vinayaka mission's research foundation · declaration by the candidate i, nathiya. s. declare...

EVALUATION OF HEPATOPROTECTIVE EFFECT OF HESPERIDIN

AND ASCORBIC ACID ON ETHANOL AND ANTITUBERCULAR

DRUGS INDUCED HEPATOTOXICITY IN WISTAR RATS.

Thesis submitted in partial fulfillment for the award of degree of

Doctor of Philosophy in Pharmacology

By

NATHIYA. S.

Reg No. PRMOC 12 B 02

Under the guidance of

Prof. Dr. S. RAJARAM. M.D

VINAYAKA MISSIONS UNIVERSITY, SALEM

(VINAYAKA MISSIONS RESEARCH FOUNDATION-DEEMED UNIVERSITY)

MARCH 2017

DECLARATION BY THE CANDIDATE

I, NATHIYA. S. declare that the thesis entitled “EVALUATION OF

HEPATOPROTECTIVE EFFECT OF HESPERIDIN AND ASCORBIC

ACID ON ETHANOL AND ANTITUBERCULAR DRUGS INDUCED

HEPATOTOXICITY IN WISTAR RATS” submitted by me for the award

of Degree of Doctor of Philosophy (Ph.D) in Pharmacology is the

record of research work carried out by me during the period from

July 2012 to June 2016 under the guidance of DR. S. RAJARAM. M.D,

Prof and HOD, Department of Pharmacology, VMKV Medical College,

Salem. This thesis has not formed the basis for the award of any

other degree, diploma, associate-ship, fellowship or any other similar

titles in this or any other university or other similar institutions of

higher learning.

Place: Salem

Date : 20.03.17 (Mrs. NATHIYA. S.)

CERTIFICATE BY THE RESEARCH SUPERVISOR

DR. RAJARAM. S Salem,

Professor and Head 20.03.17.

Dept. of Pharmacology

VMKV Medical College

Salem.

I, Dr. S. RAJARAM. M.D certify that the thesis entitled

“EVALUATION OF HEPATOPROTECTIVE EFFECT OF HESPERIDIN

AND ASCORBIC ACID ON ETHANOL AND ANTITUBERCULAR

DRUGS INDUCED HEPATOTOXICITY IN WISTAR RATS” submitted

by NATHIYA. S for the award of degree of Doctor of Philosophy in

the department of Pharmacology is the record of research work

carried out by her during the period from July 2012 to June 2016

under my guidance and supervision and this has not formed the

basis for the award of any other degree, diploma, associate-ship,

fellowship or any other similar titles in this or any other university or

other similar institutions of higher learning.

(Dr. S. RAJARAM)

ACKNOWLEDGEMENT

Every arduous job becomes easy if it is fueled by good guidance. This

is a small but generous attempt to acknowledge the tremendous

support my near and dear ones have given to me throughout my study.

I wish to express my sincere and hearty gratitude, to my respected

guide Prof. Dr.S.RAJARAM, M.D, Professor & HOD, Department of

Pharmacology, VMKV Medical College, Salem. For his immense

guidance, help, intellectual supervision, and dedicated support for the

timely completion of my work. I would be much thankful to his endless

help and criticisms to embellish my study, which influenced me to

accomplish this work successfully. Last but not least, it’s my fortune and

so I am proud to have him as my guide.

My special thanks to the Honourable Dr. A.S. GANESAN, Chancellor,

Vinayaka Missions University, Salem, for providing infrastructure and

facilities required for this research work.

I gratefully acknowledge my deep sense of gratitude to Prof. V. R.

Rajendran, Vice- Chancellor, Vinayaka Missions University, Salem

Dr. CL. Prabhavathi , Dean (Research) and Dr. R. Rajendran, former

Dean (Research), Vinayaka Missions University, Salem, for their

blessings and opportunity offered to precede this piece of research

leading to the award of Doctor of Pharmacology.

I gratefully acknowledge my deep sense of gratitude to Dean Dr.P.S.

Manoharan, VMKV Medical College for their blessings and opportunity

offered to fulfill my assignment in this prestigious institution.

My heartfelt gratitude to Dr.Nirmala Sethuraman, M.D., for her

guidance, suggestions and support.

I express my sincere thanks to Dr. E. Manivannan MD, Professor&

DR.V.Sivasankari, Associate Professor, Department of Pharmacology,

VMKV Medical College, Salem, for their valuable suggestions and

support throughout the work.

My sincere thanks to Dr. Vijayababu, MD, Professor, Annapoorna

Medical College, Salem and Dr. Arul Mohan M.D. Assistant professor

VMKVMC, Salem for their support.

My heartfelt gratitude to Dr.Philips Abraham, Professor, Department of

Biochemistry, VMKVMC, Salem and Dr. Sachu Philips, Professor and

HOD, Vivekananda Dental College, Mrs. G. Vennila, Lecturer, KSR

Dental College, Tiruchengode for their valuable guidance,

encouragement and support throughout the work.

My heartfelt thanks to Dr. Karthi, Dr. Dinesh for their timely help,

support, suggestion and guidance throughout the research.

I express my profound thanks to my colleagues Dr.Saravanan, Tutor,

Annapoorna Medical College, Salem, for his for his constant support

and encouragement.

My sincere thanks to my colleagues Dr. Arul Raja, Tutor,

Dr. Karthikeyan, Tutor , Dr. Ramya M.D. Assistant professor, VMKV

Medical College, Salem, for their valuable support.

My sincere thanks to Dr. Sivakami MD, Assistant professor, PMCH

Medical College salem for her support in Histopathological results.

My heartfelt thanks to Dr. Paramasivan, Dr. Geetha V Shasthri for

their dedicated support for the timely completion of my work.

My sincere thanks to Dr. Gandhimathi, Dr. Sumathi, Mr. Ramesh,

Mrs. Jeevitha for their support in completing my thesis.

My heartfelt gratitude to Dr. Reka, Dr. Rajitha, Dr. Perumal,

Miss. Reena, Dr. Hema Nandhini and Dr. Indra VMKV Medical

College, Salem for their timely help, support and suggestion throught

out the research.

My heartfelt thanks to Mr. Senthil, Mr. Selva kumar, Mrs. Amudha,

Mrs. Papa, Mrs Rajammal, mrs. Jeya for their support during my

research.

I would like to express my gratitude to all the HODs, Faculties, non

teaching staffs of VMKV Medical College for their encouragement and

support.

My sincere thanks to Miss. Udhaya, Miss. Nandhini, Miss Pavithra,

Miss. Tamilarasi, for their support during my work.

Words are not sufficient to express my love and appreciation to my

affectionate, lovable Father Mr. P.Shanmugam, My Mother

S.Soundaram, My Lovable sister S. Hemalatha and my inlaws

whose full-hearted co-operation, love and moral support made me to

complete this task successfully.

Above all, I would like to thank my beloved husband

Mr. P.Senthil Kumar B.Tech, for his personal support and great

patience at all times even during the inevitable ups and downs, without

which the thesis would not have been possible.

I thank the Almighty, who has given me this opportunity to extend

my gratitude to all those people who have helped me and

guided me throughout my work and life.

S.NATHIYA

CONTENTS

CHAPTER TITLE PAGE NO.

1. INTRODUCTION 1-9

2. REVIEW OF LITERATURE 10-57

3. NEED FOR THE STUDY 58

4. AIM AND OBJECTIVES OF THE STUDY 59

5. MATERIALS AND METHODS 60-92

6. RESULTS 93-129

7. DISCUSSION 130-163

8. CONCLUSION 164-165

9. LIMITATIONS AND FUTURE PROSPECTS 166

10. BIBLIOGRAPHY 167-212

11. LIST OF PUBLICATIONS 213

https://www.google.co.in/search?q=FUTURE+PROSPECTS&spell=1&sa=X&ved=0ahUKEwiWx6LKnt3SAhVBVZQKHXB3BbIQvwUIGCgA

LIST OF TABLES

Table

No. TITLE

Page

No.

1. Drug and toxin induced hepatotoxicity 14

2. Primers used for RT-PCR analysis 91

3.

Effect of Hesperidin and Ascorbic acid on serum Total

protein, Albumin and Bilirubin in Ethanol induced

hepatotoxic rats

94

4. Effect of Hesperidin and Ascorbic acid on liver marker

enzymes in serum of ethanol induced hepatotoxic rats 96

5. Effect of Hesperidin and Ascorbic acid on antioxidant

enzymes in liver of ethanol induced hepatotoxic rats 101

6.

Effect of Hesperidin and Ascorbic acid on serum Total

protein, Albumin, Bilirubin, Urea and Creatinine in

antitubercular drug induced hepatotoxic rats

106

7.

Effect of Hesperidin and Ascorbic acid on liver marker

enzymes in serum of antitubercular drugs (HRZ)

intoxicated rats

108

8.

The effect of hesperidin and ascorbic acid on

enzymatic and non enzymatic antioxidant in

antitubercular drug induced hepatotoxic rats

112

9.

The antilipidemic effect of Hesperidin and Ascorbic

acid on serum lipid profile in antitubercular drug

induced hepatotoxic rats

116

LIST OF FIGURES

FIGURE

NO. TITLE

PAGE

NO.

1. The redox homeostasis of the liver 12

2. Structure of Ethanol 17

3. Metabolic pathway of Ethanol 18

4. Oxidative pathways of Ethanol metabolism 22

5. Chemical structure of Isoniazid 26

6. Chemical structure of Rifampicin 29

7. Chemical structure of Pyrazinamide 31

8. Metabolic pathway of Isoniazid 35

9. Chemical structure of Hesperidin 41

10. Chemical structure of Ascorbic acid 49

11. Effect of Hesperidin and Ascorbic acid on serum

lipid profile in ethanol induced hepatotoxic rats. 98

12.

Effect of Hesperidin and Ascorbic acid on Lipid

peroxidation in liver of ethanol induced hepatotoxic

rats

98

13.

Effect of Hesperidin and Ascorbic acid on

histopathological changes induced by ethanol in

rat liver (H & E stain, 400x).

103

14.

Effect of Hesperidin and Ascorbic acid on oxidative

stress markers (TBARS) in liver of antitubercular

drug induced hepatotoxic rats.

110

15.

Effect of Hesperidin and Ascorbic acid on liver

oxidative stress markers (LHP and CD) in

antitubercular drug induced hepatotoxic rats.

110

16.

Effect of Hesperidin and Ascorbic Acid on

antioxidant Vitamin C and Vitamin E in liver of


113

17.

Effect of Hesperidin and Ascorbic acid on serum

Total cholesterol and triglycerides in antitubercular

drug induced hepatotoxic rats.

113

18.


membrane bound Na+K+ ATP ase enzymes in liver

of Antitubercular drug induced hepatotoxic rats

118

19.

Effect of Hesperidin and Ascorbic acid on membrane bound Ca 2+ and Mg 2+ ATP ase enzymes in liver of Antitubercular drug induced hepatotoxic rats.

118

20.


histopathological changes induced by

antitubercular drug in rat liver (H & E stain, 400x).

120

21. Western blotting study on the protein expression of

Bax and Bcl-2. 122

22. Western blotting study on the protein expression of

caspase 3 and caspase 9. 122

23. RT-PCR Analysis on the mRNA expression of Bcl-2

and Bax. 124

24. RT-PCR Analysis on the mRNA expression of

caspase 3 and caspase 9. 124

25. Effect of Hesperidin and Ascorbic acid on DNA

Fragmentation. 126

26. Western blotting analysis on the Protein expression

of TNF-α, NF-κB and IL-10. 126

27. RT-PCR Analysis on the mRNA expression of

TNF-α, NF- κB and IL-10. 129

ABSTRACT

Aim

The present study was designed to evaluate the protective effect

of Hesperidin and Ascorbic acid against ethanol and antitubercular drug

induced hepatotoxicity in wistar albino rats.

Methods

Hepatoprotective activity of Hesperidin (200mg/kg) and Ascorbic

acid (100mg/kg) was studied against ethanol (40%) induced

hepatotoxicity. Biochemical parameters (total protein, bilirubin), serum

marker enzymes (AST, ALT, ALP etc.,), lipid peroxidation, antioxidant

enzymes (SOD, CAT, GSH, VIT C etc.,), lipid profile, histological

changes of liver were assessed in control, toxicant and treatment

animals exposed to ethanol.

Hepatoprotective activity of Hesperidin (200mg/kg) and Ascorbic

acid (100mg/kg) was studies against antitubercular drug Isoniazid +

Rifampicin + pyrazinamide (27,54,135 mg/kg.b.wt.) induced

hepatotoxicity. Biochemical parameters (total protein, bilirubin), serum

marker enzymes, lipid peroxidation, antioxidant enzymes (SOD, CAT,

GSH, VIT C etc.,), lipid profile, histological changes of liver , membrane

bound ATP ase enzyme, apoptotic (Bax, Bcl2, caspase 3, 9) and the

inflammatory markers (TNFα, IL-10 and NF kB) were assessed in

control, toxicant and treatment animals exposed to antitubercular drugs.

Results

Ethanol induced hepatotoxicity was evident by increased level of

serum liver marker enzymes (AST, ALT, ALP, & LDH) and also a

significant rise in the level of LPO along with decline in the level of both

enzymatic and non enzymatic antioxidant enzymes (SOD, CAT, GSH,

VIT C and VIT E). Ethanol administration showed alteration in the lipid

profile and serum biochemical markers (bilirubin, albumin, total protein).

Our results are further confirmed by Histopathological examination

which showed changes in the normal liver architecture. All these

biochemical and Histopathological changes induced by ethanol were

ameliorated by the co-administration of Hesperidin and Ascorbic acid.

Antitubercular drug induces hepatotoxicity was evident by

increased level of liver marker enzymes (AST, ALT, ALP, ACP, γ-GT &

LDH) and also a significant rise in the level of LPO along with decline in

the level of both enzymatic and non enzymatic antioxidant enzymes

(SOD, CAT, GSH, VIT C and VIT E) . Antitubercular drug also alter the

biochemical marker enzymes, lipid profile and membrane bound ATP

ase enzymes. Moreover, antitubercular drug causes hepatic damage by

inducing apoptotic death and inflammation in hepatic cells, manifested

by an increase in the expression of Bax, caspase-3, caspase-9, NF-κB,

IL- 10, TNF- α and decrease in Bcl-2 expression. These results were

further supported by the histopathological examination of liver. All these

features of antitubercular drugs induced toxicity were reversed by the

co-administration of Hesperidin and Ascorbic acid.

Conclusion

Therefore, our study favors the view that Hesperidin and Ascorbic

acid combination may be a useful modulator in alleviating ethanol and

antitubercular drug induced hepatotoxicity. However further research is

need to validate Hesperidin and ascorbic acid combination as a new

therapeutic agent supplemented with antitubercular drugs in the

treatment of TB and also in alcoholic liver disease .

ABBREVIATIONS

AA Ascorbic acid

ACP Acid phosphatise

ADH Alcohol Dehydrogenase

ALDH Aldehyde Dehydrogenase

ADH Alcohol Dehydrogenase

ALP Alkaline phosphatise

ALT Alanine aminotransferase

ANSA 1-amino 2-napthol 4-sulphonic acid

AST Aspartate aminotransferase

ATDH Anti TB drug induced hepatotoxicity

ATP Adenosine triphosphate

ATP ase Adenosinetriphosphatase

ATT Antitubercular treatment

Bcl 2 B-cell lymphoma 2

BHT Butylated Hydroxy Toluene

BSA Bovine serum albumin

cAMP Cyclic adenosine monophosphate

CAT Catalase

CDNB 1-Chloro-2, 4-dinitrobenzene

CDs Conjugated Dienes

CHF Congestive Heart Failure

CPCSEA Committee for the purpose of control and supervision

of experiments on animals

CYP cytochrome P 450

DTNB dithio-nitrobenzoic acid

DILI Drug induced liver injury

DNA Deoxyribonucleic Acid

E Ethambutol

EDTA Ethylenediaminetetraacetic acid

EtOH Ethanol

FAD Flavin Adenine Dinucleotide

FFA Free Fatty Acids

GABA Gamma-Aminobutyric Acid

GPx Glutathione peroxidase

GR Glutathione Reductase

GSH Reduced glutathione

GSSG Glutathione disulfide

GST Glutathione-S-transferase

H & E Hematoxylin and Eosin

H Isoniazid

H2O2 Hydrogen peroxide

H2SO4 Sulphuric acid

HBV Hepatitis B virus

HCL Hydrochloric acid

HCD High Cholesterol Diet

HDL High density lipoprotein

HDN Hesperidin

HIV Human Immunodeficiency Virus

HRP Horseradish Peroxidase

i.p Intra peritoneal

IAEC Institutional Animal Ethics Committee

IFN Interferon

IL Interleukin

INH Isonicotinylhydrazine

IU International unit

KCL Potassium chloride

LDH Lactate dehydrogenase

LDL low density lipoprotein

LHP lipid hydroperoxide

LPO Lipid peroxides

MDA Malondialdehyde

MEOS Microsomal Ethanol Oxidizing System

MgSO4 Magnesium sulphate

mg milli gram

MIC Minimum Inhibitory Concentration

Nacl Sodium chloride

NAD+ Nicotinamide adenine dinucleotide

NADH Nicotinamide adenine dinucleotide

NADH Reduced nicotinamide adenine dinucleotide

NADP Nicotinamide adenine dinucleotide phosphate

NaOH Sodium hydroxide

NAT N-acetyl transferase 2

NBT Nitro blue tetrazolium

NF-κ Nuclear Factor Kappa-Light-Chain-Enhancer Of

Activated B Cells

NMDA N -methyl-D-aspartate

OD Optical Denisity

PA Pyrazinoic Acid

PMS Phenazine methosulphate

PVDF polyvinylidene difluoride,

PUFA Poly unsaturated fatty acids

RBC Red Blood Cells

RNA Ribonucleic acid

RNS Reactive Species Of Nitrogen

RNTCP Revised National Tuberculosis Control Programme.

RTPCR Reverse Transcriptase Polymerase chain reaction

ROS Reactive oxygen species

Rpm Revolution per minute

R Rifampicin

S Streptomycin

SD Standard deviation

SDS-PAGE Sodium dodecil sulphate-polyacrylamide gel

Electrophoresis

SLY Silymarin

SOD Superoxide dismutase

TBA Thiobarbituric acid

TBARS Thiobarbituric acid reactive substances

TC Total Cholesterol

TCA Trichloroacetic acid

TB Tuberculosis

TNF-α Tumor necrosis factor alpha

TCA cycle Tri carboxylic acid cycle

TG Triglyceride

VLDL Very low-density lipoprotein

v/v volume per volume

WHO World Health Organisation

Z Pyrazinamide

γGT Gamma glutamyltransferase.

Introduction

1

1. INTRODUCTION

Drug induced liver injury (DILI) represent a major challenge for

drug regulatory authorities and industry and it is the leading causes for

termination of further substance development in preclinical and clinical

phases and it is also the most common single adverse drug reaction

leading to refusal of market approval. However in many instances a

drugs hepatotoxic potential can only be recognized post marketing. DILI

is the most frequent reason for withdrawing drugs from the market and

requires modification of labeling (Temple et al., 2002; kaplowitz, 2001).

Approximately around 900 drugs have been identified as

hepatotoxins and it is the most common reason for a drug to be

withdrawn from the market. Drugs like Isoniazid, Rifampicin,

paracetomol, Halothane and alcohol induce subclinical injury to liver

which manifests as abnormal liver enzyme activities (Ostapowicz et al.,

2002).

In the present study ethanol and antitubercular drugs like

Isoniazid, Rifampicin and pyrazinamide were used to induce

hepatotoxicity to investigate the protective effect of Hesperidin and

Ascorbic acid.

Tuberculosis (TB) is the one of the deadliest infectious disease

which affects one third of the world population. In 2015, 10.4 million

people are infected with TB in the world and 1.8 million deaths were

Introduction

2

reported to WHO (2015). TB can be cured by multiple drug regimens for

around 6-9 months. The first line anti tubercular regimen that form main

core in the TB treatment regimen includes Isoniazid (H), Rifampicin(R),

Pyrazinamide(z), Ethambutol(E) and streptomycin(S). However

hepatotoxicity is the main drawback of multiple treatment regimens

containing HRZ which is evidenced by increased level of liver marker

enzyme in systemic circulation. Adverse effects of antitubercular

therapy are sometimes potentiated by multiple drug regimens, though

these drugs each in it are hepatotoxic, given in combination their toxic

effect is enhanced synergistically.

During metabolism Isoniazid is converted into a reactive

metabolite, which get activated by cytochrome P450 system, results in

the generation of toxic intermediates and reactive oxygen species. This

will leads to oxidative stress which will induce liver injury (Tayal et al.,

2007). On the other hand Rifampicin is the enzyme inducers which

enhances the production of toxic metabolites from INH and exacerbate

liver injury (Asduq et al., 2007). However Pyrazinamide in combination

with isoniazid and Rifampicin will increase incidence of hepatotoxicity

(Asduq et al., 2007).

Research evidence stated that the antitubercular drug induced

liver injury is mainly due to the oxidative stress which leads to cell injury

and apoptosis in humans (Tasduq et al., 2005; British Medical Research

Council 1991; Steele, 1991).

Introduction

3

Mechanism of anti TB drugs metabolism and related liver injury is

not completely understood, but alterations in the various cellular

defense mechanism have reported to be involved in this (Tasduq et al.,

2005). Recent studies suggested that antitubercular drug induced

hepatotoxicity is mainly due to the oxidative stress which enhances the

production of reactive oxygen species (ROS) and induced peroxidative

damage (LPO) to lipids. This will lead to the dysfunction of hepatic

antioxidant defense system, causing destruction and damage to the

cellular membrane (Tasduq et al., 2005; Singh et al., 2011; Basini Jyothi

et al., 2013; Attri et al., 2000). This paves the way for apoptosis

(Chowdhury et al., 2006).

Since oxidative stress mediated hepatotoxicity is the major events

in TB treatment, there is no effectual treatment to overcome such liver

injury. This results in interruption of the most efficacious first line

antitubercular drugs or change in the treatment regimen.

On the other side Alcohol abuse is one of the major healths,

social and economic problems facing the world. At least 80% of heavy

drinkers have been reported to develop steatosis, 10–35% alcoholic

hepatitis, and approximately 10% liver cirrhosis. Alcoholic liver disease

(ALD) is a main cause of chronic liver disease globally which lead to

fibrosis, cirrhosis and hepatocellular carcinoma (Partha Pal et al., 2016).

It was recognized as the second most widely used psychoactive

substances in the world, after caffeine. Possible factors that affect the

Introduction

4

development of liver injury include the dose, duration, type of alcohol

and related risk factors including obesity, iron overload, concomitant

infection with viral hepatitis, and genetic factors (O'Shea et al., 2010).

During metabolism Alcohol is oxidized to acetaldehyde in the

liver. The metabolic process is catalyzed by different enzymes like

alcohol dehydrogenase (ADH), microsomal ethanol metabolizing

system (MEOS) and acetaldehyde dehydrogenase (ALDH). The

acetaldehyde is more toxic metabolite which leads to a larger number of

the metabolic disorders including hepatic and extra hepatic diseases

(Tarasankar Maity et al., 2012). Alcohol ingestions have been found to

cause accumulation of reactive oxygen species and deplete the

antioxidants which lead to oxidative stress and liver injury (Tostmann et

al., 2008).

The important factor that plays a central role in the

aetiopathology of alcohol-induced liver disease and which has been the

focus of much research is the excessive generation of ROS. Thus,

numerous interventions have been put forward to counteract the

vulnerability of the liver to oxidative challenges during alcohol

consumption by reinforcing the endogenous antioxidant defense system

(Wu et al., 2003; Koch et al., 2004).

Research evidence suggested that Ethanol and antitubercular

drugs induced hepatotoxicity was mainly due to the accumulation of free

Introduction

5

radical in hepatocytes that oxidized the reduced glutathione, which in

turn lead to lipid per oxidation of cellular membranes, oxidation of

protein and DNA resulting in hepatic injury (Vidhya and Indira, 2009;

Sana Tufail et al., 2010). On the otherhand the toxic metabolite formed

during metabolism of ethanol and antitubercular drug will increased the

generation of free radical so that the antioxidant in our body are not able

to neutralise the excess free radical which result in the failure of

antioxidant dense system which damage the hepatocytes. Therefore,

agents that have antioxidant properties, represent promising therapeutic

interventions for liver damage.

In the modern medicine corticosteroids, pentoxyphylline and

immunosuppressant were used in the treatment of liver disorder but

their side effects will be more. Although substantial advance have been

made against drug induced hepatotoxicity but the efficacy is often

limited by its side effects. According new approaches needed to further

the development of an effective therapy against DILI. So focus has

shifted to materials from natural sources that aid in liver damage.

Traditional medicines have been the starting point for the

discovery of many important modern drugs which led to

pharmacological investigations and biological screening programs for

natural products all over the world. Now a day’s dietary supplement

containing natural products, fruits, vegetables and medicinal plants

have many biological properties and have potential to fight against

Introduction

6

human pathogens. Consumption of a flavonoid rich diet might decrease

the risk of degenerative changes in certain diseases.

Flavonoids are low molecular weight polyphenolic compounds,

widely distributed in the plant kingdom as a secondary metabolite based

on parent compound flavones. Flavonoid occur in all plants including

fruits, vegetables, nuts, seeds, leaves, flowers and barks (Garg et al.,

2001).

Hesperidin is the flavanon glycosides which belong to the

polyphenolic compounds. It’s mainly found in citrus fruits, especially in

the peel of orange and grape fruit (Crozier et al., 2009). It named after

the term hesperidium referring to citrus fruits. Citrus fruits and their

products are important sources of health promoting constituents and are

widely consumed around the world. It is used as a supplement drug in

the treatment regimen. Hesperidin deficiency has been associated to

the abnormal capillary leakage as well as pain in the extremities

causing aches, weakness and night leg cramps. Supplement with

Hesperidin helps in reducing edema/ excess swelling in the leg due to

fluid accumulation (Naveen Tirkey et al., 2005).

Furthermore Hesperidin shows various pharmacological actions

such as antihypertensive (Chanet et al., 2012), anti-inflammatory (Garg

et al., 2001), sedative and antinociceptive properties (Loscalzo et al.,

2008). In addition an anti-tumor property of hesperidin was reported by

Introduction

7

Kamaraj et al., (2010). Numerous studies reported that Hesperidin has

antioxidant property and possess satisfactory effect in neutralize free

radicals formed during oxidative stress (Cho 2006; Ahmad et al., 2012).

The antioxidant property of Hesperidin may be the reason behind

various pharmacological actions and hence it can be used to treat

number of diseases. Hesperidin is present in a combination with

ascorbic acid; flavonoid in combination with vitamins act in synergistic

manner (Seiichiro et al., 2006; Joe et al., 2001).

Ascorbic acid (AA) is commonly known as vitamin C. Vitamin C is

a water soluble micronutrient in human and required for variety of

biological functions. Humans and a small selection of animal species

are not able to synthesis vitamin C due to mutations in the gene

encoding L-gulono-γ-lactone oxidase, the terminal enzyme involve in

the vitamin C biosynthetic pathway (Nishikimi et al., 1994). Hence they

depend on diet as a source of Vitamin C. It is found in citrus, soft fruits

and green leafy vegetables, while kidney and liver are good animal-

derived sources of this compound (Stangeland et al., 2008).

Several studies have demonstrated that, Ascorbic acid decreased

risk of a wide range of pathologies, such as cardiovascular disease like

atherosclerosis (Seung-Woo Hong et al., 2007; Salonen et al. 2003),

human breast cancer (Shailja chambial et al., 2013), diabetes (Hoffman

et al., 2012), schizophrenia (Dakhale et al., 2005), Alzheimer’s disease

Introduction

8

(Harrison FE,2012), anxiety, depression (Gautam et al., 2012),

nephrotoxicity (Shang et al., 2014) and so on.

Ascorbic acid is essential for detoxification process in liver and

used for various liver diseases like hepatitis C, non alcoholic fatty liver

and other liver diseases. It is a well known antioxidant, which can

protect the body from damage caused by free radicals that can be

generated during normal metabolism as well as through exposure to

toxins and carcinogens (Banerjee et al., 2009). Ascorbic acid is

hydrophilic and exerts its antioxidant action by inhibiting lipid

peroxidation and oxidative cell damage (Xavier et al., 2007). In another

study by Uwe Wenze et al. (2004) reported that ascorbic acid

drastically reduces the ROS in mitochondria by its antioxidative capacity

that is required for the execution of drug-induced apoptosis.

Ascorbic acid also contributes to the regeneration of the vitamin E

and constitutes a strong line of defence in retarding free radical induced

cellular damage and apoptosis (Uwe Wenzel et al., 2004; Chan, 1993).

Hence, Ascorbic acid scavenges reactive oxygen species there by

reduces oxidative damage, apoptosis and related complications

(Naseer et al., 2011).

In this context, Ascorbic acid supplementation has been reported

to ameliorate symptoms and to enhance the expression of specific

Introduction

9

immune response markers in clinical conditions (Wintergerst et al.,

2006).

There are strong indications of Vitamin C involvement, along with

bioflavonoid like Quercetin, in maintaining the tissue levels of the

glutathione. Vitamin C, as glutathione's right hand man, can produce

indirectly an antioxidant benefit similar to that of giving glutathione itself.

Besides its ability to scavenge the free radicals, Vitamin C shows

synergistic antioxidant effect with other phenolic antioxidant (Liao and

Yin, 2000). Hence combination of Vitamin C with the phenolic

antioxidant Hesperidin may provide protective effects against free

radical induced oxidation which will be helpful for the prevention of

oxidation related disorder.

Review Of Literature

10

2. RIVIEW OF LITERATURE

2.1. Liver

Liver is the major organ which performs most vital function and

maintains the homeostasis of the body. One of the primary functions of

the liver is involve in the Biotransformation and detoxification of

ingested substances including xenobiotics, alcohol, environmental

pollutant etc., Hence, it is the most susceptible organ for drug induced

adverse effects, because all ingested substances that are absorbed are

first presented to the liver and it is responsible for the metabolism and

elimination (Klaassen, 2008).

The main functions of liver involves

Synthesis of glucose, plasma proteins, clotting factor, hormones

(Thrombopoietin, Angiotensinogen) etc.,

Secretion of bile.

