wen hao neo1, jun feng lim1 raelene grumont2 steve ... · wen hao neo1, jun feng lim1, raelene...

This document is downloaded from DR‑NTU (https://dr.ntu.edu.sg)Nanyang Technological University, Singapore.

c‑rel regulates Ezh2 expression in activatedlymphocytes and malignant lymphoid cells

Lim, Jun Feng; Grumont, Raelene; Gerondakis, Steve; Su, I‑hsin; Neo, Wen Hao

2014

Neo, W. H., Lim, J. F., Grumont, R., Gerondakis, S., & Su, I.‑h. (2014). c‑rel regulates Ezh2expression in activated lymphocytes and malignant lymphoid cells. Journal of biologicalchemistry, 289(46), 31693‑31707.

https://hdl.handle.net/10356/79473

https://doi.org/10.1074/jbc.M114.574517

© 2014 American Society for Biochemistry and Molecular Biology. This is the author createdversion of a work that has been peer reviewed and accepted for publication by The Journalof Biological Chemistry, American Society for Biochemistry and Molecular Biology. Itincorporates referee’s comments but changes resulting from the publishing process, suchas copyediting, structural formatting, may not be reflected in this document. The publishedversion is available at: [Article URL/DOI: http://dx.doi.org/10.1074/jbc.M114.574517].

Downloaded on 16 Apr 2021 12:56:46 SGT

c-Rel Regulates Ezh2 Expression

1

c-Rel Regulates Ezh2 Expression in Activated Lymphocytes and Malignant Lymphoid Cells*

Wen Hao Neo1, Jun Feng Lim1, Raelene Grumont2, Steve Gerondakis2, I-hsin Su1

1School of Biological Sciences, College of Science, Nanyang Technological University, 60 Nanyang

Drive, Singapore 637551, Republic of Singapore 2The Australian Center for Blood Diseases, Monash University, 89 Commercial Road, Melbourne,

Victoria 3004, Australia

*Running Title: c-Rel Regulates Ezh2 Expression

To whom correspondence should be addressed: I-hsin Su, School of Biological Sciences, College of Science, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551, Republic of Singapore, Tel.: (+65) 65138687; Fax: (+65) 67913858; E-mail: [email protected]

Keywords: Transcription factor, Polycomb, Gene regulation, Lymphocyte, Leukemia, Lymphoma

Background: The mechanisms by which the expression of Ezh2 is regulated in normal and malignant cells are poorly understood. Results: c-Rel recruited to the Ezh2 locus up-regulates Ezh2 expression in activated lymphocytes and malignant lymphoid cells. Conclusion: c-Rel is a critical regulator of Ezh2 expression in lymphocytes and malignant lymphoid cells. Significance: We provide a mechanistic basis for rational combinatorial therapy for Ezh2-expressing cancers. ABSTRACT

The Polycomb group protein Ezh2 is a histone methyltransferase that modifies chromatin structure to alter gene expression during embryonic development, lymphocyte activation and tumorigenesis. The mechanism by which Ezh2 expression is regulated is not well defined. In the current study, we report that c-Rel is a critical activator of Ezh2 transcription in lymphoid cells. In activated primary murine B and T cells, plus human leukemia and multiple myeloma cell lines, recruitment of c-Rel to the first intron of the Ezh2 locus promoted Ezh2 mRNA expression. This up-regulation was abolished in activated c-Rel-deficient lymphocytes and by c-Rel knockdown in Jurkat T cells. Treatment of malignant cells with the c-Rel inhibitor pentoxifylline (PTX), not only reduced c-Rel

nuclear translocation and Ezh2 expression, but also enhanced their sensitivity to the Ezh2-specific drug, GSK126 through increased growth inhibition and cell death. In summary, our demonstration that c-Rel regulates Ezh2 expression in lymphocytes and malignant lymphoid cells, reveals a novel transcriptional network in transformed lymphoid cells expressing high levels of Ezh2 that provides a molecular justification for combinatorial drug therapy.

Polycomb group (PcG) proteins are highly conserved regulatory factors that were first identified as repressors of hox genes in Drosophila melanogaster (1). Three PcG complexes, including polycomb repressive complex 1 (PRC1), PRC2 and PhoRC, have been identified and well characterized (2-5). The histone methyltransferase enhancer of zeste homolog 2 (Ezh2) is a core component of PRC2 that represses gene activity via structural modification of chromatin and contributes to the epigenetic regulation of gene expression during development and tumorigenesis (2,5-12). Ezh2 overexpression and somatic mutations are known to associate with several types of aggressive human cancers, including prostate cancer, breast cancer, lymphoma and leukemia (13-15). However, the functional importance of Ezh2 in immune responses is poorly understood.


2

Our previous studies showed that Ezh2 has critical roles in lymphopoiesis (16,17). When Ezh2 was inactivated in bone marrow stem cells, lymphocyte development was blocked at the pro- to pre-B cell and pro- to pre-T cell transitions. Defective distal VH to DHJH recombination was also identified in Ezh2-deficient pro-B cells (16). Inactivation of Ezh2 in germinal center B cells also revealed an essential role of Ezh2 in germinal center formation, while overexpression of hyperactive Ezh2 in the presence of a Bcl2 transgene promoted lymphomagenesis (18,19). In the T-lineage cells, Ezh2-deficient double negative thymocytes failed to progress to the double positive stage in response to anti-CD3 stimulation in vivo, implying that Ezh2 is involved in TCR-mediated T cell signaling (17). Taken together, these data suggest an indispensable role for Ezh2 in normal lymphocyte development, maturation, and activation, as well as lymphoid transformation.

Because Ezh2 is crucial for various biological and pathogenic processes, its expression requires precise regulation (16,17,20). While a large number of Ezh2 expression profiling studies have focused on identifying Ezh2-regulated genes (21-23), only a handful of molecules are reported to regulate Ezh2 expression at the transcriptional level (21,24-27). For instance, E2F1/2 and HIF-1α up-regulate Ezh2 mRNA expression by binding directly to the Ezh2 promoter via their respective response elements (21,24). c-Myc can induce Ezh2 expression indirectly by either down-regulating miR-26a expression which targets the Ezh2 mRNA 3’UTR and suppresses Ezh2 protein levels, or by activating the retinoblastoma protein-E2F (pRB-E2F) pathway (26,28,29). Elk-1, a downstream effector of the MEK-ERK signaling cascade, directly contributes to the up-regulation of Ezh2 in breast cancer cells (27). In contrast, p53 represses Ezh2 expression either through direct binding to the Ezh2 promoter or by down-regulating E2F via p21WAF1 to reinforce p53-mediated G2/M arrest (25). While the deregulation of these transcription factors in epithelial tumors provides a clear link between Ezh2 expression and epithelial cancer, it remains unclear whether these or other transcription factors are responsible for the high levels of Ezh2 in lymphomas and leukemias, or the up-regulation of Ezh2 in mature mitogen stimulated lymphocytes.

Here, we identified c-Rel as a positive transcriptional regulator of Ezh2 expression in activated primary murine lymphocytes and human malignant lymphoid cells, where c-Rel recruitment to the first intron of the murine and human Ezh2 loci promoted Ezh2 expression. Treatment with the c-Rel inhibitor, pentoxifylline (PTX) not only reduced Ezh2 expression, but also reduced the survival of human leukemia/lymphoma cell lines, including enhancing their sensitivity to the Ezh2-specific inhibitor, GSK126. Our results demonstrating that c-Rel is critical for regulating Ezh2 expression in normal and malignant lymphoid cells, also provides a mechanistic basis for rational combinatorial therapy to treat cancers that express high levels of Ezh2. EXPERIMENTAL PROCEDURES

Cells-B and T cells were isolated from spleen and lymph nodes of 8-12 weeks old C57BL/6 or c-Rel-/- mice (30) using standard protocol. B cells were cultured and stimulated in complete RPMI medium supplemented with IgM F(ab)2 (5µg/ml, Jackson ImmunolResearch Laboratories, Inc.) and IL-4 (10ng/ml, Prospec-Tany Technogene Ltd.). T cells were activated by plate bound anti-mouse CD28 antibody (5µg/ml, eBioscience, Inc.) and anti-mouse CD3 antibody (10µg/ml, 145-2C11 clone, BioLegend). For NF-κB inhibitor treatment, B and T cells were pre-treated with 300µg/ml Pentoxifylline at 37°C for 10 minutes. Jurkat/MM1S cells and HEK293T cells were cultured in RPMI and DMEM/high-glucose (GE Healthcare), respectively. All culture media are supplemented with 10% Fetal Bovine Serum (FBS), 1mM sodium pyruvate, 2mM L-Glutamine, 100U/ml penicillin, 100µg/ml streptomycin, and 55µM 2-mercaptoethanol (all from Invitrogen,).

