a conserved patch near the c-terminus of histone h4 is required for

1

A conserved patch near the C-terminus of histone H4 is required for genome stability in

budding yeast

Yao Yu1, Madhusudhan Srinivasan

1, Shima Nakanishi

2, Janet Leatherwood

3, Ali

Shilatifard2 and Rolf Sternglanz

1

1Department of Biochemistry and Cell Biology,

3Department of Molecular Genetics and

Microbiology, Stony Brook University, Stony Brook, NY 11790, 2Stowers Institute,

Kansas City, MO 64110

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Mol. Cell. Biol. doi:10.1128/MCB.01432-10 MCB Accepts, published online ahead of print on 28 March 2011

on April 11, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

2

Abstract

A screen of yeast histone alanine substitution mutants revealed that mutations in any of

three adjacent residues, L97, Y98 or G99, near the C-terminus of H4 led to a unique

phenotype. The mutants grew slowly, became polyploid or aneuploid rapidly and also

lost chromosomes at a high rate, most likely because their kinetochores were not

assembled properly. There was lower histone occupancy not only at the centromeric

region, but also throughout the genome for the H4 mutants. The mutants displayed

genetic interactions with the genes encoding two different histone chaperones, Rtt106 and

CAF-I. Affinity purification of Rtt106 and CAF-I from yeast showed that much more H4

and H3 were bound to these histone chaperones in the case of the H4 mutants compared

to wild type. However, in vitro binding experiments showed that the H4 mutant proteins

bound somewhat more weakly to Rtt106 than did wild type H4. These data suggest that

the H4 mutant proteins, along with H3, accumulate on Rtt106 and CAF-I in vivo because

they cannot be deposited efficiently on DNA or passed on to the next step in the histone

deposition pathway, and this contributes to the observed genome instability and growth

defects.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

3

The fundamental building block of chromosomes is the nucleosome, consisting of 147 bp

of DNA wrapped around a histone octamer with two copies of each of histones H2A,

H2B, H3 and H4 (17). During DNA replication old histones have to be moved from

parental DNA to the newly replicated DNA, and in addition new histones have to be

deposited in order to achieve the proper density of nucleosomes on the DNA. A variety

of histone chaperones exist to carry out this function (6). Similarly, during transcription

the moving RNA polymerase displaces the histones as it traverses the DNA, and, again,

various histone chaperones play an important role in redepositing the histones behind the

transcribing RNA polymerase (3, 27).

Histone chaperones play an important role to prevent non-specific interactions

between the highly basic histones and negatively charged DNA (16). Based on

specificity for different histone cargo, chaperones can be classified into at least 2 groups.

Chaperones for the H3/H4 dimer or tetramer include the CAF-I complex, Asf1, the Hir

proteins, Rtt106 and FACT. Chaperones for H2A/H2B dimers include FACT, NAP1,

nucleoplasmin and Chz1. Because of the peripheral position of the two H2A/H2B dimers

on the nucleosome, H2A/H2B dimers are not loaded onto the DNA until the central

H3/H4 tetramer has been deposited. Conversely, during nucleosome disassembly,

H2A/H2B dimers are removed before the H3/H4 tetramer (25). There is even a specific

chaperone, Scm3/HJURP, for the centromeric histone H3 variant, CenH3 (6, 8, 31).

In order to learn more about the function of the individual amino acids present in

the highly conserved histones, two groups have systematically mutated each amino acid

to alanine in the yeast, Saccharomyces cerevisiae (7, 21). In this yeast there are two

copies of divergently transcribed H3 and H4 genes and, similarly, two copies of


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

4

divergently transcribed H2A and H2B genes, all on different chromosomes. In one study,

a plasmid shuffle techniques was used to introduce the histone mutations (21). A strain

was constructed in which both chromosomal copies of the genes coding for the H3 and

H4 were deleted and the strain was kept alive by a URA3 CEN plasmid encoding a wild

type H3-H4 histone gene pair, HHT1/HHF1. This strain was transformed with

individual TRP1 CEN plasmids, each bearing a different H3 or H4 residue mutated to

alanine. The strains were then plated on 5-FOA to select for cells that had lost the URA3

plasmid and were being kept alive by the TRP1 plasmid carrying the H3 or H4 mutation.

Only viable mutants could grow on such a medium. Surprisingly, in spite of the extreme

conservation of the amino acid sequences of H3 and H4, most of the mutants were viable,

although some grew poorly. An analogous strategy was used to generate viable H2A and

H2B mutants in which each residue was mutated to alanine.

In examining this collection of histone mutants, we discovered that three specific

H4 mutants had become polyploid. Interestingly, these mutants had alanine substitutions

on three adjacent residues on H4, amino acids 97, 98 and 99, near the C-terminus of the

protein, in the globular domain of the nucleosome. In this report, we describe the

properties of the H4 L97A, Y98A and G99A mutants and their unusual genetic and

biochemical interaction with the histone chaperones Rtt106 and CAF-I. The results

suggest that this small C-terminal patch on histone H4 is important proper kinetochore

assembly and for H4/H3 deposition by Rtt106 and CAF-I.

Materials and Methods

Yeast strains, growth media and plasmids. The S. cerevisiae strains used in this


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

5

study are listed in Table 1 and the plasmids used are listed in Table 2. Most of the histone

plasmids used in this study were described in our paper on alanine scanning mutagenesis

of the histones (21). All growth media, including yeast extract/peptone/dextrose (YPD),

synthetic minimal (SD), synthetic complete (SC) and media with 5-FOA were prepared

as described (1). Unless indicated, to avoid polyploid/aneuploid cells dominating the

culture, extraordinary large colonies were excluded when inoculating cultures expressing

the H4 L97A, Y98A G99A, G99L or G99D mutants.

Growth assays. Plasmid shuffling was used to generate freshly derived strains

with alanine substitution mutations in the histones. Strain YYY67 carrying plasmid

pMS329 (HHT1-HHF1 URA3 CEN4) was transformed with TRP1 plasmids expressing

either wild-type H4 (pWZ414-F12) or mutant derivatives of that plasmid. Colonies were

taken from the –Trp transformation plate and spread onto SC-Trp+5-FOA to select

against the URA3 plasmid. Similarly, strain FY406 carrying pSAB6 (HTA1-HTB1-URA3)

was transformed with HIS3 plasmids expressing wild type or mutant histone H2A.

Transformants were selected on SC-His plates and counterselected on SC-His+5-FOA

plates. For growth assays, about 2×107

cells were taken from the 5-FOA plates and

suspended in 100 µl H2O. Ten-fold dilutions were spotted onto SC selective medium and

the growth checked after 2 days.

In the case of the H4 L97A, Y98A and G99A mutants, after counterselection on

SC-Trp+5FOA medium both very large and small colonies were visible after 3 days

incubation. Single colonies, large or small, were picked, resuspended in H2O, and spread

onto fresh SC-Trp+5-FOA plates. The plates were checked after 4 days and cells were

inoculated into SC-TRP+5FOA liquid medium for flow cytometry analysis.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

6

Flow cytometry analysis. Flow cytometry analysis was performed according to

a previous protocol with minor modifications (1). About 1×107 cells were harvested and

fixed in 70% ethanol. Cells were briefly sonicated, incubated in 1 mg/ml RNase A at

37ºC for 1 hr and left at 4ºC overnight. Before analysis, cells were treated with 5 mg/ml

pepsin at 37ºC for 10 min and stained by 1 µM SYTOX Green (Invitrogen). 25,000 cells

were measured by FACSCalibur (Becton Dickinson) and data analyzed by Flowjo 2.0.

Microarray analysis of ploidy. H4 mutant cells from large colonies that showed

an increased ploidy by flow cytometry analysis were restreaked 3 times on SC-Trp+5-

FOA medium before growing in the same liquid medium. About 5×106 cells were

collected and DNA purified as described (1). DNA was labeled and hybridized according

to the manufacturer’s protocol (Agilent). The S. cerevisiae expression array was made by

Stony Brook Spotted Microarray Facility (Cat. A-26). Data was analyzed by Feature

Extraction 9.5.3.1 (Agilent).

Chromosome III loss assay. Strain YYY91 (MATα) carrying a URA3 plasmid

(pMS329) expressing wild-type H4 was transformed with TRP1 plasmids expressing

wild-type or mutant H4 and transformants selected on SC-Ura-Trp plates. About 3×107

cells from the transformation plate were suspended in 200 µl YPD and spread onto a

lawn of DC17 (MATα) on an SD plate. As a control, the original suspension was diluted

10,000-fold in YPD and 200 µl spread onto a lawn of DC16 (MATa) on an SD plate.