Storage of vitamins, sugars, fats and other nutrients from the

food.

Aids in metabolism of carbohydrate, protein and fat.

Remove waste products from the blood.

Decomposition of RBC.

Detoxification/ biotransformation: One of the major functions of

liver is to remove the toxic substance from the blood stream.

Smooth endoplasmic reticulum in the liver is the principal clearing


11

houses that detoxify both endogenous (metabolic byproducts)

and exogenous substance (drugs, alcohol) (Singh et al., 2011).

Because of the role of clearance of blood and excretion of drugs and

exogenous compounds, liver profusely exposed to the adverse effects

of these compounds and is hence it is prone to injury.

2.2. Hepatotoxicity

Hepatotoxicity implies chemical induced liver injury. The Incidence of

liver toxicity has been reported to be much higher in developing

countries like India (8-30%) to that of advanced countries (2-3%) (Jyothi

Basini et al., 2012).

Several reasons are known to cause moderate to severe hepatic

complication, few liver complications emerge out as result of socially

unaccepted life style and also due to unavoidable circumstances.

Certain drugs like Halothane, acetaminophen, antiepileptic (valporic

acid), paracetomol, antitubercular drugs and chemicals used as food

preservatives are of great threat to the integrity of the liver. In addition

cigarette smoking and tobacco chewing are found to aggravate the

above said problems.

Chronic alcoholism is one of the major reasons for hepatic

damage which result in fatty liver, cirrhosis and hepatomegaly. On the

another side natural products, environmental pollutants, heavy metals,


12

dietary constituents and exposure of the individual to various

hepatotoxic substances due to occupational responsibilities also

produce hepatotoxicity (Singh et al., 2011). Hence the liver is not only

expected to perform functions, but also play a role in protecting itself

against the deleterious effects of medicines and harmful chemicals.

2.3. Drugs and toxin induced hepatotoxicity

Hepatotoxicity caused by deleterious effect of drugs and toxic

chemicals has been linked to the occurrence of oxidative stress which

alters the redox homeostasis of the liver (Fig 1). This will result in the

generation of ROS and depletion of antioxidant enzymes SOD, CAT

GSH,VIT C&E etc.,

Fig 1: The redox homeostasis of the liver


13

Oxidative stress has also been implicated in the pathogenesis of cellular

damage caused by a number of drugs/toxic agents including arsenic,

diclofenac, carbon tetrachloride, alcohol etc., (Deavall et al., 2012).

Drugs and toxin can affect the liver in any one of the following ways.

1. Predictable and dose related or intrinsic hepatotoxicity

Two types of intrinsic Hepatotoxicity.

a. Direct hepatotoxins: a direct cytotoxic effect refers to the direct

development of liver cell injury at the sub cellular level, affecting various

organelles, like endoplasmic reticulum, with subsequent steatosis,

necrosis or both.

b. Indirect hepatotoxins: the cell injury is caused by alterations of

specific metabolic pathways or selective effects on cell membrane

receptors, DNA and RNA molecules either within the nuclei or in the

cytosol.

2. Unpredictable and idiosyncratic

Idiosyncratic hepatotoxins: An idiosyncratic reaction is due to either

hypersensitivity or genetically determined differences in drug

metabolism. Other clinical classifications include hepatocellular,

cholestatic or mixed liver enzyme patterns, histological criteria, acute

vs. chronic, onset or severity (Tsui, 2003; Zimmerman, 2004; Tierney et

al., 2006).


14

Table 1: Drug and toxin induced hepatotoxicity:

Category of

agent

Mechanism Histological

lesion

Examples

1.Intrinsic toxicity

a) Direct

Membrane injury,

destruction of

structural basis of

cell metabolism.

Necrosis/

steatosis

CCl 4,

CHCl3

phosphorus

b) Indirect

I. cytotoxic

Interference with

specific metabolic

pathways leads to

structural injury

Steatosis/

necrosis

Ethanol,

tetracycline,

thioacetamide,

paracetomol.

II. cholestatic Interference with

hepatic excretory

pathways leads to

cholestasis.

Bile cysts,

bile duct

injury.

Rifampicin,

steroids.

II idiosyncrasy

a)hypersensitivity

b) metabolic

abnormality

Drug allergy

Production of

hepatotoxic

metabolites

Necrosis/

cholestasis

Necrosis/

cholestasis

Halothane,

sulphonamides

Isoniazid,

Rifampicin,

pyrazinamide.


15

2.4. Drug induced liver injury (DILI)

DILI may result not only from the direct toxicity of the parent drug

compound but also from the reactive / toxic metabolite or from an

immunologically mediated response affecting the hepatocytes

(Saukkonen, et al., 2006; Deng et al., 2009).

DILI is responsible for 5% of all hospital admissions and 50% of

all acute liver failure cases. More than 75% are due to idiosyncratic drug

reactions result in liver transplantation or death (Ostapowicz et al.,

2002).

The human body identifies almost all drugs (xenobiotics) as

foreign substances and subjects them to various chemical processes to

make them suitable for elimination. Mostly all drugs are liphophilic which

rendered hydrophilic in the hepatocytes to yield water soluble products

by biochemical process (biotransformation) which can be excreted in

urine/ bile (Tostmann et al., 2008). Biotransformation involves phase I &

II reaction which is mediated by cyt p 450 systems located in the

endoplasmic reticulum of the liver. The Phase I reactions includes

oxidation, reduction hydroxylation etc., produces toxic intermediates

which are rendered non toxic by phase II conjugation reactions which

lead to the formation of water soluble metabolite which, can be excreted

easily.


16

Another metabolic pathway for detoxifying many compounds in

phase II involves glutathione which covalently bind to toxic

intermediates by glutathione S transferase. However this phase can

lead to the formation of reactive metabolite (Singh et al., 2011). In the

liver these chemically reactive metabolites have the ability to

interconnect with cellular macromolecules such as proteins, lipids and

nucleic acids, leading to protein dysfunction, lipid peroxidation, DNA

damage and oxidative liver damage.

These damaging hepatocytes activate innate immune system like

kupffer cells and produce proinflammatory mediators like tumor necrosis

factor –α (TNF α); interferon (IFN) and interleukin (IL) produced liver

injury. However, innate immune cells are also the main source of IL-10,

IL-6 and certain prostaglandins, all of which have been shown to play a

hepatoprotective role. Thus, it is the delicate balance of inflammatory

and hepatoprotective mediators produced after activation of the innate

immune system (Michael et al., 2006). Many agents directly act on

mitochondria and inhibit electron transport and fatty acid oxidation

which leads to apoptosis (programmed cell death) or necrosis (Singh

Robin et al., 2012; Patel et al., 1998).

In our study ethanol and antitubercular drug induced

hepatotoxicity mainly due to oxidative stress caused by the reactive

metabolite and ROS.


17

2.5. Ethanol

Alcohol (ethanol), has occupied an important place in the history

of humankind for around 8000 years. Like other sedative-hypnotic

drugs, alcohol in low to moderate amounts will relieve anxiety and

induces sleep. It also fosters a feeling of well-being or even euphoria.

The majority of this drinking population is able to enjoy the pleasurable

effects of alcohol without allowing their alcohol consumption to become

a health risk. People who continue to drink alcohol in spite of adverse

medical or social consequences suffer from alcoholism, which is a

complex disorder that appears to have genetic as well as environmental

determinants.

2.5.1. Structure

Fig 2: Structure of ethanol


18

2.5.2. Pharmacokinetics

Ethanol is a small water-soluble molecule absorbed rapidly from

the GIT. The presence of food specially milk delays absorption of

ethanol. The volume of distribution for ethanol approximates total body

water (0.5-0.7 L/kg). It crosses the BBB and placental barrier. About

95% of alcohol consumed is oxidized in the liver; much of the remainder

is excreted through the lungs, sweat and in the urine. The ethanol is

metabolised first to acetaldehyde and then to acetic acid. In the liver two

major pathways involves in alcohol metabolism.

Fig 3: Metabolic pathway of Ethanol

2.5.2.1. Alcohol Dehydrogenase Pathway

It is the primary pathway of alcohol metabolism which involves

the cytosolic enzyme- alcohol dehydrogenase (ADH), which catalyzes

the conversion of alcohol to acetaldehyde (Figure 3). ADH is mainly


19

located in the liver, but trace amounts are also found in major organ like

brain. The genetic polymorphisms of ADH in Asian populations

increased the risk of alcoholism.

During metabolism the ethanol is oxidised into acetaldehyde by

ADH. In this oxidative pathway hydrogen ion is transferred from alcohol

to the cofactor nicotinamide adenine dinucleotide (NAD+) to form

NADH. As a net result, alcohol oxidation generates the highly reduced

cytosolic environment in the liver, chiefly as NADH. Hence it leaves the

hepatocytes from the deleterious effects of intermediate products like

acetaldehyde and ROS, which are formed during ethanol metabolism.

The excess NADH production appears to induce metabolic disorders

that accompany chronic alcoholism.

2.5.2.2. Microsomal Ethanol Oxidizing System (MEOS):

This enzyme system, also known as the mixed function oxidase

system, uses NADPH as a cofactor for ethanol metabolism which

consists of cytochrome P450 1A2, 2E1, and 3A4. These enzymes

contributed in the oxidation of ethanol which is present mainly in the

microsomes, endoplasmic reticulum and vesicles of the cell.

As the concentration of ethanol increases above 100 mg/dL the

ADH system get saturated owing to depletion of NAD+. In such situation

there is increased contribution from the MEOS system, which does not

rely on NAD+ as a cofactor. As a result of chronic alcohol consumption


20

there is an induction of MEOS system which increases not only the

ethanol metabolism but also increases the clearance of other drugs

(steroids, paracetomol etc.,) eliminated by the cytochrome P450s. This

will result in the generation of the toxic byproducts of cytochrome P450

reactions (toxins, free radicals, H2O2).

2.5.2.3. Metabolism of Acetaldehyde to Acetate

Around 75-80% of the acetaldehyde formed from alcohol is

oxidised to acetate in the liver in a reaction catalyzed by aldehyde

dehydrogenase (ALDH). The product of this reaction is acetate (Figure

3), which can be further metabolized to CO2 and water, or used to form

acetyl-CoA. Chronic alcoholism results in the increased risk of severe

liver disease, mainly due to the deleterious effects of acetaldehyde

(Deck DH et al., 2012; Sharma and Sharma, 2009).

2.5.3. Mechanism of Action of Ethanol

Ethanol affects a membrane proteins that participate in signalling

pathways, including neurotransmitter receptors for amines, amino acids;

enzymes such as Na+ K+ ATPase, adenylyl cyclase etc., Ethanol

enhances the action of GABA (the main inhibitory neurotransmitters in

the CNS) at GABAA receptor (GABA mimetic action). Ethanol inhibits

the ability of glutamate to open the cation channel associated with the N

-methyl-D-aspartate (NMDA) receptors and inhibit the opening of ca 2+

channel linked to NMDA receptor. The NMDA receptor is implicated in


21

many aspects of cognitive function, including learning and memory.

High level of alcohol inhibits the NMDA receptor activation will leads to

Blackouts periods of memory loss.

2.5.4. Uses of Ethanol

As an antiseptic

As an astringent used to harden the skin to prevent bed sores.

To treat methanol poisoning.

2.5.5. Adverse effects of Ethanol

The acute effects of ethanol on CNS comprise sedation, loss of

inhibition, impaired judgements and motor functions. Higher levels of

alcohol 500mg/dL are usually lethal. Chronic ethanol consumption will

develop tolerance, physical and psychological dependence.

Neurological deficits occur in chronic drinkers which lead to ataxia,

dementia and peripheral neuropathies. Consumption of alcohol during

pregnancy cause foetal alcohol syndrome. Long term excessive

consumption of alcohol causes fatty liver which progress to hepatitis,

necrosis, fibrosis and liver failure (Sharma and Sharma, 2009; Deck DH

et al., 2012).

2.5.6. Mechanism of ethanol induced hepatotoxicity

Ethanol induced hepatotoxicity is mainly due to oxidative stress

mediated by the proximal metabolite acetaldehyde. Ethanol or its


22

metabolite alter the peroxidative balance of the liver cell by acting as

prooxidant and decreased the antioxidant level. This will result in the

excess generation of free radicals (ROS) that causes damage to the

cellular proteins, lipids and DNA (Wu et al., 2006).

During ethanol metabolism the cyt p 450 catalytic cycle use

NADPH to reduce O 2 leading to the production of hydrogen peroxide

and superoxide anion radical. Cellular system is protected from ROS

induced cell injuries by various antioxidant defense systems in our

body.

Fig 4: Oxidative pathways of Ethanol metabolism

Chronic exposure to ethanol involves CYP 450 2E1 which will

induce the generation of ROS in the cellular system. This ROS

https://www.ncbi.nlm.nih.gov/pubmed/?term=Wu%20D%5BAuthor%5D&cauthor=true&cauthor_uid=16958666


23

overwhelm the antioxidant defense mechanism which results in

hepatocyte injury. Alcohol has been shown to deplete GSH levels in

mitochondria, which are normally characterized by high levels of GSH

needed to eliminate ROS generated during activity of the respiratory

chain. The selective depletion of the mitochondrial GSH pool is the

consequence of a defect in GSH transport from the cytosol to the

mitochondrial matrix. In mitochondrial GSH occur predominantly in the

centrilobular hepatocytes, where most of the liver injury originates and

precede the development of mitochondrial dysfunction and lipid

peroxidation (Sid et al., 2013).

2.6. Tuberculosis

Tuberculosis (TB) is chronic granulomatous diseases caused by

the mycobacterium tuberculi and remains one of the major global health

problems in developing countries (Glickman et al., 2006).

The incidence of TB was estimated that, around 10.4 million

people were fallen ill with TB in the world. In India the incidence of TB

was around 23% of world TB cases (WHO 2015). TB along with HIV

infection increases the risk of TB to 5-50 folds (Corbett EL et al., 2003).

2.6.1. Treatment regimen for TB

Single drug therapy may not be useful in the TB treatment due to

the occurrence of resistance which results in the treatment failure.

Hence combination therapy will be used in the treatment of TB (Forget


24

et al., 2006). The combination therapy consists of Isoniazid and

Rifampicin for 9 months cures about 95-98% of TB cases. Including

pyrazinamide to the above combination for the first 2 months will

reduced the total duration of treatment to 6 months without affecting the

efficacy.

2.6.2. DOTS- Treatment regimen (Directly Observed Treatment-

Short Course)

The new TB cases should be treated for the 6 months of therapy

consists of 2 months of intensive phase with Isoniazid, Rifampicin,

Pyrazinamide and Ethambutol and followed by 4 moths of continuation

phase with Isoniazid and Rifampicin. Control and treatment of TB in

India is covered under the Revised National Tuberculosis Control

Programme (RNTCP).

2.6.3. Antitubercular drug induced hepatotoxicity

Even though drugs are available for curing TB, many adverse

effects attributable to anti TB drug therapy. Although a vast majority of

patients tolerate the drugs, some develop adverse effects; among this

hepatotoxicity is the major one. This hepatotoxicity leads to treatment

interruption or modifies the treatment regimen during the course of

therapy. This challenges not only the physician, but also a challenge for

drug regulatory agencies (Sudhir Kumar et al., 2014). Further it

decreases the success rate of the treatment and brings the negative


25

impact on TB control. Therefore anti TB (ATT) drug induced liver

damage is an increasing concern in the treatment of TB.

2.6.4. Incidence of AntiTB drug induced Hepatotoxicity

Overall Hepatotoxicity attributed to AntiTB drugs has been

reported in 5-28% of patients. Huang et al. (2002) reported that the

incidence was 24.7 % in Taiwanese population. In Nepalese population,

the incidence of Hepatotoxicity was 8%. In Turkey it was 8.1%, in

Germany it was 11%. In Indian population the incidence for AntiTB DILI

was 14.3%. The variation in anti TB DILI may be due to the difference in

the patient factors, regimen used and the diagnostic criteria (Sudhir

Kumar et al., 2014; Tostmann et al., 2008; Saukkonen et al., 2006).

2.6.5. Risk factors

It has been observed in several studies that patients with pre-

existing hepatic diseases due to chronic viral infection with Hepatitis B,

Hepatitis C, HIV, HBV infection, Alcoholics, the elderly, and the

malnourished are at a higher risk of developing ATT induced

hepatotoxicity (Anand et al., 2006). Recent studies show that

polymorphism of N-acetyl transferase 2 (NAT2) genes, glutathione-s-

transferase (GST) and Null mutation at GSTM1 gene are the major

susceptibility risk factors for ATT induced hepatitis (Hussain et al., 2003;

Roy et al., 2001). The time required for the metabolites to reach

hepatotoxic levels is much earlier with Isoniazid plus Rifampicin


26

treatment than Isoniazid alone and this has shown to be synergistic

rather than additive. Slow acetylators of NAT2 develop more severe

hepatotoxicity than rapid acetylators making it a significant risk factor

(Hussain et al., 2003).

2.6.6. Antitubercular drugs

2.6.6.1. Isoniazid

Isoniazid also known as isonicotinylhydrazine (INH) is an

excellent first line bactericidal antitubercular drug. It is used for actively

growing tubercle bacilli. For active tuberculosis it is often used together

with rifampicin and pyrazinamide.

2.6.6.2. Structure

Chemically isoniazid is Isonicotinic acid hydrazide. Its molecular

formula is C6H7N30. The structure of isoniazid comprises a pyridine ring

and a hydrazine group. The MIC of isoniazid in the treatment of TB is

0.02-0.20 µg/ml. structurally similar to pyridoxine.

Fig 5: Chemical structure of Isoniazid

https://en.wikipedia.org/wiki/Rifampicin

https://en.wikipedia.org/wiki/Pyrazinamide


27

2.6.6.3. Properties

The molecular weight of INH is 137.14gm, and the melting point

is 170-173°C. It is a colourless, odourless, white crystalline powder and

freely soluble in water.

2.6.6.4. Mechanism of action

INH is a prodrug and converted into an active metabolite by the

M.tuberculosis catalase – peroxidise enzyme KatG. The activated drug

generates the organic and oxygen derived free radicals (superoxide,

hydrogen peroxide and peroxynitrite) that will inhibit the synthesis of

mycolic acid which are unique fatty acid component of mycobacterium

cell wall. The sensitive bacteria convert INH into an active metabolite

that interacts with InhA and KasA gene products involved in mycolic

acid synthesis (Deck et al., 2012).

2.6.6.5. Pharmacokinetics:

INH completely absorbed from the gastro intestinal tract and

penetrates all body tissues, tubercular cavities, placenta and meninges.

Metabolism takes place in liver by N acetylation by NAT2 enzyme. The

acetylated metabolites are excreted via urine. The genetic variation

influence the rate of INH acetylation: they are slow and fast acetylators.


28

2.6.6.6. Uses

The typical dosage of 5mg/kg/day, adult dose 300mg/day can be

given in Tuberculosis. A regimen with Isoniazid 15 mg/kg dose or

900mg twice weekly can be used along with Rifampicin for 9 months.

For latent TB Isoniazid alone can also be given at the dosage of

300mg/day (5mg/kg/day) or 900mg twice weekly for 9 months.

2.6.6.7. Adverse effects

Hepatitis is the most common adverse effect of Isoniazid and can

be fatal if the drug is not stopped promptly. The occurrence of hepatitis

depends on age. The age between 21-35 years the incidence was

around 0.3%, between 36-50 was around 1.2%, 50 and above it was

2.3%. The risk of hepatitis will be more during pregnancy and

postpartum period and also in alcohol dependent individual. Histological

reports shows that isoniazid cause hepatocellular damage and necrosis.

Peripheral neuritis and neurological manifestations like paresthesias,

mental disturbances and rarely convulsion are the most important dose

dependent adverse effects. Other miscellaneous side effects include

pyridoxine deficiency anaemia, tinnitus and gastrointestinal discomfort.

2.6.7. Rifampin (Rifampicin -R)

It is a semi synthetic derivative of Rifamycin B. It is bactericidal

drug obtained from Streptomyces mediterranei. It act against M.


29

tuberculosis and other gram positive and negative bacteria like Staph.

Aureus, N. meningitides, H. Influenza, E. Coli etc., Against M.

tuberculosis it is as efficacious as INH and better than all other drugs. It

acts best on slowly and intermittently dividing organism. MIC of

Rifampin for M. tuberculosis is 0.05-0.50 μg/mL.

2.6.7.1. Structure

Chemically Rifampicin is 3-[((4-methyl-1-piperazinyl) imino] methyl)]

rifamycin. Its chemical structure is depicted in fig (6).

Fig 6: Chemical structure of Rifampicin

2.6.7.2. Properties

Molecular formula is C43H58N4012 and its Molecular weight is

822.96g. It is powder in nature, red to orange in colour and odourless.

Melting point is 138 to 188º C. Suspension in water has pH 4.5 to 6.5.

Rifampicin is Soluble in water and chloroform.


30


Rifampin inhibits the RNA synthesis by binding to the subunit of

DNA dependent RNA polymerase. This will prevents the bacillus from

synthesizing messenger RNA and protein, causing cell death.

2.6.7.4. Pharmacokinetics

Well absorbed orally when taken on empty stomach, widely

distributed in the body. Highly plasma protein bound, penetrate cavities

caseous masses, Placenta and meninges. It is metabolized in liver to an

active deacetylated metabolite which is excreted mainly in bile and

some in urine also. Rifampicin is a potent enzyme inducer. The t1/2 is

2-5 hours.

2.6.7.5. Uses

For active tuberculosis patients, Rifampicin 600mg/day orally

(10mg/kg/day) can be given in combination with Isoniazid and other

antitubercular drugs. Rifampicin at a dose of 600mg daily or twice

weekly for 6 months effective in combination with other drugs used in

mycobacterial infections and in leprosy. Rifampicin 600mg daily for 4

months used as an alternative to INH for latent TB who are unable to

take isoniazid, leprosy, prophylaxis of Meningococcal and H influenza

meningitis and carrier state. Combination of doxycyline and Rifampin is

the first line therapy of brucellosis.


31

2.6.7.6. Adverse effects:

ADR is similar to that of INH. Hepatitis is a major adverse effect

generally occurs in patients with pre existing liver disease and is dose

related. Minor reactions are cutaneous syndrome, flu syndrome, and

abdominal syndrome. Urine and secretions may become orange red but

this is harmless.

2.6.8. Pyrazinamide (Z)

Pyrazinamide is a bactericidal drug and relative of nicotinamide. The

chemical structure of pyrazinamide is depicted in fig 7.

2.6.8.1. Properties

It is stable compound soluble in water. It inhibits the tubercle

bacilli at the concentration of 20 mcg/ mL.

Fig 7: Chemical structure of Pyrazinamide


32


During metabolism Pyrazinamide is converted into pyrazinoic acid

by the mycobacterial pyrazinamidase. Pyrazinoic acid accumulated in

the acidic medium and inhibits the mycolic acid synthesis and disrupts

mycobacterial cell membrane metabolism and transport functions.

2.6.8.3. Pharmacokinetics

The absorption takes place in the gastrointestinal tract and

distributed widely in the body including inflamed meninges. Parent drug

is metabolised in liver but the active metabolite excreted in urine. A

dose of 40–50 mg/kg can be given in twice or thrice weekly treatment

regimens. Half life is about 8-11hours.

2.6.8.4. Uses

In short course TB (6 month) regimens it is usually given in

conjugation with Isoniazid and Rifampicin as a sterilizing agent active

against residual intracellular organism which may cause relapse.

2.6.8.5. Adverse effects

Hepatotoxicity (1-5%) is the major adverse effect of

pyrazinamide. Other side effect includes nausea, vomiting, drug fever

and hyperuricemia. Hyperuricaemia may result in acute gouty arthritis


33

2.6.9. Mechanism of AntiTB drug induced hepatotoxicity

Hepatotoxicity is a serious complication of anti TB therapy and it

is mainly due to the combination of multiple drug regimens. It

encompasses a wide spectrum of liver injury ranging from

asymptomatic elevation of liver enzymes to acute liver failure, which

often leading to death or liver transplantation (Kumar et al., 2010). Most

cases of DILI associated with ATT are idiosyncratic in nature, it is

mainly due to the nature of the host and not about the drug which

responsible for liver injury. On the otherhand ATT induced liver injury is

through metabolic idiosyncrasy due to the metabolites released during

the metabolic pathway. This may be facilitated by genetic factors or

polymorphism in drug metabolizing enzymes (genetic polymorphism)

(Lammert et al., 2010). Research evidence suggested that it is

mediated through toxic metabolite which induces oxidative stress

damage to the hepatocytes (Ali, 2012).

2.6.9.1. Hepatotoxicity induced by Isoniazid

Among the first line antitubercular drugs, Isoniazid is mainly

attributed to most cases of drug induced liver damage. In the metabolic

pathway (fig 8) Isoniazid is acetylated to acetylisoniazid via hepatic

enzyme NAT2 and it is further hydrolysis to acetylhydrazine and

isonicotinic acid. The acetylhydrazine is either acetylated to

diacetylhydrazine or hydrolysed to hydrazine or oxidized by CYP2E1 to


34

form hepatotoxic intermediates, which destroy hepatocytes resulting in

injury (Huang et al., (2003). The other metabolic route of INH leads to

the production of toxic metabolite hydrazine by the process of direct

hydrolysis. NAT2 is also responsible for converting hydrazine to

acetylhydrazine and further diacetylhydrazine, a nontoxic component

(Sudhir kumar et al., 2014). Also, INH is a potent enzyme inhibitor of

many forms of cytochrome P450 enzymes including CYP1A2, 2A6,

2C19 and 3A4. Among these cytochromes, CYP1A2 play a key role in

the detoxification of hydrazine. Therefore, INH is the most likely to

cause its own toxicity, possibly by the inhibition of these enzymes (Wen

et al., 2002; Desta et al., 2001; Jyothi bhasini et al., 2012).

GST is an important phase II detoxification enzyme, plays a

defensive role against hepatotoxic products that are generated from

CYP2E1, by conjugating glutathione with toxic metabolites. This

conjugation reduces the toxic effect and is eliminated from the body

(Hayes et al., 2005). The diminish level of plasma glutathione due to

toxic metabolite in AntiTB therapy will leads to oxidative stress which

leads to hepatotoxicity.

Isoniazid induced hepatotoxicity is mainly due to the induction of

oxidative stress by the toxic metabolite hydrazine. Research evidence

stated that Isoniazid induce peroxidative damage which leads to protein

damage, inflammation and apoptosis. This is evidence by significant

elevation of serum liver marker enzymes (AST, ALT, AST), Lipid


35

peroxidation, proinflammatory cytokines (NF-κB, TNF-α) and

subsequent decrease in the level of serum albumin, protein, liver

glutathione and antioxidant enzymes (Ayman et al., 2014).

Fig 8: Metabolic pathway of Isoniazid

2.6.9.2. Hepatotoxicity induced by Rifampicin

Rifampicin is associated with hepatocellular pattern of DILI and

more often it potentiates the hepatotoxicity of other anti-TB drugs

(Ramappa and Aithal, 2013). Rifampicin is an effective inducer of

CYP2E1 enzymes and increase INH induced toxicity by increasing the

formation of its toxic metabolite hydrazine, resulting in elevated liver


36

marker enzymes and altered the structural integrity of liver (Ramappa

and Aithal, 2013). Rifampicin also increases the metabolism of INH to

isonicotinic acid, which is also a hepatotoxic product. The plasma half

life of acetyl hydrazine (INH metabolite) is shortened by RIF and acetyl

hydrazine is quickly converted to its active metabolites by increasing the

oxidative elimination rate of acetyl hydrazine, which is related to the

higher occurrence of liver necrosis (Tostmann et al., 2008). Therefore,

the activity of Rifampicin has been attributed to the enzyme inducing

property thereby it increase the incidence of anti-TB-DIH.

2.6.9.3. Hepatotoxicity induced by Pyrazinamide

Pyrazinamide is usually given in combination with Isoniazid and

Rifampicin in the treatment of TB. Pyrazinamide is metabolized to

pyrazinoic acid (PA) by hepatic Microsomal amidase and further

oxidized to 5- hydroxyl pyrazinoic acid (5-OH-PA) by xanthine oxidase.

These two reactive metabolites of Pyrazinamide are considered to have

hepatotoxic potential. However, 5- OH-PA is the more toxic metabolite

as compared to PA, responsible for Pyrazinamide-induced

hepatotoxicity (Shih et al., 2013). The combination of Pyrazinamide with

the other antitubercular drug like Isoniazid and rifampicin will increase

incidence of hepatotoxicity (Jyothi bhasini et al., 2012).

Numerous studies stated that Isoniazid, Rifampicin and

Pyrazinamide have been reported to induce significant hepatotoxicity by


37

inducing oxidative stress mediated cell injury which will leads to

inflammation and apoptosis in the hepatocytes (Tasduq et al., 2005;

Steele et al., 1991). Ayman et al.(2014) and Sankar et al.(2015) in their

studies shown that anti TB drug induced liver damage is mainly due to

oxidative stress caused by the parent drug and active metabolites. In

the liver, the hepatotoxic metabolite of AntiTB drugs enhances the level

of liver marker enzymes (AST, ALT, ALP and LDH).

The oxidative stress induces Lipid peroxidation of membrane and

subsequently depletes the glutathione and other antioxidants (SOD,

CAT, and GST). These altered levels of antioxidant enzymes influence

the liver tissue to oxidative damage which paves the way for apoptosis

and inflammation which is indicated by the upregulated Bax, NF-κB,

TNF-α , caspase 3 and caspase 9 and down regulated the Bcl2 gene

expression (Ayman et al., 2014; Sankar et al., 2015). Wang et al. (2011)

and Saraswathy et al. (1998) demonstrated that the Antitubercular drug

altered the lipid profile which is evidenced by increased level of LDL,

VLDL, and FFA and decreased level of HDL. Saraswathy et al. (1998)

in their study stated that HRZ decreased the level of membrane bound

ATPase enzymes like Na+ K+, Ca+ and Mg+ ATPase.

2.7. Hepatoprotective compounds

The use of medicinal plants in treating hepatic illnesses has been

reported since ancestral times. In the case of hepatic diseases, several


38

species such as Silybum marianum, Curcuma longa, Phyllanthus niruri,

Allium sativum, Hibiscus vitifolius, Phyllanthus polyphyllus, Ocimum

sanctum and Panus giganteus (Bark) have been shown to ameliorate

hepatic lesions.

