., and Watanabe, M. (2004) Eur JNeurosci 20, 144-160

46. Somjen, D., Weisman, Y., Harell, A., Berger, E., and Kaye, A. M. (1989) Proc Natl Acad SciU S A 86, 3361-3365

47. Ch'ng, J. L., and Ibrahim, B. (1994) J Biol Chem 269, 2336-234148. Wang, F., Samudio, I., and Safe, S. (2001) J Cell Biochem 84, 156-17249. Ho, Y., Gruhler, A., Heilbut, A., Bader, G. D., Moore, L., Adams, S. L., Millar, A., Taylor,

P., Bennett, K., Boutilier, K., Yang, L., Wolting, C., Donaldson, I., Schandorff, S.,Shewnarane, J., Vo, M., Taggart, J., Goudreault, M., Muskat, B., Alfarano, C., Dewar, D.,Lin, Z., Michalickova, K., Willems, A. R., Sassi, H., Nielsen, P. A., Rasmussen, K. J.,Andersen, J. R., Johansen, L. E., Hansen, L. H., Jespersen, H., Podtelejnikov, A., Nielsen, E.,Crawford, J., Poulsen, V., Sorensen, B. D., Matthiesen, J., Hendrickson, R. C., Gleeson, F.,Pawson, T., Moran, M. F., Durocher, D., Mann, M., Hogue, C. W., Figeys, D., and Tyers, M.(2002) Nature 415, 180-183

50. Vasilescu, J., Guo, X., and Kast, J. (2004) Proteomics 4, 3845-3854

12

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

ACKNOWLEDGEMENTSWe thank Seth Masters and Helene Martin for providing a partial cDNA clone for Asb-9.This work was supported by the Australian National Health and Medical Research Council, Canberra,Australia: Program Grant 257500; the Anti-Cancer Council of Victoria, Melbourne, Australia; theAustralian Federal Government Cooperative Research Centers Program, Australia; and ZenythTherapeutics Limited, Melbourne, Australia. M.A.D is a recipient of a Dora Lush Postgraduate Awardfrom the Australian National Health and Medical Research Council.

13

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

FIGURE LEGENDS

Figure 1: Northern blot hybridization analysis of Asb-9 RNA expression levels. Total RNA wasisolated from primary tissues taken from 8 week old normal mice. The transcript size for Asb-9 is 1.3kb. To confirm RNA loading and integrity, the blot was stripped and re-probed with GAPDH.

Figure 2: Identification of proteins that bind to Asb-9. Lysate from 293T cells transfected withpEFBOS (Lane 1) and pEF-FLAG-tagged Asb-9 (Lane 2) were subjected to precipitation with anti-FLAG M2 resin. Bound proteins were separated by SDS-PAGE and visualized by Coomassiestaining. Arrows in Lane 2 indicate the protein bands excised for sequencing analysis by massspectrometry (see Table 1). The heat shock proteins 60/70 (Hsp 60/70) have been observed to co-immunoprecipitate with a plethora of other proteins and are likely to be non-specific (49,50)(Benjamin T. Kile, Jian-Guo Zhang, Nicos A. Nicola; unpublished observations).

Figure 3: Asb-9 and CKB expression in 293T cells. Asb-9 and CKB expression was detected byRT-PCR (panels on left) and Western blot (panels on right) of total cell lysate by an anti-Asb-9polyclonal antibody and anti-CKB antibody respectively. The expression of Asb-9 compared tocreatine kinase in 293T cells is low. A CKB plasmid was used as a control in the RT-PCRexperiments. Lysate obtained from 293T cells transfected with 50 ng of FLAG-Asb-9 plasmid wasused as a control for the Western blot analysis. The Western blot was re-probed with an anti-Hsp70antibody as a loading control.

Figure 4: CKB specifically interacts with Asb-9. In panels A and B membranes wereimmunoblotted with anti-CKB antibody. Arrows indicate the CKB band. Expression of all FLAG-tagged proteins was confirmed by re-probing with anti-FLAG antibody as shown in panels C and D./ΔSB represents SOCS box deleted constructs.

Figure 5: SOCS box dependent and independent interactions. Transfected 293T lysates wereimmunoprecipitated with M2 resin and immunoblotted with anti-CKB, anti-Elongin B/C or anti-Cullin-5 (panels A, C and D respectively). The expression of FLAG-Asb-9 and FLAG-Asb-9/∆SBwas confirmed by an anti-FLAG Western blot (panel B).

Figures 6A, 6B and 6C: SOCS box dependent degradation of CKB. (A) 293T cells were co-transfected with increasing concentrations (0-2.5 µg) of FLAG-tagged Asb-9 or FLAG-tagged Asb-9/ΔSB constructs and decreasing concentrations of pEFBOS vector to ensure that a total of 2.5 µg ofDNA was used per transfection. Total cell lysate was immunoblotted with an anti-CKB antibody(upper panels). Expression of FLAG-tagged protein was determined by an anti-FLAG Western blot(middle panels). Actin levels were also examined in the presence of increasing concentrations ofAsb-9 to ensure that Asb-9 specifically regulates CKB degradation (lower panels).