Chemicals-Pentoxifylline (Sigma Aldrich) was dissolved in phosphate buffer saline (PBS) following the manufacturer’s instruction. GSK126 (Active Biochem) was dissolved in Dimethyl sulfoxide (DMSO) (Sigma Aldrich) following the manufacturer’s instruction.

Plasmids-To generate Ezh2 minimal promoter (MP) reporter construct, MP of Ezh2 (-1915/+55) was PCR amplified from the genomic DNA (gDNA) of A20 cell line and subcloned into the Hindlll site of pGL3-basic vector (Promega). To create Ezh2 reporter constructs with its enhancer


3

region, a 220bp fragment (including the first 5bp of Ezh2 exon 2) upstream of Ezh2 exon 2 was PCR amplified and subcloned into Hindlll-Ncol site of pGL3-enhancer vector (Promega). Subsequently, fragments containing Ezh2 MP with different lengths of Ezh2 intron one region were subcloned into Mlul-Hindlll site of pGL3-basic vector. Different lengths of identified conserved fragment upstream of the Ezh2 MP were fused with Ezh2 MP and MP1694 construct at Mlul site. pGL3-control (Promega) and pGL3-enhancer were used as controls for the luciferase assay. Selected transcription factors were PCR amplified from their cDNA clone and subcloned into pEGFP-N1 (2A) expression vector. pEGFP-N1 (2A) was modified from pEGFP-N1 vector (Clontech) by adding a 2A peptide sequence into the N-terminus of EGFP. 2A peptide sequence enables the bicistronic expression of the cDNA and EGFP reporter gene (31). All plasmids were verified by restriction enzyme digestions and sequencing (1st Base Holding).

Site-directed mutagenesis-The predicted c-Rel binding site was mutated by base pair changes using DpnI mediated site-directed mutagenesis (Stratagene). The primer sequences are listed below; site 1 forward: 5’- CCAACAATTACTGT TTACCAACAGAATCCGCTAGTTCTTGAGTC -3’, site 1 reverse: 5’- GACTCAAGAACTAGCG GATTCTGTTGGTAAACAGTAATTGTTGG -3’, site 2 forward: 5’- GAACCTGTTTTCACAGGTC TGATTCAGATGCATCTTATTAAAAGTA -3’, site 2 reverse: 5’- TACTTTTAATAAGATGCAT CTGAATCAGACCTGTGAAAACAGGTTC -3’, site 3 forward: 5’- CCCGCCTGGCCGGGGCTGT GTGGCCGATCGGGGCCG -3’, site 3 reverse: 5’- CGGCCCCGATCGGCCACACAGCCCCGG CCAGGCGGG -3’, site 4 forward: 5’-GGCGGG ACTGCGTGCACAATGTTTAGCCCTGCGGCTGACATTTC -3’, site 4 reverse: 5’- GAAATGTC AGCCGCAGGGCTAAACATTGTGCACGCAGTCCCGCC -3’. Humanized mouse site 4 reporter construct was generated using primers flanking region 5’ upstream and 3’ downstream of site 4. Hsa R forward: 5’-GCGTGCACAATGTGGGAA CTCGGAGTAGCTTCGCCTCTGACTTTCCCCGAGAGCCGGGAGTC -3’, Hsa R reverse: 5’-GACTCCCGGCTCTCGGGGAAAGTCAGAGGCGAAGCTACTCCGAGTTCCCACATTGTGCACGC -3’, Hsa L forward: 5’-AACGCCGGGCCTT

GCTAAGGGCGGGACGACGTTCGCGGCGGGGAACTCGGAGTAGCTTCG -3’, Hsa L reverse: 5’-CGAAGCTACTCCGAGTTCCCCGCCGCGA ACGTCGTCCCGCCCTTAGCAAGGCCCGGCGTT -3’.

Semi-quantitative RT-PCR and RT-qPCR analysis-Total RNA was purified using Trizol (Invitrogen) as recommended. Reverse transcription (RT) was performed using SuperScript III (Invitrogen) with random hexamer. cDNA was amplified with primers specifically for Ezh2 and HPRT. Ezh2 forward: 5’- AACACCAAACAGTGTCCATGCTAC -3’, Ezh2 reverse: 5’- CTAAGGCAGCTGTTTCAGAGAG AA -3’, HPRT forward: 5’- GCTGGTGAAAAGG ACCTCT -3’, HPRT reverse: 5’- CACAGGACTA GAACACCTGC -3’. The abundance of transcripts of the housekeeping gene HPRT was used as a loading control. Quantification of PCR product was done using image processing software, Image J (National Institute of Health). Ezh2 expression was also assessed by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) with TaqMan Gene Expression Assay, Mm00468464_m1 which amplifies exon 19 and 20 boundary of Ezh2. Ezh2 expression was detected with the ABI StepOnePlus Real-Time PCR System (All from Applied Biosystems). Fold changes in expression were determined by the 2-

Ct method. Alternatively, RT-qPCR for ChIP was analyzed using KAPA SYBR Fast ABI Prism 2x qPCR master mix (KAPA Biosystems, Inc.) with 0.15µM of each forward and reverse primer. Data were normalized to the expression levels of the HPRT.

DNA affinity precipitation assay-Jurkat cells were harvested, washed once with PBS and resuspended in Buffer A [0.25 M Sucrose, 10 mM HEPES (pH 7.9), 5 mM MgCl2 and 0.5% NP-40]. Cells were lysed on ice and the nuclei pelleted. Pelleted nuclei were washed in Buffer A and pelleted again. Washed nuclei were resuspended in Buffer B150 (25 mM HEPES (pH 7.9), 20 % glycerol, 1.5 mM MgCl2, 0.1 mM EDTA, 150 mM KCl, 0.5 mM PMSF and 0.5 mM DTT], followed by Buffer B450 (20 mM HEPES (pH 7.9), 20 % glycerol, 1.5 mM MgCl2, 0.1 mM EDTA, 450 mM KCl, 0.5 mM PMSF and 0.5 mM DTT) dropwise, and incubated on a rotator for 40 min at 4°C. Nuclear extracts were purified at 14000G for 15


4

min at 4°C to pellet the debris and the supernatant as the nuclear extract was collected. Buffer B0 (25 mM HEPES (pH 7.9), 20% glycerol, 1.5 mM MgCl2, 0.1 mM EDTA, 0.5 mM PMSF and 0.5 mM DTT) was added into the purified nuclear extract to lower salt concentration down to 150 mM. DNA probes were prepared via the hybridization of synthesized single stranded oligonucleotide DNAs. Equal amounts of oligonucleotides, in annealing buffer (10 mM Tris (pH 8.0), 50 mM NaCl, 1 mM EDTA) was prepared, to a total volume of 20 μl. DNA mixture was heated at 95°C for 4 min and cooled to 30°C slowly. Dynabeads were washed in 1× B&W buffer (5 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, and 1 M NaCl) and subsequently, 200 pmol of prepared DNA probe mixture was added to pre-washed Dynabeads and incubated at RT for 30 min. The probe bound beads were washed once in 1× B&W buffer and followed by Buffer B150, twice. 60 μg of Jurkat nuclear extract was added with probe-bound beads to a total volume of 80 μl in Buffer C (25 mM HEPES (pH 7.9), 20 % glycerol, 1.5 mM MgCl2, 0.1 mM EDTA, 150 mM KCl, 1 mg/ml BSA, 0.5 mM PMSF and 0.5 mM DTT), and incubated at RT for 1 hour to facilitate protein-DNA binding interaction. Dynabeads were washed 3 times with Buffer B150 and DNA bound protein was detected by immunobloting.

Immunobloting-Cytosolic extracts were prepared by re-suspending cells in Buffer A with 0.5% NP40. Cell membranes were ruptured without destroying nuclear membranes by carefully passing the cells through an 18G needle several times. Extraction of the nuclear fraction was done in nuclear ion extraction buffer (25mM HEPES, 1.5mM MgCl2, 500mM NaCl, 0.1mM EDTA, 20% Glycerol) by extensive sonication (Bioruptor, Diagenode Inc.) after the cytosolic fraction was removed. The separation of cytosolic and nuclear fraction was controlled by the presence of tubulin and GAPDH, as cytosolic marker, and lamin as nuclear marker. Whole cell lysates were prepared by re-suspending cells in NP40 buffer (50mM Tris-HCl, pH8.0, 500mM NaCl, 1mM EDTA, 1% NP-40, 10% Glycerol) and sonicated (Bioruptor). Protein concentration was determined using Bio-Rad DC Protein Assay (Bio-Rad laboratories) and analyzed by Tecan infinite F200 plate reader (Tecan System, Inc.).

Protein samples were subjected to SDS-PAGE. Antibodies used in the study were anti-Ezh2 (Cell Signaling Technology), anti-tubulin (Sigma), anti-GAPDH (Ambion, Life Technologies), anti-Lamin and anti-c-Rel (Santa Cruz Biotechnology, Inc.), anti-phospho-Akt (S473) (Cell Signaling Technology), anti-Akt (Santa Cruz Biotechnology, Inc.), anti-phospho-Erk1/2 (Thr202/Thr204) (Cell Signaling Technology), anti-Erk1/2 (Cell Signaling Technology).