2.7.1. Current antioxidant therapy for liver disease in clinical trials

In addition to the natural plants, many single compounds are

investigated for their antioxidant role in eliminating oxidative stress. The

compounds include l-theanine, Vitamin E, N-acetyl cysteine, Raxofelast

and betaine. L-theanine, an amino acid in green tea, has been proven

the ability to prevent alcoholic hepatic damage. The compounds like

silymarin, N-acetyl cysteine are used as a drug or supplement for non

alcoholic fatty liver disease or non alcoholic steatohepatitis or alcoholic

liver disease in phase IV clinical trial. In phase III trial Quercetin and

reservatrol have been studied as an antioxidant in food for liver disease.

Vitamins especially Vit E used as a dietary antioxidant supplement for

liver disease in phase II and phase III clinical trial.

Hence natural sources and bioactive compounds isolated from

plants and endogenous antioxidant have shown strong antioxidant

effect and hepatoprotective effect should be studied in trials (Li et al.,

2015).


39

2.7.2 .Flavonoids

Flavonoids are a dietary component, consist of a large number of

polyphenolic compounds have health-promoting properties due to their

high antioxidant capacity. Several flavonoids such as Catechin,

Silymarin, Apigenin, Quercetin, Naringenin, Rutin etc, are reported to

have hepatoprotective activities.

2.7.3. Silymarin

Silymarin is derived from Silybum marianum, which is commonly

known as Milk thistle. The plant contains at least seven flavolignans and

the flavonoid taxifolin. The most important flavolignans present in it

include silybin, silydianin, and silychristine. Silymarin has been used for

many years as a complementary alternative medicine used in treatment

of hepatic diseases.

In Clinical trials silymarin exerts hepatoprotective effects in acute

viral hepatitis, poisonous A phalloides and toxic effects produced by

alcohol-related liver disease, including cirrhosis, at daily doses ranging

from 280 to 800mg. Hepatoprotection has been documented by

improvement in liver function tests; moreover, treatment with silymarin

was associated with an increase in survival in a placebo-controlled

clinical trial in alcoholic liver disease (Fraschini et al., 2002).


40

In previous studies, Silymarin shows an imminent

hepatoprotective and antioxidant activity against free radicals produced

during the metabolism of ethanol (Et-OH), acetaminophen

(Paracetamol), or carbon tetrachloride (Vargas-Mendoza et al., 2014).

Silymarin inhibit the depletion of two main detoxicification

enzymes like GSH and superoxide dismutase (SOD), by enhancing

GSH, SOD level thereby it reduces the free radical burden.

Subsequently prevent the cell contents, including DNA, RNA and other

cellular components from oxidative damage. It has a regulatory

mechanism on cellular and mitochondrial membrane permeability in

association with enhanced membrane stability against xenobiotics

injury. It can prevent the absorption of toxins into the hepatocytes by

occupying the binding sites as well as inhibiting many transport proteins

at the membrane. It donate electrons to stabilize the free radicals and

ROS and also enhance glutathione thereby it prevent lipid peroxidation.

It prevent the ROS induced IL-10, TNF α, NFκB and reduces apoptosis

and inflammation (Vargas-Mendoza et al., 2014).

These actions, together with the antiperoxidative property, make

silymarin a suitable candidate for the treatment of iatrogenic and toxic

liver diseases (Fraschini et al., 2002).


41

2.8. Hesperidin

Hesperidin’s is a bioflavonoid which was derived from the word

“hesperidium” which refers to fruit produced by citrus trees. Hesperidin

exerts wide range of benefits in a variety of neuronal conditions from

anxiety and depression to Alzheimer's and Parkinson's diseases.

Additional benefits that come from hesperidin consumption include radio

and UV-protection, anti-diabetic, anti-allergic, anti-osteoporotic, and

anti-cancerous effects.

2.8.1 Sources

Lemons, limes, oranges and tangerines the main source of

hesperidin. Citrus fruit peels contain highest concentration of

hesperidin.

2.8.2. Structure

Chemical structure of Hesperidin depicted in fig: 9

Fig 9: Chemical structure of Hesperidin


42


Hesperidin is a hesperitin-7-rutinoside which is bound to Rutin.

Absorption not takes place in intestine. Hesperidin is metabolised by

fermentation in colon to produce Hesperitin, get absorbed in the colon

then it reaches the circulation. Plasma peak concentration of the

Hesperetin was up to 7-7.4 hours. The metabolism takes place in the

liver mainly through glucuronidation and sulfation. The circulating form

of Hesperetin metabolites were found in plasma was glucuronides

(87%) and sulfoglucuronides (13%) and the metabolites are excreted in

urine.

2.8.3.1. Acute toxicity study

The lethal dose of Hesperidin was more than 2000mg/kg (Papiya

Bigoniya and Kailash singh, 2014).

2.8.4. Pharmacological Effects

Hesperidin plays a protective role against fungal and other

microbial infections in plants. Apart from its physiological antimicrobial

activity, decades of research revealed its many therapeutic applications

in prevention as well as in the treatment of many human disorders. Most

of these benefits are attributed to its antioxidant properties. Hesperidin

is effectively used as a supplemental agent in treatment programs and

protocols of complementary settings.


43

2.8.4.1. Hesperidin in prevention of cardiovascular diseases

Hesperidin supplementation has been recommended for vascular

disorders like fragility and permeability. Studies show that Hesperidin

inhibits inflammatory processes in the ischaemia-induced

hyperpermeability, characteristic for venous stasis. HDN at 200mg/kg

oral administration in rat shows antihypertensive and diuretic effect

(Vesna Kunti et al., 2014). In randomized crossover study in healthy

volunteers’ shows that it decreases the systolic blood pressure and

postprandially increases endothelium-dependent microvascular

reactivity by promote NO production resulting in vasodilatation

(Christine Morand et al., 2011). Research evidence shows that

consumption of citrus fruits reduced the risk of coronary heart disease

and stroke. In case of myocardial infarction after cardiac

ischemia/reperfusion injury HDN treatment significantly reduced the

percentage of infarction, partially by antioxidant and anti-inflammatory

activity and also by blocking apoptosis (cell death) (Agrawal et al.,

2014). Hesperidin notably augmented anti-apoptotic (Bcl-2) and

decreased pro-apoptotic (Bax) protein expression thereby preventing

loss of contractile cells (Agrawal et al., 2009). Hesperidin 200mg/kg

shows a protective effect against doxorubicin induced cardiotoxicity

(Ihab T. Abdel-Raheem et al., 2009).


44

2.8.4.2. Antilipidemic effect of hesperidin

It also acts as an inhibitor of two main enzymes in cholesterol

metabolism includes HMGCoA reductase and acetyl CoA

acetyltransferase (ACAT) that regulate LDL and HDL levels. Thus, by

inhibiting the activity of these two enzymes hesperidin decreases the

LDL and increases the HDL. A study on rats fed a high cholesterol diet

supplemented with flavonoids (hesperidin and naringin) demonstrated

inhibition of liver cholesterol biosynthesis (28.3 %) and the esterification

of hepatic cholesterol (23.7 %) by hesperidin. A human study

demonstrated that there was a marked reduction in the triglyceride level

after 4 weeks of hesperidin (G-Hesperidin, 500 mg/day)

supplementation (Kim et al., 2003; Miwa et al., 2005).

2.8.4.3. Effect on Central Nervous system

Hesperidin has the ability to cross blood brain barrier and hence

used in number of neurological disorder like Parkinson’s disease,

Alzheimer’s disease, Anxiety, Epilepsy and Multiple sclerosis. The

neuroprotective effect of hesperidin has mainly attributed to its anti-

inflammatory and antioxidant properties as seen by an increased level

of antioxidant enzymes, decreased level of oxidative stress,

inflammatory markers, and pro-apoptotic proteins in neurons (Vesna

Kunti et al., 2014). It also shows anxiolytic and antidepressant effect

(Filho CB et al., 2013). Hesperidin reduces pain sensitivity which is


45

mediated through µ-opioid receptor like morphine (Loscalzo et

al., 2011).

2.8.4.4. Hesperidin as a radioprotector

Hesperidin shows a protective and antioxidant effect against

-irradiation and X ray radiation induced cellular damage in the liver by

diminished the level of liver marker enzymes and lipid peroxidation by

simultaneously enhances the level of antioxidant enzymes (Pradeep et

al., 2008; Kalpana et al., 2011).

2.8.4.5. Effect on Respiratory System

A study in mouse model shows that hesperidin has a protective

effect against allergic asthma (Kim et al., 2011). Hesperidin inhibits the

synthesis and release of histamine from mast cells and also increases

the vascular endothelial growth factor (VEGF & Ig E). It also shows

protective effective against allergic rhinitis and allergic asthma by

suppressing the inflammation in airway (Kobayashi, 2006).

2.8.4.6. Effect on cancer

Hesperidin induces cell growth arrest apoptosis in a large variety

of cells including colon, pancreatic and lung cancer (Park et al., 2008;

Patil et al., 2009; Al-Jasabi and Abdullah, 2013; Kamaraj et al., 2010).

Some studies have reported that hesperidin significantly induced

apoptosis by modulating BAX/Bcl-2 ratio together with enhanced


46

cytochrome c release and caspase activations in colon cancer cells

(Saiprasad et al., 2014) and mediates apoptosis through extrinsic

pathway in cervical cancer cells (Bartoszewski et al., 2014).

2.8.4.7. Effect on Oxidative stress

Free radicals are generated in the body by various

physiochemical reactions. The excess formation of free radicals leads to

oxidative stress which produces damage to the cell structure and

function. Oxidative stress triggers inflammation which further triggers

the various life threatening disease ranging from cardiovascular and

neurodegenerative disorders to diabetes and cancer.

Hesperidin scavenges the reactive oxygen species and also has

the ability to stimulate the endogenous antioxidant defense mechanism.

In recent years, studies have focused mainly on the protective

properties of HDN against various oxidants, chemicals and toxins that

cause damage to tissues via oxidative stress or other mechanisms

(Kalpana et al., 2009; Ahmad et al., 2012; Kamaraj et al., 2010;

Kawaguchi et al., 2004; Kim et al., 2011).

Kalpana et al. (2009) studied the antioxidant effects of HDN

against H2O2 induced membrane damage in red blood cells (RBCs).

They found that HDN showed significant radical scavenging activity and

prevented H2O2 induced oxidative damage on the cellular membranes of

RBCs. HDN exert their antioxidant properties via two ways: direct


47

radical scavenging and augmenting cellular antioxidant defense.

Numerous studies showed that HDN neutralized ROS, including

superoxide anions, hydroxyl radicals, nitric oxide radicals etc., (Garg et

al., 2001; Hamideh Parhiz et al., 2015). This direct radical scavenging

activity of HDN plays an important role in their protection of DNA,

proteins, and tissues against oxidative damage induced by intrinsic

(such as oncogenes) and extrinsic (such as radiation, inflammation, and

toxins) factors. Studies were shown that HDN had the capability to

attenuate oxidative damage in tissues induced by various compounds,

like hydrogen peroxide, CCl4, acetaminophen, gamma radiation

(Kalpana et al., 2009; Naveen Tirkey et al., 2005; Ahmad et al., 2012;

Pradeep et al., 2008). The above mentioned compounds increased the

lipid peroxidation and decrease the antioxidant enzymes including SOD,

GST, CAT, GSH-Px, GR etc. Reversibly these compounds enhance the

liver marker enzymes including ALT, AST, ALP, LDH, GGT, and

bilirubin in the serum.

HDN treatment resulted in a decreased level of all of the

biomarkers, and the antioxidant status was brought back to nearly

normal. Therefore, HDN offers protection against oxidative tissue

damage that is caused by various intrinsic and extrinsic factors by

enhanced the production of enzymatic and non enzymatic antioxidant

(Kalpana et al., 2009; Naveen Tirkey et al., 2005; Ahmad et al., 2012;

Pradeep et al.,2008).


48

2.8.4.8. Effect of hesperidin on apoptosis and inflammation

Hesperidin showed anti-apoptotic effects by augmented anti-

apoptotic (Bcl-2) and decreased pro-apoptotic (Bax) protein expression

thereby protect the cells from apoptosis (Agrawal et al., 2009). Recent

study showed that Hesperidin Attenuates Ultraviolet B-Induced

Apoptosis by Mitigating Oxidative Stress and attenuated the oxidation of

cellular macromolecules, prevented the release of cytochrome c into the

cytoplasm, down regulated the expression of Bcl-2-associated X protein

and caspase in Human Keratinocytes (Susara et al., 2016). In another

study Hesperidin attenuates oxidative stress, inflammation and

apoptosis by down regulated the expression of caspase-3, caspase-9,

NFκB, iNOS, Kim-1 and upregulated the expression of Bcl-2 (Ahmad et

al. 2012). Furthermore, HDN apparently suppressed NF-κB, IL-1β and

TNF-α and enhanced IL-10 production at the transcription level (Li et al.,

2010).

2.8.5. Adverse effects of Hesperidin

It is safe for majority of the people when taken orally for up to 6

months. The Safety of using it for a longer duration is unknown. The

common side effects include headache, nausea, stomach upset, and

diarrhoea. It is possibly safe during pregnancy and breast feeding

mothers. Hesperidin slow down blood clotting and increase the risk of


49

bleeding during and after surgery. It also decreases the blood pressure

(WebMD 2017).

2.9. Ascorbic acid

Ascorbic acid (Vitamin C) is a water soluble vitamin. It is

generally known as ascorbic acid. Man and few small animals require

Vitamin C from their diet. It is completely absorbed from gastrointestinal

tract and distributed widely distributed both extra and intracellularly.

Usual 60 mg/day intake results in about 0.8 mg/dl in plasma and 1.5 gm

in body as a whole. Chemical Formula - C6H8O6.

2.9.1. Structure

Chemical Structure of Ascorbic Acid is debited in the fig 10.

Fig 10: Chemical structure of Ascorbic acid


50

2.9.2. Sources

Citrus fruits (lemon, orange), Guavas, Amla and Indian

gooseberry, vegetables including tomatoes, cabbage, leafy greens

and germinating pulses, are the rich sources of Vitamin C.

2.9.3. Physiological role of Ascorbic acid

It acts as a cofactor in the numerous oxidation and hydroxylation

reactions.

It is essential for the synthesis of collagen, norepinephrine,

oxytocin and adrenal steroidogenesis

It enhances iron and calcium absorption and also assists in the

prevention of blood clotting and also strengthening the walls of

the capillaries.

It promotes cell development, wound healing and protect against

infection

It enhances the immune system and helps reduce cholesterol

levels, high blood pressure and preventing arteriosclerosis (Ozer

et al., 2017; Monfort et al., 2013).

2.9.4. RDA (Recommended daily allowance

Infants- 30 mg/day, premature babies - 40 mg/day, adult male -60

mg/day, Pregnant & lactating women - 75-90 mg/day.


51

2.9.5. Deficiency symptoms and treatment

Scurvy (defect in collagen synthesis) characterized by gingival

bleeding, gingivitis, loosening of tooth and defects in tooth formation,

failure of wound healing, capillaries rupture, haematomas and anaemia.

Treatment: Ascorbic acid 1-1.5gm daily for scurvy, at a dose of 100-

300 mg/day provides quick relief, for Prophylaxis- 50-500mg /day, as an

antioxidant 100mg /day, in haematinic formulations 150mg /day with

iron and folic acid.In mega doses it given for common cold, viral

infections and cancer prophylaxis.


They are ingested in the diet, since ascorbate can be oxidized in

the gastrointestinal tract (GIT) by the presence of other substances that

act as oxidizing agents [e.g., Iron (F3+) and some flavonoids] (Wilson,

2002). Sodium-Dependent Vitamin C Transporters (SVCTs) & GLUT

transporters transport ascorbate into the cell. Ascorbate is better

absorbed in the most distal segments (ileum) of the small intestine and,

in smaller quantities, in the most proximal segments (duodenum).

2.9.7. Pharmacological effects:

2.9.7. 1. Ascorbic acid role in CNS

Ascorbate functions in the nervous system can be divided as

follows: firstly, the interaction of ascorbate with blood- brains barrier as


52

well as its medical implications; secondly, it is essential for neuronal

differentiation, maturation and survival; thirdly, its effect on modulating

neurotransmission and its participation in catecholamine synthesis.

Finally, it has an antioxidant effect and plays a role in the structure and

support of the nervous system. The studies showed that ascorbate

interaction with other antioxidant such as α- tocopherol and glutathione

therapeutically used in the prevention of Alzheimer’s disease (Figueroa-

Méndez R and Rivas-Arancibia, 2015). Another study showed that the

intravenous injection of large dose of vitamin C produced improvement

in mental condition in 75 % of schizophrenic’s patients. Oral

supplementation of Vitamin C with antipsychotic reverses ascorbate

levels by reducing oxidative stress and improves BPRS score (Dakhale

et al., 2005). Gautam et al. (2012) in their study shows the effect of

ascorbic in stress induced psychiatric disorders.

2.9.7. 2. Role in Diabetes

Vitamin C has been associated with decreased risk of developing

diabetes mellitus (DM). Hyperglycaemia is responsible for micro

vascular ROS generation which causes endothelial dysfunction.

Treatment with ascorbic acid prevented the acute hyperglycaemic

impairment of endothelial function in diabetic subjects (Shailja Chambial

et al., 2013).


53

2.9.7.3. Cardiovascular disease:

2.9.7.3.1. Vitamin C role in Hypertension

Vitamin C has been shown to lower blood pressure. After an

initial vitamin C dose of 2 g and subsequent daily doses of 500 mg for

one month, the participants’ mean blood pressure dropped 9.1%,

providing evidence that long-term vitamin C treatment can reduce blood

pressure in patients with hypertension.

2.9.7.3.2. Vitamin C role in hyperlipidemia and atherosclerosis

Amir Khan and Deepti Malhotra, (2011) investigation showed that

daily intake of Vitamin-C by smokers may be useful in the prevention as

well as in the treatment of tobacco induced hyperlipidemia and

atherosclerosis by decreased the level of plasma lipid parameters like

VLDL, LDL, TC,TG,MDA and enhanced the level of HDL in smokers.

Vitamin C reduces plasma lipid level on hypercholesterolemia -induced

hepatic damage by high cholesterol diet (HCD) in female Wistar rats

(Osama A Alkhamees 2013). Few researchers observed that vitamin C

administration causes significant reduction in LDL and increase in HDL

thereby reduces the risk of cardiovascular disease (Lothar Rossig et al.,

2001; Marc P and McRae, 2008).


54

2.9.7.4. Role in cancer

Evidence supports that a high intake of vitamin C decreased risk for

cancer. Ascorbic acid shows the potential effect in the cancer of

oesophagus, oral cavity, stomach, pancreas, cervix, rectum and breast

(Shailja Chambial et al., 2013) and also non-hormonal cancers (Head

1998). Vitamin C also decreases the tumor cell growth and tumor

weight (Chen et al., 2008).

Vitamin C once weekly dose of 7.5 g IV decreased overall side-

effects like nausea, loss of appetite, and fatigue on breast cancer

patients undergoing chemotherapy/radiotherapy (Vollbracht et al.,

2011). In an 11 year cohort study on the association of vitamin

supplementation and upper gastrointestinal cancers, it was shown that

multivitamin use did not help to lower risk, but specific vitamin C

supplementation revealed a 21% lower risk of gastric noncardia

adenocarcinoma (Dawsey et al., 2014).

2.9.7.5. Vitamin C as an antioxidant and interaction with ROS

Vitamin C is an effective antioxidant protects the body from the

deleterious effect of free radicals during oxidative stress. Banerjee et al.

(2009), Naseer et al. (2011), Sminorff and Wheeler, (2000) reported that

Vitamin C has the ability to trap free radicals and protect the

biomembranes from peroxide damage by effectively scavenge the ROS.

The antioxidant property of Vit C can ameliorate the oxidative damage


55

by decreasing lipid peroxidation by donating electrons to free radicals

and quench their deleterious activity on cellular macromolecules, thus

playing a role in antioxidant mechanism (El-Gendy et al., 2010). In

addition, ascorbate prevents hepatic antioxidant depletion in chemical-

induced toxicity in which antioxidant acted as intracellular free radical

scavengers and protected cells from free radical induced peroxidative

damage (Cuddihy et al., 2008). Accordingly, Santos et al. (2009)

reported that tissue dysfunction owing to cell death via apoptosis is one

of the major outcomes of oxidative stress that could be ameliorated by

Vitamin C.

2.9.7. 6.Coantioxidant to regenerate the vitamin E

Vitamin C act as cofactor used to regenerate the α-tocopherol

(Vitamin E) from the α-tocopheroxil radical produced when this is

debugged from the lipid-soluble radicals. This is a potentially important

function, because in the in vitro experiments have shown that α-

tocopherol can act as a pro-oxidant in absence of co-oxidants just as

vitamin C. It also helps in the regeneration of glutathione and β-

carotene from their own oxidation products with one unpaired electron

(urate radicals, glutathionil radicals and cations of β-carotene radicals)

(Gueguen et al., 2003). In the absence of ascorbic acid Vit E can act as

a prooxidant hence ascorbic acid act as a cofactor in the generation of

Vit E.


56

2.9.7.7. Vitamin C role in Apoptosis and inflammation

Heikal et al. (2014) reported that Vitamin C supplement down

regulated the level of the expression of apoptosis-related genes and

protect against oxidative damage and apoptosis. Vitamin C could

reduce cytotoxicity via the ROS-mediated mitochondrial pathway and

NF-kB/FasL pathway (Jin et al., 2014). Its shows antiapoptotic activity

by inhibiting the mitochondrial cytochrome C release and suppression of

subsequent activation of pro-inflammatory cytokines(IL-2, IL-8,TNF-)

and caspase (Rossig et al., 2001; Perez-Cruz et al., 2007;Siow et al.,

1999; Isabel Perez-Cruz et al., 2003; Mikirova et al.,(2012)

2.9.8. Adverse effects

The common side effects of vitamin C include redness of the skin,

flushing, headache, Nausea, vomiting, diarrhoea. Renal side effects

include oxalate and urate kidney stones.

From the above part it is clear that human beings can’t avoid taking

drugs and some of these unavoidable drugs posses significant toxicity

on liver. Ethanol and antitubercular drugs induced hepatotoxicity is

mainly due to the cellular oxidative stress and failure of antioxidant

defense mechanism. Hence there is the need for hepatoprotective

agent with antioxidant property in the treatment regimen while

administering antitubercular drugs to minimize the hepatic damage and

also to treat alcoholic liver disease.


57

Hesperidin and ascorbic acid are potential antioxidant used in the

treatment of various ailments. From the scientific data Hesperidin

reported to posses’ hepatoprotective and antioxidant effect against

acetaminophen (Ahmad et al., 2012), γ radiation (Pradeep et al., 2012),

iron (Pari et al., 2015) and cyclophosphamide (Ayman, 2014) induced

hepatotoxicity. On the other hand Ascorbic acid posses’ protective

effect against formaldehyde (Shang et al., 2014), acetaminophen (Sabiu

et al., 2015) and monosodium glutamate (Ibrahim et al., 2011) induced

hepatotoxicity.

The above scientific reviews suggested that the hepatoprotective effect

of Hesperidin and ascorbic acid is mainly due to its antioxidant and free

radical scavenging property. Considering the high patronage of this

antioxidant property Hesperidin and ascorbic acid can be used to

alleviate ethanol and antitubercular drugs induced hepatotoxicity. Even

though previous studies reported the protective effect of Hesperidin and

Ascorbic acid against various toxic models none of the earlier studies

have reported the protective effect against ethanol and antitubercular

drugs induced hepatotoxicity.

Hence the present study was designed evaluate the hepatoprotective

effect of Hesperidin and Ascorbic acid on ethanol and antitubercular

drugs induced hepatotoxicity in rats.

58

3. NEED FOR THE STUDY

Due to rapid industrialization and change in life style, human

subjects are exposed to a variety of xenobiotics inevitably. However, the

ultimate burden due to such exposure will be on the vital organ of the

body, especially the liver.

In spite of tremendous strides in the modern medicine, there is no

satisfactory measure for the treatment of liver disorders. Hence, it is an

urgent need to explore the natural made remedies to serve as the

alternative therapeutic agents so as to counter the side effects of

various drugs and toxins because they are believed to be safer and

economical. Thus, additional natural products need to be evaluated for

their antioxidant potential.

Hence the present study was designed to evaluate the protective effect

of Hesperidin and Ascorbic acid against ethanol and antitubercular drug

induced hepatotoxicity.

59

4. AIM AND OBJECTIVES OF THE STUDY

The main aim of the study was to evaluate the hepatoprotective effect of

Hesperidin and Ascorbic acid on Ethanol and Antitubercular drugs

induced hepatotoxicity in Wistar albino rats.

The Primary objective of the research was

to evaluate the hepatoprotective effect of Hesperidin and ascorbic

acid on ethanol and antitubercular drug induced hepatotoxicity.

The secondary objectives of the research was

to analyse the effect of Hesperidin and ascorbic acid on lipid

peroxidation and antioxidant status on ethanol and antitubercular

drug induced hepatotoxicity.

to investigate the effect of Hesperidin and ascorbic acid on lipid

profile and membrane stabilizing action on antitubercular drug

induced hepatotoxicity.

to explore the effect of Hesperidin and ascorbic acid on the

expression of apoptotic and inflammatory markers on

antitubercular drug induced hepatotoxicity.

to evaluate the synergistic effect of Hesperidin and ascorbic acid

on ethanol and antitubercular drug induced hepatotoxicity.

Materials and Methods

60

5. MATERIALS AND METHODS

5.1. Experimental animals:

Healthy adult wistar male rats weighing about 150-200g were

obtained from the VMKV Medical College, Salem. The experimental

animals were housed in polypropylene cages in a well ventilated room

under laboratory condition (24± 2 ºC) and relative humidity with a 12 h

light/dark cycle. The animals were acclimatize for around one week

before the experimental procedure and fed with standard laboratory diet

and water ad libitum. The Experimental design was approved by the

institutional Animal ethical committee VMKV Medical college (Approved

No: IAEC/VMKVMC/04/2013). CPCSEA and WHO guidelines were

followed for animal handling and treatment.

5.2. Tools

Chemicals, pH meter, vertex, centrifuge, spectrophotometer,

Tissue homogenizer, agarose gel electrophoresis and RTPCR.

5.3 Chemicals:

Isoniazid, Hesperidin, Ascorbic acid and Silymarin were

purchased from Sigma Aldrich, USA. Pyrazinamide obtained from the

Sterling healthcare Ltd and Rifampicin obtained from Lupin limited. The

Antibody for Bcl-2, Bax, caspase 3, and caspase 9 were purchased

from cell signalling technology (Beverly, MA) and the antibody for TNF-


61

α, NF-kB, IL-10 were purchased from Abcam Ltd (Cambridge, U.K). All

other chemicals and solvents used in the study are of analytical grade.

Standard orogastric cannula was used for oral drug administration.

5.4. Treatment regimens:

The selection of the dose for Ethanol (Tarasankar Maity et al.,

2012) and Anti–tubercular drugs (Chandane et al., 2013), Hesperidin

(Ahmad et al., 2012), Ascorbic acid (Ibrahim et al., 2011), Silymarin

(Basini Jyothi et al., 2013) based on the previous literature. The fasted

rats were randomly divided into 6 groups consists of 6 rats each such

that the weight difference within and between group does not exceed

±20% of the average weight of the total rats.

5.5. Experimental design -1: Ethanol-induced hepatotoxicity

Group 1 :Control rats were administered with distilled water

p.o for 21 days.

Group 2 :test control were administered with Ethanol (40%)-

2ml/100gm p.o for 21 days.

Group 3 :rats administered with Hesperidin ( 200 mg/kg b.wt.)

p.o 1 h before oral administration of Ethanol (40%-

2ml/100gm) for 21 days.


62

Group 4 :rats administered with Ascorbic acid (100 mg/kg

b.wt.) p.o 1 h before oral administration of Ethanol

(40%-2ml/100gm) for 21 days.

Group 5 :rats administered with both Hesperidin 200 mg/kg

b.wt. and Ascorbic acid (100 mg/kg b.wt.) p.o 1 h

before oral administration of Ethanol(40%-


Group 6 :rats administered with Silymarin (100mg/kg b.wt.)

p.o 1 h before oral administration of Ethanol (40%-


At the end of the experimental period (21 days) all the

animals were faster overnight and they were anesthetized with inhaled

diethyl ether anesthesia for about 30–40s. The 2ml of the blood was

collected through retro orbital vein and the serum was separated for

biochemical analysis. After that the animals were sacrificed by cervical

dislocation. For biochemical analysis, liver tissues were quickly

removed and homogenized with appropriate buffer and centrifuged at

4°C and the supernatant was used in the assay of antioxidants and lipid

peroxidation. The small sections of the liver lobe were collected in 10%

formalin and stored for Histopathological examination.


63

5.5.1. Investigations:

5.5.1.1. Estimation of serum Biochemical markers.

Serum Total Protein, Albumin, Bilirubin.

5.5.1.2. Estimation of liver marker enzymes in serum.

Aspartate aminotransferase (AST), Alanine

aminotransferase (ALT), Alkaline phosphatase (ALP) and Lactate

dehydrogenase (LDH) was estimated by using commercially available

KIT purchased from Transasia Bio Medicals, Bengaluru.

5.5.1.3. Estimation of serum lipid profile.

Total cholesterol and triglycerides was estimated by KIT obtained

from Nicholas India Pvt Ltd.

5.5.1.4. Estimation of Oxidative stress markers in the liver.

The level of TBARS was measured using the method of Ohkawa et al.

5.5.1.5. Estimation of antioxidant enzymes in the liver.

Superoxide dismutase (SOD) was estimated by the method of

Kakkar et al. Catalase (CAT) was determined by the method of Sinha.

Reduced glutathione (GSH) activity was estimated by the method of

Rotruck et al. Vitamin C & E content were estimated by the methods of


64

Omaye et al & Desai ID. Total protein content was determined by the

method of Lowry et al.

5.5.1.6. Histopathological Examination

The liver was quickly removed after sacrificing the rats and fixed with

10% formalin solution. Histological sections were prepared, stained with

hematoxylin and eosin and then examined under microscope.