Cells that were able to mate with DC17 could either result from loss of chromosome III

or from mutation of α1 or α2. To distinguish between these possibilities, the colonies on

the DC17 cell lawn were streaked onto YPD+G418 plate to check if the KANr marker

present on the left arm of chromosome III was lost. The loss frequency was calculated as


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

7

(number of G418 sensitive colonies formed on the DC17 cell lawn)/ (number of colonies

formed on the DC16 cell lawn×104).

CEN plasmid loss assay. Strain YYY70 containing the CEN LEU2 plasmid

pRS315 and pMS329 (HHT1-HHF1 URA3 CEN4) was transformed with a TRP1 plasmid

expressing wild-type H4 or the L97A, Y98A or G99A mutants. Transformants were

selected on SC-Leu-Ura-Trp medium. Fresh colonies were suspended in H2O and equal

volumes spread onto SC-Leu and SC plates. The CEN plasmid loss frequency was

calculated as (1- ((number of colonies formed on SC-Leu)/(number of colonies formed on

SC))×100%).

Fluorescence microscopy. Strains with kinetochore components tagged with

GFP and Spc29-RFP to mark the spindle pole body were transformed with plasmids

expressing wild type or mutant histone H4. In the case of strains MAY8526 (Nuf2-GFP)

and MAY8539 (Spc105-GFP) the histone plasmids had a TRP1 selectable marker and in

the case of MAY8511 (Mtw1-GFP) HIS3 plasmids were used. Transformants were

grown to mid-log phase in the SC-Trp or SC-His medium. Cells were harvested, fixed

with formaldehyde and stained with DAPI. An Observer Z1 microscope (Carl Zeiss)

was used for imaging. Fluorescence images were acquired by taking 8 steps along the Z-

axis at 400-nm interval. One hundred cells from each transformant were analyzed by

Axiovision Release 4.7.

Chromatin sensitivity to nucleases. The integrity of the centromeric chromatin

structure was assessed by protection of DraI sites inside the CDE II of CEN3 as

described before (18). Strain YYY67 carrying pMS329 (HHT1-HHF1 URA3 CEN4) was

transformed TRP1 plasmids expressing wild type or mutant H4. Transformants were


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

8

counterselected on SC-Trp+5-FOA medium to remove the URA3 plasmid. Cells were

grown in YPD medium to OD600= 0.8. Nuclei were isolated and suspended in SPC buffer

as described (12). The buffer was adjusted to a final concentration of 10 mM MgCl2 and

20 mM Tris⋅HCl pH=8.0 before incubation with indicated concentrations of the DraI at

37ºC for 30 min. The reaction was stopped with 20 mM EGTA. DNA was purified,

digested to completion with EcoRI, and resolved by a 1.0% Tris-Borate-EDTA gel.

CEN3 DNA was detected by Southern blot using a 899 bp probe generated by PCR with

primers: 5′ACTTGTCATGCGGTGAGAATCG 3′ and 5′

ATGACATGACCAAGCATTTTGTAC 3′. Hybrization was performed at 57ºC. The blot

was exposed to a phosphoimager (Fujisu), scanned by Storm 840 (Molecular Dynamics)

and analyzed by ImageQuant (GE Healthcare). The percentage of cutting was calculated

by the counts in the cut band (2.9 kb), divided by the sum of counts in cut bands and

uncut bands (5.1 kb). The DraI site in the GAL10 gene was analyzed in a similar way.

The GAL10 probe was generated by PCR using primers:

5' AGATGGTACCCCGATCAGGG 3' and 5' TATTGGCGTCGCTTCACCAG 3'

For the micrococcal nuclease assay, nuclei were isolated and suspended in SPC

buffer as described above. One unit of micrococcal nuclease (Worthington) was added to

200 µl of nuclei and incubated at 37ºC for varying amounts of time (10-40 min). The

reactions were stopped with 300 µl of stop buffer (20 mM Pipes pH=6.3, 33.3 mM

EGTA). DNA was purified as described (5) and resolved by agarose electrophoresis.

The DNA bands were visualized by ethidium bromide staining and scanned by a

KODAK 1D image analysis system. The intensities of the bands corresponding to mono,

di or tri nucleosomes were quantified with ImageQuant (GE Healthcare).


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

9

Chromatin immunoprecipitation. After counterselection on 5-FOA plates,

fresh cells expressing wild type or mutant histone H4 were grown in YPD to OD600 = 1.

Cells were harvested and prepared for the chromatin immunoprecipitation (ChIP) assay

as described (4). Three µl of H4 antibody was added to 200 µl of cell lysate for

immunoprecipitation and a no antibody control was also prepared. Quantification of the

ChIP samples was performed by real-time PCR (Roche Applied Sciences LightCycler

480). The following primers were used to check the H4 occupancy at different loci: 5’

CATCCAATACCTTGATGAACTTTTC 3’ and 5’

GTACTATAAGCGGAAGGGGAAGG 3’ for CEN3; 5’ ATTGGCGCACATCCCTCTGG

3’ and 5’ GGAACCCAAGTTCCACTCACGAC 3’ for GAL10;

5’ CTATTATTGATGCTTTGAAGACCTCCAG 3’ and

5’ TGCCCAAAATAATAGACATACCCCATAA 3’ for PMA1. Data were expressed as

the ratio of the signal in the ChIP sample relative to input. The experiments were

repeated in entirety 3 times, and the real-time PCR was performed in duplicate for each

sample.

TAP purification of Rtt106 and Cac2. Strain ZGY692 or ZGY892 was

transformed with pYY119 (wild type H4), pYY120 (H4 L97A), pYY121 (H4 Y98A), or

pYY123 (H4 G99A), and transformants selected on SC-His plates. Colonies from the

transformation plate were spread onto SC-His+5-FOA. Fresh colonies from the 5-FOA

plates were grown in 50 ml SC+5-FOA liquid medium for 10 hrs, then diluted into 1 liter

YPD and grown at 30ºC to OD600 of 2.0. Cells were harvested and lysed, and the TAP-

tagged protein purified by IgG Sepharose 6 fast flow (GE Healthcare) and calmodulin

affinity resin (Stratagene) as described (15). The bound proteins were eluted by Laemmli


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

10

buffer, resolved by SDS-PAGE and detected by Western blotting using antibodies against

histone H3 (Abcam, ab1791), histone H4 (from the lab of AS), H3 K56Ac (from Zhiguo

Zhang) or CBP-tag (GenScript, A00635).

Histone-Rtt106 in vitro binding assay. To purify histones from yeast, strain

YYY67 was transformed with plasmids expressing WT H4 or each of the four mutants,

transformants selected on SC-Trp medium and counterselected on SC-Trp+5FOA. Cells

were grown in YPD medium to OD600=1.5 and harvested. Following spheroplasting,

nuclei were isolated and histones purified by sulfuric acid extraction as described (9).

To express the histone H3/H4 tetramer in E. coli, pYY133 (wild type) or pYY131

(H4 Y98A) was transformed into BL21-DE3-CodonPlus cells (Stratagene). The induction,

lysis, histone extraction and purification were carried out as described previously (14),

except the LB medium contained 50 µg/ml kanamycin and 34 µg/ml chloramphenicol;

induction time was 2 hr; HiTrap SP FF column (GE Healthcare 17-5054-01) was used for

purification.

To express GST-Rtt106, pGEX-4T-1-RTT106 was transformed into BL21-DE3-

CodonPlus cells and cells grown in LB medium with 100 µg/ml ampicillin and 34 µg/ml

chloramphenicol at 37ºC. At OD600 = 0.4, the culture was shifted to 23º and induced with

0.4 mM IPTG for 4 hrs. Cells were harvested and frozen at -20º. Cells were lysed by

sonication and GST-Rtt106 was purified on Glutathione Sepharose 4 fast flow beads (GE

Healthcare ) according to the manufacture’s protocol. For binding assays, GST-Rtt106

was immobilized on the sepharose beads and washed by A300 buffer (25 mM Tris⋅HCl

(pH 8.0), 10% glycerol, 1 mM EDTA, 0.01% Nonidet P-40, 300 mM NaCl) 3 times.