Electroporation-Jurkat T cells suspended in un-supplemented, pre-warmed RPMI, with 300 nM of human si-Rel or non-targeting siRNA (Dharmacon) in 4 mm cuvettes (Bio-Rad Laboratories) were electroporated (Bio-Rad GenePusler, Bio-Rad Laboratories). After electroporation, cells were transferred into culture flask with pre-warmed complete Jurkat media without antibiotics. Lympholyte M treatment was performed at 0, 6 and 24-hour post transfection to enrich live cells. RNA from transfected cells was isolated at 6 and 24 hour and reverse transcribed. RT-qPCR was performed to analyze levels of indicated transcript.

Luciferase assay-HEK293T cells were transiently transfected with luciferase reporter construct, transcription factor expression vectors and Renilla luciferase expression vector (pRL-TK) (Promega). Cells were harvested for assay 48 hours post-transfection. Firefly luciferase activity was determined by Dual-Glo Luciferase Assay System (Promega) and normalized against Renilla luciferase activity. All assays were done according to manufacturer’s standard protocol and detected using Fluoroskan Ascent FL (Thermo Scientific). For luciferase assays performed using Jurkat T cells, Jurkat T cells were transiently transfected with luciferase reporter construct, transcription factor expression vectors and Renilla luciferase expression vector using X-tremeGene HP DNA Transfection Reagent (Roche) according to manufacturer’s instructions.

Chromatin immunoprecipitation-Chromatin immunoprecipitation (ChIP) was done according to manufacturer’s protocol (Upstate, Millipore). In brief, 2x106 cells were fixed in 0.37% formaldehyde for 10 minutes at 37°C. Fixed cells were washed twice with ice cold PBS and resuspended in SDS lysis buffer (1% SDS, 10mM EDTA, 50mM Tris-HCl, pH 8.1) containing


5

protease inhibitor cocktail (Sigma Aldrich). Cells were incubated on ice for 10 minutes and the chromatin was sheared by sonication (Bioruptor) to a length of around 500bp. Cell lysate was pre-cleared with salmon sperm DNA/protein A agarose (Millipore). Pre-cleared lysate was incubated with antibody for overnight at 4°C. Subsequently, the lysate was incubated with salmon sperm DNA/protein A agarose for 1 hour at 4°C. Beads were washed once with low salt buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20mM Tris-HCl, pH 8.1, 150mM NaCl), high salt buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20mM Tris-HCl, pH 8.1, 500mM NaCl), LiCl buffer (0.25M LiCl, 1% IGEPAL-CA630, 1% deoxycholic acid, 1mM EDTA, 10mM Tris-HCl, pH 8.1) and twice with TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0). The immunoprecipitated chromatin was eluted with elution buffer (1% SDS, 0.1M NaHCO3). The DNA-protein cross-links was reversed by adding NaCl to a final concentration of 200mM and incubated at 65°C for four hours. The proteins were digested with proteinase K (Promega) treatment and the DNA was isolated with phenol/chloroform/isoamyl alcohol method. The enrichment of immunoprecipitated DNA was quantified by RT-qPCR. Four primer pairs were designed to detect the recruitment of c-Rel to various regions of mouse Ezh2 locus. A: sense 5’- GGCAATGCTGATTCACTGGT -3’ and anti-sense 5’- GACCTAGAATGGATGGGGCA -3’; B: sense 5’- CCGTTCGGCCCTCTGATT -3’ and anti-sense 5’- CTGCCTTCGATGTCCCACT -3’; C: sense 5’- TCGTCCTTGCCTGGCC -3’ and anti-sense 5’- TAGCCCTGAAGCATAC -3’; D: sense 5’- GGAACATGGGTAGAAAGGAACA -3’ and anti-sense 5’- TGTCCCACAACACTTAG ACAG -3’. The primer sequences used to detect the recruitment of c-Rel to human Ezh2 locus are, Hm c-Rel: sense 5’- GAGGGGAAGGGGCATGA C -3’ and anti-sense 5’- TGGGGAAACGTCAGA GGC -3’.

Annexin V and Propidium Iodide staining-Cells were harvest and incubated with FITC Annexin V (Biolegend) and Propidium Iodide (Sigma) for 15 minutes at room temperature. Cells were acquired using FACS Calibur instrument (BD Biosciences).

Cell viability assay-1x103 (Jurkat) or 1x104 (MM1S) cells were seeded onto each well of 96-well plates and treated with GSK126 and PTX at various concentrations for 6 days. Medium and drugs were replaced at day 3. Cell viability was assessed using MTT assay (Molecular Probes, Life Technologies). Briefly, MTT was added to culture medium and incubated at 37°C for 4 hours. In living cells MTT was reduced to purple insoluble formazan, which was then solubilized by acidified isopropanol. The absorbance at 570nm was read on a spectrophotometer (Tecan System Inc.) with reference wavelength at 620nm. IC50 values of the selected compounds were defined as the drug concentration that reduced the absorbance by 50% and were determined graphically. RESULTS

Identification of regulatory regions within intron 1 of the murine Ezh2 gene-Ezh2 protein is reported to be up-regulated in various proliferative lymphomas and germinal center lymphoblasts (18,32). In order to determine whether Ezh2 up-regulation is controlled by a transcriptional mechanism, we first performed semi-quantitative and quantitative RT-PCR analysis of cDNAs isolated from purified peripheral B and T cells 24 and 48 hours after antigenic stimulation (Fig. 1A and B). Our results showed that Ezh2 mRNA expression levels were up-regulated approximately 1.5 to 2 fold in both activated B and T cells. To confirm the activation lymphocytes in our experiments, we determined the expression levels of several surface markers by FACS. As expected, activated lymphocytes down-regulated CD62L and up-regulated CD69, CD86 (B cells) or CD44 (T cells) after 24 hours of stimulation (Fig. 1C and D).

Because Ezh2 mRNA expression was induced in activated lymphocytes, we performed a comparative analysis of conserved non-coding sequences (CNSs) using VISTA Browser (33-35) to identify potential regulatory regions in the Ezh2 gene. The minimal promoter (MP) of the murine Ezh2 locus (-1915 to +55, relative to the transcription start site) was defined based on an the alignment with the known human EZH2 minimal promoter (25). Several stretches of highly conserved CNSs along the Ezh2 locus were identified, but in the current study, we focused on the CNS that covers a 3kb intron 1 fragment


6

adjacent to exon 1 (Fig. 2A). To identify the cis-regulatory elements located between positions -1915 and +3051, we generated a series of firefly luciferase reporter constructs containing the Ezh2 minimal promoter, untranslated exon 1 and various lengths of intron 1 CNS. Since splicing signals are shown to enhance transcription (36), we also introduced into our reporter constructs a 220bp intron 1 fragment upstream of Ezh2 exon 2 that contains a splice acceptor and a branch site (Fig. 2B). It is unlikely that transcripts initiated within intron 1, because no significant luciferase activity was detected with the reporter constructs lacking both the MP and exon 1 (Fig. 2B: constructs +220, +838 and +1694). In addition, the proper splicing of each reporter construct was confirmed by RT-PCR with a specific primer pair (Fig. 2C). Two active regions (A1 and A2) and one repressive (R1) regions were identified in these reporter assays (Fig. 2B). Since all three regulatory regions fall between +715 and +1694, the MP/+1694 reporter was used for subsequent screening to identify transcription factors that regulate Ezh2 expression.

c-Rel is a transcriptional activator controlling Ezh2 expression-In order to identify transcription factor binding sites in the Ezh2 minimal promoter and intron 1 fragment, the sequence was analyzed using TFSEARCH and rVista2.0 programs (37,38). High-scoring binding sites of 7 transcription factors, including AP1, c-Rel, DP1, Ikaros, Pbx1, Meis1a and SP1 were identified by both prediction methods. Sequence logos, positions, and their respective scores are summarized in Table 1. To test the regulatory effects of the predicted transcription factors on Ezh2 expression, we co-expressed each factor with a luciferase reporter construct containing only the Ezh2 MP or both the Ezh2 MP and partial intron 1 (MP/+1694). E2F and p53 were used as positive and negative controls, respectively (21,25). As shown in Fig. 3, we identified Ikaros and SP1 as potential negative regulators and c-Rel as the lone activator of Ezh2 expression in our assay.

c-Rel binds to intron 1 of the Ezh2 locus-Since c-Rel induced the most significant changes in the expression of the Ezh2 reporter, we performed additional assays to validate its regulatory effect. Using in silico analysis, we revealed four c-Rel binding sites within the Ezh2 MP/+1694 construct.