5.6. Experimental design 2: Antitubercular drug induced

hepatotoxicity.

Group 1 :Control rats administered distilled water p.o for 50

days.

Group 2 :test control were administered with Isoniazid (27

mg/kg. b.wt.) + Rifampicin (54 mg/kg b.wt.)+

Pyrazinamide (135 mg/kg b.wt.) p.o for 50 days.

Group 3 :rats administered with Hesperidin (200 mg/kg b.wt.)

p.o 1h before oral administration of Isoniazid (27

mg/kg b.wt.) + Rifampicin (54 mg/kg b.wt).+

Pyrazinamide (135 mg/kg b.wt.) for 50 days.

Group 4 :rats administered with Ascorbic acid (100 mg/kg b.wt.)

p.o 1 h before oral administration of Isoniazid (27

mg/kg b.wt.) + Rifampicin (54 mg/kg b.wt.) +

Pyrazinamide (135 mg /kg b.wt.) for 50 days.


65

Group 5 :rats administered with both Hesperidin (200 mg/kg

b.wt.) and Ascorbic acid (100 mg/kg b.wt.) p.o 1 h

before oral administration of Isoniazid (27 mg/kg

b.wt.) + Rifampicin (54 mg/kg b.wt.) + Pyrazinamide

(135 mg/kg b.wt.) for 50 days.

Group 6 :rats administered with Silymarin (100 mg/kg b.wt.)

p.o 1 h before oral administration of Isoniazid (27 mg/

kg b.wt.)+ Rifampicin (54mg/kg b.wt.) + Pyrazinamide

(135 mg/kg b.wt.) for 50 days.

At the end of the experimental period (50 days) all the animals

were fasted overnight and sequentially anesthetized with inhaled diethyl

ether anesthesia for about 30–40s. The 2ml of the blood was collected

through retro orbital vein and serum was separated for biochemical

analysis. After that the animals were sacrificed by cervical dislocation.

For biochemical analysis, liver tissues were quickly removed and

homogenized with appropriate buffer and centrifuged at 4°C and the

supernatant was used in the assay of antioxidants, ATP ase and lipid

peroxidation. For western blot studies and RT PCR studies liver was

dissected, immediately stored on RNA later (sigma), and stored at

−80ºC. A small section of the liver lobe were collected in 10% formalin

and stored for histopathology.


66

5.6.1. Biochemical Investigations

5.6.1.1. Estimation of Serum Biochemical markers

The serum level Total protein, Albumin, Bilirubin, Urea and

Creatine were estimated by using kit obtained from Transasia Bio

Medicals, Bengaluru).

5.6.1.2. Estimation of Liver marker enzymes in serum

The serum level of Aspartate aminotransferase (AST), Alanine

aminotransferase (ALT), Lactate dehydrogenase (LDH), Acid

phosphatase (ACP), Alkaline phosphatise (ALP), Gamma

glutamyltransferase (γGT) were estimated by using KIT from- Transasia

Bio Medicals, Bengaluru).

5.6.1.3. Estimation of lipid profile

The serum level of high density lipoprotein (HDL), Low density

lipoprotein (LDL), Very low density lipoprotein (VLDL), Free Fatty Acids

(FFA),Phospholipids, Total cholesterol (TC), Triglycerides (TG) were

estimated by KIT- from Nicholas India Pvt. Ltd.

5.6.2. Estimation of protein

Protein content was determined by the method of Lowry, et al.,

(1951).


67

Principle

Proteins react with folin-ciocalteau reagent to give a coloured

complex. The colour so formed was due to the reaction of alkaline

copper with protein and the reduction of phosphomolybdate by tyrosine

and tryptophan present in the protein. The intensity of the colour

depends on the amount of these aromatic amino acids present.

Reagents

1. Alkaline copper reagent

i. Solution A : 2% sodium carbonate in 0.1N NaOH

ii. Solution B: 0.5% copper sulphate

iii.SolutionC: 1% sodium potassium tartarate 50mL solution A was

mixed with 0.5mL solution B and 1.0mL solution C just before use.

2. Folin's phenol reagent: This commercial Folin's phenol reagent was

diluted with double distilled water (1:2) just before use.

3. Standard bovine serum albumin (BSA): In a standard flask a stock

solution was prepared by dissolving 100mg of BSA in 100mL water.

10mL of the stock was diluted to 100mL, to obtain a working standard

concentration 100μg/mL.


68

Procedure

0.1mL of tissue homogenate was made up to 1.0 mL with saline,

then 1.0mL of 10% TCA was added. The mixture was centrifuged, the

supernatant was discarded and the precipitate was dissolved in 1.0mL

of 0.1 N NaOH. From this aliquots were taken for the estimation. 4.5mL

of alkaline copper reagent was added to all the tubes and the contents

were allowed to stand at 37°C for 10 minutes. Then 0.5mL diluted folin's

phenol reagent was added and mixed well. The colour intensity was

measured in a spectrophotometer at 660nm. A series of standards with

a concentration range of 20-100μg and a blank were processed in a

similar manner. The values are expressed as mg/g tissue in the liver.

5.6.3. Estimation of oxidative stress markers

5.6.3.1. Estimation of tissue thiobarbituric acid reactive

substances (TBARS)

The extent of lipid peroxidation (LPO) in tissues was estimated by

measuring TBARS by the method of Ohkawa, et al., (1979).

Principle

Thiobarbituric acid reactive substances (TBARS) were measured

by their reactivity with thiobarbituric acid (TBA) in acidic conditions to

generate a pink coloured chromophore, the absorbance of which was

read in a spectronic 20 colorimeter at 535nm.


69

Reagents

1. 5% TCA

2. 0.25N HCl

3. TBA: 0.375% in hot distilled water

4. TCA-TBA-HCl reagent: Solutions 1, 2 and 3 were mixed

freshly in the ratio of 1: 1:1.

5. Stock standard: 0.16mL of 3.0 M solution of 1, 1', 3, 3'

tetraethoxy propane was made up to 100mL with double

distilled water.

6. Working standard: 50 nmol/m in distilled water

Procedure

The tissue homogenate was prepared using the Tris- HCL buffer

0.025M, at pH 7.8. The 1.0mL of the tissue homogenate was mixed with

2.0mL of TCA-TBA-HCl reagent. This mixture was kept in the boiling

water bath for about 15 minutes and then cooled. After that the tubes

were centrifuged at 1000 x g for 10 minutes. The colour developed in

the supernatant was measured in a spectronic 20 colorimeter at 535nm

against a blank. A series of standard solutions in the concentration

range of 2.5 – 10 nmoles were treated in a similar manner. The values

are expressed as nmoles/mg protein.


70

5.6.3.2. Estimation of lipid hydroperoxides

Lipid hydroperoxides were determined by the method of Jiang et

al., (1992).

Principle

Oxidation of ferrous iron (Fe2+) under acidic medium in the presence of

xylenol orange which leads to the formation of a chromophore with an

absorbance maximum at 560nm.

Reagents

1. Fox reagent: 88mg butylated hydroxy toluene (BHT), 76mg

xylenol orange and 9.8mg ammonium iron (II) sulphate were

added to 90mL methanol and 10mL of 250mM H2SO4.

Procedure

0.9mL of Fox reagent was mixed with 0.1mL of the sample and

incubated for 30 minutes at room temperature. The absorbance was

read in a spectronic 20 colorimeter at 560 nm. The amount of

hydroperoxides produced was calculated by using the molar extinction

co-efficient of 4.6 x 104 M-1cm-1. The values are expressed as moles

/mg tissue.

5.6.3.3. Estimation of conjugated dienes (CD)

Conjugated dienes were assayed by the method of Recknagel,

(1984).


71

Principle

Lipid peroxidation is associated with rearrangement of the double

bonds in the poly unsaturated fatty acids this will results in the formation

of conjugated dienes, which absorb at 233nm. The conjugated dienes

will reflect the extent of lipid peroxidation taking place.

Reagents

1. Chloroform

2. Methanol

3. Cyclohexane

Procedure

To 1.0mL of tissue homogenate, 5.0mL chloroform-methanol

reagent (2:1v/v) was added, mixed thoroughly and centrifuged for 5

minutes. To this, 1.5mL of cyclohexane was added. The absorbance

was read at 233nm against a cyclohexane blank. The total amount of

conjugated dienes formed was calculated by using a molar extinction

coefficient (2.52 x 104cm-1). The conjugated dienes concentration was

expressed as moles/mg protein.


72

5.6.4. Estimation of enzymatic antioxidants

5.6.4. 1. Estimation of Superoxide dismutase (EC 1. 15. 1. 1)

Superoxide dismutase was estimated by the method of Kakkar et

al. (1984).

Principle

The assay was based on the inhibition of the formation of

NADH-phenazine methosulphate-nitroblue tetrazolium formazan. The

reaction was initiated by adding NADH and incubated for 90 seconds.

The glacial acetic acid was added to arrest the reaction. The colour

which was developed at the end of the reaction was extracted into the

n-butanol and the absorbance was measured in a colorimeter at 520nm.

Reagents

1. Sodium pyrophosphate buffer: 0.052M, pH 8.3.

2. Absolute ethanol

3. Chloroform

4. n-butanol

5. Phenazine methosulphate (PMS): 186M

6. Nitroblue tetrazolium (NBT): 300M

7. Reduced nicotinamide adenine dinucleotide (NADH): 780M

8. Glacial acetic acid


73

Procedure

Tissue was homogenised by using sodium pyrophosphate buffer

(0.025 M, pH). 0.5mL of the tissue homogenate was diluted to 10mL

with water, followed by the addition of 2.5mL of ethanol and 1.5mL

chloroform (chilled reagents were added). This mixture was shaken for

90 seconds at 4°C and then centrifuged. The enzyme activity in the

supernatant was determined as follows. The assay mixture contained

1.2mL of sodium pyrophosphate buffer, 0.1mL of PMS and 0.3mL of

NBT and appropriately diluted enzyme preparation in a total volume of

3.0mL. The reaction was started by adding 0.2mL NADH. After that it

was incubated under 30C for 90 seconds. Then the reaction was

stopped by the addition of 1.0mL glacial acetic acid. The reaction

mixture was stirred vigorously and shaken with 4.0mL n-butanol. The

contents were left aside for 10 minutes. The contents were centrifuged

and the n- butanol layer. The colour intensity of the chromogen in n-

butanol layer was measured in a spectronic 20 colorimeter at 560nm. A

system devoid of enzyme served as control. The enzyme concentration

required to inhibit the chromogen produced by 50% in one minute under

standard conditions was taken as one unit. The specific activity is

expressed as units/min/mg protein.


74

5.6.4. 2. Estimation of Catalase (EC 1. 11. 1. 6)

The activity of catalase was determined by the method of Sinha,

(1972).

Principle

Dichromate in acetic acid was heated in the presence of H2O2

was converted into perchromic acid and then to chromic acetate. The

chromic acetate formed was measured at 620 nm. The enzyme

catalase was allowed to split H2O2 for various periods of time. The

reaction was stopped at different time intervals by the addition of

dichromate-acetic acid mixture and the remaining H2O2 as chromic

acetate was measured using a spectrophotometer at 620nm.

Reagents

1. Phosphate buffer: 0.01M, pH 7.0

2. Hydrogen peroxide: 0.2M

3. Potassium dichromate: 5%

4. Dichromate-acetic acid reagent: 1:3 ratios of potassium

dichromate and glacial acetic acid.

5. Standard hydrogen peroxide: 0.1mL/100mL in distilled water.


75

Procedure

Tissue homogenate was prepared by using phosphate buffer

(0.01 M, pH 7.0). 0.9mL phosphate buffer was mixed with 0.1mL of

tissue homogenate and 0.4 mL H2O2. The reaction was arrested after

15, 30, 45 and 60 seconds by adding 2.0mL of dichromate-acetic acid

reagent. The tubes were kept in the boiling water bath for 10 minutes

and cooled. The absorbance of the colour developed was read in a

spectronic colorimeter at 620nm. Standards in the concentration range

of 20-100 moles were processed as for the test. The specific activity of

catalase is expressed as moles of H2O2 utilized/min/mg protein.

5.6.4.3. Estimation of glutathione peroxidase (EC. 1. 11. 1. 9)

Glutathione peroxidase (GPx) was determined by the method of

Rotruck et al., (1973).

Principle

A known amount of enzyme preparation was allowed to react with

H2O2 in the presence of GSH for a specified time period. The amount of

GSH was utilized measured calorimetrically.

2 GSH + H2O2 GPx GSSG + 2 H2O

Reagents

1. Tris-HCl buffer: 0.4 M, pH 7.0


76

2. Sodium azide solution: 10mM

3. TCA: 10%

4. EDTA: 0.4mM

5. 0.4mM H2O2 solution

6. Glutathione (GSH): 2.0mM

Procedure

0.2mL Tris buffer (0.4M pH 7), 0.2mL EDTA, 0.1mL sodium azide

and 0.5mL haemolysate and the tissue homogenate were mixed

together. To this mixture, 0.2 ml of GSH followed by 0.1 ml H2O2 was

added. These contents were mixed will and incubated at 37C for 10

minutes along with a control containing all reagents except the

homogenate. After 10 minutes the reactions was arrested by the

addition of 0.5 ml of 10% of TCA. The contents were centrifuged and

the supernatant was assayed for GSH by the method of Ellman. The

activities are expressed as moles of GSH utilized/min/mg protein.

5.6.4.4. Estimation of glutathione reductase (EC. 1. 6. 4. 2)

Glutathione reductase activity was assayed measured by the

method of Carlberg and Mannervik, (1985).


77

Principle

The enzyme activity was determined by measuring the GSH

formed when the oxidised glutathione (GSSG) is reduced by reduced

nicotinamide adenine dinucleotide phosphate (NADPH).

Reagents

1. Phosphate buffer: 0.1M pH 7.4

2. Sodium bicarbonate solution: 0.1M

3. GSSG: 250M

4. FAD: 250 mM

5. NADPH: 4mM

6. EDTA: 80mM

Procedure

2.0mL phosphate buffer, 0.1mL enzyme sample (plasma or tissue

homogenate), 0.1mL FAD and 0.5mL EDTA solution were taken in a

test tube. A blank was set up using all the reagents except FAD+. The

tubers were incubated for 15 minutes at 37°C, followed by the addition

of 0.1mL of NADPH solution to each tube. The reaction was

continuously monitored for 5 minutes at 340 nm and the change in the


78

linear absorbance was measured. The values are expressed in moles

of NADPH oxidised/min/mg Hb or protein.

5.6.4.5. Estimation of glutathione-S-transferase (EC. 2. 5. 1. 18)

The activity of (GST) glutathione-S-transferase was assayed by

the method of Habig et al., (1974).

Principle

GST activity was assayed by following the increase in

absorbance at 340nm using 1 - chloro, 2, 4 dinitrobenzene (CDNB) as

the substrate.

2GSH H2O2 Non-Se-GPx GSSG 2H2O

Reagents


2. GSH: 30mM

3. 30mM CDNB in 95% ethanol

Procedure

1.0mL phosphate buffer, 0.1mL CDNB and 0.1mL of tissue

homogenate were added in a test tube. The volumes were adjusted to

2.9mL by adding water. The reaction mixture was preincubated for 5

minutes at 37°C for 5 minutes and the reaction started by adding 0.1mL


79

of 30mM glutathione. The absorbance was followed for 5 minutes at

540 nm. A system without the enzyme served as the blank. The specific

activity of GST is expressed as moles of CDNB-GSH conjugate

formed/min/mg protein that was calculated using the formula

mginproteinx5x9.6

1000x3xO.D

9.6 is the difference in the molar extinction co-efficient between CDNB-

GSH conjugate and CDNB.

5.6.5. Estimation of non enzymatic antioxidants

5.6.5.1. Estimation of reduced glutathione (GSH)

Reduced glutathione was assayed by the method of Ellman, (1959).

Principle

This method was based on the development of yellow colour

when dithio-nitrobenzoic acid (DTNB) is added to compounds

containing sulphydryl groups.

Reagents


2. TCA: 5%


80

3. Ellman’s reagent: 34mg of DTNB was dissolved in 10mL of

0.1% sodium citrate.

4. 0.3M Disodium hydrogen phosphate

5. Stock standard glutathione: 1000g/mL in distilled water

6. Working standard: 100g/mL in distilled water.

Procedure

0.5 mL of tissue homogenized in phosphate buffer (0.1M, pH 7.0),

2.0mL of 5 % TCA was added to precipitate the proteins. After

centrifugation, to 1.0ml of supernatant, 3.0mL of 0.2 M phosphate buffer

and 0.5mL of Ellman’s reagents were added. The yellow colour

developed was read in a colorimeter at 412nm. A serious of standards

(20-100g) were treated in a same manner along with a blank

containing 1.0mL buffer. The amount of glutathione was expressed as

mg/g tissue.

5.6.5.2. Estimation of Vitamin-C

Vitamin C was estimated by the method of Omaye et al.,

(1979).

Reagents

1. Trichloroacetic acid (TCA): 5%


81

2. Sulphuric acid (H2SO4): 65%

3. DNPH- Thiourea-CuSO4 (DTC) reagent: 3 gm of DNPH,

0.4 gm of thiourea and 0.05 gm of CuSO4 were dissolved

in 9N H2SO4 and made up to 100 ml with the same.

4. Standard: Standards of ascorbic acid were made in 5%

TCA in the range of 1 to 20 μg/ml

Procedure

Aliquots of the sample was precipitated with 5% ice cold TCA

and centrifuged for 20 min at 3500 rpm. The 1 ml of the supernatant

was mixed with 0.2 ml of DTC was added and incubated at was added

and incubated at 37ºC for 3 h. Then to 1.5 ml of ice cold 65% of H2SO4

was added and mixed well. The solutions were allowed to stand at room

temperature for an additional 30 min. Absorbance was determined at

520 nm. The amount of Vitamin-C was expressed as mg/gm of wet

tissue.

5.6.5.3. Estimation of Vitamin-E

Vitamin-E was determined by the method of Desai (1984).

Reagents

1. Absolute ethanol

2. Hexane


82

3. Bathophenthroline reagent: 0.2% solution of 4,7-diphenyl-

1-10-pheneanthroline in purified absolute ethanol.

4. Ferric chloride reagent: 0.001 M ferric chloride solution in

purified absolute ethanol. This reagent was prepared

fresh and was kept in amber colored bottle.

5. Orthophosphoric acid reagent: 0.001 M orthophosphoric

acid solution in purified absolute ethanol.

6. Vitamin E standard: -tocopherol standards in the range

1-10μg/ml of purified absolute ethanol were prepared and

treated in the same manner as test samples.

Procedure

To 1 ml of sample, l ml of ethanol was added and thoroughly

mixed. Then 3m1 of hexane was added, shaken rapidly and

centrifuged. 2m1 of supernatant was taken and evaporated to dryness.

To this 0.2 ml of bathophenanthroline was added. The assay mixture

was protected from light and 0.2ml of ferric chloride was added followed

by 0.2m1 of 0-phosphoric acid. To the total volume was made up to

3m1 with ethanol. Standard α-tocopherol acetate was also treated

similarly. The absorbance was read at 530 nm. The amount of Vitamin

E was expressed as mg/dL for serum and mg/gm of wet tissue.


83

5.6.6. Estimation of membrane bound ATP ase enzyme

5.6.6.1. Estimation of Na+ K+ ATPase (E.C 3.6.1.3)

Na+ K+ ATPase was assayed according to the method of

Bonting, (1970).

Reagents

1. Tris-HCl buffer (184 mM, pH 7.5): Tris (2.23 gm) was

dissolved in 100 ml of deionised water and pH was

adjusted to 7.5 with 1N HCl.

2. Magnesium sulphate (50 mM): MgSO4 (369.9 mg) was

dissolved in 25 ml of deionised water.

3. Potassium chloride (50 mM): KCl (93.2 mg) was dissolved

in 25 ml of the deionised water.

4. Sodium chloride (600 mM): NaCl (876.6 mg) was

dissolved in the 25 ml of deionised water.

5. EDTA (1 mM): EDTA (3.72 mg) was dissolved in 10 ml of

deionised water.

6. ATP (40 mM): ATP (44.56mg) was dissolved in 2.0 ml of

deionised water.


84

7. Sodium bisulphate (15%): Anhydrous sodium bisulphate

(15gm) was dissolved and made upto 100m1 with

distilled water.

8. Sodium sulphite (20%): Sodium sulphite (20gm) was

dissolved and made upto 100m1 with distilled water.

9. 1-amino 2-napthol 4-sulphonic acid (ANSA): ANSA

(500mg) was dissolved in a solution containing 195 ml of

15% sodium bisulphate and 5 ml of 20% sodium sulphite

and stored in a brown bottle.

Procedure

The incubation mixture contained 1.0 ml of buffer, 0.2 ml each

of magnesium sulphate, EDTA, ATP, potassium chloride, sodium

chloride and the test samples. The mixture was incubated for 15 min at

37°C. The reaction was arrested by adding 1.0 ml of TCA and mixed

well. The mixture was then centrifuged and the supernatant was used

for the estimation of inorganic phosphate by the method of Fiske and

Subbarow, (1925). The control without the enzyme was also incubated

after arresting with TCA, after that the enzyme was added. The enzyme

activity was expressed as µ moles of inorganic phosphate liberated/mg

protein/min.


85

5.6.6.2. Estimation of Ca2+ ATPase (E.C 3.6.1.3)

Ca2+- ATPase was estimated as described by the method of

Hjerten and Pan (1983).

Reagents


dissolved in 100 ml of deionised water and the pH 8.0

was adjusted with 1N HCl.

2. Calcium chloride (50 mM): calcium chloride (273.6 mg)

was dissolved in 25 ml of deionised water.

3. ATP (10 mM): ATP (33 mg) was dissolved in 6.0 ml of

deionised water.

4. Sodium bisulphate (15%): Anhydrous sodium bisulphate

(15gm) was dissolved in distilled water and made upto

100ml.

5. Sodium sulphite (20%): sodium sulphite (20gm) was

dissolved in distilled water and made up to 100ml.



20% sodium sulphite and 195 ml of 15% sodium

bisulphate and stored in brown bottle.


86

Procedure

The mixture contained 0.1 ml of each buffer, calcium chloride,

ATP and test samples were incubated at 37°C for 15 min. The reaction

was arrested by adding 1.0 ml 10% TCA. The color developed was

read at 620nm after 20 min against the blank using a

spectrophotometer. The amount of inorganic phosphate liberated was

estimated by the method of Fiske and Subbarow, (1925). The enzyme

activity was expressed as µ moles of inorganic phosphate liberated/mg

protein/min.

5.6.6.3. Estimation of Mg2+- ATPase (E.C 3.6.1.3)

Mg2+- ATPase was estimated by the method of Ohnishi et al..

(1962).

Reagents


dissolved in the 100 ml of deionised water and the pH 7.6

was adjusted with 1N HCl.

2. Magnesium chloride (50 mM): MgCl2 (50.8 mg) was

dissolved in 5.0 ml of deionised water.

3. ATP (10 mM): ATP (33mg) was dissolved in 6.0 ml of

deionised water.


87

4. Sodium bisulphate (15%): 15gm of anhydrous sodium

bisulphate was dissolved in distilled water and made upto

100ml.

5. Sodium sulphite (20%): sodium sulphite (20gm) was

dissolved with distilled water and made up to 100ml.



20% sodium sulphite and 195 ml of 15% sodium

bisulphate and stored in brown bottle.

Procedure

The mixture containing 0.1 ml of each buffer, magnesium

chloride, ATP and test samples were incubated for 15 min at 37°C. The

reaction was arrested by the addition of 1.0 ml 10% TCA and it was

centrifuged. The color developed was read at 620nm after 20 min

against the blank using a spectrophotometer. The liberated inorganic

phosphate was estimated by the method of Fiske and Subbarow,

(1925). The enzyme activity was expressed as µ moles of inorganic

phosphate liberated/mg protein/min.

5.6. 7. Histopathological Examination

The portion of the liver was cut into small slices and fixed in 10%

formalin until processing. Formalin fixed tissues were dehydrated


88

through 70%, 90%, and 100% alcohol and embedded in low-melting-

point paraffin. Sections of 5 μm thick were made using rotary microtome

Hematoxylin and Eosin Staining

After paraffin embedding and routine sectioning, sections were

loaded on slides. The slide were deparaffinize through three changes of

xylene, incubating slides for 10 min in each change.

Hydrate slides to water by dipping them 20-40 times in each of

three changes of 100% ethanol, two changes of 95% ethanol, one of

70% ethanol. Rinse with 2-3 changes of tap water, 30-50 dips each.

Stain with Hematoxylin for 5 minutes. Rinse with 3-4 changes of tap

water. Stain in Eosin for 10 minutes. Dehydrate through 2 changes of

95% ethanol (15 dips each) followed by 3 changes of 100% ethanol (30-

50 dips each). Clear through three changes of Xylene, 30-50 dips each.

Blotting was done after each steps Mount by cover slip with D.P.X.

slides examined under microscopes.

5.6.8. Western blotting analysis

Liver tissue sample were subjected to lyse in the sample buffer

and the protein concentration of lysates was determined. The Bradford

protein estimation kit was used to determine the concentrate of the

protein in the lysate. From the each sample equal amount (40 µg) of

liver tissue proteins are subjected to 12% SDS–PAGE gels. Then it is


89

transferred onto PVDF membranes. Then membranes were then

probed with the respective primary antibodies (rabbit polyclonal

antibody) against Bax, Bcl2, Caspase-3, Caspase 9, IL-10, TNF –α and

NF-κB) overnight at 4oC. After that wash the each membrane and then

incubated with horseradish peroxidase (HRP)-labeled anti-rabbit

secondary antibodies for 1 h at room temperature. The protein bands

were visualized by Enchanced chemiluminescent HRP substrate (ECL)

kit (Amersham Bioscience) according to the manufacturer’s

instructions.The expression levels were quantified using the image J

analysis (version 1.43, NIH, USA) for Windows. Blots were reported

with β- actin antibody as a loading control.

5.6.9. Reverse Transcription PCR

The total RNA was isolated from the liver tissue using Trizol

reagent, according to the manufacturer’s recommendations (Invitrogen

Life Technologies, Carlsbad, CA, USA). By using SuperScript First-

Strand Synthesis System for RT-PCR (Invitrogen), 0.1 µg of the total

RNA was reverse transcribed as per the manufacturer’s

recommendations. By using the first-strand cDNA as a template, the

PCR was carried out using the gene specific upstream & downstream

primers (Table 2) for Bcl-2, Bax, Caspase-3, Caspase-9, TNF-α, NFκB,

IL-10 and β-actin (reference gene), were subjected to 35 cycles of PCR

amplification with 30s denaturation at 94 ◦C, then followed by 30s

annealing temperature at 55◦C and 2 min extension at 72 ◦C. The PCR


90

products were resolved by agarose gel electrophoresis (Biorad) on

1.5% agarose and visualized by ethidium bromide. β- Actin was used as

an internal loading control. The intensity of the individual bands was

semi-quantitatively assessed using NIH Image.

5.6.10. DNA Fragmentation

DNA fragmentation is a distinctive feature of apoptosis at the

biochemical level. It is a semi quantitative method used for measuring

the apoptosis. The liver tissue was homogenised and centrifuged at

3000 × g for 5 min and the cell pellet was collected. The Pellets were

lysed with a hypotonic lysis buffer (10 mM of Tris-HCl at pH 8.0)

containing EDTA (10 mM) and Triton X-100 (0.5%) and then pooled

with pellets made of detached cells. RNA was digested using RNase

(0.1 mg/ml at 37 °C for 1 hour) followed by proteinase K treatment for 2

hour at 50 °C. After that DNA was extracted with a mixture of phenol,

chloroform, and isoamyl alcohol (25:24:1). Then the DNA was

precipitated by the addition of an equal volume of isopropyl alcohol and

stored overnight at 20 °C and centrifuged at 12,000 × g for 15 min at 4

°C. The pellet was air-dried, resuspended in 20 μl Tris acetate EDTA

buffer supplemented with 2 μl of sample buffer (0.25% bromphenol

blue, 30% glyceric acid). Then it was electrophoretically separated on a

2% agarose gel containing 1 μg/ml ethidium bromide and visualized

under ultraviolet transillumination.


91

Table 2: Primers used in RT-PCR analysis.

S.No Genes Forward primer Reverse primer

1 Caspase-3 TCCTAGCGGATGGGTGCTAT TCACGGCCTGGGATTTCAAG

2 Caspase-9 TGTTCAGGCCCCATATGATCG GGACTCACGGCAGAAGTTCA

3 Bcl-2 GAACTGGGGGAGGATTGTGG GGCAGGCATGTTGACTTCAC

4 Bax CCCTTTTGCTTCAGGGTTTCAT ACAGGGACATCAGTCGCTTC

5 NF-kB ACTTCTCCTGAAAGCCGGTG AGGAAGAGGTTTGGATGCCG

6 IL-10 TACGGCGCTGTCATCGATTT AAGGTTTCTCAAGGGGCTGG

7 TNF-α CTGGGCAGGTCTACTTTGGG CTGGAGGCCCCAGTTTGAAT

8 β- Actin GAGCACAGAGCCTCGCCTTT AGAGGCGTACAGGGATAGCA


92

5.7. Statistical analysis

Statistical analysis was done using SPSS v 16.0. All results were expressed

as mean± SD. The results were statistically analyzed using one way ANOVA

by Tukey HSD Post hoc multiple range test and differences below P<0.05 are

considered as significant.

Results

93

6. RESULTS

6.1. Effect of Hesperidin and Ascorbic acid against Ethanol

induced hepatotoxicity in rats.

6.1.1 Effect of Hesperidin and Ascorbic acid on serum biochemical

markers in Ethanol induced hepatotoxic rats.

Table 3 shows the effects of Hesperidin (HDN) and Ascorbic acid

(AA) on the activities of serum Albumin, Total protein (TP) and Bilirubin

in the control and experimental rats. In Ethanol intoxicated group the

level of Bilirubin was significantly increased (p<0.001), where as the

level of total protein and albumin were found to be significantly

(p<0.001) decreased when compared to the control group.

This elevated activities of the assayed bilirubin concentration

induced by Ethanol was significantly (p<0.001) diminished following

treatment with either HDN or AA or combination of both HDN and AA.