Then the beads were incubated at 4ºC overnight with equal amounts of wild type or


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

11

mutant histones purified from yeast or E. coli. The beads were washed with A300 buffer

4 times, and the bound proteins were eluted with Laemmli buffer, resolved by SDS-

PAGE and detected by Coomassie blue staining or Western blotting.

RESULTS

H4 point mutants that cause aneuploidy. In the course of studies focused on

the identification of novel alleles of H4 we obtained genetic evidence that strains with

alanine substitution mutations of three adjacent residues of H4, amino acids 97,98, and 99,

appeared to be polyploid. To check on our initial observations, we repeated the plasmid

shuffle to obtain newly derived mutants. Specifically, strain (YYY67), containing a

URA3 plasmid expressing wild-type H4, was transformed with plasmids expressing each

of the three H4 mutants, L97A, Y98A and G99A, and 5-FOA used to select against the

URA3 plasmid. Cells which grew on 5-FOA were collected and replated by serial

dilution. All three mutations caused a growth defect, particularly Y98A, whereas

mutations of adjacent residues 94-96 and 100-102 did not affect growth (Fig. 1). In cells

containing both the mutant and wild-type histone H4 plasmids, the growth defect was still

observed, but to a lesser extent, indicating that these three mutations were semi-dominant

(data not shown).

Plating of cells containing only the mutant H4 plasmid showed that all three

mutants gave rise to both large and very small colonies (Fig. 2A). When cells from the

large colonies were replated, they again grew rapidly, but not as fast as wild type (Fig.

2B). Replating of cells from small colonies of mutants L97A and G99A yielded both

small and large colonies (Fig. 2C). On the other hand, replating of the cells from small


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

12

colonies of the Y98A mutant gave mainly rapidly growing cells and a reduced number of

them, suggesting that the original Y98A mutant had poor viability unless it obtained

compensatory mutations. In summary, the large colonies arose from cells with

compensatory mutations and the small colonies contained a mixture of cells without and

with such compensatory mutations.

To determine the ploidy of the mutants, we performed flow cytometry analysis on

them. As shown in Fig. 2D, cells from the large colonies showed increased ploidy,

compared to haploid wild-type cells. The DNA peaks from the mutants resembled those

of an authentic diploid, with peaks at 2n and 4n DNA content, suggesting that the mutants

had become diploid. The increase-in-ploidy phenotype was observed for all 9 large

colonies tested from the Y98A mutant, and also for 8 out of 9 large colonies from the

L97A or G99A mutants. Cells from the small colonies of the L97A and G99A mutants

showed a mixed DNA distribution with both 1n and 2n peaks characteristic of haploids,

and a 4n shoulder. This pattern reflects the mixture of small and large colonies seen in

Fig. 2C. On the other hand, the Y98A mutant cells from small colonies had a prominent

4n peak, probably because that mutant is the sickest of the three and there is strong

selective pressure for an increase in ploidy. These data show that mutations of these three

H4 residues leads to poor growth and strong selective pressure to become diploid and

thus grow more rapidly.

To examine the ploidy of the rapidly growing mutants in more detail, we carried

out a microarray analysis, comparing the DNA content of each yeast gene for the histone

mutants versus a wild type haploid control. Consistent with the flow cytometry data, all

genes from the mutants were present in at least twice the DNA content of the haploid


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

13

control (Table 3). Interestingly, the data showed that many of the cells had become

aneuploid, containing more than two copies of a specific chromosome. Strikingly, in

every case of aneuploidy (7/9 mutant colonies tested) Chromosome XI was present in 3

or 4 copies (Table 3). In addition, several mutant isolates also had 3 copies of

Chromosome III, VI or XII.

We also measured the chromosome loss frequency for the mutants. The loss of

chromosome III was measured by quantifying the ability of MATα cells expressing the

H4 mutant to mate with a MATα test strain. Compared to wild type, cells expressing

L97A or G99A exhibited a 5-fold elevated chromosome III loss frequency, and the Y98A

mutant had close to a 10-fold elevated frequency (Fig. 3A). In another test, we measured

the frequency of loss of a CEN plasmid. Just as was seen for Chromosome III, cells

expressing the H4 mutants exhibited an increased frequency of CEN plasmid loss (Fig.

3B), reinforcing the point that the H4 mutants have a chromosome segregation defect.

The experiments depicted in Fig. 3 were done with cells containing plasmids expressing

both wild-type and mutant H4 and reflect the semi-dominant phenotype of the H4

mutants. After plasmid shuffle, similar results were seen with cells expressing only the

mutant H4.

The poor growth and polyploidy is specific to mutations of three adjacent H4

C-terminal residues. The poor growth and polyploidy of the H4 mutants was specific to

mutations of residues 97, 98 and 99 and was not observed for H4 mutations of amino

acids on either side of those three amino acids (Fig. 1 and data not shown). The G99A

mutation is a relatively small change in that residue. To create a more drastic mutation,

we changed Gly99 to Leu or Asp. Those mutants grew more slowly than the G99A


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

14

mutant, and had a more prominent 4n peak (Fig. 4A and B). We also created a

conservative change in amino acid 98 by mutating it from Tyr to Phe. If phosphorylation

of Tyr98 plays an important role in its function, then mutating it to Phe should lead to an

observable phenotype. As seen in Fig. 4C and D, the H4 Y98F mutant grew as well as

wild type and had a haploid DNA content. Thus it is very unlikely that phosphorylation

of Tyr98 plays an important role in the function of this residue, and in fact there is no

evidence that it is phosphorylated.

The nucleosome structure shows that H4 residues 97-99 interact with H2A

residues 101-104 in a β sheet (17, 30). Therefore, we tested whether mutation of any of

those H2A residues led to the same phenotype as seen for the H4 mutants. Mutation of

V101, T102 or I103 to Ala caused no growth defect and the mutants remained haploid

(Fig. 4E and F). Since H2A amino acid 104 is an alanine, we mutated it to Arg, and we

also created a V101R mutant. These two H2A mutants also grew normally and had a

haploid DNA content (Fig. 3E and F). H2B residues K60, S63 and I64 are also

somewhat near residues H4 97-99 (17, 30). Mutating those three H2B residues also did

not lead to a growth defect or polyploidy. In fact, in an initial screening of all the viable

H2A, H2B, H3 and H4 Ala substitutions mutants by flow cytometry, only the three H4

mutants affecting amino acids 97, 98 and 99 showed polyploidy (data not shown). Thus,

we conclude that the phenotype of these three H4 mutants is unlikely to be due to a

defective interaction of H4 with other histones in the nucleosome.

H4 mutants have a defect in kinetochore assembly. The observed polyploidy

could result from perturbation of cell cycle progression. Various stages in the cell cycle

such as DNA replication, spindle assembly, cohesion cleavage and cytokinesis, and the


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

15

response to DNA damage, all are subject to checkpoint control (29). To help clarify the

defect caused by the H4 mutants, we checked the growth of the mutants in combination

with deletion of different checkpoint genes. Combining each of the H4 mutants with a

rad9∆ or a mec1∆ mutant did not lead to any significant synthetic sickness (data not

shown). These results suggested that the H4 mutants didn’t cause excess DNA damage or

a replication defect. In contrast, combining the H4 mutants with deletion of the MAD2

spindle assembly checkpoint gene led to a much more severe growth defect (Fig. 5).

Cells expressing the L97A or the G99A mutant were barely alive and cells expressing the

Y98A mutant were dead, except for a few giant colonies derived from cells that

presumably had obtained compensatory mutations. These data suggested that the H4

mutants exhibited a defect in spindle or kinetochore assembly.

To investigate the fidelity of kinetochore assembly in the H4 mutants, we checked

the localization of several kinetochore proteins: Nuf2 from the Ndc80 complex, Mtw1

from the MIND complex and Spc105. Each of these proteins was tagged with GFP in

separate strains and the spindle pole body was labeled with Spc29-RFP in each strain (2).

Two RFP foci could be seen in cells after duplication of the spindle pole body. The

kinetochore was assembled nearby, as shown by two GFP foci adjacent to the RFP foci in

most wild type cells (Fig. 6 and Table 4). In cells expressing one of the H4 mutants, a

higher percentage of cells contained only one GFP focus (Fig. 6 and Table 4).

Significantly, in almost every case, the single GFP focus was associated with the brighter

of the two red foci. The brighter red focus reflects the old spindle pole body and the

dimmer one represents the new spindle pole body. These results suggest that there is a

significant delay or defect in the assembly of the kinetochore at the new spindle pole


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

16

body in the H4 mutants. This was the case for all three kinetochore proteins (Table 4). In

addition, no GFP focus was seen in 23 out of 900 cells examined for the three H4 mutants

and only once in 300 cells for wild type, again suggesting a defect in kinetochore

assembly (Table 4).