Sites 1 and 2 are located in the minimal promoter region and sites 3 and 4 are within intron 1 of the MP/+838 construct (Fig. 4A). Since all predicted c-Rel binding sites are located within the MP/+838 construct, we utilized this reporter for subsequent experiments. c-Rel not only controlled the expression of the Ezh2 reporter in a dose-dependent manner (Fig. 4B), but also promoted endogenous Ezh2 expression in HEK293T cells (Fig. 4C). Deletion of site 1 and/or 2 did not have any effect on the expression of the Ezh2 MP reporter (Fig. 4D), which is in agreement with the earlier screening showing that c-Rel did not enhance the luciferase activity of the MP reporter (Fig. 3). Surprisingly, the luciferase activity in cells expressing the MP/+838 reporter lacking site 3 was increased. This was due to the generation of an artificial c-Rel binding site (CGGGGCTG/TGT) upon site 3 deletion (Fig. 4E). The elevated luciferase activity was abolished when the artificial c-Rel binding site was removed (3*). In contrast, deletion of site 4 significantly reduced the luciferase activity of the MP/+838 construct (Fig. 4E). Comparable results were obtained using Jurkat T cells, a lymphoid lineage cell line (Fig. 4F). While site 4 is not well conserved between human and mouse loci, they are both predicted to be as c-Rel binding sites. To determine if c-Rel could also regulate the expression of Ezh2 through the human site 4 sequence, we generated a humanized reporter construct (Site 4 Hsa) by replacing the mouse site 4 and adjacent sequence with the corresponding human sequence in the mouse reporter MP/+838 construct (Site 4 Mmu). Similar c-Rel-induced luciferase activities were observed with both constructs (Fig. 4G). Taken together, our data suggests that position +779 to +788 (site 4) of the Ezh2 locus is the only authentic c-Rel binding site.

c-Rel regulates Ezh2 expression in activated lymphocytes-Next, we sought to determine whether c-Rel regulates Ezh2 expression in activated B and T cells. As the transcriptional activity of c-Rel, a member of the NF-κB family, is regulated by nuclear translocation following stimulus-dependent IκB degradation (39-41), we examined the translocation of c-Rel in activated lymphocytes. Our results showed that the nuclear translocation of c-Rel upon antigenic stimulation preceded the up-regulation of Ezh2 expression


7

(Fig. 5A and B), suggesting an involvement of c-Rel in the up-regulation of Ezh2 during lymphocyte activation.

In order to determine whether c-Rel is recruited to the newly identified c-Rel binding site in the endogenous Ezh2 locus upon lymphocyte activation, we performed chromatin immunoprecipitation (ChIP) assays. The positions of the PCR products are indicated in Fig. 5C. While c-Rel did not associate with the Ezh2 locus in either resting lymphocytes or after 4 hours of stimulation, a significant increase in c-Rel binding to this site (position C) in B and T cells was detected 24 hours after antigenic stimulation (Fig. 5D and E). The binding of c-Rel to mouse and human site 4 was further validated by DNA affinity precipitation assays using either mouse (Mmu) or human probes (Hsa), but not a mutated mouse probe (Mmu*) which did not interact with c-Rel (Fig. 5F). Since c-Rel frequently associates with the co-activator, p300 (42), we also determined the histone 3 acetylation levels across the Ezh2 promoter and intron 1 region. As expected, the increase in c-Rel binding correlated well with elevated chromatin accessibility as determined by the enrichment of acetylated histone 3 (H3Ac) (Fig. 5G and H).

To further validate the c-Rel regulation of Ezh2 expression, we examined Ezh2 expression in c-Rel-deficient B and T lymphocytes. We found that c-Rel was not required for basal Ezh2 expression in resting lymphocytes. However, in contrast to activated control B and T cells antigen stimulated c-Rel-deficient lymphocytes which still undergo most aspects of activation including the up-regulation of cell surface markers (30,43), failed to up-regulate Ezh2 expression (Fig. 6). Collectively, this data demonstrates that c-Rel regulates the induction of Ezh2 expression in activated lymphocytes.

To determine if Ezh2 expression can be regulated by a c-Rel inhibitor, we pre-treated lymphocytes with a phosphodiesterase inhibitor pentoxifylline (PTX), a phosphodiesterase inhibitor reported to block c-Rel activation (44-46). As expected, the nuclear translocation of c-Rel in activated B and T cells was compromised by PTX treatment (Fig. 7A-C), with c-Rel recruitment to the Ezh2 locus and Ezh2 up-regulation during lymphocyte activation abolished (Fig. 7A-E).

Importantly, the up-regulation of several activation markers was not affected by PTX treatment in B cells and was only slightly reduced in T cells (Fig. 7F and G). We also noted that PTX treatment of T cells also altered the kinetics and magnitudes of Akt and Erk activation (Fig. 7H). Collectively, these results suggest that PTX suppresses Ezh2 expression by inhibiting c-Rel nuclear translocation.

c-Rel controls Ezh2 expression in leukemia and multiple myeloma cell lines-To determine if c-Rel is responsible for high levels of Ezh2 expression in transformed lymphoid lineage cells, we analyzed the human leukemic Jurkat T cell line and the multiple myeloma cell line MM1S, both of which expressed high levels of wild-type Ezh2 (data not shown). When these cell lines were treated with PTX for 24 hours, nuclear levels of c-Rel plus its recruitment to the Ezh2 locus was reduced and coincided with a drop in Ezh2 expression levels (Fig. 8A and B). The PTX effect was diminished at 48 hours, most likely due to the relatively short half-life of this compound (47). c-Rel knockdown in Jurkat T cells also resulted in decreased Ezh2 expression (Fig. 8C). High levels of Ezh2 expression in Jurkat and MM1S cells coincide with their relative resistance to the Ezh2 specific inhibitor, GSK126 (Fig. 8D and E) when compared to other cancer cell lines (48). Given PTX treatment significantly decreased Ezh2 expression levels, reduced cell viability and induced G1 phase cell cycle arrest (Fig. 8F and G and data not shown), we decided to determine whether a combination of GSK126 and PTX would result in enhanced growth inhibition and death of these cells (Fig. 8F-H). As predicted, the dosage of GSK126 required to achieve significant growth inhibition and cell death was reduced dramatically with the addition of PTX. For example, in the presence of 300µg/ml PTX, the growth IC50 of GSK126 in Jurkat cells was reduced more than 10-fold (from IC50 = 8982nM with GSK126 alone to 643nM in combination), which is comparable to GSK126 sensitive cancer cell lines (48) (Fig. 8D). This result suggests that c-Rel is a novel therapeutic target for cancers expressing high levels of Ezh2 and that c-Rel inhibition may complement treatment with Ezh2 specific inhibitors.


8

DISCUSSION In the current study, we showed that c-Rel is a

critical positive regulator of Ezh2 expression in activated primary murine lymphocytes and human leukemia/lymphoma cell lines. Our experiments demonstrated that c-Rel recruited to intron 1 of the Ezh2 locus promotes Ezh2 expression. c-Rel regulation of Ezh2 expression was further validated by the lack of Ezh2 up-regulation in activated murine c-Rel-deficient lymphocytes and c-Rel knockdown Jurkat T cells. Collectively, our results indicate that c-Rel is the most important positive regulator of Ezh2 identified to date in activated lymphocytes and lymphoid malignancies.

Treatment with PTX blocked c-Rel nuclear translocation and suppressed Ezh2 expression in primary murine lymphocytes and leukemia and multiple myeloma cell lines. Moreover, combinatorial treatment with the Ezh2 specific inhibitor, GSK126 and PTX lowered the IC50 of GSK126 significantly (more than 10-fold) and reduced the survival of these malignant cell lines. PTX (Trental) has already been used widely in the clinical treatment of a variety of inflammatory disorders (45,46). Here, our data provides a molecular justification for using combinatorial therapy in cancers expressing c-Rel and high levels of wild-type Ezh2 by showing that PTX targets the Ezh2 transcriptional activator, c-Rel, lowering Ezh2 expression to a level where the Ezh2-specific inhibitor, GSK126 disables the function of any remaining Ezh2 protein.

Since other members of the NF-B family of proteins share DNA binding motifs that are similar to that of c-Rel, we also determined whether RelA, RelB, p50 and p52 are able to regulate Ezh2 expression. In our experiments, only RelA enhanced luciferase activity of an Ezh2 reporter, but it did not promote endogenous Ezh2 expression. Furthermore, RelA was neither up-regulated in primary lymphocytes upon antigenic stimulation (Fig. 6C), nor recruited to the c-Rel binding site in the Ezh2 locus (data not shown). The critical role of c-Rel and not RelA in the regulation of Ezh2 expression was supported by the capacity of PTX to block the nuclear translocation of c-Rel, but RelA in T cells, the former coinciding with a reduction in Ezh2 protein levels (data not shown and Fig. 7B). It is not surprising that RelA recognizes the c-Rel binding

site on the Ezh2 reporter construct, since the DNA-contacting residues are conserved in both RelA and c-Rel (49,50). However, the endogenous Ezh2 locus in lymphocytes is almost certainly regulated by additional mechanisms to ensure preferential binding of c-Rel. One drawback of our primary reporter screen is that we did not use lymphoid lineage cells due to their low transfection efficiencies. This may have precluded the identification of other cell or tissue-specific transcriptional regulators. Notwithstanding the crucial regulatory effect of c-Rel on Ezh2 expression in lymphoid cells, our study demonstrating that even in non-lymphoid lineage cells, c-Rel can function as a potent Ezh2 regulator raises the possibility that c-Rel has a hitherto unappreciated role in the control of Ezh2 expression in a wider range of cell types.