On the otherhand Ethanol induced reduction in the total protein

concentration was significantly enhanced after treatment with either

HDN (p< 0.001) or AA (p< 0.01) or combination of both HDN and AA

(p<0.001). Similarly the level of serum albumin was significantly

increased in the group supplemented with either HDN (p<0.05) or AA

(p>0.05) when compared to the ethanol treated group.

Results

94

Table 3: Effect of Hesperidin and Ascorbic acid on serum Total protein, Albumin and Bilirubin in

Ethanol induced hepatotoxic rats.

Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by Tukey HSD Post

hoc multiple range test. The significant changes are calculated as * p<0.05, ** p<0.01,

*** p<0.001 compared to control group; a p<0.05, b p<0.01, c p<0.001 compared to Ethanol group.

ns – non significant results.

SERUM CONTROL ETHANOL(EtOH) EtOH +HDN EtOH +AA EtOH +HDN+AA EtOH +SLY

TP(g/dl) 6.33±0.33 3.66±0.29*** 5.52 ±0.47 c 4.85±0.15 b 6.22±0.30 c 6.24 ±0.30 c

Albumin(g/dl) 37.95±2.36 19.30±0.77*** 26.59 ±2.27 a 24.96 ±3.06 ns 36.05 ±2.31 c 33.94 ±2.94 c

Bilirubin(mg/dl) 0.43±0.13 3.75±0.10*** 1.41 ±0.16 c 1.27 ±0.27 c 0.48 ±0.10 c 0.45 ±0.08 c

Results

95

However the effects were significantly (p< 0.001) more pronounced in

the rats those co treated with the combination of both Hesperidin and

Ascorbic acid when compared to the individual treatment. Standard

drug Silymarin (SLY) significantly (p<0.001) reversed all the biochemical

changes induced by Ethanol to the normal level. There was no

significant difference noted between Ethanol+HDN+AA treated group

and Silymarin treated group.

6.1.2: Effect of Hesperidin and Ascorbic acid on liver marker

enzymes in the serum of ethanol induced hepatotoxic rats.

The effects of HDN and AA on the serum level of AST, ALT, ALP

and LDH were shown in the Table 4. Ethanol induced liver injury is

evidenced by significant (p<0.001) elevation in the levels of liver marker

enzyme (AST, ALT, ALP and LDH) when compared to control group.

In contrast, co treatment with either HDN or AA significantly

(p<0.001) reduced the level of liver marker enzymes compared to the

ethanol group. Moreover, the elevated activities of the assayed serum

marker enzymes induced by Ethanol were significantly (p<0.001)

attenuated following treatment with the combination of both HDN and

AA. However, concurrent treatment with the combination of both HDN

+AA shows better results when compared to the individual treatment

with either HDN or AA. Standard drug silymarin significantly (p<0.001)

reversed the changes induced by ethanol.

Results

96

Table 4: Effect of Hesperidin and Ascorbic acid on liver marker enzymes in serum of


The results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by Tukey HSD Post hoc

multiple range test. The Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001 compared

to control group; a p<0.05, b p<0.01, c p<0.001 compared to Ethanol group. ns – non significant results.

SERUM CONTROL ETHANOL (EtOH) EtOH +HDN EtOH +AA EtOH +HDN+AA EtOH +SLY

AST (IU/L) 17.50±1.10 64.31±3.72*** 28.31 ±2.78 c 30.00 ±2.83 c 22.10 ±2.83 c 26.34 ±0.87 c

ALT(IU/L) 45.31±2.58 105.81±5.27*** 64.55 ±5.73 c 76.41±2.80 c 56.81 ±1.40 c 60.72 ±1.64 c

ALP(IU/L) 188.50±5.36 284.19±4.56*** 214.64 ±5.0 c 218.93±1.91 c 196.99 ±6.94 c 191.15 ±1.66 c

LDH (IU/L) 3.08±0.17 10.26±1.13*** 4.55 ±0.67 c 5.05 ±0.71 c 3.45 ±0.65 c 3.97 ±0.21 c

Results

97

6.1.3. Effect of Hesperidin and Ascorbic acid on serum lipid profile

in Ethanol induced hepatotoxic rats.

Fig 11 shows the effects of Hesperidin and Ascorbic acid on the

serum level of total cholesterol (TC) and triglycerides (TG) in the control

and experimental rats. Ethanol administration significantly enhanced the

level of serum total cholesterol (p<0.001) and triglycerides (p<0.001)

when compared to control group.

On the otherhand, concurrent treatment with either HDN or AA

significantly (p<0.001) reduced the serum level of total cholesterol &

triglycerides when compared to ethanol treated group.

Moreover the combination therapy with HDN and AA shows

better result (p<0.001) when compared to individual therapy with either

HDN or AA alone. The standard drug silymarin also significantly

(p<0.001) reversed the lipid changes induced by Ethanol.

Results

98

Fig 11: Effect of Hesperidin and Ascorbic acid on serum lipid profile in Ethanol

induced hepatotoxic rats.

Fig 12: Effect of Hesperidin and Ascorbic acid on Lipid peroxidation in liver of

ethanol induced hepatotoxic rats.

Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by

Tukey HSD Post hoc multiple range test. Significant changes are calculated as

* p<0.05, ** p<0.01, *** p<0.001 compared to control group; a p<0.05, b p<0.01,

c p<0.001 compared to Ethanol group. ns – non significant results.

Results

99

6.1.4. Effect of Hesperidin and Ascorbic acid against Ethanol

induced oxidative stress in rat liver.

The effects of Hesperidin and Ascorbic acid on the activities of

Lipid peroxidation (TBARS) in liver was depicted in fig 12. The lipid

peroxidation study revealed that the level of TBARS was significantly

increased (p<0.001) in ethanol intoxicated group, when compared to

that of control group.

Alternatively, co treatment with either HDN or AA significantly

(P<0.001) reduced the level of TBARS when compared to ethanol

group. Similarly, co treatment with the combination of both HDN and AA

effectively (P<0.001) ameliorate the lipid peroxidative damage induced

by ethanol by reducing level of TBARS in liver. Furthermore, treatment

with silymarin significantly (P<0.001) reduced the TBARS level when

compared to the ethanol intoxicated group.

6.1.5 Effect of Hesperidin and Ascorbic acid on antioxidant

enzymes in the liver of Ethanol intoxicated rats.

Table 5 shows the effects of Hesperidin and Ascorbic acid on the

enzymatic and non enzymatic antioxidant enzymes in the liver of

ethanol induced hepatotoxic rats. Administration of ethanol significantly

(p<0.001) reduced the level of enzymatic and non enzymatic

antioxidants such as SOD, CAT, GSH, VIT C and VIT E when

compared to control rats.

Results

100

Conversely, the animals supplemented with HDN markedly

increased the level of SOD (p<0.001), CAT (p<0.001), GSH (p<0.001),

VIT E (p<0.001) and VIT C (p<0.01) when compared to the ethanol

administered group. Similarly in the AA supplemented group the level of

antioxidant enzymes like SOD (p<0.01), CAT (p<0.001), GSH

(p<0.001), VIT E (p<0.001) and VIT C (p<0.001) were found to be

moderately enhanced when compared to the ethanol group.

However, the combination of HDN and AA effectively (p<0.001)

restored the antioxidant enzymes to their normal levels when compared

to the individual treatment with either HDN / AA and protect the liver

from the oxidative damage. Standard drug Silymarin (p<0.001)

significantly restored the antioxidant enzyme to their normal levels when

compared to ethanol administered group.

Results

101

Table 5: Effect of Hesperidin and Ascorbic acid on the antioxidant enzymes in the liver of


TISSUE CONTROL ETHANOL(EtOH) EtOH +HDN EtOH +AA EtOH +HDN+AA EtOH +SLY

SOD 18.59±0.77 8.99±0.62*** 14.17±0.21 c 13.38 ±1.02 b 17.68 ±0.67 c 16.97±1.52 c

CAT 55.20±4.16 20.39 ±1.08*** 45.95±1.74 c 43.95 ±1.48 c 50.15 ±0.84 c 51.81±1.47 c

GSH 83.52±2.52 37.91±1.56*** 69.47 ±0.84 c 64.79 ±1.81 c 77.74 ±0.87 c 80.36 ±0.66 c

VIT C 2.31±0.18 1.02 ±0.10*** 1.53b ±0.10 b 2.16 ±0.08 c 2.35 ±0.21 c 2.32 ±0.14 c

VIT E 8.18±0.17 3.24±0.04*** 4.48 ±0.41 c 6.04 ±0.15 c 8.04 ±0.28 c 7.82±0.53 c

SOD- (units/mg protein/min), CAT - (μm of H2O2 consumed /min/ mg protein), GSH (μg /mg protein), VIT

C (mg/g of wet tissue), VIT E (mg/g of wet tissue).

Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by Tukey HSD Post hoc

multiple range test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001 compared

to control group; a p<0.05, b p<0.01, c p<0.001 compared to Ethanol group. ns – non significant results.

Results

102

6.1.6. Histopathological analysis:

The Histopathological examinations of the rat liver are

represented in fig (13). The liver of the control rats showed normal

architecture with well-preserved hepatocytes, well demarcated

sinusoids without any signs of inflammatory changes (Fig. 13.1).

This is in contrast to the features observed in the liver of hepatotoxic

rats. There was a drastic alteration in liver architecture ranging from

extensive central vein congestion; distended hepatocytes, sinusoidal

congestion and disruption of lobular architecture were seen in the

Ethanol intoxicated rats (Fig. 13.2).

In contrast, rats treated with either HDN (Fig. 13.3) / AA (Fig.

13.4) showed mild sinusoidal congestion with almost near normal

architecture. In addition, rats supplemented with the combination of both

HDN and AA shows normal liver architecture by attenuating the above

mentioned changes induced by Ethanol and protect the liver from

ethanol induced injury (Fig 13.5). Standard drug silymarin treatment

shows the normal liver architecture (Fig 13.6).

Results

103

Fig 13: Effect of Hesperidin and Ascorbic acid on histopathological

changes induced by ethanol in rat liver (H and E stain, 400X).

Fig 13.1: CONTROL Fig 13.2: ETHANOL

Fig 13.3: ETHANOL +HDN Fig 13.4: ETHANOL+AA

Fig 13.5: ETHANOL+HDN+AA Fig 13.6: ETHANOL+SLY

Results

104

6.2. Effect of Hesperidin and Ascorbic Acid on Antitubercular Drug

Induced Hepatotoxicity

6.2.1: Effect of Hesperidin and Ascorbic acid on serum

biochemical markers in Antitubercular drug (HRZ) induced

hepatotoxic rats.

The level of Total protein (TP), Albumin, Bilirubin, urea and

creatinine were shown in the table 6. The serum level of total protein

(P<0.001) and albumin (P>0.05) were significantly diminished in HRZ

administered rats when compared to the normal control rats. On the

otherhand the serum level of urea, creatinine and bilirubin were

significantly (p<0.001) elevated in HRZ administered group when

compared to control group.

Conversely co treatment with HDN along with HRZ significantly

raised the serum level of TP (p<0.05) and Albumin (p>0.05) and

subsequently decreased the level of bilirubin (p>0.05), urea (p<0.01)

and creatinine (p<0.05) when compared to HRZ administered group.

Similarly, Ascorbic acid (AA) treatment with HRZ moderately enhanced

the level of Total protein (p<0.01) and Albumin (p>0.05) and

subsequently diminished the level of bilirubin (p<0.001), urea (p<0.001)

and creatinine (p<0.01) when compared to HRZ administered group.

However concurrent treatment with the combination of both HDN

and AA significantly (p<0.001) reversed all the above changes induced

Results

105

by HRZ and restored their level to normal. Moreover the effect will be

higher in combined therapy (HDN+AA+HRZ) when compared to the

individual therapy (HRZ+ HDN, HRZ+AA). Standard drug silymarin also

significantly (p<0.001) reversed all the changes induced by HRZ.

Results

106

Table 6: Effect of Hesperidin and Ascorbic acid on serum Total protein, Albumin, Bilirubin, Urea and

Creatinine in antitubercular drug induced hepatotoxic rats.

SERUM CONTROL HRZ HRZ+HDN HRZ+AA HRZ+HDN+AA HRZ+SLY

TP g/dl 11.60 ±0.63 5.54±0.37*** 7.27 ±0.58 a 7.82 ±0.66 b 11.25 ±0.44 c 11.49 ±0.82 c

Albumin g/dl 47.47 ±1.62 42.81 ±2.19 ns 43.82 ±0.92 ns 44.65±0.92 ns 47.93±1.57 a 45.86 ±0.64 ns

Bilirubin mg/dl 1.87 ±0.15 4.65±0.61*** 3.61 ±0.26 ns 2.46 ±0.56 c 2.09±0.15 c 2.45 ±0.49c

Urea mg/dl 26.16 ±0.86 53.49±2.16*** 46.81 ±1.40 b 40.46 ±1.68 c 31.23±1.40 c 27.35 ±1.41 c

Creatinine mg/dl 1.42 ±0.12 4.66 ±0.27*** 3.44 ±0.37 a 2.89±0.73 b 2.10 ±0.61 c 1.46 ±0.10 c

Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by Tukey HSD Post

hoc multiple range test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001

compared to control group; a p<0.05, b p<0.01, c p<0.001 compared to HRZ group. ns – non

significant results.

Results

107

6.2.2. Effect of Hesperidin and Ascorbic acid on liver marker

enzymes in serum of antitubercular drugs (HRZ) intoxicated rats.

Table 7 provides the serum level of liver marker enzymes in the

control and experimental rats. In the present study the serum levels of

liver specific marker enzymes namely ALT (p<0.001), AST (p<0.001),

ALP (p<0.001), ACP (p<0.01), LDH (p<0.001) and ϒ-GT (p<0.001)

were significantly enhanced in HRZ intoxicated rats in comparison with

that of control rats. Conversely, co treatment with HDN significantly

diminished the level of liver marker enzymes namely ALT (p>0.05), AST

(p<0.05), ALP (p>0.05), ACP (p>0.05), LDH (p<0.05) and ϒ-GT

(p<0.01) when compared to the HRZ group.

On the otherhand, co treatment with AA significantly decreased

the level of liver marker enzymes AST (p<0.01), ALT (p<0.01), ALP

(p>0.001), ACP (p>0.01), LDH (p<0.05) and ϒ-GT (p<0.01) when

compared to the HRZ group. Moreover, co treatment with the

combination of both HDN and AA more pronouncedly (p<0.001)

restored the liver marker enzymes almost to the normal range. However

the treatment effect found to be higher in the combined therapy

(HRZ+HDN+AA) when compared to the individual therapy (HRZ+HDN

and HRZ+AA). The combined treatment of HDN+AA+HRZ was shown

significant effect which is almost similar to the effect of standard drug

Silymarin.

Results

108

Table 7: Effect of Hesperidin and Ascorbic acid on liver marker enzymes in serum of the

antitubercular drugs (HRZ) intoxicated rats.

SERUM(IU/L) CONTROL HRZ HRZ+HDN HRZ+AA HRZ+HDN+AA HRZ+SLY

AST 7.55 ±0.38 11.62±0.18*** 9.39±0.13b 9.95 ±0.42a 8.26 ±0.76c 8.51±0.81 c

ALT 38.36 ±1.63 46.64±1.15*** 41.86±0.78b 42.58 ±0.49ns 39.40±1.09c 40.57±0.84 c

ALP 202.97 ±12.64 296.8 ±10.2*** 260.02±4.30ns 255.16 ±10.71b 219.09±14.21c 211.84±11.87 c

ACP 51.81 ±4.82 62.77±1.67** 56.21 ±1.40ns 58.02 ±2.36ns 53.00±1.98a 52.76 ±3.25 a

LDH 1.64 ±0.13 4.55±0.48 *** 3.25±0.27a 3.95 ±0.05ns 2.28±0.68 c 2.31±0.37c

γ -GT 3.1 ±0.78 8.79 ±0.89*** 5.89 ±0.53 b 6.21±0.45b 3.76±0.46 c 3.64 ±0.51 c

Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by Tukey HSD Post hoc

multiple range test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001 compared

to control group; a p<0.05, b p<0.01, c p<0.001 compared to HRZ group. ns – non significant results.

Results

109

6.2.3. Effect of Hesperidin and Ascorbic acid against antitubercular

drug induced oxidative stress in rat liver.

Antitubercular drug induced peroxidative damage is determined

by measuring the level of oxidative stress markers like TBARS, CDs

and LHP. Our data revealed that administration of antitubercular drugs

(HRZ) drastically (p<0.001) enhanced the level of TBARS, CDs and

LHP in liver when compared to the control group (Fig 14, 15).

In contrast, concurrent treatment with HDN moderately reduced

the level of TBARS (p<0.001), LHP (p<0.01) and CDS (p<0.001) when

compared to the HRZ group. Similarly in AA cotreatment group the level

of TBARS (p<0.01), LHP (p<0.001), CDS (p<0.001) were found to be

significantly diminished when compared to the HRZ administered group.

However, cotreatment with the combination of both HDN and AA

more efficiently (p<0.001) reduced the level of lipid peroxidative markers

to near normalcy as compared with that of individual treatment

(HRZ+HDN, HRZ+AA). In addition, Silymarin co treatment significantly

(p<0.001) reversed the level of TBARS, CDs and LHP to normal

compared to the HRZ intoxicated group.

Results

110

Fig 14: Effect of Hesperidin and Ascorbic acid on oxidative stress

markers (TBARS) in liver of antitubercular drug induced hepatotoxic

rats.

Fig 15: Effect of Hesperidin and Ascorbic acid on liver oxidative stress

markers (LHP and CD) in antitubercular drug induced hepatotoxic rats.

Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by

Tukey HSD Post hoc multiple range test. Significant changes are calculated as

* p<0.05, ** p<0.01, *** p<0.001 compared to control group; a p<0.05, b p<0.01,

c p<0.001 compared to HRZ group. ns – non significant results.

Results

111

6.2.4. Effect of Hesperidin and Ascorbic acid on enzymatic and non

enzymatic antioxidant in antitubercular drug induced hepatotoxic

rats.

The effects of HDN and AA on the antioxidant status of rat liver

are represented in the table 8 and fig 16. The levels of enzymatic

(SOD, CAT, GST, GPx, GR) and nonenzymatic antioxidants (GSH, VIT

C and VIT E) were drastically reduced (p<0.001) in HRZ group in

comparison to the control groups. However, the HRZ-induced

impairment in these enzyme activities (SOD (p<0.001), CAT (p<0.001),

GST (p>0.05), GSH (p<0.001), GPx (p<0.01), GR (P<0.001), VIT C

(p<0.001) and VIT E (p>0.05)) were significantly enhanced by

concurrent treatment with HDN. Similarly co treatment with AA

significantly enhanced the level of antioxidant enzyme SOD (p<0.01),

CAT (p<0.01), GPx (p<0.01), GR (P<0.001), GST (p<0.001), GSH

(p<0.001), VIT C (p<0.001) and VIT E (p<0.05) when compared to the

HRZ administered group.

Moreover, the combined effect of HDN+AA was more efficiently

(p<0.001) attenuated all the changes induced by antitubercular drugs

and restore the antioxidant levels to their normal level compared to the

HDN or AA alone treatment. Standard drug silymarin also significantly

(P<0.001) increased the level of antioxidant to near normal level.

Results

112

Table 8: The effect of hesperidin and ascorbic acid on enzymatic and non enzymatic antioxidant in


TISSUE CONTROL HRZ HRZ+HDN HRZ+AA HRZ+HDN+AA HRZ+SLY

SOD 12.38±0.83 3.28±0.27*** 7.28 ±0.92 c 6.43 ±0.36 b 11.11 ±0.91 c 11.41±0.79 c

CAT 66.44±3.27 38.82±1.93*** 54.23 ±3.62 c 52.28 ±1.95 b 62.43 ±3.25 c 62.90 ±1.75 c

GR 7.58±0.46 3.77±0.04*** 6.64 ±0.08 c 5.96 ±0.07 c 7.02 ±0.22 c 7.80 ±0.27 c

GPx 82.97±5.25 46.14±2.24*** 56.94 ±1.10 b 60.43±1.50 b 78.07±2.56 c 80.04 ±2.08 c

GST 24.36±1.12 6.32±0.95*** 16.77±0.51 ns 15.77 ±3.37 c 18.44 ±1.08 c 20.44±0.60 c

GSH 73.78 ±4.35 23.69±0.52*** 41.59 ±1.74 c 44.39 ±0.91 c 54.58 ±2.01 c 65.43±1.68 c

SOD-(units/mg protein/min), CAT (μm of H2O2 consumed /min/ mg protein), GSH (μg /mg protein). GR (μg/mg

protein /min), GPx (μg of GSH utilized/ mg protein /min), GST (mmoles of CDNB conjugate formed /min/mg

protein), VIT C (mg/g of wet tissue), VIT E (mg/g of wet tissue).

Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by Tukey HSD Post hoc

multiple range test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001 compared to

control group; a p<0.05, b p<0.01, c p<0.001 compared to HRZ group. ns – non significant results.

Results

113

Fig 16: Effect of Hesperidin and Ascorbic Acid on antioxidant Vitamin C and

Vitamin E in the liver of antitubercular drug induced hepatotoxic rats.

Fig 17: Effect of Hesperidin and Ascorbic acid on serum Total cholesterol and

triglycerides in antitubercular drug induced hepatotoxic rats.

Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by

Tukey HSD Post hoc multiple range test. Significant changes are calculated as *

p<0.05, ** p<0.01, *** p<0.001 compared to control group; a p<0.05, b p<0.01, c p<0.001 compared to HRZ group. ns – non significant results.

Results

114

6.2.5. Effect of Hesperidin and Ascorbic acid on serum lipid profile

in antitubercular drug induced hepatotoxic rats.

The level of serum lipid profile LDL (p<0.001), VLDL (p<0.001),

FFA (p<0.001) were significantly increased (table 9) where as the level

of HDL (p<0.001), phospholipids (p<0.01) levels were significantly

decreased in HRZ administered group when compared to the control

group. Furthermore, there was a significant rise in the level of Total

Cholesterol (p<0.01), Triglycerides (p<0.001) in HRZ intoxicated rats

compared to the control rats (fig 17).

In contrary, the group supplemented with HDN significantly

reduced the level of LDL (p<0.01), VLDL (p>0.05), TC (p>0.05), TG

(p>0.05), FFA (p<0.001) and subsequently enhanced the level of HDL

(p>0.05) and Phospholipids (p>0.05). Similarly, AA supplement with

HRZ intoxicated group the level of LDL (p<0.05), VLDL (p>0.05), TC

(p>0.05), TG (p>0.05), FFA (p<0.001) were significantly decreased

whereas the level of HDL (p<0.05) and Phospholipids were significantly

increased (p>0.05) when compared to HRZ group.

Furthermore the group supplemented with both HDN and AA

significantly reversed all the changes induced by antitubercular drug

(HRZ) by diminished level of LDL (p<0.001), VLDL (p<0.001), TC

(p>0.05), TG (p<0.001), FFA (p<0.001) and subsequently enhanced the

level of HDL (p<0.05) and Phospholipids (p>0.05).

Results

115

However combined therapy, showed more significant (P<0.001)

effect against hyperlipidemia-induced by HRZ when compared to the

individual therapy. Treatment with silymarin significantly (P<0.001)

ameliorates the hyperlipidaemia induced by HRZ.

Results

116

Table 9: Effect of Hesperidin and Ascorbic acid on serum lipid profile in


Results are expressed as mean ± SD (n= 6 animals); one way ANOVA; followed by Tukey HSD Post

hoc multiple range test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001

compared to control group; a p<0.05, b p<0.01, c p<0.001 compared to HRZ group. ns – non

significant results.

SERUM-mg/dl CONTROL HRZ HRZ+HDN HRZ+AA HRZ+HDN+AA HRZ+SLY

HDL 69.44 ±5.15 32.68 ±2.85*** 41.22 ±8.23 ns 45.38±2.25 a 63.68±2.06 c 66.37±1.05 c

LDL 6.93 ±0.51 37.45±2.32*** 27.53±1.24 b 22.86±2.01 a 9.39±0.25 c 8.02 ±0.99 c

VLDL 16.39 ±0.41 20.66±0.45*** 20.13 ±1.01 ns 19.43 ±0.69 ns 16.65±0.66 c 17.26 ±0.21 c

PHOSPHOLIPIDS 12.11 ±0.15 6.15±0.34* 8.73±0.41 ns 7.21 ±0.001 ns 9.33±0.10 ns 12.70 ±3.20 b

FFA 41.04 ±5.60 76.00±4.10*** 62.39 ±2.53 a 54.06 ±3.87 c 45.26±1.90 c 46.71 ±6.11 c

Results

117

6.2.6. Effect of Hesperidin and Ascorbic acid on membrane bound

ATPase enzymes in Antitubercular drug induced hepatotoxic rats.

Activities of membrane bound ATPase (Na+K+ ATPase,

Ca2+ATPase and Mg2+ ATPase) were represented in the fig (18,19).

There was a significant reduction in the activities of Na+K+ ATPase

(P<0.001), Mg2+ ATPase (P<0.001) and Ca2+ ATPase (P<0.001) in the

liver of HRZ administered rats as compared to the control rats.

On the otherhand, concurrent treatment with Hesperidin

significantly (P<0.001) increased the level of Na+K+ ATPase (P>0.05),

Ca2+ ATPase (P>0.05) and Mg2+ ATPase (P<0.001) compared to that of

HRZ group. Similarly co treatment with Ascorbic acid significantly

elevated the level of Na+K+ ATPase (P<0.01), Ca2+ ATPase P<0.01)

and Mg2+ ATPase (P<0.001) when compared to the HRZ group.

Moreover treatment with the combination of both Hesperidin and

Ascorbic acid significantly maintained the level of Na+K+ ATPase

(P<0.001), Ca2+ ATPase (P<0.001) and Mg2+ ATPase (P<0.001) near to

normal status when compared to the HRZ administered rats. The

concurrent treatment with Silymarin significantly (p<0.001) elevated the

level of membrane bound ATPase to near normal level.

Results

118

Fig 18: Effect of Hesperidin and Ascorbic acid on membrane bound Na+K

+ ATP ase

enzymes in liver of Antitubercular drug induced hepatotoxic rats.

Fig 19: Effect of Hesperidin and Ascorbic acid on membrane bound Ca 2+

and Mg 2+

ATP ase enzymes in liver of Antitubercular drug induced hepatotoxic rats.

Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by Tukey

HSD Post hoc multiple range test. Significant changes are calculated as * p<0.05,

** p<0.01, *** p<0.001 compared to control group; a

p<0.05, b

p<0.01, c

p<0.001

compared to HRZ group. ns – non significant results.

Results

119

6.2.7. Histopathological examination

Histopathological examination had been carried out in the liver

tissue of control and experimental groups of rats to confirm the

cytoprotective nature of HDN and AA against HRZ-induced liver

damage. In the present examination the control liver sections showed

normal hepatocytes architecture without any signs of hepatic damage

(Fig 20.1).

Conversely, antitubercular drugs induced changes in liver

architecture was indicated by dilatation & congestion in the central vein,

periportal tract inflammation, sinusoidal widening, apoptotic and necrotic

bodies around Central vein (Fig 20.2).

In contrast, HDN / AA (Fig 18.4) supplement with HRZ

(HRZ+HDN, HRZ+AA) showed mild congestion around the central vein

(Fig 20.3, 20.4). However treatment with the combination of both HDN

and AA (Fig 20.5) protect the hepatocyte from the HRZ induced

aberrations in the hepatic structure and showed normal hepatocytes.

Standard drug Silymarin also shows the normal liver architecture (Fig

20.6) without any changes in hepatocytes architecture.

Results

120

Fig 20: Effect of Hesperidin and Ascorbic acid on histopathological

changes induced by antitubercular drug in rat liver (H&E stain, 400X).

Fig 20.1: CONTROL Fig 20.2: HRZ

Fig 20.3: HRZ +HDN Fig 20.4: HRZ+AA

Fig 20.5: HRZ +HDN+AA Fig 20.6: HRZ +SLY

Results

121

6.2.8. Effect of Hesperidin and Ascorbic acid on HRZ induced

Apoptosis.

6.2.8.1. Western blotting analysis on the protein expression Bax,

Bcl-2, caspase 3 and caspase 9.

The protein expression of Bax and Bcl-2 were shown in Fig 21.

Administration of HRZ significantly increased the protein expression of

proapoptotic Bax and subsequently decreased the protein expression of

antiapoptotic Bcl-2. Conversely, concurrent treatment with either

Hesperidin or Ascorbic acid moderately decreases the expression of

Bax and subsequently increases the expression of Bcl-2 when

compared to the HRZ group. Moreover combined treatment with both

Hesperidin and Ascorbic acid more significantly ameliorate the HRZ

induced apoptosis by decreased the expression of Bax and increased

the expression of Bcl-2. Silymarin also restore the balance between

proapoptotic Bax and antiapoptotic Bcl-2 expression.

The protein expression of caspases was shown in the Fig 22. In

our western blotting analysis administration of HRZ significantly

increased the expression of caspase 3 and caspase 9. However co-

administration of either HDN/ AA significantly diminished the HRZ

induced expression of caspase 3 and caspase 9. Moreover the

combined treatment with both Hesperidin and Ascorbic acid shows

more pronounced effect by ameliorating HRZ induced expression of

Results

122

caspase 3 and caspase 9 compared to the individual treatment with

either HDN/ AA alone. Standard drug Silymarin also significantly

(p<0.001) reversed the HRZ induced caspase activation.

Fig 21: Western blotting analysis on the protein expression of

Bax and Bcl-2.

Fig 22: Western blotting analysis on the protein expression of

caspase 3 and caspase 9.

Results

123

6.2.8.2. RT-PCR Analysis on the mRNA expression of Bax, Bcl-2,

Caspase 3 and Caspase 9.

The mRNA expressions of Bcl-2 and Bax were represented in

the fig 23. Our results showed that HRZ administration upregulated the

expression of Bax and subsequently down regulated the expression of

Bcl-2 when compared to the control, which indicated that the liver was

acutely injured. However, concurrent treatment with either Hesperidin or

Ascorbic acid significantly reduced the expression of BAX and

enhanced the expression of Bcl-2 when compared to the HRZ group.