The three H4 mutants have a more open chromatin structure. The defective

kinetochore assembly observed in the H4 mutants suggested that the chromatin structure

around the centromeric region might be altered. Therefore, we tested the susceptibility of

the chromatin of a specific centromere, CEN III, to digestion by the restriction enzyme

DraI. This method had been used previously to examine centromeric chromatin in the

case of a cse4 ts mutant (18). We found that the CEN III chromatin from each of the H4

mutants was much more susceptible to DraI digestion than the wild-type chromatin,

suggesting that the chromatin of the mutants had a more open or altered structure (Fig.

7A). To check if this effect was specific to centromeres, we tested DraI sensitivity of the

GAL10 locus. We found that this locus also exhibited greater sensitivity for all three

mutants (Fig. 7B). This result suggested that the H4 mutants had an altered chromatin

structure throughout the genome. This was confirmed by microccocal nuclease digestion

of nuclei from wild-type cells and the three H4 mutants. The digests were phenol-treated

and the resultant DNA fragments separated by agarose gel electrophoresis. We then

quantified the amount of DNA corresponding to mono-, di- and trinucleosomes released

by the enzyme digestion. As seen in Fig. 7C, there was a much greater fraction of

mononucleosomes in the each of the three mutants compared to wild type, and also

somewhat more dinucleosomes. Thus, the chromatin from the mutants was more

susceptible to micrococcal nuclease digestion, again suggesting an altered, somewhat


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

17

more accessible, chromatin structure in the H4 mutants.

The greater susceptibility to nucleases suggested that there was lower histone

occupancy on the chromatin in the mutants. To check on this, we used chromatin

immunoprecipitation (ChIP) to compare the occupancy of wild-type and mutant H4 at

three different loci on the yeast genome. As seen in Fig. 7D, at all three loci, CENIII,

GAL10 and PMA1, there is less of the Y98A mutant H4 than wild type H4. The effect is

more pronounced at the two loci with little or no transcription, CENIII and GAL10, than

at the heavily transcribed PMA1 locus. This is expected, given that transcription lowers

histone occupancy (28).

The three H4 mutants interact genetically and biochemically with the histone

chaperones, Rtt106 and CAF-I. Since the ChIP results shown in Fig. 7D showed less

mutant H4 than wild type H4, we considered the possibility that the H4 mutants might be

defective in histone deposition of H3/H4 dimers. Another hint that this might be the case

was that the growth defects and aneuploidy we observed were so localized to mutations

of three adjacent residues on H4, and were not seen for mutations of residues on H2A and

H2B that are near this H4 C-terminal patch in the nucleosome structure. We noted that

H4 residues 97, 98 and 99 interact with the histone deposition protein, Asf1 (10).

Therefore, we examined an asf1∆ mutant to see if it was polyploid, and found it to be a

normal haploid. We also generated asf1∆ double mutants with each of the H4 mutants

and found no synthetic lethality or sickness (data not shown). In addition, mutations of

Asf1 residues that reside at the Asf1-H4 interface do not have a severe growth defect (10).

Next we tested the genes for three other histone chaperones, Hir1, Rtt106 and

CAF-I for genetic interactions with the H4 mutations. No genetic interactions were


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

18

apparent with a hir1 mutation. On the other hand, unusual genetic interactions were seen

with RTT106. We found that transforming plasmids expressing the H4 mutants into a

strain expressing wild-type H4, and containing an rtt106∆ mutation, led to significantly

improved growth of the mutants compared to a RTT106 strain (Fig. 8A). In addition to

the improvement in growth, the rtt106 deletion also delayed the onset of diplodization

(Fig. 8E). On the other hand, if the plasmid expressing wild-type H4 was eliminated by

growth on 5-FOA, then the growth of the mutants was equally poor in the rtt106∆ and

RTT106 strains. This observation will be discussed in the next section. A striking result

was found with a mad2-rtt106 double mutant; the rtt106 mutation rescued the near

lethality of the H4 mutants in the mad2 background (Fig. 8B). Overexpressing Rtt106

from a multicopy plasmid had the opposite effect of an rtt106 mutation in that it

exacerbated the poor growth of the H4 mutants (Fig. 8C).

CAF-I is a replication-coupled histone chaperone for H3/H4 and consists of three

subunits, Cac1, Cac2 and Msi1. Just as was seen for rtt106∆, cac1∆ and cac2∆

mutations also improved the growth of the three H4 mutants (Fig. 8D). In an rtt106∆-

cac1∆ double mutant, there was a somewhat greater growth improvement than in either

single mutant (data not shown).

In view of the genetic interactions between the H4 mutants and RTT106, CAC1

and CAC2, we investigated whether the known binding of H3/H4 to these two chaperones

was altered in the H4 mutants. First, we examined Rtt106, using a TAP-tagged Rtt106

strain to purify the protein from yeast expressing either wild-type H4 or one of the three

H4 mutants. Western analysis was used to determine the amount of H4 and H3 bound to

the Rtt106. To our surprise, there was much more mutant H4, as well as H3, associated


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

19

with Rtt106 purified from the mutants than from wild type H4 (Fig. 9A). Rtt106 has

been shown to interact with Cac2 in vivo (13). This association was the same for the

mutants as for wild type (Fig. 9A) suggesting that the increased association between

Rtt106 and mutant H4/H3 was specific. Previous studies showed that H3 acetylated at

lysine 56 is incorporated onto replicating DNA and this was at least partially due to its

increased affinity for Rtt106 compared to unacetylated H3 (15). Therefore we considered

the possibility that the increased amount of H3 and H4 bound to Rtt106 in the mutants

was due to a greatly increased amount of K56Ac H3 in the mutants (15). To check on

this, we probed the whole cell extracts from the four strains with an antibody specific to

H3 K56Ac. As seen in Fig. 9A, the amounts of H3K56Ac in the whole cell extracts

from wild type and mutant cells were very similar, as were the amounts of total H3 or H4.

Therefore increased H3 K56 acetylation could not account for the large increase in

binding of H4 and H3 to Rtt106 seen in the mutants.

To determine if mutant H4 also accumulated on CAF-I, we performed a similar

purification of TAP-tagged Cac2 from yeast. The results for the H4 Y98A mutant, the

mutant with the most pronounced growth defect, were similar to that found for Rtt106 in

that there was much more mutant H4 than wild type H4 bound to Cac2, with a

correspondingly higher amount of H3 (Fig. 9B). On the other hand, for the L97A mutant,

less H4 and H3 were bound to Cac2 compared to wild type, while the binding of H4 and

H3 for the G99A mutant was about the same as for wild type (Fig. 9B). Very similar

results were found for two completely independent purifications of Cac2.

The TAP results described above could be due to an increased affinity of all three

H4 mutant proteins for Rtt106 and of the Y98A mutant for CAF-I, although it seemed


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

20

unlikely that mutating these H4 residues would lead to better binding. Alternatively, the

mutant H4 histones might bind to these two chaperones with the same or less affinity

than wild type, but have a defect in transferring the histones to the next component in the

deposition pathway, whether it be DNA or another chaperone. To distinguish between

these possibilities in the case of Rtt106, we performed in vitro pull down assays with

GST-Rtt106 and histones purified from yeast or E. coli. As shown in Fig. 9C, H4 and H3

from yeast bound to Rtt106, as reported previously (13). Importantly, in this in vitro

experiment all three H4 mutant proteins, as well as H3, bound more weakly to Rtt106

than did wild type H4/H3. We also expressed and purified recombinant H4/H3 (wild type

H4 or the Y98A mutant) from E. coli and repeated the pull down with GST-Rtt106. A

similar result was seen as with histones purified from yeast; in this case the mutant

H4/H3 bound slightly more weakly (Fig. 9D). Therefore, the increased amount of mutant

H4 and H3 bound to Rtt106-TAP purified from yeast is not due to an increased affinity of

the mutant H4 proteins for Rtt106, and instead is due to the mutant H4 accumulating on

Rtt106, presumably because it is blocked in the next step in the deposition pathway. We

did not attempt similar binding experiments with recombinant CAF-I because of the

difficulty of expressing all three of its subunits together.