Recently, Ezh2 has been shown to be essential for germinal center B cell survival and to be involved in the regulation of T cell polarization (18,51). Given the importance of c-Rel in lymphocyte activation, c-Rel-regulated Ezh2 expression could be critical in these physiological processes. Activation of NF-B signaling pathways are also associated with malignancies in various organisms (52). Notably, c-Rel is the only member of the NF-B family of proteins able to transform B lineage cells in culture (53). Precisely how c-Rel promotes cellular transformation remains unclear, although c-Rel can regulate BCL-2 expression directly and E2F1/2 indirectly through hyper-phosphorylation of retinoblastoma protein (pRB) (54,55). Importantly, c-Rel amplification and mutations in BCL-2 and EZH2 are commonly found in germinal center B cell like-diffuse large B cell lymphoma (GCB-DLBCL), while co-expression of BCL-2 and v-Rel or hyperactive Ezh2 promotes lymphoid transformation (19,56). Taken together, this information indicates that c-Rel is likely to play a central role in the intricate regulatory circuitry of B cell transformation. With targeting of the NF-B pathway emerging as a logical therapeutic strategy to promote apoptosis of malignant lymphoid cells and to potentially improve the efficacy of chemotherapeutic agents in childhood acute lymphoblastic leukemia patients (57,58), our current findings provide a mechanistic basis for


9

exploring new combinatorial therapies to treat cancers expressing high levels of Ezh2.


10

REFERENCES:

1. Lewis, E. B. (1978) A gene complex controlling segmentation in Drosophila. Nature 276, 565 2. Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V. (2002) Drosophila

Enhancer of Zeste/ESC Complexes Have a Histone H3 Methyltransferase Activity that Marks Chromosomal Polycomb Sites. Cell 111, 185‐196

3. Francis, N. J., Saurin, A. J., Shao, Z., and Kingston, R. E. (2001) Reconstitution of a functional core polycomb repressive complex. Molecular cell 8, 545‐556

4. Klymenko, T., Papp, B., Fischle, W., Köcher, T., Schelder, M., Fritsch, C., Wild, B., Wilm, M., and Müller, J. (2006) A Polycomb group protein complex with sequence‐specific DNA‐binding and selective methyl‐lysine‐binding activities. Genes & development 20, 1110‐1122

5. Simon, J. A. (2002) Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111, 197‐208

6. Erhardt, S., Su, I. H., Schneider, R., Barton, S., Bannister, A. J., Perez‐Burgos, L., Jenuwein, T., Kouzarides, T., Tarakhovsky, A., and Surani, M. A. (2003) Consequences of the depletion of zygotic and embryonic enhancer of zeste 2 during preimplantation mouse development. Development 130, 4235‐4248

7. Wang, L., Jin, Q., Lee, J. E., Su, I. H., and Ge, K. (2010) Histone H3K27 methyltransferase Ezh2 represses Wnt genes to facilitate adipogenesis. Proc Natl Acad Sci U S A 107, 7317‐7322

8. Herz, H. M., and Shilatifard, A. (2010) The JARID2‐PRC2 duality. Genes & development 24, 857‐861

9. Cao, R., Wang, L., Wang, H., Xia, L., Erdjument‐Bromage, H., Tempst, P., Jones, R. S., and Zhang, Y. (2002) Role of histone H3 lysine 27 methylation in Polycomb‐group silencing. Science 298, 1039‐1043

10. Sarma, K., Margueron, R., Ivanov, A., Pirrotta, V., and Reinberg, D. (2008) Ezh2 requires PHF1 to efficiently catalyze H3 lysine 27 trimethylation in vivo. Molecular and cellular biology 28, 2718‐2731

11. Kuzmichev, A., Nishioka, K., Erdjument‐Bromage, H., Tempst, P., and Reinberg, D. (2002) Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein. Genes & development 16, 2893‐2905

12. Ezhkova, E., Pasolli, H. A., Parker, J. S., Stokes, N., Su, I. H., Hannon, G., Tarakhovsky, A., and Fuchs, E. (2009) Ezh2 orchestrates gene expression for the stepwise differentiation of tissue‐specific stem cells. Cell 136, 1122‐1135

13. Varambally, S., Dhanasekaran, S. M., Zhou, M., Barrette, T. R., Kumar‐Sinha, C., Sanda, M. G., Ghosh, D., Pienta, K. J., Sewalt, R. G., Otte, A. P., Rubin, M. A., and Chinnaiyan, A. M. (2002) The polycomb group protein EZH2 is involved in progression of prostate cancer. Nature 419, 624‐629

14. Kleer, C. G., Cao, Q., Varambally, S., Shen, R., Ota, I., Tomlins, S. A., Ghosh, D., Sewalt, R. G., Otte, A. P., Hayes, D. F., Sabel, M. S., Livant, D., Weiss, S. J., Rubin, M. A., and Chinnaiyan, A. M. (2003) EZH2 is a marker of aggressive breast cancer and promotes neoplastic transformation of breast epithelial cells. Proc Natl Acad Sci U S A 100, 11606‐11611

15. Matsukawa, Y., Semba, S., Kato, H., Ito, A., Yanagihara, K., and Yokozaki, H. (2006) Expression of the enhancer of zeste homolog 2 is correlated with poor prognosis in human gastric cancer. Cancer Sci 97, 484‐491

16. Su, I., Basavaraj, A., Krutchinsky, A. N., Hobert, O., Ullrich, A., Chait, B. T., and Tarakhovsky, A. (2003) Ezh2 controls B cell development through histone H3 methylation and Igh rearrangement. Nature immunology 4, 124‐131


11

17. Su, I. H., Dobenecker, M. W., Dickinson, E., Oser, M., Basavaraj, A., Marqueron, R., Viale, A., Reinberg, D., Wulfing, C., and Tarakhovsky, A. (2005) Polycomb group protein ezh2 controls actin polymerization and cell signaling. Cell 121, 425‐436

18. Caganova, M., Carrisi, C., Varano, G., Mainoldi, F., Zanardi, F., Germain, P.‐L., George, L., Alberghini, F., Ferrarini, L., Talukder, A. K., Ponzoni, M., Testa, G., Nojima, T., Doglioni, C., Kitamura, D., Toellner, K.‐M., Su, I. h., and Casola, S. (2013) Germinal center dysregulation by histone methyltransferase EZH2 promotes lymphomagenesis. The Journal of Clinical Investigation 123, 5009‐5022

19. Béguelin, W., Popovic, R., Teater, M., Jiang, Y., Bunting, Karen L., Rosen, M., Shen, H., Yang, Shao N., Wang, L., Ezponda, T., Martinez‐Garcia, E., Zhang, H., Zheng, Y., Verma, Sharad K., McCabe, Michael T., Ott, Heidi M., Van Aller, Glenn S., Kruger, Ryan G., Liu, Y., McHugh, Charles F., Scott, David W., Chung, Young R., Kelleher, N., Shaknovich, R., Creasy, Caretha L., Gascoyne, Randy D., Wong, K.‐K., Cerchietti, L., Levine, Ross L., Abdel‐Wahab, O., Licht, Jonathan D., Elemento, O., and Melnick, Ari M. (2013) EZH2 Is Required for Germinal Center Formation and Somatic EZH2 Mutations Promote Lymphoid Transformation. Cancer cell 23, 677‐692

20. Attwooll, C., Oddi, S., Cartwright, P., Prosperini, E., Agger, K., Steensgaard, P., Wagener, C., Sardet, C., Moroni, M. C., and Helin, K. (2005) A novel repressive E2F6 complex containing the polycomb group protein, EPC1, that interacts with EZH2 in a proliferation‐specific manner. J Biol Chem 280, 1199‐1208

21. Bracken, A. P., Pasini, D., Capra, M., Prosperini, E., Colli, E., and Helin, K. (2003) EZH2 is downstream of the pRB‐E2F pathway, essential for proliferation and amplified in cancer. The EMBO journal 22, 5323‐5335

22. Visser, H. P. J., Gunster, M. J., Kluin‐Nelemans, H. C., Manders, E. M. M., Raaphorst, F. M., Meijer, C. J. L. M., Willemze, R., and Otte, A. P. (2001) The Polycomb group protein EZH2 is upregulated in proliferating, cultured human mantle cell lymphoma. British journal of haematology 112, 950‐958