But combination of both Hesperidin and Ascorbic acid treatment

ameliorated the HRZ induced changes in mRNA expression which is

evidenced by down regulation of BAX and up regulation of Bcl-2. On the

otherhand silymarin attenuated the changes induced by HRZ by

maintaining the balance between pro and antiapoptotic factor.

The mRNA expression of caspase 3 and caspase 9 were

represented in the fig 24. Our RT PCR analysis shown that, the

mRNA expression in the level of caspase 3 and caspase 9 were

significantly increased in the liver of HRZ administered group when

compared to the control group. However concurrent treatment with

either Hesperidin or Ascorbic acid markedly down regulated the mRNA

expression of caspase 3 and 9 when compared to the HRZ intoxicated

rats.

Results

124

Fig 23: RT-PCR Analysis on the mRNA expression of Bcl-2 and Bax.

Fig 24: RT-PCR Analysis on the mRNA expression of

caspase 3 and caspase 9.

Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by

Tukey HSD Post hoc multiple range test. Significant changes are calculated as *

p<0.05, ** p<0.01, *** p<0.001 compared to control group; a p<0.05, b p<0.01,

c p<0.001 compared to HRZ group. ns – non significant results.

Results

125

Moreover co treatment with the combination of both HDN and AA more

effectively down regulated the expression of caspase 3 and caspase 9

and restore their level to normal when compared to the HRZ group.

However, the combined treatment with Hesperidin and Ascorbic

acid restored the apoptotic marker to near normal level when compared

to the individual treatment with either HDN or AA alone. Standard drug

Silymarin also restores the level of caspase 3 and 9 to near normal

level.

6.2.9. Effect of Hesperidin and Ascorbic acid on DNA

Fragmentation induced by HRZ induced hepatotoxic rats.

DNA fragmentation assay represented in the fig 25. Control group

shows an intact DNA without any laddering (G1) On the otherhand in

the HRZ administered group, there was substantial increase in the

internucleosomal DNA fragmentation evident from laddering pattern in

agarose gel (G2). However, co treatment with HDN was not able to

attenuate the HRZ induced DNA fragmentation (G3).

In contrast, cotreatment with AA (G4) attenuated the DNA

fragmentation induced by HRZ. Moreover in the group cotreated with

combination of both HDN+AA (G5) substantially prevented the DNA

fragmentation which is evident by the absence of DNA laddering

pattern. On the otherhand treatment with silymarin (G6) ameliorated

the DNA fragmentation induced by HRZ.

Results

126

Fig 25: Effect of Hesperidin and Ascorbic acid on DNA Fragmentation.

Fig 26: Western blotting analysis on the Protein expression of

TNF-α, NF-kB and IL-10.

Results

127

6.2.10. Effect of Hesperidin and Ascorbic acid on HRZ induced

inflammation.

6.2.10.1 Western blotting analysis on the Protein expression of

inflammatory markers.

Western blotting results shows the anti-inflammatory effect of

Hesperidin and Ascorbic acid on protein expression of HRZ induced

inflammation in liver (fig 26). The inflammatory markers like TNF-α, NF-

kB and IL-10 were significantly up regulated in HRZ administered group

when compared to the control group.

However co administration with either HDN or AA moderately

down regulated the expression of these inflammatory proteins when

compared to HRZ administered rats. Moreover the combination of both

HDN and AA effectively down regulated the HRZ induced inflammatory

markers compared to the individual treatment with either HDN or AA.

Standard drug Silymarin also significantly down regulated the

inflammatory proteins.

6.2.10.2: RT-PCR Analysis on the mRNA expression of

inflammatory markers.

Fig 27 shows the mRNA expression of the inflammatory markers.

The mRNA expressions of the inflammatory markers (TNF-α, NF-κB)

and anti-inflammatory marker (IL-10) were significantly upregulated in

Results

128

HRZ intoxicant group compared to the control group. In contrast,

treatment with either HDN or AA significantly attenuated the HRZ-

induced expression of mRNA levels of inflammatory markers. However,

HRZ+HDN+AA and HRZ+ Silymarin treatment more markedly

ameliorated the HRZ inflammation when compared to the other

treatment group.

Results

129

Fig: 27: RT-PCR Analysis on the mRNA expression of TNF-α, NF-kB and IL-10.

Results are expressed as mean ± SD (n=6 animals); one way ANOVA; followed by Tukey HSD Post hoc multiple range

test. Significant changes are calculated as * p<0.05, ** p<0.01, *** p<0.001 compared to control group; a p<0.05,

b p<0.01, c p<0.001 compared to HRZ group. ns – non significant results.

Disscussion

130

7. DISCUSSION

The present study was aimed to investigate the protective effect

of Hesperidin and Ascorbic acid against Ethanol and Antitubercular drug

(HRZ) induced hepatotoxicity in rats.

Drug-induced liver disorders occurred frequently and can be life

threatening. It is mediated mainly through the induction of Oxidative

stress which is occasioned by the formation of highly reactive/toxic

intermediates and reactive oxygen species (Balamurugan, 2007). The

catastrophic free radical events such as lipid peroxidation, protein

oxidation and DNA oxidation are the main causes for the cell death in

realistic in vivo condition. The antioxidant defense arsenal in liver cells

is capable of detoxifying free radicals and repair damage resulting from

highly reactive metabolites (Jaeschke et al., 2003). However, when the

antioxidant defense system is overwhelmed, free radicals may inflict

direct oxidative damage to cellular macromolecules, leading to cell

death (Sabiu et al., 2014).

Timely intervention with exogenous antioxidants augments the

cellular defense system to prevent these ill effects on the cellular

macromolecules. Numerous studies have reported the antioxidant and

cytoprotective effects of Hesperidin and Ascorbic acid (Ahmad et al.,

2012; Mor and Ozmen, 2010). Hence the present study demonstrates

the antioxidant and hepatoprotective potentials of Hesperidin and

Disscussion

131

Ascorbic acid against Ethanol and Antitubercular drug induced oxidative

damage in rat liver.

This study demonstrates for the first time, that the combination of

both Hesperidin and Ascorbic acid effectively prevented ethanol and

antitubercular drugs induced hepatotoxicity.

ETHANOL INDUCED HEAPTOTOXICITY

Ethanol is a natural product with characterized psychophysical

and mood-altering effects which has been available for human

consumption for thousands of years. More than ever before, there is an

upsurge in alcohol abuse; hence alcohol related disorders are becoming

increasingly important causes of morbidity and mortality globally.

Ethanol is metabolised by a number of metabolizing enzyme

systems in the liver by both oxidative and non oxidative pathways

(Samir Zakhari, 2006). During its metabolism acetaldehyde produced by

ADH reaction and ROS by CYP2E1 oxidation will interact with proteins,

lipids, DNA and other biomolecules in the cell to induce oxidative stress.

Neutralisation of this toxic metabolite and ROS are considered to be the

initial therapy in alcohol related liver disorder.

As the majority of serum proteins were synthesised in the liver,

any alteration in the serum proteins was used as an indicator for liver

injury. The reactive metabolite of ethanol (Acetaldehyde) preferably

Disscussion

132

interacts with certain proteins and form stable or unstable protein

adducts.

Albumin is a major protein of the blood and one of its significant

functions is to transport fatty acids from adipose tissue. Therefore,

altered albumin function could impair tissue access to energy from fatty

acid oxidation (Samir Zakhari, 2006). Ethanol consumption reduced the

rate of catabolism of protein in liver due to oxidative stress.

Hypoalbuminemia is a common feature of alcoholic liver disease. In our

present study ethanol significantly reduced the level of serum protein

and albumin. This could be due to the formation of acetaldehyde protein

adducts which will disturb the liver and diminish the protein synthesis.

The findings of our result indicated that the capacity of the liver to

synthesis protein was affected by alcohol. Severe alcoholic hepatitis is

indicated by the increased level of bilirubin and decreased level of

circulating proteins (Luis et al., 2003).

Conversely, concurrent treatment with Hesperidin and / or

ascorbic acid stabilizes the serum protein and albumin levels thereby

improving the functional status of the liver.

The excess alcohol drinking will disturb the cell membrane along

with the release of cytoplasmic enzymes into the systemic circulation.

Laboratory test often assists in the diagnosis of Alcoholic liver diseases.

The elevated levels of liver marker enzyme like AST, ALT etc.; in almost

Disscussion

133

all the alcoholic patient clearly indicates the liver injury. In our present

study ethanol intoxication significantly increased the level of liver marker

enzymes like Bilirubin, AST, ALT, ALP and LDH in serum when

compared to the control group (Adewusi et al., 2010). Bilirubin is the

sensitive marker used in the diagnosis of liver disease. Abnormal

bilirubin level clearly indicates the impairment of functional capacity of

the liver.

Research evidence stated that ethanol induced peroxidative

damage to the cell membrane alter the membrane permeability and

functional integrity of the hepatocytes. This will translocate the cellular

content into circulation. Accordingly, Adewusi et al. (2010), Bautista,

(2001), Gaskill et al. (2005) reported that release of transaminases

(AST and ALT) and lactate dehydrogenase (LDH) from the cell cytosol

can occur secondary to cellular necrosis. In accordance with the earlier

reports, our Histopathological results shows the presence of necrotic

damage in the ethanol intoxicated rats which altered the membrane

integrity and cause leakage of liver specific marker enzymes into the

systemic circulation. Hence the serum levels of liver marker enzymes

are elevated in the present study.

Conversely, co treatment with HDN and / or AA significantly

reduced the enzyme activities in rats suggesting that both these

compounds were able to ameliorate the deleterious effects of ethanol by

inhibiting the peroxidative damage, thereby stabilising the membrane as

Disscussion

134

well as protecting the hepatocytes from necrotic damage. The effects

were more pronounced in the rats treated with the combination of both

HDN and AA compared to the individual treatment with either HDN or

AA alone.

Hesperidin is a bioflavanoid having radical scavenging property

scavenges the ROS formed during ethanol metabolism. On the

otherhand Ascorbic acid also scavenges the ROS by its antioxidant

property and act synergistically with the flavonoid HDN. The synergistic

action of HDN and AA enhanced the antioxidant defense mechanism,

stabilised the hepatocytes cell membrane and prevented the

acetaldehyde induced peroxidative damage to the hepatocytes. Hence

the membrane stabilising effect of HDN and AA was indicated by the

decreased level of liver marker enzymes in the circulation. Accordingly,

the membrane protective effect of Hesperidin and ascorbic acid were

reported by Pari et al. (2014), Sabiu et al. (2015).

Liver plays a central role in the synthesis and metabolism of

lipids. Hyperlipidaemia is an important complication of alcohol induced

liver injury. Early reports state that ethanol administration can produce

accumulation of cholesterol and triglycerides in the liver as well as in the

serum (Parmar et al., 2009). In our present study ethanol significantly

increased the level of triglycerides and total cholesterol when compared

to the control group. This might be due to the enhanced activity of HMG

CoA reductase enzyme which catalyzes the cholesterol biosynthesis in

Disscussion

135

the liver (Wu et al., 2011) or it may be due to the diminished activity of

the lecithin cholesterol acyl transferase enzyme (LCAT) involved in the

esterification of cholesterol in plasma.

However the significant increase in the serum triglycerides in

ethanol treated animals signifies a simultaneous accumulation of

lipoproteins. This might be due to decreased activity of lipoprotein

lipase, which is involved in the uptake of triglycerides rich lipoprotein by

extra hepatic tissue. On the otherhand, it is reported that increased

synthesis or decreased lipid deposition or both result in simultaneous

accumulation of triglycerides in the serum (Ringseis et al., 2007). The

imbalance in the lipid metabolism plays a role in aggravating the lipid

peroxidation (Makni M et al., 2010).

In contrary, co treatment with Hesperidin and / or Ascorbic acid

decreased the serum level of TC and TG. The antioxidant property

could also contribute to the protection of membrane lipids from free

radical, thereby HDN +/ AA attenuated the abnormal dispersion of

membrane lipids in circulation as well as reduced the excessive

generation of more toxic peroxides. This will drastically reduce the level

of TG and TC. However the combination of both HDN and AA

treatment shows better antilipidemic effect when compared to the

individual treatment with either HDN or AA alone. This implies the

synergistic action of Hesperidin and Ascorbic acid. The lipid lowering

effect of hesperidin was studied by MM El-Shafey and MF Abd-Ellah,

Disscussion

136

(2014). Similarly Aleisa et al. (2013), Eteng et al. (2006) in their study

demonstrated the antilipidaemic effect of ascorbic acid.

Ethanol or its metabolites (Acetaldehyde) alters the peroxidative

balance of the liver towards autoxidation, either by acting as pro-oxidant

or by lowering the cellular antioxidant level. On the otherhand the

acetaldehyde oxidation and ROS generation (superoxide and hydroxyl

radicals) by ADH/ALDH and CYP2E1 produces harmful effects

(Comporti et al., 2010; You and Crabb, 2005). This ROS contributes to

alcohol-induced oxidative damage to a variety of tissues by causing

oxidative stress and also enhances the apoptosis triggered by various

stimuli. ROS in association with acetaldehyde induced lipid peroxidation

which is considered to play a pivotal role in the mechanism by which

ethanol may exert its toxic effects on the liver and other extra hepatic

tissues (Bautista, 2001; Nordmann, 1994).

In the present study, ethanol induced peroxidative damage is

evidenced by increased levels of TBARS in liver. Accordingly Bautista,

(2001) reported that ethanol enhanced the level of hepatic lipid

peroxidation due to free radical injury. During ethanol metabolism the

CYP 450 catalytic cycle use NADPH to reduce O2 leading to the

production of ROS (Sid et al., 2013). The prolonged exposure of ethanol

increased the generation of ROS thereby inducing the peroxidative

damage to the hepatocytes. This might be the reason for observed

Disscussion

137

necrotic changes in the liver. This necrotic damage to the hepatocytes

will alter the membrane permeability which results in the leakage of

serum marker enzymes into the circulation. In contrast, the group

supplemented with HDN+/ AA the level of TBARS was significantly

diminished when compared to the ethanol group. The protective effect

of HDN and AA against ethanol induced peroxidative damage was

mainly mediated by inhibition of free radical generation and also by

enhancement of the radical scavenging action. Our results are in

parallel with that of Ahmad et al. (2012) and Sabiu et al. (2015).

Our body is empowered with an antioxidant defense system

which counteracts the free radical induced peroxidative damage and

protects the body against oxidative stress. This is obtained via

enzymatic (SOD, CAT etc.,) and non enzymatic antioxidants (VIT C, Vit

E and GSH).

Acetaldehyde promotes cell death by depleting glutathione levels

which impair a major antioxidant defense mechanism against oxidative

damage. This reduction may be due to the increased utilization of GSH

and other antioxidants for quenching enormous free radicals produced

during ethanol metabolism. This might be the reason for diminished

level of antioxidants (SOD, CAT, GSH, Vit C and Vit E) in the present

study. The impairment in the enzymatic and non-enzymatic antioxidant

defense systems has been reported in alcoholics and experimental

animals (Rukkumani et al., 2004).

Disscussion

138

Increased LPO and the deficiency of antioxidant on ethanol

exposure might be due to the excess production of ROS so that the

antioxidants are not able to quench them which result in failure of

antioxidant defense system.

Concurrent supplement with HDN +/ AA along with ethanol

impaired the lipid peroxidation (TBARS) and restored the enzymatic and

non enzymatic antioxidant enzymes. Hence the observation in our

present study indicated that Hesperidin and Ascorbic acid are effective

antioxidants in the biological system that mediates its antioxidant effect

by scavenging free radicals and protect the hepatocytes from the

oxidative damage.

In the present study, the protection offered by Hesperidin against

ethanol-induced hepatotoxicity may be generally linked to its beneficial

effects including its ability to scavenge free radicals by inhibiting

antioxidant depletion and potentiating the antioxidant defense

mechanism. These finding of our study are in parallel with the results of

the earlier reported study (Ahmad et al., 2012).

Similarly, the ability of Ascorbic acid to trap free radicals and

protect biological membranes from peroxidative damage by effectively

quenching the reactive oxygen species was reported by Sminorff and

Wheeler, (2000). This might be suggestive of its effect exhibited in the

treatment groups. The previous study reported that ascorbic acid is an

Disscussion

139

excellent electron donor to free radicals which subsequently quench

their deleterious activity on cellular macromolecules, thus playing a role

in antioxidant defense mechanism (Odigie et al 2007; Banerjee et al.,

2009; Sabiu et al., 2015).

Furthermore the peroxidative damage induced by ethanol is

further confirmed by our Histopathological examination. The

microscopic examination shows that ethanol disturbs the lobular

structure along with necrosis in the hepatocytes. Necrosis was due to

ROS produced during ethanol metabolism which acted on the

polyunsaturated fatty acid and initiated peroxidative damage to the

hepatocytes. On the otherhand treatment with HDN+/ AA apparently

annulled degenerative changes caused by ethanol on the architectural

features of hepatocytes. In fact, architectural organization of the

hepatocytes in the animals treated with combination of both HDN and

AA was almost completely restored to normal. This shows the protective

role of HDN and AA against ethanol induced oxidative damage. The

standard drug Silymarin also ameliorated the changes induced by

ethanol and restored their levels to near normal.

Conclusively, the restoration of degenerative changes caused by

ethanol by concurrent treatment with Hesperidin and/or Ascorbic acid as

an indication of their inherent antilipidemic, antioxidant and

hepatoprotective attributes in rats. The effects were more pronounced in

combined treatment with both HDN and AA compared to the individual

Disscussion

140

treatment, which clearly indicates the synergistic effect of Hesperidin

and Ascorbic acid against ethanol induced hepatic damage.

ANTITUBERCULAR DRUGS INDUCED HEPATOTOXICITY

Tuberculosis is a world health issue and the standard treatment

regimen for TB includes Isoniazid, Rifampicin and Pyrazinamide.

Hepatotoxicity is the one of the most serious adverse effect of Anti TB

treatment regimen. This will result in reducing the effectiveness of the

therapy by compromising the tubercular regimen (Khalili et al., 2009). If

this hepatic damage is not recognized earliest it may be fatal (Sarich et

al., 1995). Levels of liver marker enzymes were elevated in 20% of the

patients. Most of the patients adapt to this, and the enzymes come

down to normal. But few patients develop severe liver injury out of

which some may end in liver failure (Peng cheng et al., 2016).

In humans Isoniazid, Rifampicin and Pyrazinamide are the most

effective and basic component in the treatment regimen. Hence in our

present study Isoniazid, Rifampicin and Pyrazinamide are used in

combination to induce liver damage because these drugs were

relatively hepatotoxic and when given in combination their hepatoxic

effect enhanced in synergistic manner (Vijaya Padma et al., 1998).

Anti TB drug mediated hepatotoxicity is through the production of

toxic metabolite in its metabolic pathway. Two major pathways are

involved in Isoniazid (INH) metabolism. In first pathway INH acetylated

Disscussion

141

through N-acetyl transferase 2 (NAT 2) to form acetyl isoniazid and in

second pathway it undergoes hydrolysis by amidases to produce

Isonicotinic acid and Hydrazine. Then the acetyl isoniazid undergoes

hydrolysis to form isonicotinic acid and diacetylhydrazine. These (acetyl

hydrazine and Hydrazine) metabolites are oxidised by CYP2E1 in the

liver, which leads to the formation of reactive oxygen species (ROS)

that triggers oxidative stress and liver damage (Preziosi, 2007 ;Tayal et

al., 2007). Rifampicin is an enzyme inducer and when given in

combination with Isoniazid it stimulates the Isoniazid hydrolase enzyme

thereby enhancing the production of toxic metabolite (hydrazine)

leading to hepatic injury (Sarma et al., 1986). The combination of

Pyrazinamide with other antitubercular drug like Isoniazid and

Rifampicin will increase the incidence of liver damage.

The exact mechanism of Anti TB drug (HRZ) induced

hepatocellular damage is still unknown. Numerous studies have shown

that, it is primarily due to the parent drug / reactive metabolite formed

during metabolism which will induce oxidative stress (ROS formation).

These ROS bind to the hepatocytes macromolecules and induce

cellular damage (Ali, 2012). In a case study HRZ treatment for 6 weeks

resulted in jaundice with rise in bilirubin and ALP level leading to liver

failure and the patients has undergone liver transplantation (Farrell et

al., 1994).

Disscussion

142

In our present study HRZ induced hepatotoxicity is evidenced by

increased level of Bilirubin. Similarly the serum level of Creatinine and

Urea were also increased in the HRZ group. However Bilirubin is one of

the most useful clinical clues to the severity of necrosis. Hence the

accumulation of bilirubin in serum is an important binding, conjugation

and excretory capacity of hepatocytes. In our present study the elevated

level of bilirubin in the serum of HRZ groups might be due to the

diminished hepatic clearance, endorsing jaundice condition (Saukkonen

et al., 2006; Gupta and Misra, 2006). Byre et al. (2002) stated that

Rifampicin interfere with bilirubin uptake and result in hyperbilirubinemia

by inhibiting bilirubin excretion through bile salt export pump.

Liver is the most important organ in maintaining the blood

ammonia levels through the urea cycle. Formation of urea and

creatinine are the mode of disposal of nitrogen (Stryer, 1995). In

hepatotoxic condition, due to the failure of the liver to convert amino

acids and ammonia to urea, a significant increase in urea and creatinine

were observed in our present study. Conversely co treatment with

Hesperidin +/ Ascorbic acid aids the hepatocytes to function properly,

by boosting the hepatic clearance of Bilirubin, creatinine and urea.

One of the major functions of the liver is to synthesize proteins

like albumin, globulin and fibrinogen. The liver functions were impaired

in disease condition which results in diminished synthesis of proteins.

On the otherhand amino acid metabolism was impaired in liver disease

Disscussion

143

which decreases the amino acid availability and impairs protein

synthesis.

Antitubercular drug mediated oxidative stress contributed to the

changes in the rough endoplasmic reticulum in the liver which disturb

the protein synthesis and hence the level of total protein and albumin

were significantly decreased in our present study. This is in accordance

with an earlier reported study (Chandane et al., 2013).

On the otherhand HDN+/ AA co treatment protected the

hepatocytes from experimental injury induced by HRZ and retained the

function of the liver cells to synthesize proteins. It probably did so by

counteracting the antitubercular drugs mediated oxidative damage of

polyribosomal profiles in the rough endoplasmic reticulum. Hence their

levels were increased in HDN and / or AA treated group when

compared to the HRZ treated group. The combination of both HDN and

AA shows better result compared to the individual treatment with either

HDN or AA alone which shows the synergistic effect of HDN and AA.

During TB treatment, the level of serum marker enzymes (AST,

ALT, ALP, LDH etc.,) were increased which indicates the hepatic injury.

ATDH is a treatment emergent which increases the level of liver marker

enzymes with or without symptoms of hepatitis or jaundice (Saukkonen

et al., 2006). In accordance with the earlier report, our results show that

antitubercular drug significantly elevated the level of liver marker

Disscussion

144

enzymes (AST, ALT, ALP, ACP, γ-GT and LDH) in the circulation.

Oxidative stress mediated hepatic damage is the main ascription

mechanism behind ATDH (Kale et al., 2003).

HRZ induced oxidative stress might be due to formation of toxic

metabolite and ROS in excess of antioxidant detoxification capacity

which will induce peroxidative damage to the hepatocytes. When there

is hepatopathy the integrity of the cell membrane is lost which result in

the leakage of these enzymes into blood stream (Nkosi et al., 2005).

Elevated levels of these marker enzymes clearly indicated the drug

induced hepatic damage, which is further confirmed by our

Histopathological examination which showed the presence of necrotic

damage in the liver of HRZ administered group. Imogen et al. (1995)

stated that sub acute and chronic treatment with Isoniazid increased the

level of serum transaminases and phosphatases. Our results are in line

with an earlier reported study (Imogen et al., 1995; Basini Jyothi et al.,

2013; Mohamed Saleem Thattakudian Sheik Uduman et al., 2011).

Conversely significant reduction in the activities of AST, ALT,

ALP, γ GT and LDH were observed in the rats supplemented with either

Hesperidin or Ascorbic acid. This shows that these compounds were

able to ameliorate the deleterious effect produced during the

antitubercular therapy by quenching the generated free radicals (lipid

peroxides) and thereby maintaining the hepatocyte integrity. However

Disscussion

145

the combination of both HDN and AA treatment restored the liver

marker enzymes to normal level compared to the individual treatment.

Hesperidin and Ascorbic acid stabilise the hepatic cell membrane

thereby it protect the hepatocytes from the toxic effect of HRZ which

reduces the leakage of enzymes into the circulation. The membrane

protective effect of Hesperidin and Ascorbic acid has been reported by

Pari et al. (2015) and Grajeda-Cota et al. (2004).

Liver is the major site for synthesis and metabolism of

cholesterol, bile acids and phospholipids. The major disorder

encountered in antitubercular drugs-induced hepatotoxicity is fatty

accumulation in the liver, which develops either due to excessive supply

of lipids to the liver or interference with lipid deposition. Oxidative stress

triggers the hepatic damage by altering the lipids (Shali et al., 2015).

Antitubercular drug treatment affects the metabolism of cholesterol, TG,

FFA and bile acid in the liver (Wang P et al., 2016). In the present study

HRZ induced hyperlipidemia is evidenced by significant increase in the

levels of serum total cholesterol, triglycerides, LDL, VLDL, free fatty acid

and eventual decrease in the level of HDL and phospholipids. This

elevated concentration of LDL in the HRZ treated rats might be due to

defect in LDL receptor either through failure in its production (or)

function. HDL is protective by reversing cholesterol transport, inhibiting

the oxidation of LDL and by neutralizing the atherogenic effects of

oxidized LDL. A greater increase of LDL and VLDL might have been

Disscussion

146

due to reduction in the level of HDL and diminished lecithin cholesterol

acyl transferase activity (Sabesin et al., 2011).

Furthermore, the level of triglycerides in serum reflects a balance

between the rates of exogenous supply and endogenous fatty acid

synthesis. The decreased removal of triglyceride and cholesterol from

serum is due to diminished lipoprotein activity (You et al., 2002).

Phospholipids play a significant role in maintaining the structural

integrity of the cellular membrane (Endo et al., 1992). Our data showed

a decrease in phospholipids content, this might be due to the increased

activity of phospholipases and lipid peroxidation which degrades

membrane phospholipids.

Pal et al. (2008) in their finding reported that Isoniazid and

Rifampicin increase the level of total lipids, TC, TG and decreased the

levels of phospholipids. In another study by Chen and Raymond,

(2005) stated that Rifampicin decreased the level of HDL and increased

the level of TC, TG by inhibiting the CYP A71 (a rate limiting enzyme in

the conversion of cholesterol to bile acids). Our results are in

accordance with the report of the previous study.

In our present study Hesperidin and Ascorbic acid exhibited a

notable hypolipidemic effect as evidenced by its modulating effects on

the serum lipid profile against HRZ induced hyperlipidaemia. This might

be due to its inhibitory effect through free radical quenching activity,

Disscussion

147

since lipids are the primary target of free radicals. Wang et al.(2011),

MM El-Shafey and MF Abd-Ellah, (2014) have shown that citrus

flavonoid Hesperidin reduces the lipid profile like Total cholesterol,

triglycerides and LDL concentrations and increases the HDL

concentrations in the rats fed with high-cholesterol diet, which cope with

the results of our present study.

In another study HDN lower cholesterol and Triglyceride by

inhibiting the HMG CoA reductase and Acyl CoA: cholesterol acyl

transferase (ACAT) (Bok et al., 1999) and also enhance the expression

of LDL R encoding gene (Wilcox et al., 2001). Similarly a study by

Ahmed et al. (2012) showed the hypolipidemic effect of Hesperidin in

Type 2 diabetes rats. Yoshida et al. (2010) in their study showed that

Hesperidin block the TNF α induced FFA release by down regulating the

perilipin and PDE 3B (antilipolytic gene). These are the some of the

possible mechanism underlying hypolipidemic effect of Hesperidin.

Similarly hypolipidemic effect of Ascorbic acid (Marc and McRae,

2008) also reported in earlier studies. Vitamin C has a favorable effect

on lipid profile. El Mashad et al. (2016) in their study stated that Vitamin

C supplement decrease the LDL, TC, TG and increases the HDL level

in children on hemodialysis.

Oxidative stress alters the redox homeostasis of the liver leads to

the generation of radicals that induces lipid peroxidation and

Disscussion

148

dysfunction the antioxidant defence system. This will play a critical role

in the pathogenesis of AntiTB drug induced liver damage (Chowdhury et

al., 2001). Isoniazid metabolism involves CYP2E1 enzymes which result

in the generation of ROS and the hepatotoxic metabolite (Sarich et al.,

1999; Delaney et al., 1995). On the otherhand Rifampicin upregulated

the transcription of Phase I and Phase II drug metabolizing enzyme like

CYP and GST and enhance the isoniazid metabolism (Burk et al., 2004;

Nannelli et al., 2008). This will result in excessive generation of ROS

and toxic metabolite which will induce peroxidative damage to the lipid.

Lipid peroxidation (LPO) is a multistep chain reaction that initiates

when a free radical react with the polyunsaturated fatty acid (PUFA) in

cell membrane to form conjugated dienes. This reacts with O2 and OH•

atoms from other cellular lipids, producing lipid hydroperoxides, MDA,

cyclic peroxides and other radicals (Jomova and Valko, 2011). Our

results shows that antitubercular drugs administration results in the

significant elevation of peroxidative markers like TBARS, conjugated

dienes and hydroperoxides enzymes levels. This increased LPO might

be due to the excess production of reactive metabolite during the

detoxification of AntiTB drug which induce the necrotic damage to the

hepatocytes. Hence the integrity of the hepatocyte will be lost which

result in the leakage of enzymes in to the circulation. Our studies are in

parallel with other studies (Georgieva et al., 2004; Chowdhury et al.,

2001). Moreover TB patients with ATDH have been shown to have

Disscussion

149

lower plasma levels of glutathione and higher malondialdehyde, which

may be due to the result of oxidative stress from the antituberculosis

therapy (Chowdhury et al., 2001).

Research evidence suggested that the Antitubercular drugs

causes’ hepatocellular damage through the induction of oxidative stress

and consequence dysfunction of hepatic antioxidant defense system

(Attri et al., 2000). In physiological condition both enzymatic and non

enzymatic antioxidant are involves to protect the body from oxidative

stress (Young and Woodside, 2001). Therefore they are used as a

measure to evaluate the oxidative stress level.