Discussion

In this study, we identified a unique three amino acid patch near the C-terminus of

histone H4, composed of L97, Y98, G99, which when mutated led to a severe growth

defect accompanied by polyploidy and aneuploidy. The precise structure of this patch

must be important for function. Mutating Y98 to Ala led to a severe growth defect while

changing it to Phe did not. Gly 99 was clearly an important residue because even a


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

21

conservative change to Ala led to a significant growth defect, while mutating it to a larger

residue such as Leu or Asp led to a more severe defect. Strikingly, mutating residues on

either side of this three amino acid patch did not lead to same phenotypes, nor did

mutating nearby nucleosomal residues on H2A or H2B (Fig. 3). Thus, we don’t think

that the phenotypes seen for these three H4 mutants are due to an altered nucleosome

structure.

Yeast mutations of H4 Y98 have been the subject of previous studies. Santisteban

et al. found that a Y98G mutation was lethal, a Y98H allele grew poorly at 25ºC and was

temperature-sensitive, while a Y98W mutant had no observable phenotypes (26). The

lack of a phenotype seen for the Y98W mutant was similar to what we observed for a

Y98F mutant (Fig. 3). In another study, a Y98A mutation was found to be lethal in one

strain background and slow growing in another background (7). In human tumors and in

cultured cells exposed to nitric oxide, Y98 is sometimes found to be modified by nitration,

and this modification of tyrosine is considered a biomarker for nitric oxide-dependent

oxidative stress (11, 23). It is intriguing to consider that the genome instability often

associated with cancer cells may be partially due to this modification of H4 Y98.

Polyploidy and a chromosome segregation defect of the mutants. A striking

phenotype of the three H4 mutants was that the strains, initially haploid, showed a rapid

increase in ploidy upon further growth, and this increase was closely linked to improved

growth (Fig. 2). This observation was consistent with a previous report showing that

polyploidy and aneuploidy are common genetic alterations in evolving poorly-growing

yeast mutants (24). We found that the H4 mutants rapidly became diploid, and when

examined carefully by microarray analysis, many isolates actually had more than two


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

22

copies of one or more chromosomes. Interestingly, in every case of aneuploidy, cells had

2 or 3 extra copies of chromosome XI, suggesting that overexpression of one or more

genes on chromosome XI led to improved growth of the mutants. There were several

histone-related genes on the chromosome XI, including CSE4 and NAP1. Nap1 protein is

a histone chaperone for H2A-H2B dimers (20). However, overexpression of NAP1 from

a 2 micron plasmid had no effect on growth of the H4 mutants (data not shown). Cse4 is

the histone H3 variant present at centromeres (18). Overexpression of CSE4 did improve

the growth of the mutants, but the extent of improvement was much less than that

observed for the evolved aneuploid strains (data not shown). Hence, other transcriptional

changes associated with the extra copies of chromosome XI, probably in combination

with the alterations on other chromosomes, are required to fully rescue the growth defect

of the mutants.

In addition to polyploidy, the H4 mutants exhibited a chromosome loss phenotype.

Both Chromosome III and a centromere-based plasmid were lost at a high frequency

compared to wild type (Fig. 3). The chromosome instability exhibited by the mutants as

well as synthetic sickness/lethality seen with a mad2 mutation (Fig. 5) suggested that the

H4 mutants might have a defect in attaching the mitotic spindle to centromeric chromatin.

Indeed we found that kinetochore assembly was defective in the mutants and the defect

was almost always seen in the newer of the two spindles in cells in which spindle pole

duplication had occurred (Fig. 6 and Table 4). It was particularly significant that we

observed this defect in strains with a plasmid expressing the mutant H4 but with both

wild-type chromosomal H4/H3 genes, relying on the semi-dominant phenotype of the

mutants. Presumably we would have seen a higher percentage of abnormal kinetochores


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

23

if we had deleted one or both of the chromosomal H4/H3 genes.

We also found that CEN III chromatin had increased sensitivity to DraI nuclease

in the case of all three H4 mutants compared to wild type (Fig. 7A). However,

examination of the GAL10 gene showed the same increased sensitivity to DraI cutting,

suggesting that this effect might be genome-wide (Fig. 7B). The kinetochore is likely to

interact not only with the Cse4-containing nucleosome but also with surrounding H3-

containing ones (K. Bloom, personal communication). Thus the defective kinetochore

assembly of the mutants may be due to a lower nucleosome density in the centromere

region or conceivably to a direct interaction of kinetochore components with H4 residues

97-99.

Global lower nucleosome density in the mutants. In view of increased DraI

sensitivity for the mutants at two loci, we looked at micrococcal nuclease sensitivity of

bulk chromatin and found a larger fraction of the chromatin was digested to mono- and

dinucleosomes in the mutants than in wild type (Fig. 7C). We also looked at H4

occupancy by chromatin immunoprecipitation at two loci expressed at a very low level,

CEN III and GAL10, and at the highly expressed PMA1 gene. We found a lower

occupancy for the mutants than for wild type at all three loci (Fig. 7D). The combination

of all these results leads us to conclude that the mutants have a lower than normal

nucleosome density throughout the genome. We also considered the possibility that the

altered chromatin structure changed gene expression in the H4 mutants, thus causing the

increase-in-ploidy and the slow growth. A microarray analysis comparing gene

expression of the mutants with wild type found that no clear pattern emerged which could

explain how altered gene expression caused the chromosome segregation defects (data


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

24

not shown).

The role of histone chaperones Rtt106 and CAF-I. An affinity purification of

the H4/H3 chaperone Rtt106 from yeast yielded a surprising result. Much more mutant

H4 than wild type H4, was bound to Rtt106 in the case of each of the three H4 mutants

(Fig. 9A). The amount of H3 bound was also correspondingly higher in the case of the

mutants, not unexpected since H4 and H3 both bind to Rtt106 and are deposited together,

probably as a dimer. Purification of CAF-I from yeast using TAP-tagged Cac2 yielded

similar results to those seen for Rtt106 for the H4 Y98A mutant, the one with the most

severe phenotypes (Fig. 9B). However, in vitro binding experiments provided a different

result. Regardless of the source of histones, either purified from yeast or E. coli, the

mutant H4 bound slightly more weakly to recombinant Rtt106 than the wild type H4 (Fig.

9C and D). Thus, the large amount of H4 and H3 bound to Rtt106 purified from yeast in

the case of the mutants (Fig. 9A) was not due to a greater affinity of the mutant H4 to

Rtt106. Instead, it was due to a defect in the transfer of H4/H3 (we assume dimers) from

Rtt106 to the next step in the deposition pathway, whether it be to another chaperone or

DNA itself. These results are depicted in cartoon form in Fig. 10A and B. The

interpretation that deposition by Rtt106 and CAF-I is defective in the H4 mutants would

explain why they have a lower nucleosome density on the chromatin, as judged by three

different criteria. The centromeric region of the chromosomes may be particularly

sensitive to this chromatin alteration, and that would explain the kinetochore assembly

and chromosome segregation defects observed for the H4 mutants. A previous study

found that two H2A single amino acid replacement mutants showed an increase-in-ploidy

and a chromosome loss phenotype, similar to what we found for the three H4 mutants. In


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

25

the case of the H2A mutants, both genetic and biochemical experiments suggested that

the phenotypes were due to an altered centromeric chromatin (22).

We also observed strong genetic interactions between the three H4 mutants and

RTT106, CAC1 and CAC2. Strains expressing wild-type H4 and one of the H4 mutants

from different plasmids exhibited much better growth in the presence of rtt106∆ or cac1∆

or cac2∆ mutations (Fig. 8A and D). Conversely, overexpression of Rtt106 exacerbated

the poor growth of the H4 mutants (Fig. 8C). These genetic interactions can be explained

with the following model based on the large accumulation of mutant H4 seen bound to

Rtt106 purified from yeast and of the Y98A mutant in the case of CAF-I. We suggest that

in cells expressing both wild-type and mutant histones, the deposition of wild type H4/H3

through Rtt106 or CAF-I is also affected, since a certain fraction of Rtt106 and CAF-I

have mutant histones bound to them non-productively (Fig. 10C). As argued above, poor

histone deposition causes a lower nucleosome density on the chromatin and hence poor

growth. We propose that when RTT106, CAC1 or CAC2 are deleted, the deposition of

histones is taken over by one of the other chaperone present in cells, and these

chaperones do not bind mutant H4/H3 non-productively the way Rtt106 or CAF-I do (Fig.