23. Hwang, C., Giri, V. N., Wilkinson, J. C., Wright, C. W., Wilkinson, A. S., Cooney, K. A., and Duckett, C. S. (2008) EZH2 regulates the transcription of estrogen‐responsive genes through association with REA, an estrogen receptor corepressor. Breast cancer research and treatment 107, 235‐242

24. Chang, C. J., Yang, J. Y., Xia, W., Chen, C. T., Xie, X., Chao, C. H., Woodward, W. A., Hsu, J. M., Hortobagyi, G. N., and Hung, M. C. (2011) EZH2 promotes expansion of breast tumor initiating cells through activation of RAF1‐β‐catenin signaling. Cancer cell 19, 86‐100

25. Tang, X., Milyavsky, M., Shats, I., Erez, N., Goldfinger, N., and Rotter, V. (2004) Activated p53 suppresses the histone methyltransferase EZH2 gene. Oncogene 23, 5759‐5769

26. Sander, S., Bullinger, L., Klapproth, K., Fiedler, K., Kestler, H. A., Barth, T. F., Moller, P., Stilgenbauer, S., Pollack, J. R., and Wirth, T. (2008) MYC stimulates EZH2 expression by repression of its negative regulator miR‐26a. Blood 112, 4202‐4212

27. Fujii, S., Tokita, K., Wada, N., Ito, K., Yamauchi, C., Ito, Y., and Ochiai, A. (2011) MEK‐ERK pathway regulates EZH2 overexpression in association with aggressive breast cancer subtypes. Oncogene 30, 4118‐4128

28. Nevins, J. R. (2001) The Rb/E2F pathway and cancer. Human Molecular Genetics 10, 699‐703 29. Neri, F., Zippo, A., Krepelova, A., Cherubini, A., Rocchigiani, M., and Oliviero, S. (2012) Myc

Regulates the Transcription of the PRC2 Gene To Control the Expression of Developmental Genes in Embryonic Stem Cells. Molecular and cellular biology 32, 840‐851

30. Kontgen, F., Grumont, R. J., Strasser, A., Metcalf, D., Li, R., Tarlinton, D., and Gerondakis, S. (1995) Mice lacking the c‐rel proto‐oncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleukin‐2 expression. Genes Dev 9, 1965‐1977


12

31. Szymczak, A. L., and Vignali, D. A. A. (2005) Development of 2A peptide‐based strategies in the design of multicistronic vectors. Expert Opinion on Biological Therapy 5, 627‐638

32. van Galen, J. C., Dukers, D. F., Giroth, C., Sewalt, R. G. A. B., Otte, A. P., Meijer, C. J. L. M., and Raaphorst, F. M. (2004) Distinct expression patterns of polycomb oncoproteins and their binding partners during the germinal center reaction. European Journal of Immunology 34, 1870‐1881

33. Woolfe, A., Goodson, M., Goode, D. K., Snell, P., McEwen, G. K., Vavouri, T., Smith, S. F., North, P., Callaway, H., and Kelly, K. (2004) Highly conserved non‐coding sequences are associated with vertebrate development. PLoS biology 3, e7

34. Loots, G. G., Locksley, R. M., Blankespoor, C. M., Wang, Z. E., Miller, W., Rubin, E. M., and Frazer, K. A. (2000) Identification of a coordinate regulator of interleukins 4, 13, and 5 by cross‐species sequence comparisons. Science 288, 136‐140

35. Frazer, K. A., Pachter, L., Poliakov, A., Rubin, E. M., and Dubchak, I. (2004) VISTA: computational tools for comparative genomics. Nucleic acids research 32, W273‐W279

36. Furger, A., Binnie, J. M. O. S., Lee, B. A., and Proudfoot, N. J. (2002) Promoter proximal splice sites enhance transcription. Genes & development 16, 2792‐2799

37. Heinemeyer, T., Wingender, E., Reuter, I., Hermjakob, H., Kel, A. E., Kel, O. V., Ignatieva, E. V., Ananko, E. A., Podkolodnaya, O. A., and Kolpakov, F. A. (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic acids research 26, 362‐367

38. Loots, G. G., and Ovcharenko, I. (2004) rVISTA 2.0: evolutionary analysis of transcription factor binding sites. Nucleic acids research 32, W217‐W221

39. Harris, J., Oliére, S. p., Sharma, S., Sun, Q., Lin, R., Hiscott, J., and Grandvaux, N. (2006) Nuclear Accumulation of cRel following C‐Terminal phosphorylation by TBK1/IKKε. The Journal of Immunology 177, 2527‐2535

40. May, M. J., and Ghosh, S. (1998) Signal transduction through NF‐κB. Immunology today 19, 80‐88

41. Molitor, J. A., Walker, W. H., Doerre, S., Ballard, D. W., and Greene, W. C. (1990) NF‐kappa B: a family of inducible and differentially expressed enhancer‐binding proteins in human T cells. Proceedings of the National Academy of Sciences 87, 10028‐10032

42. Garbati, M. R., Thompson, R. C., Haery, L., and Gilmore, T. D. (2011) A rearranged EP300 gene in the human B‐cell lymphoma cell line RC‐K8 encodes a disabled transcriptional co‐activator that contributes to cell growth and oncogenicity. Cancer letters 302, 76‐83

43. Bunting, K., Rao, S., Hardy, K., Woltring, D., Denyer, G. S., Wang, J., Gerondakis, S., and Shannon, M. F. (2007) Genome‐wide analysis of gene expression in T cells to identify targets of the NF‐kappa B transcription factor c‐Rel. J Immunol 178, 7097‐7109

44. Wang, W., Tam, W. F., Hughes, C. C. W., Rath, S., and Sen, R. (1997) c‐Rel Is a Target of Pentoxifylline‐Mediated Inhibition of T Lymphocyte Activation. Immunity 6, 165‐174

45. Zabel, P., Schade, F. U., and Schlaak, M. (1993) Inhibition of endogenous TNF formation by pentoxifylline. Immunobiology 187, 447‐463

46. Shan, D., Wu, H. M., Yuan, Q. Y., Li, J., Zhou, R. L., and Liu, G. J. (2012) Pentoxifylline for diabetic kidney disease. Cochrane Database Syst Rev 2, CD006800

47. Albersen, M., Fandel, T. M., Zhang, H., Banie, L., Lin, G., De Ridder, D., Lin, C. S., and Lue, T. F. (2011) Pentoxifylline promotes recovery of erectile function in a rat model of postprostatectomy erectile dysfunction. Eur Urol 59, 286‐296

48. McCabe, M. T., Ott, H. M., Ganji, G., Korenchuk, S., Thompson, C., Van Aller, G. S., Liu, Y., Graves, A. P., Iii, A. D. P., Diaz, E., LaFrance, L. V., Mellinger, M., Duquenne, C., Tian, X., Kruger, R. G., McHugh, C. F., Brandt, M., Miller, W. H., Dhanak, D., Verma, S. K., Tummino, P. J., and Creasy, C. L. (2012) EZH2 inhibition as a therapeutic strategy for lymphoma with EZH2‐activating mutations. Nature 492, 108‐112


13

49. Chen, F. E., and Ghosh, G. (1999) Regulation of DNA binding by Rel/NF‐kappaB transcription factors: structural views. Oncogene 18, 6845

50. Huang, D. B., Chen, Y. Q., Ruetsche, M., Phelps, C. B., and Ghosh, G. (2001) X‐ray crystal structure of proto‐oncogene product c‐Rel bound to the CD28 response element of IL‐2. Structure 9, 669‐678

51. Tumes, Damon J., Onodera, A., Suzuki, A., Shinoda, K., Endo, Y., Iwamura, C., Hosokawa, H., Koseki, H., Tokoyoda, K., Suzuki, Y., Motohashi, S., and Nakayama, T. (2013) The Polycomb Protein Ezh2 Regulates Differentiation and Plasticity of CD4+ T Helper Type 1 and Type 2 Cells. Immunity 39, 819‐832

52. Rayet, B., and Gélinas, C. (1999) Aberrant rel/nfkb genes and activity in human cancer. Oncogene 18, 6938

53. Gilmore, T. D., Kalaitzidis, D., Liang, M.‐C., and Starczynowski, D. T. (2004) The c‐Rel transcription factor and B‐cell proliferation: a deal with the devil. Oncogene 23, 2275‐2286

54. Cheng, S., Hsia, C. Y., Leone, G., and Liou, H.‐C. (2003) Cyclin E and Bcl‐xL cooperatively induce cell cycle progression in c‐Rel‐/‐ B cells. Oncogene 22, 8472‐8486

55. Catz, S. D., and Johnson, J. L. (2001) Transcriptional regulation of bcl‐2 by nuclear factor kB and its significance in prostate cancer. Oncogene 20