In our present study antitubercular drug reduces the level of

enzymatic (SOD,CAT,GST,GPx,GR) and nonenzymatic (GSH,VIT C &

E) antioxidant, this might be due to excessive production of oxidant

species, so the antioxidant are not able to neutralize them, which result

in the depletion or failure of intracellular antioxidant defense system.

Hydrazine a principle reactive metabolite of INH, deplete GSH by

reacting with their sulfahydral groups and initiate oxidative stress

(Chowdhury et al., 2006). This depletion in the GSH content might be

the effect of maximum utilization for detoxification of ROS and reactive

metabolite. GSH play a role as a free radical scavenger it undergoes

Sulfhydryl conjugation and facilitates the elimination of toxic metabolite

from the body. GSH acts as a substrate in the scavenging reaction

Disscussion

150

catalysed by the enzyme glutathione peroxidase (GPx) and also play a

role in scavenging the radicals of Vitamin C & E (Ortotani et al., 2010).

GPX reduction is subsequent of GSH reduction.

In our study the serum GSH concentration significantly decreased

in HRZ administration which might be due to an increased utilization of

GSH to detoxify the toxic metabolite. Vit C is a water soluble naturally

occurring chain breaking antioxidant (Abraham, 2005). We have

observed a significant reduction the levels of Vit C in anti TB drug

intoxicated animals which could be due to the enhanced Vitamin C

utilization, as an antioxidant defense against ROS. On the otherhand it

may also due to the reduced concentration of GSH because, GSH

involved in the recycling of vitamin C. The Vitamin E plays a major role

in maintaining cell membrane integrity by limiting lipid peroxidation by

ROS. The declined concentration of Vitamin E might be due to

extensive utilization of Vitamin E in scavenging the oxyradicals or due to

the deficiency of vitamin C, there is a well established interaction

between Vitamin E and C.

GST involved in the detoxicification of the reactive metabolite that

is formed by oxidation of hydrazine and acetyl hydrazine during the

metabolic pathway of Isoniazid. The conjugation of reduced form of

glutathione to electrophilic substance are catalysed by GST thereby it

reduces the peroxidative damage toward the cellular substance. The

homogenous null mutation in the GST genotype reduce the catalytic

Disscussion

151

activity of GST enzyme hence leads to the accumulation of toxic

metabolite which will induce hepatotoxicity (Bing et al., 2011; Tang et

al., 2013; Huang et al., 2007).

On the otherhand SOD and CAT are the front line antioxidant

enzymes, which are inactivated by the excess generation of lipid

peroxides (Reiter et al., 2000). SOD scavenges the superoxide anion

into form hydrogen peroxide thereby it diminishes deleterious effects

caused by the radical (Kharpate et al., 2007). CAT is an important

enzyme which protects the cell from oxidative damage induced by the

free radicals (ROS). It catalyses the conversion of hydrogen peroxide to

water and oxygen. In the current study higher level of LPO along with

reduced levels of CAT and SOD indicate the presence of oxidative

insult due to excess generation of peroxide radicals so that the

antioxidant where are not able to neutralise them result in peroxidative

damage.

In our present study concurrent treatment with Hesperidin and

ascorbic acid ameliorate the Anti TB drug associated rise in TBARS,

CDs, LHP & depletion of antioxidant enzymes. This could be attributed

to the scavenging activity of Hesperidin (Pari et al., 2015) and Ascorbic

acid (Wu et al., 2004) towards ROS and sparing of endogenous

antioxidant enzymes.

Disscussion

152

Flavanoids are effective in combating the oxidative stress in

human. Dietary flavanoids act as an electron donor and functions as

exogenous antioxidant by scavenging the free radicals (Issabeagloo et

al., 2012). It also induces phase II detoxification enzyme and protect the

tissue from oxidative damage (Talalay et al., 1995).

Hesperidin is a natural and pharmacologically active bioflavonoid

found in citrus fruits, with their antioxidant effect and free radical

neutralizing property (pari et al., 2015). Hence this bioflavonoid has a

good intracellular radical quenching activity and is able to inactivate

reactive metabolites and ROS at the site of its production itself (Sam-

Long Hwang and Gow-Chin Yen, 2008). The previous study stated that

HDN functions as a scavenger for ROS acts as a chain breaking

antioxidant, which quench the free radicals and also it act as a protector

for ascorbic acid (Singh and Agarwal, 2006). In another study HDN

attenuated the cisplatin induced oxidative stress by decreased the level

of ROS and MDA and enhanced the antioxidant enzyme (Sahu et al.,

2013). These studies are in parallel with our result.

Similarly ascorbic acid at cellular level mitigates the deleterious

effect of ROS directly by increasing antioxidant enzyme activities and

indirectly by reducing oxidized form of vitamin E and GSH (Neuzil et al.,

1997; Wu et al., 2004). Ascorbic acid capable scavenging the ROS and

sparing the other endogenous antioxidant from consumption (Wu et al.,

2004). Vitamin C is a water-soluble chain breaking antioxidant,

Disscussion

153

scavenges free radicals produced during metabolic pathways of

detoxification. Preservation of intracellular ascorbic acid levels

minimizes the peroxynitrite-mediated injury which is attributable to the

beneficial effect of ascorbic acid (Carnes et al., 2001). Thus it can

prevent the peroxidation of poly unsaturated lipids present in the plasma

membrane and other sub cellular organelles like endoplasmic reticulum,

mitochondria and helps to maintain its integrity and prevent leakage of

cellular contents.

Hesperidin and Ascorbic acid enhances the expressions of

endogenous antioxidant by maintaining their levels higher compared to

the HRZ intoxicated rats. Our findings are further confirmed by

histopathological results which show the absence of necrotic lesions.

Our result shows that HDN and AA decreased the level of peroxidative

damage and increased the level of enzymatic and non enzymatic

antioxidant thereby prevent the membrane from the peroxidative

damage and stabilise the membrane. This proves the antioxidant

property of HDN and AA against the peroxidative damage induced by

HRZ. This antioxidant property of Hesperidin (Cho 2006, Ahmad et al.,

2012) and Ascorbic acid (Banerjee et al., 2009) are well in accordance

with the earlier report.

Enhanced oxidative damages on the membrane are further

evident from altered ATP ases (Na+K+, Ca2+, and Mg2+ ATPases)

activities in the liver tissue of HRZ administered groups. Hydrazine, the

Disscussion

154

active metabolite of Isoniazid inhibits the ATP production and alters the

electron transport chain in hepatocytes (Lee et al., 2013). ATPase has

been described as prominent enzymes found in all organisms providing

metabolic energy for energy-dependent processes. It is an integral

membrane protein and required thiol groups and phospholipids to

maintain their structure and function (Hazarika and Sankar, 2001). It is

also responsible for the transport of ions through the membrane and

thus regulates cellular volume, osmotic pressure and membrane

permeability.

Peroxidative damage to membrane phospholipids not only alter

the lipid profile, structural and function integrity of membrane but also it

affected the activities of various membrane bound ATPase. The

membrane-bound enzymes such as Na+K+, Ca2+ and Mg2+ ATPases are

responsible for transport of sodium/potassium and calcium ions across

the cell membrane at the expenses of ATP, and they are lipid-

dependent membrane-bound enzymes susceptible to lipid peroxidation

(Stekhoren and Bonting 1981; Selvendiran and Sakthisekaran, 2004).

In this context, Geetha and colleagues have suggested that lipid

peroxidation in cells decreases the activity of membrane-bound ATPase

because cell membrane is extremely susceptible to free radical attack

and any alteration in membrane lipid leads to change in membrane

fluidity, which in turn alters the ATPase activities and cellular functions

(Geetha A et al., 1991). The diminished activities of membrane bound

http://journals.sagepub.com/doi/full/10.1177/0960327113485252

Disscussion

155

ATPases in the present investigation might be due to the free radicals

induced damage caused by HRZ administration and this is well in

accordance with the previous reports of several investigators

(Saraswathy SD et al., 1998; Ohta Y et al., 2002).

In contrast, concurrent treatment with Hesperidin and / or

Ascorbic acid increased the level of the ATPases this might be due to

the protective role of Hesperidin & Ascorbic acid in membrane

permeability and stabilizing potential. In addition, it can maintain the

structural integrity of cell membrane probably by protecting the

membrane ATPases from the deleterious effect of lipid peroxidation

caused by the HRZ. The membrane stabilising activity of Hesperidin

(Pari et al., 2015) and Ascorbic acid (Grajeda-Cota, et al., 2004) have

reported in previous studies.

Antitubercular induced liver damage is further confirmed by

abnormal histological findings. Toxicity manifestations by HRZ in the

liver tissue are revealed by morphological changes such as

inflammation around portal triad, sinusoidal dilation, necrosis and

central vein congestion. These changes revealed that ROS and active

metabolite formed during antitubercular drug metabolism induces lipid

peroxidation results in hepatic injury. In Previous studies the active

metabolite acetyl hydrazine does not show any toxic effect but

hydrazine is responsible for antitubercular drug mediated necrotic

damage, macrovesicular degeneration and steatosis in liver (Richards

Disscussion

156

et al., 2004). Our results are in parallel with that of the above reports.

The observation in liver of patients who died in Rifampicin and

Pyrazinamide induced toxicity shows bridging necrosis, increased

fibrosis and infiltration of lymphocyte and micronodular cirrhosis was

observed (Westphal et al., 1994; Brown et al., 2005).

Treatment with either HDN or AA showed maximum recovery of

hepatocytes with mild congestion. However treatment with the

combination of HRZ and AA shows the normal liver architecture this

might due to their antioxidant property which enhance the action of

antioxidant defense system and protect the hepatocytes from the

peroxidative damage induced by toxic metabolites. Similary standard

drug silymarin treatment with HRZ shows almost near normal

architecture.

Antitubercular drug mediated apoptosis is mainly due to the

formation of highly reactive oxygen species within mitochondria which

leads to mitochondrial membrane depolarization which triggers caspase

cascade and initiate apoptosis (Bhadauria et al., 2010; Desagher and

Martinou, 2000). Apoptosis is an ATP dependent programmed cell

death which is mediated by activating caspase cascade pathways

(Intrinsic and extrinsic pathway). The intrinsic pathway triggered by

drug or toxic metabolite activate caspase cascade and damage the

mitochondria (Battaglia et al., 2009; Riedl and shi, 2004). It is mediated

through Bcl2 family of protein which includes proapoptotic Bax and anti

Disscussion

157

apoptotic Bcl2. Studies shows that Bax act as the positive regulator will

enhance mitochondrial polarization and induces cell death; Bcl2 act as

the negative regulator of cell death by restores the mitochondrial

polarization (Desagher and Martinou, 2000). Bcl2 family proteins are

essential for regulating the apoptosis.

On the otherhand extrinsic apoptotic pathway is activated by

binding of death ligand (TNF α, FasL etc.,) to death receptor (TNF R1)

induces conformation changes in the receptor and activate the effector

caspase cascade (Yin and Ding, 2003; Zhang et al., 2015). Caspase

are cysteine protease enzyme involved in apoptosis act as a initiator

caspase (8,9,10) or effector caspase (3,6,7). Caspase 3 involved in

cleaning a various cellular protein and DNA strands break (Bratton et

al., 2000). To investigate the HRZ induced apoptotic damage the

expression of Bax, Bcl2, Caspase 3 and Caspase 9 were analysed.

In our western blotting and RT PCR analysis antitubercular drugs

up regulated the expression of caspase 3 and caspase 9 might be due

to the migration of proapoptotic marker Bax to the mitochondria and

inhibit the protective effect of antiapoptotic Bcl2. Therefore in our

analysis Bax is up regulated and Bcl2 is down regulated by

antitubercular drugs due to the activation of intrinsic apoptotic pathway

by ROS. Bazhanova et al. (2015) stated that combined administration of

antitubercular drug induces apoptosis by activating both intrinsic and

extrinsic apoptotic pathway.

Disscussion

158

Conversely treatment with either HDN or AA with antitubercular

drugs moderately increased the expression of Bcl2 and decreased

expression of Bax, Caspase 3 and Caspase 9. However treatment with

the combination of both HDN and AA more pronouncedly upregulated

the expression of Bcl2 and down regulated the expression of Bax,

Caspase 3 and Caspase 9 which indicates that these drugs stabilize

the mitochondrial membrane from the oxidative damage thereby it

prevent the activation of caspase cascade mediated intrinsic apoptotic

pathway. On the otherhand it also restored the balance between Bax

and Bcl2 and prevents the hepatocytes from apoptosis. Reports shown

that enhanced expression of Bcl-2 inhibit the transcriptional activation of

proapoptotic proteins Bax and inhibit the release of cyt c from

mitochondria, thereby inhibiting the activation of caspase, and apoptosis

(Desagher and Martinou, 2000; Budihardjo et al., 1999; Imogen et al.,

1995). Moreover, Antiapoptotic effect of Hesperidin was reported by

various authors (Ahmad et al., 2012; Tamilselvam et al., 2013).

Hesperidin scavenge the ROS generated during oxidative stress

and protect the cellular macromolecules from the oxidative damage and

established the mitochondrial polarization thereby it prevent the

expression of Bax, caspase 3, 9 and upregulated the Bcl2 expression

by its antioxidant effect (Hewage et al., 2016). In another study

Hesperidin attenuates cisplatin induced renal injury by down regulated

the caspase 3 & DNA damage (Sahu et al., 2013). Similarly Naseer et

Disscussion

159

al. (2011) in their study reported that vitamin C impaired apoptosis by

down regulated the expression of Bax, caspase-9, caspase-3,

cytochrome-c, and significantly upregulated the expression of

antiapoptotic Bcl-2 protein. On the otherhand ascorbic acid inhibits

apoptosis by induction of phase II enzymes involved in the detoxification

of toxic metabolite and eliminates ROS (Garcia et al., 2009).

Moreover, the DNA fragmentation detected by gel electrophoresis

as a DNA ladder representing a series of fragments. There is always a

positive association between apoptosis and the DNA fragmentation. Fig

(25) showed the laddering pattern of DNA in group fed with HRZ

compared to the control. DNA fragment analysis clearly indicate that

antitubercular drug induced hepatic damage is mediated through the

apoptosis induction. In the combination group of both HDN and AA

dramatically reduce the laddering pattern thereby it prevented the DNA

fragmentation and apoptosis induced by HRZ. The increased level of

antioxidant decreases the ROS level and inhibits the apoptosis which is

indicated by the absence of laddering in HRZ+HDN+AA and silymarin

treated rats.

On the otherhand ROS triggers an inflammatory response

through the activation of transcription factor NF-κB (Czaja, 2007). The

NF-κB-activating pathway is induced by pro-inflammatory cytokines

(TNFα) (Martin and Wesche, 2002; Devin et al., 2000). Research

evidence stated that oxidative stress along with toxic metabolite

Disscussion

160

increase the production of TNF-α which act on TNF-α receptor 1 and

leads to the production of other proinflammatory cytokines (Tacke et al.,

2009; Leagins et al., 2015; coffin et al., 2011; Leifeld et al., 2006). In our

present study Antitubercular drugs increase the expression of NF-κB

and TNF-α. The activation of extrinsic apoptotic pathway by the ROS

might be the reason for enhanced expression of NF-κB and TNF-α.

Furthermore, IL-10 with anti-inflammatory and immunomodulatory

effects can prevent the activation of TNF-α-induced activation of NF-κB

pathway (Bourdi et al., 2002; Dhingra et al., 2009). In our study

antitubercular drugs enhanced the expression of IL-10 because of

compensatory mechanism against TNF-α induced inflammation.

Inversely concurrent treatment with Hesperidin and Ascorbic acid

down regulated the level of TNF-α, IL-10 and NF-κB to near normal in

HRZ intoxicated rats. Thus Hesperidin and ascorbic acid ameliorated

the oxidative stress by neutralising the ROS thereby it prevent the

activation of NF-κB pathway and subsequently suppress the release of

proinflammatory cytokines (TNF-α). Hence the expression of TNF-α and

NF-κB was reduced in our study. Furthermore the level of anti-

inflammatory cytokines IL- 10 was diminished in Hesperidin and

Ascorbic acid treatment. This could be due to attenuation of

inflammatory stress which in turn secured the formation of anti-

inflammatory cytokines (IL-10). Hence Hesperidin and Ascorbic acid

have protective effect against inflammation by suppressing the release

Disscussion

161

of proinflammatory cytokines and oxidative stress responsive

transcription factor there by inhibit the activation of caspase 3 and

caspase 8 mediated apoptotic pathway (extrinsic pathway).

Hesperidin suppresses the proinflammatory cytokine TNF-α by

inhibiting the NF-κB protein complex. Analysis of gene expression after

Hesperidin treatment enhance the NF-κB inhibitor which block the

activity of NF-κB and associated genes regulated by NF-κB factor

(Milenkovic et al., 2011). Our results are in parallel with the findings of Li

et al. (2008) and Visnagri et al. (2014).

Numerous studies stated that Hesperidin suppress the apoptosis

and inflammation by inhibiting the intrinsic and extrinsic apoptotic

pathway (Tamilselvam et al., 2013; Ahmad et al., 2012). On the

otherhand Cárcamo JM et al.(2002) data pointed out that vitamin C

suppress NFkB activation by inhibiting TNF-α, These results of our

study stated that vitamin C can influence inflammatory and apoptotic

processes via inhibition of NFkB activation.

Our results shows that individual treatment group with either HDN

or AA markedly reduced all the changes induced by Antitubercular

drugs (HRZ). However the combination of both HDN and AA more

efficiently ameliorated all the changes induced by antitubercular drugs.

This shows the synergistic effect of hesperidin and ascorbic acid

against antitubercular drug hepatotoxicity. Vitamin C works better when

https://www.ncbi.nlm.nih.gov/pubmed/?term=C%C3%A1rcamo%20JM%5BAuthor%5D&cauthor=true&cauthor_uid=12390026

Disscussion

162

accompanied by flavonoid molecule as their presence in the cell spares

Vit C and provides greater antioxidant.

On the otherhand Silymarin is the standard hepatoprotective drug

which protects the hepatocytes from the oxidative damage by its

antioxidant property. Numerous researchers investigated the

hepatoprotective and antioxidant property of Silymarin against various

hepatotoxic drugs like paracetomol (Sabiu et al., 2015), carbon

tetrachloride (Jia et al., 2013), antitubercular drug (Eminzade et al.,

2008) etc., In our present study Silymarin was used as a positive control

for its known hepatoprotective effect. Our results shows silymarin exerts

its protective effect against HRZ induced hepatotoxicity by impaired the

oxidative stress, apoptosis and inflammation.

The combination of flavonoid and ascorbic acid produce a

synergistic effect. The previous studies shown that flavonoids

Quercetin in combination with vitamin C synergistically regenerate

Vitamin E while the regeneration not happen with either Vit C or

Quercetin alone treatment. Furthermore the combination of citrus

flavonoid and vitamin C previously reported to produce synergistic

antioxidant effect in lipoprotein oxidation model (Seiichiro et al., 2006).

In another study by Joe et al. (2001) described the antioxidant

property of citrus extract and Ascorbic acid on hypercholesterolemic

human subjects. The results shows that there was no invivo antioxidant

Disscussion

163

effect of ascorbic acid alone but the effect was more significant in the

combination of both Vitamin C and citrus fruits.

From our study citrus flavonoid Hesperidin and Ascorbic acid

when given alone it moderately attenuated the antitubercular induced

toxicity. But when given in combination, it effectively reduced oxidative

damage induced by Isoniazid, Rifampicin and Pyrazinamide by

preventing oxidative stress, hyperlipidemia, mitochondrial dysfunction,

apoptosis and inflammation. This implies that the Hesperidin and

Ascorbic acid work synergistically and prevent the liver from the

oxidative damage.

This finding may have important implications in the use of

Hesperidin and ascorbic acid against antitubercular drug induced

hepatotoxicity.

Conclusion

164

8. CONCLUSION

The present study described the hepatoprotective effect of

hesperidin and Ascorbic acid in 2 different hepatotoxic models (Ethanol

and antitubercular drug).

The result of our present study shows that administration of

ethanol induces hepatic damage which is evidence by increased level of

liver marker enzymes (AST, ALT, ALP, LDH), total cholesterol,

triglycerides, lipid peroxidation (LPO) and subsequently decreased the

level of antioxidant enzymes (SOD, CAT, GSH, VIT C , VIT E).

Concurrent treatment with Hesperidin and Ascorbic acid

attenuated all the changes induced by ethanol and protect the

hepatocytes from the oxidative damage.

On the otherhand antitubercular drug induced oxidative stress

and hepatotoxicity is evidenced by increased level of liver marker

enzymes (AST, ALT, ACP, ALP, LDH, γ GT), LPO, and subsequently

decreased the level of antioxidant enzymes (SOD, CAT, GSH, GST,

GR, GPx, VIT C, VIT E). Antitubercular drug induces hyperlipidaemia is

evidenced by increased level of LDL, VLDL, FFA, TC, TG and

decreased level of HDL and phospholipids.

Similarly, Antitubercular drugs induced apoptosis and

inflammation is evidenced by upregulation of Apoptotic markers

Conclusion

165

(caspase 3, 9, BAX) and down regulation of antiapoptotic markers (Bcl

2). In addition, antitubercular drug upregulated the expression of

inflammatory markers(TNFα, NFκB) &antiinflammatory markers (IL- 10).

Antitubercular drugs leads to membrane destabilisation which is

evidenced by decrease the level of membrane bound ATP ase enzymes

like Na+ K+ ATP ase, Mg+ ATP ase and Ca+ ATP ase.

Conversely supplement with Hesperidin and / or Ascorbic acid

attenuates all the changes induced by the ethanol and antitubercular

drugs and protect the hepatocytes from the oxidative damage. This

shows the hepatoprotective, antioxidant, antilipidemic, antiapoptotic and

membrane stabilising action of HDN and AA against drugs induced

toxicity.

The hepatoprotective effect offered by the combination of both

Hesperidin and Ascorbic acid treatment was found to be significantly

greater than the treatment with either hesperidin or ascorbic acid alone.

This implies the synergistic action of Hesperidin and Ascorbic acid.

Therefore, our study favors the view that Hesperidin and Ascorbic

acid combination may be a useful modulator in alleviating ethanol and

antitubercular drug induced hepatotoxicity. However further research is

need to validate Hesperidin and ascorbic acid combination as a new

therapeutic agent supplemented with antitubercular drugs in the

treatment of TB and also in alcoholic liver disease.

Limitations

166

9. LIMITATIONS AND FUTURE PROSPECTS

Antitubercular drug induced hepatotoxicity was mainly due to the

induction of CYP 2E1 and deficiency of phase II detoxification enzyme

(GST). The gene expression of CYP2E1 and GST was not measured in

our study.

Hence our future prospects will be to examine the genetic variation in

the expression of CYP2E1 Microsomal enzymes and GST.

On the otherhand we planned to investigate the hepatocytes growth

factor gene therapy in drug induced hepatotoxicity.

https://www.google.co.in/search?q=FUTURE+PROSPECTS&spell=1&sa=X&ved=0ahUKEwiWx6LKnt3SAhVBVZQKHXB3BbIQvwUIGCgA

Bibliography

167

10. BIBLIOGRAPHY

Abraham P. Vitamin C may be beneficial in the prevention of

Paracetamol-induced renal damage. Clin Exp Nephrol. 2005; 9(1):24-

30.

Adewusi EA, Afolayan AJ. Effect of Pelargonium reniforme roots on

alcohol induced liver damage and oxidative stress. Pharm Biol. 2010;

48(9): 980-987.

Agrawal YO, Sharma PK, Shrivastava B, Ojha S, Upadhya HM.

Hesperidin Produces Cardioprotective Activity via PPAR-c Pathway in

Ischemic Heart Disease Model in Diabetic Rats. PLOS ONE.2014;

9(11): e111212.

Ahmad ST, Arjumand W, Nafees S, Seth A, Ali N, Rashid S, Sultana

S,et al. Hesperidin alleviates acetaminophen induced toxicity in Wistar

rats by abrogation of oxidative stress, apoptosis and inflammation.

Toxicol Lett. 2012; 208(2):149-16.

Ahmed OM, Mahmoud A M, Abdel-Moneim A, Ashour M B. Antidiabetic

Effects Of Hesperidin And Naringin In Type 2 Diabetic Rats.

Diabetologia Croatica. 2012; 41(2):53-67.

Aleisa AM, Hatem M, Abuohashish, Mohammed M. Ahmed, Salim S. Al-

Rejaie, Osama A, et al. Ameliorative effects of rutin and ascorbic acid

Bibliography

168

combination on hypercholesterolemia-induced hepatotoxicity in female

rats. Afr J Pharm. Pharmacol. 2013;7(6): 280-288.

Ali ZY. Biochemical Evaluation of Some Natural Products against

Toxicity Induced By Anti-tubercular Drugs in Rats. New York Sci J.

2012; 5(10): 69-80.

Al-Jasabi S, Abdullah MS. The Role of Antioxidant Hesperidin in the

Attenuation of Lung Cancer Caused by Benzo(a) pyrene in Balb/c Mice.

World Applied Sciences Journal. 2013; 22 (8): 1106-1110.

Amir Khan, Deepti Malhotra. Protective Role of Ascorbic Acid (Vitamin

C) Against Hyperlipidemia and Enhanced Oxidizability of Low Density

Lipoprotein in Young Smokers. European Journal of Experimental

Biology. 2011; 1(1):1-9.

Anand AC, Seth AK, Paul M, Puri P. Risk Factors of hepatotoxicity

during anti-tuberculosis treatment. MJAFI .2006; 62(1): 45-49.

Anita S, Tej KB, Om PS. Clinical biochemistry of hepatotoxicity. J Clin

Toxicol. 2011;S4:1–9.

Asduq SA, Kaiser P, Sharma SC, Johri RK. Potentiation of isoniazid-

induced liver toxicity by rifampicin in a combinational therapy of

antitubercular drugs (rifampicin, isoniazid and pyrazinamide) in Wistar

rats a toxicity profile study. Hepatol. 2007;37(10):845-53.

Bibliography

169

Attri S, Rana SV, Vaiphei K, Sodhi CP, Katyal R, Goel RC,et al.

Isoniazid and Rifampicin induced oxidative hepatic injury protection by

N-acetylcysteine. Hum Exp Toxicol 2000;19(9):517-22.

Ayman MM, Mousa OG, Ayman SS. Berberine attenuates Isoniazid

induced Hepatotoxicity by modulating peroisome proliferator activated

receptor γ, oxidative stress and inflammation. International journal of

pharmacology. 2014; 10(8): 451-460.

Banerjee P, Bhattacharyya N, Bhattacharjee S, Boujedaini AR, Khuda-

Bukhsh B. Ascorbic acid combats arsenic-induced oxidative stress in

mice liver.Ecotox Eaviron Safe. 2009; 72: 639-649.

Bartoszewski R, Hering A, Marszall M, Stefanowicz Hajduk J,

Bartoszewska S, Kapoor N, et al. Mangiferin has an additive effect on

the apoptotic properties of hesperidin in Cyclopia sp tea extracts. PLOS

One.2014;9(3): e92128.

Basini Jyothi, Mohanalakshmi S, Anitha k. Protective effect of Mirabilis

jalapa leaves on Anti-tubercular drugs induced hepatotoxicity. Asian J

Pharm Clin Res. 2013;6 Suppl 3: 221- 24.

Battaglia V, Compagnone A, Bandino A. Cobalt induces oxidative stress

in isolated liver mitochondria responsible for permeability transition and

intrinsic apoptosis in hepatocyte primary cultures. Int J Biochem Cell

Biol. 2009;41(3):586–594.

Bibliography

170

Bautista AP. Free radicals, chemokines and cell injury in HIV-I and SIV

infections and alcoholic an official Publication of Phcog.Net hepatitis.

Free Radic Biol Med. 2001;31:1527–1532.

Bazhanova ED, Sukhanov DS, Teplyi DL. Pathways of apoptosis

regulation in hepatocytes induced by first-line antitubercular drugs. Bull

Exp Biol Med. 2015; 158(5):650–653.

Bhadauria S, Mishra R, Kanchan R, Tripathi C, Srivastava A, Tiwari A.

Isoniazid-induced apoptosis in HepG2 cells. generation of oxidative

stress and Bcl-2 down-regulation.Toxicol Mech Methods. 2010; 20(5):

242–251.

Bhadauria S, Singh G, Sinha N, Srivastava S. Isoniazid induces

oxidative stress, mitochondrial dysfunction and apoptosis in Hep G2

cells. Cell Mol Biol (Noisy-le-grand). 2007; 53(1):102-14.

Bing C, Xiaomeia C, Jinhenga L. Gene dose effect of NAT2 variants on

the pharmacokinetics of isoniazid and acetylisoniazid in healthy

Chinese subjects. Drug Metabol Drug Interact. 2011; 26:113–8.

Bok SH, Lee SH, Park YB, Bae KH, Son KH, Jeong TS, et al. Plasma

and hepatic cholesterol and hepatic activities of 3-hydroxy-3-methyl-

glutaryl-CoA reductase and acyl CoA: cholesterol transferase are lower

in rats fed citrus peel extract or a mixture of citrus bioflavonoids. J Nutr.

1999; 129:1182–1185.

Bibliography

171

Bonting, S.L. Sodium potassium activated adenosine triphosphatase

and carbon transport. In Membrane and Iron Transport, (ed Bittar EE),

WileyInterscience, London .1970; 1: 257-363.

Bourdi M, Masubuchi Y, Reilly TP, Amouzadeh HR, Martin JL, George

JW, Shah AG, Pohl LR. Protection against acetaminophen-induced liver

injury and lethality by interleukin 10: Role of inducible nitric oxide

synthase. Hepatology. 2002; 35: 289–298.

Bratton SB, MacFarlane M, Cain K, Cohen GM. Protein complexes

activate distinctcaspase cascades in death receptor and stress-

activated apoptosis. Exp Cell Res.2000; 256: 27-33.

British Medical Research Council (Hong Kong Chest Service).