10D). This can explain why growth of the histone mutants was improved by deletion of

RTT106, CAC1 or CAC2. Similarly, overexpression of Rtt106 bound even more mutant

H4/H3 and thus caused greater toxicity. Surprisingly, no apparent improvement of

growth was observed in rtt106∆ or cac1∆ after the plasmid expressing wild-type H4 was

removed by 5-FOA treatment, leaving mutant H4 as the only source of H4. One possible

explanation is that in that case the whole chromosome is occupied by mutant H4, and that

might cause other defects that cancel the positive effects of alternate, redundant


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

26

chaperones.

In conclusion, we have identified a small domain near the C-terminus of histone

H4 that is important for genome stability. When this domain is mutated, it leads to less

deposition of H4/H3 onto chromatin, which in turn causes the genome instability.

Structural studies of the interaction between H4/H3 and the histone chaperones Rtt106

and CAF-I should shed further light on why this domain of H4 is so important for H4/H3

deposition.

Acknowledgements. We thank Nancy Hollingsworth and Aaron Neiman for

important suggestions, Zhiguo Zhang and Kerry Bloom for advice and reagents, Evelyn

Prugar for valuable technical assistance, Michael Schultz for technical advice and Carl

Wu for histone expression plasmids. This work was supported by NIH grants GM55641

and PO1 GM88297 to R.S., GM76272 to J.L. and GM69905 to A.S.

REFERENCES

1. Amberg, D. C., D. Burke, J. N. Strathern, and Cold Spring Harbor Laboratory. 2005.

Methods in yeast genetics : a Cold Spring Harbor Laboratory course manual, 2005 ed. Cold Spring

Harbor Laboratory Press, Cold Spring Harbor, N.Y.

2. Anderson, M., J. Haase, E. Yeh, and K. Bloom. 2009. Function and assembly of DNA looping,

clustering, and microtubule attachment complexes within a eukaryotic kinetochore. Mol Biol Cell

20:4131-9.

3. Belotserkovskaya, R., S. Oh, V. A. Bondarenko, G. Orphanides, V. M. Studitsky, and D.

Reinberg. 2003. FACT facilitates transcription-dependent nucleosome alteration. Science

301:1090-3.

4. Bhaumik, S. R., and M. R. Green. 2003. Interaction of Gal4p with components of transcription

machinery in vivo. Methods Enzymol 370:445-54.

5. Bloom, K. S., and J. Carbon. 1982. Yeast centromere DNA is in a unique and highly ordered

structure in chromosomes and small circular minichromosomes. Cell 29:305-17.

6. Camahort, R., B. Li, L. Florens, S. K. Swanson, M. P. Washburn, and J. L. Gerton. 2007.

Scm3 is essential to recruit the histone h3 variant cse4 to centromeres and to maintain a functional

kinetochore. Mol Cell 26:853-65.

7. Dai, J., E. M. Hyland, D. S. Yuan, H. Huang, J. S. Bader, and J. D. Boeke. 2008. Probing


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

27

nucleosome function: a highly versatile library of synthetic histone H3 and H4 mutants. Cell

134:1066-78.

8. Dunleavy, E. M., D. Roche, H. Tagami, N. Lacoste, D. Ray-Gallet, Y. Nakamura, Y. Daigo, Y.

Nakatani, and G. Almouzni-Pettinotti. 2009. HJURP is a cell-cycle-dependent maintenance and

deposition factor of CENP-A at centromeres. Cell 137:485-97.

9. Edmondson, D. G., M. M. Smith, and S. Y. Roth. 1996. Repression domain of the yeast global

repressor Tup1 interacts directly with histones H3 and H4. Genes Dev 10:1247-59.

10. English, C. M., M. W. Adkins, J. J. Carson, M. E. Churchill, and J. K. Tyler. 2006. Structural

basis for the histone chaperone activity of Asf1. Cell 127:495-508.

11. Haqqani, A. S., J. F. Kelly, and H. C. Birnboim. 2002. Selective nitration of histone tyrosine

residues in vivo in mutatect tumors. J Biol Chem 277:3614-21.

12. Hirschhorn, J. N., S. A. Brown, C. D. Clark, and F. Winston. 1992. Evidence that SNF2/SWI2

and SNF5 activate transcription in yeast by altering chromatin structure. Genes Dev 6:2288-98.

13. Huang, S., H. Zhou, D. Katzmann, M. Hochstrasser, E. Atanasova, and Z. Zhang. 2005.

Rtt106p is a histone chaperone involved in heterochromatin-mediated silencing. Proc Natl Acad

Sci U S A 102:13410-5.

14. Levenstein, M. E., and J. T. Kadonaga. 2002. Biochemical analysis of chromatin containing

recombinant Drosophila core histones. J Biol Chem 277:8749-54.

15. Li, Q., H. Zhou, H. Wurtele, B. Davies, B. Horazdovsky, A. Verreault, and Z. Zhang. 2008.

Acetylation of histone H3 lysine 56 regulates replication-coupled nucleosome assembly. Cell

134:244-55.

16. Loyola, A., and G. Almouzni. 2004. Histone chaperones, a supporting role in the limelight.

Biochim Biophys Acta 1677:3-11.

17. Luger, K., A. W. Mader, R. K. Richmond, D. F. Sargent, and T. J. Richmond. 1997. Crystal

structure of the nucleosome core particle at 2.8 A resolution. Nature 389:251-60.

18. Meluh, P. B., P. Yang, L. Glowczewski, D. Koshland, and M. M. Smith. 1998. Cse4p is a

component of the core centromere of Saccharomyces cerevisiae. Cell 94:607-13.

19. Morgan, B. A., B. A. Mittman, and M. M. Smith. 1991. The highly conserved N-terminal

domains of histones H3 and H4 are required for normal cell cycle progression. Mol Cell Biol

11:4111-20.

20. Mosammaparast, N., C. S. Ewart, and L. F. Pemberton. 2002. A role for nucleosome assembly

protein 1 in the nuclear transport of histones H2A and H2B. EMBO J 21:6527-38.

21. Nakanishi, S., B. W. Sanderson, K. M. Delventhal, W. D. Bradford, K. Staehling-Hampton,

and A. Shilatifard. 2008. A comprehensive library of histone mutants identifies nucleosomal

residues required for H3K4 methylation. Nat Struct Mol Biol 15:881-8.

22. Pinto, I., and F. Winston. 2000. Histone H2A is required for normal centromere function in

Saccharomyces cerevisiae. EMBO J 19:1598-612.

23. Radi, R. 2004. Nitric oxide, oxidants, and protein tyrosine nitration. Proc Natl Acad Sci U S A

101:4003-8.

24. Rancati, G., N. Pavelka, B. Fleharty, A. Noll, R. Trimble, K. Walton, A. Perera, K. Staehling-

Hampton, C. W. Seidel, and R. Li. 2008. Aneuploidy underlies rapid adaptive evolution of yeast

cells deprived of a conserved cytokinesis motor. Cell 135:879-93.

25. Ransom, M., B. K. Dennehey, and J. K. Tyler. 2010. Chaperoning histones during DNA

replication and repair. Cell 140:183-95.

26. Santisteban, M. S., G. Arents, E. N. Moudrianakis, and M. M. Smith. 1997. Histone octamer

function in vivo: mutations in the dimer-tetramer interfaces disrupt both gene activation and

repression. EMBO J 16:2493-506.

27. Schwabish, M. A., and K. Struhl. 2006. Asf1 mediates histone eviction and deposition during

elongation by RNA polymerase II. Mol Cell 22:415-22.

28. Schwabish, M. A., and K. Struhl. 2004. Evidence for eviction and rapid deposition of histones

upon transcriptional elongation by RNA polymerase II. Mol Cell Biol 24:10111-7.

29. Storchova, Z., and D. Pellman. 2004. From polyploidy to aneuploidy, genome instability and

cancer. Nat Rev Mol Cell Biol 5:45-54.

30. White, C. L., R. K. Suto, and K. Luger. 2001. Structure of the yeast nucleosome core particle

reveals fundamental changes in internucleosome interactions. EMBO J 20:5207-18.

31. Williams, J. S., T. Hayashi, M. Yanagida, and P. Russell. 2009. Fission yeast Scm3 mediates


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

28

stable assembly of Cnp1/CENP-A into centromeric chromatin. Mol Cell 33:287-98.