(B) HeLa cells were transfected with 0-2.5 µg of FLAG-Asb-9 or FLAG-Asb-9/ΔSB. The pEFBOSvector was also transfected to ensure that a total of 2.5 µg of DNA was used per transfection.Endogenous CKB was detected using an anti-CKB antibody (upper panels). The expression of FLAG-tagged Asb-9 or Asb-9/DSB was confirmed by an anti-FLAG Western blot (lower panels).

(C) Stable 293 cell lines were uninduced (Lane 1) or induced to express FLAG-Asb-9 (Lane 2) andFLAG-Asb-9/ΔSB (Lane 3) by the addition of doxycyclin. Total cell lysate was immunoblotted withanti-CKB (upper panel). Expression of FLAG-tagged protein was determined by an anti-FLAGWestern blot (middle panel). The membrane was re-probed with anti-Hsp70 as a loading control.

Figure 7: Creatine kinase B is not detectable in 293T cells that over-express Asb-9. 293T cellswere either untransfected or transiently transfected with FLAG-Asb-9, FLAG-Asb-9/ΔSB, FLAG-Asb-3 or FLAG-SOCS-3. Expression of the FLAG-tagged protein was analyzed byimmunofluorescence using confocal microscopy with rat anti-FLAG/anti-rat Cy5 antibody (red).

14

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9 mediated degradation of CKB

Endogenous CKB was visualized with rabbit anti-CKB/anti-rabbit Alexa Fluor 488 antibody (green).293T cells express high levels of CKB. However, upon over-expression of Asb-9, CKB could nolonger be detected. Co-localization of CKB with all other expressed FLAG proteins was observed.

Figure 8: Degradation of CKB is enhanced by Asb-9 co-expression. (A) Asb-9 co-expressionenhances the degradation of CKB in vitro. 293T cells were transfected with MYC-tagged CKB (0.5µg) and either pEFBOS vector, FLAG-tagged Asb-9 or FLAG-tagged Asb-9/ΔSB plasmids (0.5 µg).At 48 h, cells were pulsed for 1 h with [35S]-methionine labeling mixture then chased for 0, 0.5, 1, 2,4, 8 and 24 h in DMEM with 10% FCS. Where indicated, cultures were treated prior to lysis with 10nM PS341 overnight. Lysates were subjected to immunoprecipitation with anti-MYC antibody andbands visualized by a PhosphorImager. Images are representative of at least 3 independentexperiments giving similar results. (B) The extent of [35S]-methionine labeled CKB radioactivity wasquantified by densitometry. As shown, the addition of PS341 prolongs CKB half-life when co-expressed with Asb-9. Graph constructed from data obtained from at least 3 separate pulse-chaseexperiments.

Figure 9: Asb-9 induces SOCS box-dependent ubiquitylation of CKB. 293T cells wereuntransfected (Lane 1), transfected with HA-ubiquitin (1.0 µg) (Lane 2), transfected with HA-ubiquitin (0.5 µg) and MYC-CKB (0.5 µg) (Lanes 3 and 6), transfected with HA-ubiquitin (0.5 µg),MYC-CKB (0.5 µg) and FLAG-Asb-9 (0.5 µg) (Lanes 4 and 7) or FLAG-Asb-9/ΔSB (0.5 µg) (Lanes5 and 8). Where indicated, cultures were treated prior to lysis with 10 nM PS341 overnight. 48 h posttransfection, cells were lysed in NP40 lysis buffer. Cell lysates were subjected to anti-MYCimmunoprecipitation, followed by immunoblotting with anti-HA antibody (panel 9A). The blot wasthen stripped and re-probed with anti-MYC antibody to show ubiquitinated forms of MYC-taggedCKB protein. Mono-ubiquitinated CKB forms were determined by calculating Rf values (calculationsnot shown) (panel 9B). Total cell lysates were subjected to immunoblot with anti-FLAG antibody toconfirm expression of transfected FLAG-tagged proteins and anti-MYC to confirm expression ofMYC-tagged CKB protein (panels 9C and 9D respectively).

Figure 10: Asb-9 co-precipitates with creatine kinase B in testes. Lysate was prepared from thetestes of C57BL/6 mice. CKB was immunoprecipitated with anti-CKB antibody. Following SDS-PAGE, the immunoprecipitates were analyzed by immunoblotting with anti-Asb-9. Anti-Asb-9antibody detected FLAG-tagged Asb-9 (Lane 1), endogenous Asb-9 in testes (Lane 2) and aninteraction between endogenous Asb-9 and creatine kinase B (Lane 5).