56. Rayet, B., Fan, Y., and Gélinas, C. (2003) Mutations in the v‐Rel Transactivation Domain Indicate Altered Phosphorylation and Identify a Subset of NF‐kB‐Regulated Cell Death Inhibitors Important for v‐Rel Transforming Activity. Molecular and cellular biology 23, 1520‐1533

57. Lerma‐Díaz, J. M., Hernández‐Flores, G., Domínguez‐Rodríguez, J. R., Ortíz‐Lazareno, P. C., Gómez‐Contreras, P., Cervantes‐Munguía, R., Scott‐Algara, D., Aguilar‐Lemarroy, A., Jave‐Suárez, L. F., and Bravo‐Cuellar, A. (2006) In vivo and in vitro sensitization of leukemic cells to adriamycin‐induced apoptosis by pentoxifylline: Involvement of caspase cascades and IκBα phosphorylation. Immunology letters 103, 149‐158

58. Bravo‐Cuellar, A., Hernández‐Flores, G., Lerma‐Díaz, J. M., Domínguez‐Rodríguez, J. R., Jave‐Suárez, L. F., De Célis‐Carrillo, R., Aguilar‐Lemarroy, A., Gómez‐Lomeli, P., and Ortiz‐Lazareno, P. C. (2013) Pentoxifylline and the proteasome inhibitor MG132 induce apoptosis in human leukemia U937 cells through a decrease in the expression of Bcl‐2 and Bcl‐XL and phosphorylation of p65. Journal of biomedical science 20, 13

59. Crooks, G. E., Hon, G., Chandonia, J.‐M., and Brenner, S. E. (2004) WebLogo: A Sequence Logo Generator. Genome Research 14, 1188‐1190

60. Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R., Thompson, J. D., Gibson, T. J., and Higgins, D. G. (2007) Clustal W and Clustal X version 2.0. Bioinformatics (Oxford, England) 23, 2947‐2948


14

Acknowledgements - We thank Professor Yoichi Taya, Professor Mark Featherstone and Dr. Tobias Carl Cornvik for providing cDNA clones of the transcriptional factors used in the minimal promoter study. The manuscript was edited by Amy Sullivan from Obrizus Communications. FOOTNOTES *This work is supported by research funding from National Medical Research Council (NMRC/IRG/1269/2010: W.H.N., I-H.S.) and Ministry of Education, Singapore (MOE2009-T2-1-034: I-H.S., MOE2013-T2-2-038: J.F.L.,I-H.S.), National Health and Medical Research Council (NHMRC), Australia (Program Grant #1016701: S.G. and Fellowship #1002580: R.G.). 1To whom correspondence should be addressed: I-hsin Su, Division of Molecular Genetics and Cell Biology, School of Biological Sciences, College of Science, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551, Republic of Singapore, Tel.: (+65) 65138687; Fax: (+65) 67913858; E-mail: [email protected] 2The abbreviations used are: PcG, Polycomb group; PRC1, polycomb repressive complex 1; 3’UTR, 3’ untranslated region; pRB, retinoblastoma protein; PTX, pentoxifylline; MP, minimal promoter; RT, reverse transcription; ChIP, chromatin immunoprecipitation; CNS, conserved non-coding sequence; H3Ac, acetylated histone 3

FIGURE LEGENDS

TABLE 1. Predicted transcription factors binding sites in Ezh2 locus (-1915/+1694). High-scoring transcription factor (TF) binding sites identified by TFSEARCH and rVista2.0 (37,38) were summarized. Sequence logo was generated with WebLogo3 (59) based on TFSEARCH (37) (AP1, c-Rel, Ikaros-2, Pbx1, and SP1) or Children’s Hospital Informatics Program MAPPER position weight matrix database (Meis1a and DP1).

FIGURE 1. Ezh2 expression is up-regulated in activated lymphocytes. Purified mature naïve B and T cells were stimulated with anti-IgM antibody (5µg/ml)/IL-4 (10ng/ml) and plate bound anti-CD3 (10µg/ml)/anti-CD28 (5µg/ml) antibodies, respectively. (A) Total RNAs isolated from indicated post-activation time points were reverse-transcribed and Ezh2 mRNA levels were determined by semi-quantitative PCR. Threefold serial dilution of the cDNA templates were used for semi-quantitative PCR amplification. The housekeeping gene, HPRT, was chosen as a loading control. PCR products were confirmed by sequencing. Data shown are the mean ± standard deviation (S.D.) of more than three independent experiments. (B) Real time RT-qPCR was conducted using Taqman Gene Expression Assays (ABI) and normalized against HPRT. (C and D) B and T cell activations were controlled by assessing down-regulation of the resting cell marker, CD62L, and up-regulation of the activation markers, CD69 and CD86 for B cells and CD69 and CD44 for T cells, 24 hours post-activation. Data shown in this figure are representative of three independent experiments.

FIGURE 2. Identification of regulatory regions in the Ezh2 locus. (A) The conserved non-coding sequences (CNSs) in the murine Ezh2 locus as determined by Vista Browser 2.0. The positions of the minimal promoter and potential regulatory region in intron 1 are indicated by the striped box and thick black line, respectively. The positions of individual exons of Ezh2 are indicated above the sequence. The Ezh2 locus is shown in the reverse orientation. (B) Luciferase assays were performed to identify novel regulatory regions in the Ezh2 locus. Schematic representations of the luciferase reporter constructs used are shown (left). Small light and dark blue boxes represent Ezh2 exon 1 and 2, respectively. Position +1


15

corresponds to the transcription start site. Different lengths of Ezh2 intron 1 were fused to the 3’ end of Ezh2 exon 1. A 220bp DNA fragment upstream of Ezh2 exon 2 was cloned into the indicated constructs to enable splicing to occur. Small open boxes represent potential active (A1, A2) and repressive (R1) regulatory regions of the Ezh2 locus. HEK293T cells were transfected with the indicated constructs and analyzed for luciferase activity 48 hours post-transfection. Non-transfected cells (NT), as well as pGL3-Enhancer (En) and pGL3-Control (Control) transfected cells were used as internal controls for the luciferase assay. The relative luciferase activities (RLAs) of the respective constructs were normalized to Renilla luciferase activity. Relative fold changes were calculated using the RLA of control. Data shown are the mean ± S.D. of three independent experiments. The difference between the indicated pairs was determined by two-tailed Student’s t-test with equal variance (** p<0.005, *** p<0.001). (C) The correct splicing of each reporter construct was examined by RT-PCR with the indicated primer pairs (arrows). Properly spliced constructs generated a 168bp band, except in the case of the MP construct, which gave rise to a 99bp band.

FIGURE 3. Identification of potential Ezh2 regulators using a candidate gene approach. HEK293T cells were co-transfected with the indicated minimal promoter constructs and transcription factor (TF) expression vectors. E2F and p53 were used as positive and negative controls, respectively. Luciferase activity was analyzed 48 hours post-transfection. RLA was normalized to Renilla luciferase activity. Relative fold changes were calculated using the RLA of the empty vector control (EV). Data shown are the mean ± S.D. of three independent experiments. The significant differences between cells expressing individual TFs and empty vector control were determined by two-tailed Student’s t-test with equal variance (* p<0.01, ** p<0.005, *** p<0.001).

FIGURE 4. c-Rel binds to intron 1 of the Ezh2 locus. (A) c-Rel binding sites in the Ezh2 locus were predicted using rVista2.0 and TFSEARCH. Predicted c-Rel binding sites are designated with boxes in the DNA fragments shown. The degree of conservation between human and mouse sequence was analyzed with ClustalW (60) and conserved nucleotides are indicated by asterisks. The transcription start site is defined as +1. (B) c-Rel controls Ezh2 luciferase reporter activity in a dose-dependent manner. HEK293T cells were transfected with the MP/+838 reporter construct and different amounts of c-Rel expression vector, as indicated. Luciferase activity was analyzed and normalized as described in Fig. 3. c-Rel protein levels in nuclear fractions were analyzed by western blot and Lamin B was used as a loading control. (C) c-Rel up-regulates endogenous Ezh2 expression in HEK293T cells. Ezh2 expression levels in whole cell lysates at the indicated times post-transfection were analyzed by western blot. The fold changes of Ezh2 expression levels compared to the non-transfected (NT) control are shown below the western blot. Levels of overexpressed c-Rel were also observed by western blot. Tubulin was used as a loading control. (D) Site 1 and 2 are dispensable for c-Rel mediated up-regulation of MP/+838 luciferase reporter activity. MP/+838 reporter constructs with c-Rel binding site 1 or 2 deletions were co-transfected with c-Rel expression vector in HEK293T cells. Relative fold change was calculated using the RLA of wild type MP/+838 without c-Rel co-expression. (E) c-Rel mediated up-regulation of MP/+838 luciferase reporter activity was abolished upon site 4 (+779 to +788) deletion. MP/+838 reporter constructs with c-Rel binding site 3 or 4 deletions were co-transfected with c-Rel expression vector. Relative fold change was calculated using the RLA of wild type MP/+838 without c-Rel co-expression. 3* indicates construct after removal of the artificial c-Rel binding site that is generated upon deletion of site 3. (F) c-Rel regulates Ezh2 reporter expression in lymphoid lineage cells. Luciferases assays done in (E) were repeated in lymphoid lineage Jurkat T cells. (G) c-Rel regulates the expression of mouse and humanized Ezh2 reporters. The mouse site 4 (including 20 nucleotides both up- and down-stream of this site) was replaced with corresponding human site sequence (Site 4 Hsa) in the mouse reporter construct MP/+838 (site 4 Mmu). The luciferase activities of these constructs were measured with or without exogenous c-Rel expression. Data shown in (D) to (G) are the mean ± S.D. of technical triplicates from one experiment representative of three independent experiments. The differences between indicated pairs were determined by two-tailed Student’s t-test with equal variance (**p<0.005, *** p<0.001).