32. Zhang, W., J. R. Bone, D. G. Edmondson, B. M. Turner, and S. Y. Roth. 1998. Essential and

redundant functions of histone acetylation revealed by mutation of target lysines and loss of the

Gcn5p acetyltransferase. EMBO J 17:3155-67.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

29

TABLE 1. Yeast strains

Strain Genotype Source

YYY67 MATa leu2∆1 his3∆200 ura3-52 trp1∆63 lys2-128δ (hht1-

hhf1)∆::LEU2 (hht2-hhf2) ∆::HIS3 Ty912∆35-lacZ::his4

<pMS329 HHT1-HHF1 URA3 SUP11 CEN4>

This study

YYY70 Same as YYY67, but replace (hht1-hhf1)∆::LEU2 by (hht1-

hhf1)∆::KAN

This study

FY406 MATa leu2∆1 his3∆200 ura3-52 trp1∆63 (htat1-

htb1)∆::LEU2 (hta2-htb2) ∆::TRP1 <pSAB6 HTA1-HTB1

URA3 >

(27)

YYY91 MATα leu2 his3 ura3 trp1 ade2-1 can1-100 cyh2 (hht1-

hhf1)∆::LEU2 (hht2-hhf2) ∆::HIS3 his4∆::KAN <pMS329

HHT1-HHF1 URA3 SUP11 CEN4>

This study

DC16 MATa HMLα HMRa his1 Kim

Nasmyth

DC17 MATα HMLα HMRa his1 Kim

Nasmyth

YYY85a mad2∆::KAN This study

YYY87a sml1∆::KAN, mec1∆::NAT1 This study

YYY90a rad9∆::KAN This study

MAY8526 MATa trp1∆63 leu2∆ ura3-52 his3∆200 lys2-8∆1 NUF2-

GFP::URA3 SPC29-RFP::Hb

(2)

MAY8539 MATa trp1∆63 leu2∆ ura3-52 his3∆200 lys2-8∆1 SPC105-

GFP::KAN SPC29-RFP::Hb

(2)

MAY8511 MATα leu2-3,112 ura3-52 his3∆200 lys2 MTW1-GFP::KAN

SPC29-RFP::Hb

(2)

YYY92a rtt106∆::KAN This study

YYY93a mad2∆::KAN, rtt106∆::NAT This study

YYY83a cac1∆::KAN This study

YYY88a cac2∆::KAN This study

ZGY692 MATα ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1

RTT106-TAP::TRP1 hht1-hhf1∆::LEU2, hhf1-hhf2∆::KAN

<YCp50-HHT2-HHF2>

(13)

ZGY892 MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1

CAC2-TAP::TRP1 hht1-hhf1∆::LEU2, hhf1-hhf2∆::KAN

<YCp50-HHT2-HHF2>

(13)

a Isogenic relative to YYY67


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

30

TABLE 2. Plasmids used in this study

Plasmid Description Reference

pWZ414-F12 HHT2-HHF2 TRP1 CEN3 (32)

pH4-G94A Same as pWZ414-F12, but contains H4 G94A

mutation

(21)

pH4-R95A Same as pWZ414-F12, but contains H4 R95A

mutation

(21)

pH4-T96A Same as pWZ414-F12, but contains H4 T96A

mutation

(21)

pH4-L97A Same as pWZ414-F12, but contains H4 L97A

mutation

(21)

pH4-Y98A Same as pWZ414-F12, but contains H4 Y98A

mutation

(21)


mutation

(21)

pH4-F100A Same as pWZ414-F12, but contains H4 F100A

mutation

(21)


mutation

(21)


mutation

(21)

pYY117 Same as pWZ414-F12, but contains H4 G99L

mutation

This study

pYY118 Same as pWZ414-F12, but contains H4 G99D

mutation

This study

pYY58 Same as pWZ414-F12, but contains H4 Y98F

mutation

This study

pZS145

HTA1-FLAG-HTB1 CEN HIS3 (21)

pH2A-V101A Same as pZS145, but contains H2A V101A

mutation

(21)

pH2A-T102A Same as pZS145, but contains H2A T102A

mutation

(21)

pH2A-I103A Same as pZS145, but contains H2A I103A

mutation

(21)

pYY111

Same as pZS145, but contains H2A V101R

mutation

This study

pYY112

Same as pZS145, but contains H2A A104R

mutation

This study

pMS329 HHT1-HHF1 URA3 SUP11 CEN4 (19)

pET28b-HHT2 HHT2 ORF is cloned into the Nco I (start) and

Xho I (end) sites of pET28b vector (Novagen).

Carl Wu

pET28b-HHF2 HHF2 ORF is cloned into the Nco I (start) and

Xho I (end) sites. Nco I site is destroyed because

of ligation to compatible Afl III site.

Carl Wu

pYY133 Fragment containing T7 promoter and HHF2 ORF This study


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

31

was amplified by PCR from pET28b-HHF2, with

Xho I sites at both ends. The fragment was cloned

into the XhoI site of pET28b-HHT2 vector. The

direction of HHF2 ORF was the same as that of

HHT2.

pYY131 Same as pYY133, but contains Y98A mutation in

the ORF of HHT2.

This study

pZG114 pGEX-4T-1-RTT106 (13)

pYY119 pRS313 (3) with a 1.8 kb SpeI fragment

containing the HHT2-HHF2 genes

This study

pYY120 Same as pYY119, but contains H4 L97A mutation This study

pYY121 Same as pYY119, but contains H4 Y98A

mutation

This study

pYY122 Same as pYY119, but contains H4 G99A

mutation

This study

pYY64 CSE4 ORF with 450 bp upstream sequence and

400 bp downstream sequence was cloned into

Xho I and BamH I sites of pRS425.

This study

pYY134 RTT106 ORF plus 300 bp upstream sequence and

200 bp downstream sequence cloned into the

BamHI and XhoI sites of pRS425.

This study


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

32

TABLE 3. Microarray analysis of H4 mutants with increased ploidy

Clones Ploidy Extra Chromsome(s)

H4 L97A-1 2N 2 Chr XI

H4 L97A-2 2N

H4 L97A-3 2N 2 Chr XI

H4 Y98A-1 2N 1 Chr III, 2 Chr XI

H4 Y98A-2 2N 1 Chr III, 2 Chr XI, 1 Chr XII

H4 Y98A-3 2N 2 Chr XI

H4 G99A-1 2N

H4 G99A-2 2N 1 Chr XI

H4 G99A-3 2N 1 Chr XI, 1 Chr VI

Large colonies were grown in SC-Trp+5-FOA medium. Genomic DNA was purified from

the cells, labeled and hybridized to an S. cerevisiae expression array. The chromosomal

profiles of the cells was analyzed by Feature Extraction 9.5.3.1. All samples showed a 2n

DNA content compared to wild type, and some samples had extra chromosomes over and

above 2n as indicated.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

33

TABLE 4. Localization of kinetochore componentsa

aStrains MAY8526 (Nuf2-GFP), MAY8539 (Spc105-GFP) and MAY8511 (Mtw1-GFP)

were transformed with a plasmid expressing wild type or mutant H4. All the strains

contain Spc29-RFP. Localization of each GFP fusion kinetochore protein was analyzed

by fluorescence microscopy in 100 cells with two Spc29-RFP foci. Cells with no bud

were in late G1 phase, and those with a bud were either in S phase, G2 or early M phase.

Representative pictures of the GFP foci are shown in Fig. 6.

Late G1 cells S, G2, M Cells Strain Histone

%1 GFP

focus

% 0 GFP

focus

% 1 GFP

focus

% 0 GFP

focus

%

1 or 0

foci

WT 3 0 0 0 3

H4 L97A 5 0 2 0 7

H4 Y98A 10 0 1 3 14

Nuf2-GFP

H4 G99A 6 0 3 0 9

WT 7 0 2 1 10

H4 L97A 21 2 4 1 28

H4 Y98A 19 2 3 2 26

Spc105-GFP

H4 G99A 17 0 3 2 22

WT 8 0 6 0 14

H4 L97A 10 1 4 7 22

H4 Y98A 24 0 6 0 30

Mtw1-GFP

H4 G99A 10 0 9 3 22


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

34

Figure Legends

FIG. 1. Growth defect of H4 C-terminal substitution mutants. (A) Sequence of H4 C-

terminus. The three adjacent residues that lead to a growth defect when mutated to Ala

are underlined. (B and C) Growth of each of the H4 C-terminal Ala substitution mutants.