15

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

* Asterisk indicates proteins identified in separate purification experiments

Protein(s) Identified Database/Accession no. Mol wt (kDa) No. of peptides Sequenceidentified Coverage (%)

Asb-9 TrEMBL, Q91ZT8 31.6 17 76.6

Creatine kinase B SwissProt, P12277 42.6 31 73.2

60 kDa heat shock protein SwissProt, P10809 61.0 32 77.0

70 kDa heat shock protein* SwissProt, P08107 70.0 29 61.8

Cullin-5* SwissProt, O93034 90.8 23 35.5

Elongin B* TrEMBL, Q15370 13.1 17 93.2

Elongin C* TrEMBL, Q15369 12.4 4 56.3

Table 1

Table 1: Mass Spectrometric Identification of Proteins

16

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

1.3Asb-9

GAPDH

Figure 1

Brain Heart Kidney

Lung Liver Muscle

Skin Spleen

Testes

Thymus

17

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

97

45

66

21

31

14

___

_

__

1 2

HSP 60

CKB

Asb-9

Elongin B*Elongin C*

kDa

Figure 2

C u l l i n - 5 *

18

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

WB: α-CKB

WB: α-Asb-9

WB: α-Hsp70

Asb-9

CKB

293T

293T

CKB con

trol

Asb-9

(50n

g)

(rabbit polyclonal Ab)

Figure 3

19

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

_

kDa

50

37

_

_

25

50

37

_

_

SO

CS

-3

pE

FB

OS

Asb

-1

Asb

-4

Asb

-2A

sb-3

Asb

-6A

sb-7

Asb

-8

Asb

-5

Asb

-9

Asb

-15

WS

B-1

Asb

-14

Asb

-17

Asb

-10

Asb

-12

Asb

-11

Asb

-9/∆

SB

Asb

-3/∆

SB

WB: α-FLAG

WB: α-CKB

A

DC

B

293T

Figure 4

20

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

IP: M2

WB: α-CKBIP: M2

WB: α-FLAG

IP: M2

WB: α-Elongin B/CElongin B

C

pE

FB

OS

Asb

-9

Asb

-9/∆

SB

A

D

IP: M2

WB: α-Cullin- 5

C u l l i n - 5

pE

FB

OS

Asb

-9A

sb-9

/∆S

B

BAsb-9/∆SBC K B Asb-9

Elongin C

Figure 5

21

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Asb-9/∆SB and pEFBOSAsb-9 and pEFBOS

WB: α-CKB

WB: α-FLAG

Figure 6A

kDa

32 _

_41

WB: α-actin

kDa

32 _

_41 WB: α-CKB

WB: α-FLAG

Figure 6C

WB: α-FLAG

WB: α-CKB

WB: α-Hsp70

1 2 3

-

-41

32

kDa

1.0µ

g

200n

g10

0ng

+ve

10n

g50

ng

2.5µ

g

0 500n

g

HeL

a

Figure 6B1.

0µg

200n

g10

0ng

+ve

10n

g50

ng

2.5µ

g

0 500n

g

HeL

a

1.0µ

g

200n

g10

0ng

293T

10n

g50

ng

2.5µ

g

500n

g

0 1.0µ

g

200n

g10

0ng

293T

10n

g50

ng

2.5µ

g

500n

g

0

22

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

DAPI CKB FLAG merge

Untransfected293T cells

FLAG-Asb-9

FLAG-Asb-9/∆SB

FLAG-Asb-3

FLAG-SOCS-3

Secondary Antibody Control

Figure 7

23

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

pEFBOS

Asb-9

Asb-9/∆SB

MYC-CKB

chase time (h)

0.5 1 2 4 2480

MYC-CKB

MYC-CKB

IP: α-MYC

A

B

FLAG-Asb-9/∆SB

MYC-CKB

Asb-9 + PS341

chase time (h)

% R

adio

labe

led

MY

C-C

KB

(log

)

FLAG-Asb-9pEFBOS

FLAG-Asb-9 + 10 nM PS341

26

10

100

0 2 4 6 8 10 12 14 16 18 20 22 24 26

1000

Figure 8

24

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

IP: α-MYCWB: α-HA

WB: α-MYCIP: α-MYC

WB: α-FLAGTotal Cell Lysates

WB: α-MYCTotal Cell Lysates

untreated

HA-UbiquitinMYC-CKBFLAG-Asb-9FLAG-Asb-9/∆SB

- - + + + + + + - + + + + + + +

- - - + - - + - - - - - + - - +

PS341

1 2 3 4 5 6 7 8Lane:

12680

39

31

kDa

MYC-CKB

MYC-CKBmono.Ub. MYC-CKB

FLAG-Asb-9FLAG-Asb-9/∆SB

39

31

39

A

B

D

C

mono.Ub. MYC-CKB

Figure 9

25

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

37

25

37

WB: α-Asb-9

WB: α-CKB

+ - - - - - + + + +

- - + + +

- - - + -

- - - - +

1 2 3 4 5

Asb-9

CKB

IP conditions

Lane:

FLAG-Asb-9

testes lysate

protein G

rabbit IgG

kDa

α-CKB

Figure 10

26

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

and Douglas J HiltonKileConnolly, Richard J. Simpson, Warren S. Alexander, Nicos A. Nicola, Benjamin T.

Marlyse A. Debrincat, Jian-Guo Zhang, Tracy A. Willson, John Silke, Lisa M.for degradation

Ankyrin repeat and SOCS box containing protein ASB-9 targets creatine kinase B

published online December 5, 2006J. Biol. Chem. 

  10.1074/jbc.M609164200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from