16

FIGURE 5. Recruitment of c-Rel to the Ezh2 locus in activated lymphocytes. (A and B) c-Rel nuclear translocation is correlated with Ezh2 up-regulation. B (A) and T (B) cells were activated as described in Fig. 1. Cytosolic and nuclear fractions were isolated at the indicated post-activation time points and Ezh2 and c-Rel expression levels were analyzed by western blot. GAPDH and Lamin B were used as loading controls for the cytosolic and nuclear fractions, respectively. Data shown in this figure are representative of three independent experiments. (C) Schematic representation of the Ezh2 locus and the corresponding positions of PCR products generated in ChIP analysis. The transcription start site is defined as +1. The first exon of Ezh2 (open box) and the c-Rel binding site (black triangle) are shown. PCR products are indicated by grey lines with position numbers. (D and E) c-Rel was recruited to the Ezh2 locus in primary B and T cells. Cells were stimulated and activation was confirmed as described in Fig. 1. B (D) and T (E) cells were fixed and sonicated. Chromatin was immunoprecipitated with anti-c-Rel antibody and purified DNAs were amplified by qPCR (left) or semi-quantitative PCR (right). IgG antibody was used as a negative control. For qPCR, samples were normalized to input and expressed as fold enrichment compared to IgG controls. (F) c-Rel associates with mouse and human site 4. DNA affinity precipitation assays using biotinylated either mouse wild-type site 4 (Mmu), deleted mouse site 4 (Mmu*) or human site 4 probes (Hsa) were performed. Binding proteins were resolved on SDS-PAGE and c-Rel was detected by specific antibody. Probe sequences are indicated in the low panel. Boxes show the position of site 4 or remaining nucleotide residue after site 4 deletion in Mmu* probe. (G and H) Recruitment of c-Rel to the Ezh2 locus is correlated with acetylated histone 3. ChIP was performed using activated B (G) and T (H) cells as described above with antibody specific to acetylated histone 3 (H3Ac) and DNAs were amplified by qPCR. A to D on the x-axis indicate the positions of PCR products that are described in (C). Bar graphs shown in the figure are the mean ± S.D. of more than three independent experiments. The differences between the indicated pairs were significant as determined by two-tailed Student’s t-test with equal variance (** p<0.005, *** p<0.001).

FIGURE 6. c-Rel is critical for Ezh2 up-regulation in activated lymphocytes. Purified murine T and B cells were stimulated as described in Fig. 1. Total RNAs isolated from resting or activated control (wt) and c-Rel-deficient (c-Rel-/-) lymphocytes (24 hours upon stimulation) were reverse-transcribed and (A) c-Rel, (B) Ezh2 and (C) RelA mRNA levels were determined by qPCR and normalized against HPRT. Data shown in the figure are the mean ± S.D. of three independent experiments. The differences between the indicated pairs were significant as determined by two-tailed Student’s t-test with equal variance (* p< 0.01, ** p<0.005, *** p<0.001).

FIGURE 7. Pentoxifylline prevents the recruitment of c-Rel to the Ezh2 locus and up-regulation of Ezh2 in activated lymphocytes. Purified B (A and C) and T (B and C) cells were activated as described in Fig. 1. In addition, T cells were stimulated without (B and C) or with 20ng/ml IL-2 (C and D). Cytosolic and nuclear fractions were isolated at the indicated time points post-activation. Ezh2 and c-Rel expression levels in cytosolic and nuclear fractions were analyzed by western blot. GAPDH and Lamin B were used as loading controls for the cytosolic and nuclear fractions, respectively. PTX indicates lysates isolated from B or T cells pre-treated with 300µg/ml pentoxifylline for 10 minutes prior stimulation. (C) Quantification of the band intensities for nuclear c-Rel and Ezh2 protein levels 24 hours post-stimulation shown in A, B and D. (E) Reduced recruitment of c-Rel to the Ezh2 locus in activated B (left) and T (right) cells upon PTX treatment was observed by ChIP assay, as described in Fig. 5 D and E. The purified DNAs were analyzed by qPCR. Data shown in the figure are the mean ± S.D. of more than three independent experiments. The differences between the indicated pairs were significant as determined by two-tailed Student’s t-test with equal variance (* p<0.01, *** p<0.001). B (F) and T (G) cell activations with or without PTX and IL-2 treatments were analyzed by assessing the up-regulation of activation markers by FACS (CD69 and CD86 for B cells; CD69 and CD44 for T cells) 24 hours post-activation. Numbers in graph indicate mean fluorescence intensity (MFI) of the indicated staining on each population. (H) T cells were activated with biotinylated anti-CD3 (5µg/ml) and anti-CD28 (5µg/ml) antibodies with or without 20ng/ml IL-2. CD3 and CD28 were cross-linked with 25µg/ml recombinant streptavidin.


17

Cytosolic fractions were isolated at the indicated time points post-activation. Phosphorylated Akt and Erk levels were analyzed by western blot. Total Akt and Erk protein levels were used as loading controls. Data shown in this figure are representative of three independent experiments.

FIGURE 8. The combination of PTX and the Ezh2 inhibitor, GSK126, effectively inhibits the survival and growth of leukemia and lymphoma cell lines. (A) PTX treatment down-regulates EZH2 expression in Jurkat and MM1S lymphoma cell lines. Cytosolic and nuclear fractions were isolated from cells at the indicated time points post-activation. EZH2 expression levels in cytosolic and nuclear fractions were analyzed by western blot. GAPDH and Lamun B were used as loading controls for the cytosolic and nuclear fractions, respectively. Data shown in this figure are representative of three independent experiments. (B) c-Rel recruitment to the EZH2 locus in Jurkat or MM1S cells, as determined by ChIP assay, was significantly inhibited by PTX treatment. Data shown in the figure are the mean ± S.D. of more than three independent experiments. The differences between the indicated pairs were significant as determined by two-tailed Student’s t-test with equal variance (*** p<0.001). (C) c-Rel regulates EZH2 expression in Jurkat T cells. c-Rel expression in Jurkat T cells was knocked down by specific siRNA through electroporation. Live cells were purified by Lympholyte gradient (Cedarlane Laboratories). Total RNAs isolated from control or knockdown cells (0, 6 and 24 hours after transfection) were reverse-transcribed and c-rel, EZH2 and relA mRNA levels were determined by qPCR and normalized against HPRT. (D and E) IC50 values of GSK126 in combination with indicated concentrations of PTX in Jurkat (D) and MM1S (E) cells. Cell viability was accessed by MTT assays. The IC50 value of GSK126 for Jurkat or MM1S cells at a defined PTX concentration was calculated based on the survival curve of cells treated with five different concentrations of GSK126; 1250, 2500, 5000, 10000, and 25000nM (for Jurkat)., 20000nM (for MM1S). (F and G) Dose-dependent effects of PTX treatment on cell viability over time in Jurkat (F) or MM1S (G) cells. FACS analysis of annexin V/PI staining was used to determine cell viabilities. Live cells (black column, annexin V-PI-); early apoptotic cells (dark grey column, annexin V+PI-); late apoptotic cells (light grey column, annexin V+PI+); dead cells (white column, annexin V-PI+). Data shown in the figure are the mean ± S.D. of more than three independent experiments. (H) Combinatorial effects of PTX and GSK126 treatment on cell viability in Jurkat and MM1S cells. Jurkat and MM1S cells were cultured in the presence of vehicle control (PBS or DMSO), 10M GSK126, 900 or 600 g/ml PTX as indicated, or both drugs for the indicated periods of time. Cell viabilities were determined by FACS as described above in (F and G). Viable cells were defined as annexin V-PI-.


18

Table 1


19


20


21


22


23


24


25


26

wen hao neo1, jun feng lim1 raelene grumont2 steve ... · wen hao neo1, jun feng lim1, raelene...

Documents