Plasmids encoding wild-type or mutant H4 were introduced by plasmid shuffle (see

Materials and Methods). Cells were taken from a SC-Trp+5-FOA plate, resuspended in

H2O, and 10-fold serial dilutions plated on the same medium. Plates were photographed

after 2 days at 30 ̊ C.

FIG. 2. Colony size heterogeneity and ploidy increase of three H4 mutants compared to

wild type H4. (A) Growth heterogeneity of the H4 mutants after plating on SC-Trp+5-

FOA medium to remove the URA3 plasmid encoding wild-type H4. Representative large

colonies are indicated with black arrowheads and small colonies with white arrowheads.

(B) Replating of large colonies from each of the mutants. (C) Replating of small colonies

from each of the mutants. (D) Flow cytometry analysis of progeny of large colonies. (E)

Flow cytometrty analysis of progeny of small colonies.

FIG. 3. Genome instability of the H4 mutants. (A) Chromsome III loss frequency of the

H4 mutants. MATα cells expressing wild type or mutant histone H4 were tested for the

capacity to mate with a MATα test strain. The loss frequency is the number of cells that

were able to mate divided by the number of total cells. The average of 3 independent

experiments is shown. (B) CEN plasmid loss frequency of the H4 mutants. Strains

containing a CEN LEU2 plasmid (pRS315) and expressing wild type or mutant H4 were


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

35

used to measure the plasmid loss frequency as described in Materials and Methods. The

average of 4 experiments is shown.

FIG. 4. Analysis of H4 C-terminal patch and adjoining H2A residues. (A and B) Growth

defect of various H4 G99 mutants and their ploidy. (C and D) Growth and ploidy of an

H4 Y98F mutant. (E and F) Growth and ploidy of H2A mutations of residues that abut

the H4 C-terminal patch in the nucleosome structure. In all cases, strains were analyzed

after growth on 5-FOA to remove the wild-type H4 or H2A plasmid.

FIG. 5. H4 mutants were synthetically sick with deletion of MAD2, a spindle checkpoint

gene. Strains YYY67 (MAD2) and YYY85 (mad2∆) carrying a URA3 plasmid expressing

wild-type H4 were transformed with a TRP1 plasmid expressing wild type or mutant

histone H4, and transformants selected on the SC-Ura -Trp medium. The growth of the

transformants was checked after 4 days.

FIG. 6. Localization of kinetochore proteins. Representative fluorescent images of the

GFP foci of Nuf2 (A), Spc105 (B) and Mtw1 (C) are shown. Spindle poles are labeled

with Spc29-RFP. The frequency of normal and abnormal foci observed for wild-type H4

and the three mutants is tabulated in Table 4.

FIG. 7. H4 mutants displayed altered chromatin structure. (A) Sensitivity of nuclei to

digestion by the restriction enzyme DraI at the CEN3 locus was compared for wild-type

and the H4 mutants. A schematic representation of an EcoRI fragment containing CEN3


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

36

and its CDE II element containing three DraI sites is depicted. The sensitivity of these

sites to DraI digestion of nuclei was measured by Southern blotting using a 0.9 kb probe

located downstream of CEN3. DNA fragments generated by DraI digestion from these

closely spaced sites were not separated from each other on the agarose gel used. The

percent of the CEN3 EcoRI fragment cut by DraI was calculated from the intensity of the

2.9 kb fragment compared to intensity the intact 5.1 kb fragment plus 2.9 kb fragment,

and is shown on the right for wild-type and the H4 mutants. (B) A similar measurement

of DraI sensitivity as in (A) was performed for the GAL10 locus. In this case an AvaI-

NdeI fragment containing a single DraI site was used. The GAL10 locus is depicted on

the left and the % DraI digestion is shown on the right. (C) Chromatin in H4 mutants

were more accessible for micrococcal nuclease (MNase) digestion. Nuclei was purified

from the cells expressing wild type or mutant histone H4 and treated with MNase for 10,

20, 30 or 40 min. DNA was purified, resolved by agarose electrophoresis and visualized

by ethidium bromide staining (left panel). The intensities of the bands of mono, di or tri

nucleosomes for the 30 min samples were quantified. The amount of tri-nucleosomes was

designated as arbitrary unit 1. The relative amounts of mono-nucleosomes and di-

nucleosomes are shown in the graph on the right. Experiments were repeated in triplicate.

(D) Chromatin immunoprecipitation of H4 (WT and Y98A) at three different loci. The

% is the signal relative to the input and is the average of three independent experiments.

FIG. 8. RTT106, CAC1 and CAC2 showed genetic interactions with the H4 mutants. (A)

rtt106∆ improved the growth of H4 mutants. Strains YYY67 (RTT106) or YYY92

(rtt106∆) containing pMS329 (HHT1-HHF1 URA3 CEN4) were transformed with TRP1


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

37

plasmids expressing wild type or mutant H4. Growth of the transformants on –Ura-Trp

medium is shown after 3 days incubation. (B) The synthetic sickness or lethality of the

mad2∆ -H4 double mutants could be partially rescued by rtt106∆. As in (A) the strains

were transformed with plasmids expressing wild type or mutant H4 and selected on the

SC-Ura -Trp medium. The growth of the transformants after 4 days is shown. The mad2∆

rtt106∆ strain used was YYY93. (C) Overexpression (OE) of RTT106 exaggerated the

growth defect of the H4 mutants. Strains containing either a vector or a RTT106

overexpression plasmid and pMS329 (HHT1-HHF1 URA3 CEN4) were transformed with

plasmids expressing wild type or mutant H4. Growth of the transformants after 3 days is

shown. (D) cac1∆ or cac2∆ improved the growth of H4 mutants. Strains YYY67 (CAC1,

CAC2), YYY83 (cac1∆) or YYY88 (cac2∆) containing pMS329 (HHT1-HHF1 URA3

CEN4) were transformed with TRP1 plasmids expressing wild type or mutant H4.

Growth of the transformants on –Ura-Trp medium is shown after 3 days incubation. (E)

rtt106∆ delayed the ploidy increase in H4 Y98A mutants. RTT106 or rtt106∆ strains were

transformed with plasmids expressing wild type H4 or the H4 Y98A mutant. Fresh

transformants were grown in SC-Ura-Trp medium and flow cytometry analysis was

performed to check the ploidy of the cells.

FIG. 9. Interaction between histone chaperones Rtt106 and CAF-I with H4. (A) Rtt106

purification. Rtt106-TAP was purified from the cells expressing wild type or mutant H4.

Co-purified proteins were detected by Westerns using antibodies against H4, H3,

H3K56Ac, Cac2, and Rtt106 by anti-CBP antibody. The antibodies were also used to

detect protein levels in the whole cell extract (WCE). (B) CAF-I purification using TAP-


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

38

tagged Cac2 from cells expressing wild-type or mutant H4. Co-purified proteins were

detected by Westerns using antibodies to H4 and H3. Cac2 was detected with an anti-CBP

antibody. (C) In vitro binding of histones purified from yeast to Rtt106. Wild type or H4

mutant histones were purified from yeast, resolved by SDS-PAGE and visualized by

Coomassie blue (CB) staining (top) or by western (bottom). H3* is an N-terminally

truncated form of H3 commonly found in yeast extracts. The histones were used in a pull-

down experiment with GST-Rtt106 as described in Materials and Methods. Three

concentrations of histones were mixed with 45 pmol of GST-Rtt106. (D) In vitro binding

of recombinant H4 and H3 to Rtt106. Wild type or Y98 mutant H4, along with H3, were

co-expressed and purified from E. coli. The H4 and H3 were used in a pull-down

experiment with GST-Rtt106. Three concentrations of histones were mixed with 30 pmol

of Rtt106.

FIG. 10. . Model for the deposition defect caused by histone H4 mutant. (A) Rtt106 or

CAF-I deposit wild-type (WT) H4/H3 dimers (or possibly tetramers) onto DNA. (B)

Mutant (MT) H4/H3 dimers accumulate on Rtt106 or CAF-I and cannot be transferred to

the next step. Poor histone deposition causes a lower nucleosome density on the

chromatin. (C) In the cells expressing both wild type and mutant histone H4, the

deposition of wild type histone H4 is also affected because a certain fraction of the

chaperone becomes inactive by non-productive binding of mutant H4. (D) In cells with

RTT106, CAC1 or CAC2 deletions, mutant H4/H3 cannot accumulate on either of those

chaperones and thus can be transferred onto DNA more efficiently by another chaperone

(colored purple).


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

a conserved patch near the c-terminus of histone h4 is required for

Documents