Controlled trial of 2, 4 and 6 months of pyrazinamide in 6 month, three

times weekly regimens for smear positive pulmonary tuberculosis,

including an assessment of a combined preparation of isoniazid,

rifampin and pyrazinamide. Ann Rev Respir Dis.1991; 143: 700-6.

Brown JS, Wilson WE, Grant LD. Dosimetric comparisons of particle

deposition and retention in rats and humans. Inhal Toxicol. 2005; 17(7-

8): 355–385.

Budihardjo I, Oliver H, Lutter M, Luo X, and Wang X. “Biochemical

pathways of caspase activation during apoptosis,” Annual Review of

Cell and Developmental Biology. 1999; 15: 269–290.

Bibliography

172

Burk O, Koch I, Raucy J. The induction of cytochrome P450 3A5

(CYP3A5) in the human liver and intestine is mediated by the xenobiotic

sensors pregnane X receptor (PXR) and constitutively activated

receptor (CAR) J Biol Chem. 2004;279:38379–38385.

Byrne JA, Strautnieks SS, Mieli-Vergani G. The human bile salt export

pump: characterization of substrate specificity and identification of

inhibitors. Gastroenterology. 2002;123(5):1649–1658.

Carcamo JM, Pedraza A, Bórquez-Ojeda O, Golde DW. Vitamin C

suppresses TNF alpha-induced NF kappa B activation by inhibiting I

kappa B alpha phosphorylation.Biochemistry. 2002;41(43):12995-3002.

Carlberg I, Mannervik B. Glutathione reductase levels in rat brain.

Journal of Biological Chemistry. 1975; 250 (90):5475–5480.

Carnes CA, Chung MK, Nakayama T, Nakayama H, Baliga RS, Piao S,

et al. Ascorbate attenuates atrial pacing-induced peroxynitrite formation

and electrical remodeling and decreases the incidence of postoperative

atrial fibrillation. Circ Res. 2001;89(6):E32–8.

Chan AC. Partners in defense, Vitamin E and Vitamin C. Can J Physiol.

Pharmacol. 1993;71(9): 725-731.

Chandane RD, Jaju JB, Ghadlinge MS, Bhosale RR, Chandrakapure

AR. Effect of honey on hepatotoxicity induced by antitubercular drugs in

albino rats. Int J Basic Clin Pharmacol. 2013; 2(2):177-81.

Bibliography

173

Chanet A, Milenkovic D, Manach C, Mazur A, Morand C. Citrus fla-

vanones: what is their role in cardiovascular protection. J. Agric. Food

Chem.2012; 60(36): 8809–8822.

Chen J, Raymond K. The effect of rifampicin on cholestasis.

International Journal of Pharmacology. 2005;3(2).

Chen Q, Espey MG, Sun AY, Pooput C, Kirk KL, Krishna MC, et al.

Pharmacologic doses of ascorbate act as a prooxidant and decreases

growth of aggressive tumor xenografts in mice. Proc. Natl Acad Sci.

2008;105(32): 11105–11109.

Cho J. Antioxidant and neuroprotective effects of hesperidin and its

aglycone Hesperetin. Arch Pharm Res. 2006; 29(8):699-706.

Chowdhury A, Santra A, Bhattacharjee K, Ghatak S, Saha DR, Dhali

GK. Mitochondrial oxidative stress and permeability transition in

isoniaizd and Rifampicin induced liver injury in mice. J Heapatol. 2006;

45(1):117-26.

Chowdhury A, Santra A, Kundu S. Induction of oxidative stress in

antitubercular drug-induced hepatotoxicity. Indian J. Gastroenterol.

2001; 20(3): 97–100.

Christine Morand, Claude Dubray, Dragan Milenkovic, Delphine Lioger,

Jean Franc¸ Ois Martin, et al. Hesperidin contributes to the vascular

Bibliography

174

protective effects of orange juice: a randomized crossover study in

healthy volunteers. Am J Clin Nutr. 2011; 93:73–80.

Coffin CS, Fraser HF, Panaccione R, Ghosh S. Liver diseases

associated with anti-tumor necrosis factor-alpha (TNF-α) use for

inflammatory bowel disease. Inflamm Bowel Dis. 2011;17:479–484. doi:

10.1002/ibd.21336.

Comporti M, Signorini C, Leoncini S, Gardi C, Ciccoli L, Giardini A, et al.

Ethanol-induced oxidative stress basic knowledge. Genes &

Nutrition, 2010; 5(2):101–109. http://doi.org/10.1007/s12263-009-0159-

9

Corazza N, Kassahn D, Jakob S, Badmann A, Brunner T. TRAIL-

induced apoptosis: between tumor therapy and immunopathology. Ann

N Y Acad Sci. 2009;1171: 50–58.

Corbett EL, Watt CJ, Walker N, Maher D, Williams BG, Raviglione MC,

et al. The growing burden of tuberculosis: global trends and interactions

with the HIV epidemic. Arch Intern Med. 2003; 163(9):1009–1021.

Crozier A, Jaganath IB, Clifford MN. Dietary phenolics. Chemistry,

bioavailability and effects on health. Nat Prod Rep. 2009; 26(8):1001-

43.

Bibliography

175

Cuddihy SL, Parker A, Harwood T, Vissers MC, Winterbourn C.

Ascorbate interacts with reduced glutathione to scavenge phenoxyl

radicals in HL 60 cells. Free. Radic Biol Med. 2008; 44(8): 1637-1644.

Czaja MJ. Cell signalling in oxidative stress induced liver injury. Semin.

Liver Dis. 2007; 27(4): 378-389.

Dakhale GN, Khanzode SD, Khanzode SS, Saoji A. Supplementation of

vitamin C with atypical antipsychotics reduces oxidative stress and

improves the outcome of schizophrenia. Psychopharmacology.

2005;182(4):494–8.

Dawsey SP, Hollenbeck A, Schatzkin A, Abnet CC, Lee JE. A

prospective study of vitamin and mineral supplement use and the risk of

upper gastrointestinal cancers. PLOS One. 2014; 9(2):e88774.

Deavall GD, Elizabeth AM, Judith MH, Ruth R. Drug-induced oxidative

stress and toxicity. J Toxicol. 2012.

http://dx.doi.org/10.1155/2012/645460.

Deck DH, PharmD & Winston LG. Antimycobacterial Drugs. In; Katzung

BG, Masters SB Trevor AJ. Basic & clinical pharmacology. 12th ed.

New York: McGraw Hill Lange; 2012:839-847.

Delaney J, Timbrell JA. Role of cytochrome P450 in hydrazine toxicity in

isolated hepatocytes in vitro. Xenobiotica. 1995;25:1399– 410.

Bibliography

176

Deng X, Luyendyk JP, Ganey PE, Roth RA. Inflammatory stress and

idiosyncratic hepatotoxicity: Hints from animal models. Pharmacol Rev.

2009; 61(3): 262- 282.

Desagher S, Martinou JC. “Mitochondria as the central control point of

apoptosis,”. Trends in Cell Biology. 2000; 10(9): 369–377.

Desai ID. Vitamin E analysis methods for animal tissues. Methods

Enzymol. 1984;105:138-144.

Desta Z, Soukhova NV, Flockhart DA .Inhibition of cytochrome P450

(CYP450) isoforms by isoniazid: potent inhibition of CYP2C19 and

CYP3A.Antimicrob Agents Chemother. 2001; 45(2): 382-392.

Devin A, Cook A, Lin Y, Rodriguez Y, Kelliher M, Liu Z. The distinct

roles of TRAF2 and RIP in IKK activation by TNF-R1: TRAF2 recruits

IKK to TNF-R1 while RIP mediates IKK activation. Immunity. 2000;

12(4):419-29.

Dhingra S, Sharma A.K, Arora RC, Slezak J, Singal PK. IL-10

attenuates TNF-alpha-induced NF kappa B pathway activation and

cardiomyocyte apoptosis. Cardiovasc. Res. 2009; 82(1): 59–66.

El Mashad GM, ElSayed HM, Nosair NA. Effect of vitamin C

supplementation on lipid profile, serum uric acid, and ascorbic acid in

children on hemodialysis. Saudi J Kidney Dis Transpl. 2016;

27(6):1148-1154.

Bibliography

177

El-Gendy KS, Aly NM, Mahmoud FH, Kenawy A, El-Sebae AK. The role

of vitamin C as antioxidant in protection of oxidative stress induced by

imidacloprid.Food Chem. Toxicol. 2010; 48(1): 215-221.

Ellman GL.Tissue sulfhydryl groups. Arch. Biochem. Biophys.

1959;82:70–77.

Eminzade S, Uras F, Izzettin FV. Silymarin protects liver against toxic

effects of anti-tuberculosis drugs in experimental animals. Nutrition &

Metabolism. 2008;5:18. doi:10.1186/1743-7075-5-18.

Endo Y, Kukuchi T, Nakamura M. Orinithine and histidine

decarboxylase activities in mice sensitized to endotoxin, interleukin-1 or

tumor necrosis factor by D-galactosamine. Br J Pharmacol. 1992;107:

888–894.

Eteng MU, Ibekwe HA, Amatey TE, Bassey BJ, Uboh FU, and Owu DU,

Effect Of Vitamin C On Serum Lipids And Electrolyte Profile Of Albino

Wistar Rats. Nigerian Journal Of Physiological Sciences. 2006; 21 (1-2);

15-19.

Feagins LA, Flores A, Arriens C, Park C, Crook T, Reimold A et al.

Nonalcoholic fatty liver disease: A potential consequence of tumor

necrosis factor-inhibitor therapy. Eur J Gastroenterol. Hepatol. 2015;

27:1154–1160.

Bibliography

178

Figueroa-Mendez R and Rivas-Arancibia S. Vitamin C in Health and

Disease: It’s Role in the Metabolism of Cells and Redox State in the

Brain. Front. Physiol. 2015;6:397.

Filho CB, Del Fabbro L, de Gomes MG, Goes AT, Souza LC, Boeira

SP, et al. Kappa-opioid receptors mediate the antidepressant-like

activity of hesperidin in the mouse forced swimming test. Eur J

Pharmacol. 2013; 698(1-3):286-91. doi: 10.1016/j.ejphar.2012.11.003.

Epub 2012 Nov 20.

Forget EJ, Menzies D. Adverse reactions to first-line antituberculosis

drugs. Expert Opin Drug Saf. 2006; 5:231–49.

Fraschini F, Demartini G, Esposti D. Pharmacology of Silymarin. Clin

Drug Invest. 2002; 22(1):51-65.

Gandhi C, Upaganalawar A, Balaraman R. Protection against in vivo

focal myocardial ischemia/reperfusion injury-induced arrhythmias and

apoptosis by hesperidin.Free Radic Res. 2009; 43(9):817-27.

Gao, Bosong. Interactions between flavonoids, Vitamin C and Vitamin E

in protecting membranes against oxidative stress.

Garcia A, Morales P, Arranz N, Delgado ME, Rafter J, Haza AI.

Antiapoptotic effects of dietary antioxidants towards N-nitrosopiperidine

and N-nitrosodibutylamine-induced apoptosis in HL-60 and HepG2

cells. J Appl Toxicol. 2009;29(5):403-13. doi: 10.1002/jat.1426.

Bibliography

179

Garg A, Garg S, Zaneveld LJ and Singla AK. Chemistry and

pharmacology of the citrus bioflavonoid hesperidin. Phytother Res.

2001;15(8): 655–69.

Gaskill CL, Miller LM, Mattoon JS, Hoffmann WE, et al. Liver

histopathology and liver serum alanine aminotransferase and alkaline

phosphatase activities in epileptic dogs receiving Phenobarbital. Vet

Pathol. 2005;42(2):147–160.

Gautam M, Agrawal M, Gautam M, Sharma P, Gautam AS, Gautam S.

Role of antioxidants in generalised anxiety disorder and depression.

Indian J Psychiatry. 2012; 54(3):244–7.

Geetha A, Marar T, Shyamala Devi CS. Effect of α-tocopherol on

doxorubicin induced changes in rat liver and heart microsomes. Ind J

Exp Biol. 1991; 29(8): 782–785.

Georgieva N, Gadjeva V, Tolekova A. New Isonicotinoylhydrazones

With SSA protect against oxidative- hepatic injury of Isoniazid. TJS.

2004; 2: 37-43.

Glickman SW, Rasiel EB, Hamilton CD, Kubataev A, Schulman KA.

Medicine. A portfolio model of drug development for tuberculosis.

Science. 2006; 311:1246–1247.

Grajeda-Cota P, Ramírez-Mares MV, González de Mejía E. Vitamin C

Protects against in Vitro Cytotoxicity of Cypermethrin in Rat

Bibliography

180

Hepatocytes. Toxicology in vitro. 2004;18(1): 13-19. doi:10.1016/S0887-

2333(03)00077-8

Gueguen S, Pirollet P, Leroy P, Guilland JC, Arnaud J, Paille F et al.

Changes in Serum Retinol, α-Tocopherol, Vitamin C, Carotenoids, Zinc

and Selenium after Micronutrient Supplementation during Alcohol

Rehabilitation. J Am Coll Nutr. 2003; 22:303-310.

Gupta AK, Misra N. Hepatoprotective activity of aqueous ethanolic

extract of Chamomile capitula in paracetamol intoxicated albino rats.

Am J Pharmacol Toxicol. 2006; 1(1):17-20.

Habig, WH, Pabst, MJ, Jakoby, WB. Glutathione S-transferases.

Journal of Biological Chemistry 1974; 249(7):130–7139.

Hamideh Parhiz, Ali Roohbakhsh, Fatemeh Soltani, Ramin Rezaee,

Mehrdad Iranshahi. Antioxidant and Anti-Inflammatory Properties of the

Citrus Flavonoids Hesperidin and Hesperetin: An Updated Review of

their Molecular Mechanisms and Experimental Models. Phytother. Res.

2015; 29:323–331. DOI: 10.1002/ptr.5256

Hamideh Parhiz, Ali Roohbakhsh, Fatemeh Soltani, Ramin Rezaee and

Mehrdad Iranshahi.Antioxidant and Anti-Inflammatory Properties of the

Citrus Flavonoids Hesperidin and Hesperetin: An Updated Review of

their Molecular Mechanisms and Experimental Models. Phytother. Res.

2015; 29: 323–331.

Bibliography

181

Harrison FE. A critical review of vitamin C for the prevention of age-

related cognitive decline and Alzheimer’s disease. J Alzheimers Dis.

2012; 29(4):711–26.

Hayes JD, Flanagan JU, Jowsey IR. Glutathione transferases. Annu

Rev Pharmacol Toxicol. 2005; 45:51-88.

Hazarika A, Sarkar SN .Effect of isoproturon pretreatment on the

biochemical toxicodynamics of anilofos in male rats. Toxicol.

2001;165:87-95.

Head KA. Ascorbic acid in the prevention and treatment of cancer.

Altern Med Rev. 1998; 3(3):174–86.

Heikal TM, Mossa ATH, Khalil WKB. Protective Effects of Vitamin C

against Methomyl-Induced Injures on the Testicular Antioxidant Status

and Apoptosis-Related Gene Expression in Rat. J Environ Anal Toxicol.

2014; 4: 255. doi: 10.4172/2161-0525.1000255 186.

Hewage SRKM, Piao MJ, Kang KA, et al. Hesperidin Attenuates

Ultraviolet B-Induced Apoptosis by Mitigating Oxidative Stress in

Human Keratinocytes. Biomolecules & Therapeutics. 2016;24(3):312-

319.

Hjerten S, Pan H. Purification and characterization of two forms of low

affinity calcium ion ATPase from erythrocyte membranes Biochim.

Biophys. Acta.1983; 755: 457-466.

Bibliography

182

Hoffman RP, Dye AS, Bauer JA. Ascorbic acid blocks hyperglycaemic

impairment of endothelial function in adolescents with type 1 diabetes.

Pediatr Diabetes. 2012;13(8):607–10.

Holdin MR. Clinical pharmacokinetics of the antituberculosis drugs. Clin

Pharm. 1984; 9(6): 511–544.

Holt MP, Ju C. Mechanisms of drug-induced liver injury. The AAPS

Journal. 2006;8(1):E48-E54.

Huang HS, Chern HD, Su WJ, Wu JC, Chang SC, Chiang CH et al.

Cytochrome P4502E1 genotype and the susceptibility to

antituberculosis drug-induced hepatitis. Hepatology. 2003; 37(4): 924-

930.

Huang YS, Su WJ, Huang YH, Chen CY, Chang FY, Lin HC, et al.

Genetic polymorphisms of manganese superoxide dismutase, NAD

(P)H: quinone oxidoreductase, glutathione S-transferase M1 and T1,

and the susceptibility to drug-induced liver injury. J Hepatol

2007;47:128–34.

Hussain Z, Kar P, Husain SA. Antituberculosis drug-induced hepatitis:

risk factors, prevention and management. Indian J Exp Biol 2003;

41(11):1226-32.

Bibliography

183

Ibrahim MA, Buhari GO, Aliyu AB.Amelioration of Monosodium

Glutamate- Induced Hepatotoxicity by Vitamin C. European Journal of

Scientific Research.2011:60(1);159-165

Ihab T. Abdel-Raheem and Ahmed A. Abdel-Ghany.Hesperidin

Alleviates Doxorubicin-Induced Cardiotoxicity in Rats. Journal of the

Egyptian Nat. Cancer Inst. 2009; 21(2): 175-184.

Imogen M, Julia W, Sarah F, Roger W. Anti-tuberculous therapy and

acute liver failure. The Lancet. 1995; 345: 555- 556.

Isabel Perez-Cruz, Juan M, Carcamo, and David W. Golde. Vitamin C

inhibits FAS-induced apoptosis in monocytes and U937 cells. BLOOD,

2003:102(1):335-343.

Issabeagloo E, Taghizadieh M. Hepatomodulatory Action of Camellia

sinensis Aqueous Extract against Isoniazid-Rifampicin Combination

Induced Oxidative Stress in Rat. Advances in Bioresearch. 2012;3(3):

18 – 27.

Jadhav VB, Thakare VN, Suralkar AA, Deshpande AD, Naik SR.

Hepatoprotective activity of Luffa acutangula against CCl4 and

rifampicin induced liver toxicity in rats. A biochemical and

histopathological evaluation. Indian J Exp Biol. 2010;48:822–9.

Jamis-Dow C. A. Rifampin and rifabutin and their metabolism by human

liver esterases, Xenobiotica. 1997; 27(10): 1015–1024.

Bibliography

184

Jason E. Stout , John J. Engemann , Allen C. Cheng , et al. Safety of 2

months of rifampin and pyrazinamide for treatment of latent

tuberculosis, American Journal of Respiratory and Critical Care

Medicine. 2003;167 (6):824-827.

Jia R, Cao L, Du J, Xu P, Jeney G, Yin G. The protective effect of

silymarin on the carbon tetrachloride (CCl4)-induced liver injury in

common carp (Cyprinus carpio). In Vitro Cell Dev Biol Anim.

2013;49(3):155-61.

Jiang ZY, Hunt JV, Wolff SD. Ferrous ion oxidation in the presenceof

xylenol orange for detection of lipid hydroperoxide in low-

densitylipoprotein, Anal Biochem. 1992; 202:384–389.

Jin, Xiaoting, Li Song, Xiangyuan Liu, Meilan Chen, Zhuoyu Li, Long

Cheng, et al. Protective Efficacy of Vitamins C and E on p,p9-DDT-

Induced Cytotoxicity via the ROSMediated Mitochondrial Pathway and

NF-kB/FasL Pathway. PLOS ONE. 2014; 9(12): e113257.

Jomova K, Valko M. Importance of iron chelation in free radical-induced

oxidative stress and human disease. Curr Pharm Des. 2011;

17(31):3460-73.

Jyothi Basini S, Mohanalakshmi G, Mallikarjuna. Mechanisms For

Hepatotoxicity Induced By Anti-Tubercular Drugs: A Review. Journal of

Pharmacy Research. 2012;5(8):4338-434.

Bibliography

185

Kakkar P, Das B and Viswanathan PN. A modified spectrophotometric

assay of SOD. Indian Journal of Biochemistry Biophysics. 1984; 2:130-

132

Kale BP, Kothekar MA, Tayade HP, Jaju JB. Effect of aqueous extract

of Azadirachta indica leaves on hepatotoxicity by antituberculosis drugs

in rats. Indian J Pharmacol. 2003;35:177–80.

Kalpana KB, Devipriya N, Srinivasan M, Vishwanathan P, Thayalan K,

Menon VP, et al. Evaluating the radioprotective effect of hesperidin in

the liver of Swiss albino mice. Eur J Pharmacol. 2011; 658(2-3): 206–

12.

Kalpana KB, Srinivasan M, Menon VP. Evaluation of antioxidant activity

of hesperidin and its protective effect on H2O2 induced oxidative

damage on pBR322 DNA and RBC cellular membrane. Mol Cell

Biochem. 2009; 323: 21–29.

Kamaraj S, Anandakumar P, Jagan S, Ramakrishnan G, Devaki T.

Modulatory effect of hesperidin on benzo (a) pyrene induced

experimental lung carcinogenesis with reference to COX-2, MMP-2 and

MMP-9. European Journal of Pharmacology. 2010; 649: 320–327.

Kamaraj S, Anandakumar P, Jagan S, Ramakrishnan G, Devaki T.

Modulatory effect of hesperidin on benzo(a)pyrene induced

Bibliography

186

experimental lung carcinogenesis with reference to -COX-2, MMP-2 and

MMP-9. Eur J Pharmacol. 2010; 649: 320–327.

Kaplowitz N. Drug-induced liver disorders: implications for drug

development and regulation. Drug Saf. 2001; 24(7): 483-490.

Kawaguchi K, Kikuchi SI, Hasunuma R, Maruyama H, Yoshikawa T,

Kumazawa Y. A citrus flavonoid hesperidin suppresses infection-

induced endotoxin shock in mice. Biol Pharmaceut Bull. 2004; 27: 679–

683.

Kawanaka M, Nishino K, Nakamura J, Suehiro M, Goto D, Urata N, et

al.Treatment of nonalcoholic steatohepatitis with vitamins E and C: a

pilot study. Hepat Med. 2013, 5:11-16.

Khalili H, Dashti-Khavidaki S, Rasoolinejad M, Rezaie L, Etminana

M.Anti-tuberculosis drugs related hepatotoxicity Incidence, risk factors,

pattern of changes in liver enzymes and outcome. DARU. 2009;17: 163-

167.

Kim HK, Jeong TS, Lee MK, Park YB, Choi MS. Lipid-lowering efficacy

of hesperetin metabolites in high-cholesterol fed rats. Clin Chim Acta.

2003; 327(1-2):129-37.

Kim SH, Kim BK, Lee YC. Antiasthmatic Effects of Hesperidin, a

Potential Th2 Cytokine Antagonist, in a Mouse Model of Allergic

Asthma. Mediat Inflamm.2011: 485402.

Bibliography

187

Klaassen CD; (Ed.); Casarett and Doull's toxicology; the basic science

of poisons;7th Edition;Mc-Graw Hill, New York; 2008; 557-576.

Koch OR, Pani G, Borrello S, Colavitti R, Cravero A, Farre S, Galeotti T.

Oxidative stress and antioxidant defenses in ethanol-induced cell injury.

Mol Asp Med. 2004; 25:191–198.

Kumar R, Shalimar, Bhatia V, Khanal S, Sreenivas V, Gupta SD, et al.

Antituberculosis therapy-induced acute liver failure: magnitude, profile,

prognosis, and predictors of outcome. Hepatology. 2010;51:1665–74.

Lacroix CT, Phan Hoang J, Nouveau C, Guyonnaud G, Laine H,

Duwoos, Lafont O. et al., Pharmacokinetics of pyrazinamide and its

metabolites in healthy subjects, European Respiratory Journal. 1989;

36( 4): 395-400.

Lammert C, Bjornsson E, Niklasson A, Chalasani N. Oral medications

with significant hepatic metabolism at higher risk for hepatic adverse

events. Hepatology. 2010;51:615–20.

Lee KK, Fujimoto K, Zhang C, Schwall CT, Alder NN, Pinkert CA, et al.

Isoniazid-induced cell death is precipitated by underlying mitochondrial

complex I dysfunction in mouse hepatocytes. Free Radic Biol Med.

2013;65:584–94.

Bibliography

188

Leifeld L, Nattermann J, Fielenbach M, Schmitz V, Sauerbruch T,

Spengler U. Intrahepatic activation of caspases in human fulminant

hepatic failure. Liver Int. 2006; 26: 872–879.

Li R, Cai L, Xie XF, Yang F, Li J. Hesperidin suppresses adjuvant

arthritis in rats by inhibiting synoviocyte activity. Phytother Res. 2010;

24: 71–76.

Li R, Li J, Cai L, Hu CM, Zhang L. Suppression of adjuvant arthritis by

hesperidin in rats and its mechanisms.J Pharm Pharmacol. 2008;

60(2):221-8. doi: 10.1211/jpp.60.2.0011.

Li S, Tan H-Y, Wang N, et al. The Role of Oxidative Stress and

Antioxidants in Liver Diseases. Piva T, ed. International Journal of

Molecular Sciences. 2015;16(11):26087-26124.

Liao K and Yin M. Individual and combined antioxidant effects of

phenolic agents in human erythrocyte membrane ghosts and

phophatidylcholine liposome systems: importance of the partition

coefficient. J Agric Food Chem. 2000;48:2266-2270.

Loscalzo LM, Wasowski C, Paladini AC, Marder M. Opoid receptors are

involved in the sedative and antinociceptive effects of hesperidin as well

as in its potentiation with benzodiazepines. Eur J Pharmacol. 2008, 580:

306-313.

Bibliography

189

Loscalzo LM, Yow TT, Wasowski C, Chebib M, Marder M. Hesperidin

induces antinociceptive effect in mice and its aglycone, hesperetin,

binds to μ-opioid receptor and inhibits GIRK1/2 currents. Pharmacol

Biochem Behav. 2011 ; 99(3):333-341. doi: 10.1016/j.pbb.2011.05.018.

Lothar Rossig, Jorg Hoffmann, Benedicte Hugel, Ziad Mallat, Astrid

Haase, Jean-Marie Freyssinet et al. Circulation. 2001;104:2182-2187.

Lowry OH, Rosebrough NJ, Farr AL, Randell RJ. Protein measurement

with the folin phenol reagent. J Biol Chem. 1951;193:265-75.

Luis S M, Christian Mendez, Daniell Hill, Shirish Barve, Craig JM.

Diagnosis and Treatment of Alcoholic Liver Disease and Its

Complications. Alcohol Research & Health. 2003;27(3):247-256.

Mahfouz MM, Kummerow FA. Vitamin C or vitamin B6 supplementation

prevent the oxidative stress and decreases of prostacyclin generation in

homocysteinemic rats. Int J Biochem CellBiol. 2004;36:1919–1932.

Mannan Hajimahmoodi, Ghazaleh Moghaddam, Seyed Mohsen

Mousavi, Naficeh Sadeghi, Mohammad Reza Oveisi, Behrooz Jannat.

Total Antioxidant Activity, and Hesperidin, Diosmin, Eriocitrin and

Quercetin Contents of Various Lemon Juices. Tropical Journal of

Pharmaceutical Research. 2014; 13 (6): 951-956.

Bibliography

190

Marc P, McRae. Vitamin C supplementation lowers serum low density

lipoprotein cholesterol and triglycerides: a meta-analysis of 13

randomized controlled trials. JCM. 2008; 7(2):548–81.

Marc P, McRae. Vitamin C supplementation lowers serum low-density

lipoprotein cholesterol and triglycerides: a meta-analysis of 13

randomized controlled trials. J Chiropr Med. 2008; 7(2): 48–58.

Martin MU, Wesche H. Summary and comparison of the signaling

mechanisms of the Toll/interleukin-1 receptor family. Biochim Biophys

Acta. 2002; 1592(3): 265-80.

Mehmedagic A, Verite P, Menager S, Tharasse C, Chabenat C, André

D. et al. Determination of pyrazinamide and its main metabolites in rat

urine by high-performance liquid chromatography, Journal of

Chromatography B: Biomedical Sciences and Applications.1997;695(2):

365-372.

Naseer MI, Ullah N, Ullah I, Koh PO, HY Lee, Park MS, Kim

MO.Vitamin C protects against ethanol and PTZ-induced apoptotic

neurodegeneration in prenatal rat hippocampal neurons.2011:65(7),

562–571.

Mikirova N, Casciari J, Rogers A, Taylor P. Effect of high-dose

intravenous vitamin C on inflammation in cancer patients. J Transl Med.

2012; 10:189.

Bibliography

191

Milenkovic D, Deval C, Dubray C, Mazur A, Morand C. Hesperidin

displays relevant role in the nutrigenomic effect of orange juice on blood

leukocytes in human volunteers: a randomized controlled cross-over

study. PLOS One. 2011 ;6(11):e26669. doi:

10.1371/journal.pone.0026669.

Mitchell JR, Snodgrass WR, Gillette JR. The role of biotransformation in

chemical-induced liver injury, Environ Health Perspect. 1976;15:27-38.

Miwa Y, Mitsuzumi H, Sunayama T, Yamada M, Okada K, Kubota M et

al. Glucosyl hesperidin lowers serum triglyceride level in

hypertriglyceridemic subjects through the improvement of very low-

density lipoprotein metabolic abnormality. J Nutr Sci Vitaminol (Tokyo).

2005; 51(6):460-70.

MM El-Shafey and MF Abd-Ellah Mostafa. Hesperidin Improves Lipid

Profile and Attenuates Oxidative Stress in Hypercholesterolemic Rats.

Int J Pharma Sci. 2014, 4(3): 554-559.

Mohamed Saleem Thattakudian Sheik Uduman, Ramkanth

Sundarapandian, Azagusundharam Muthumanikkam,Gnanaprakash

Kalimuthu, Angala Parameswari S,Thiruvengada Rajan Vasanthi

Srinivas, et al. Protective effect of methanolic extract of Annona

squamosa linn in Isoniazid-Rifampicin induced hepatotoxicity in rats.

Pak J Pharm Sci. 2011; 24(2):129-134.

Bibliography

192

Monfort A, Wutz A. Breathing-in epigenetic change with vitamin C.

EMBO Rep. 2013; 14: 337–346.

Mor F, Ozmen O. Effect of vitamin C in reducing the toxicity of

endosulfan in liver in rabbits. Exp Toxicol Pathol. 2010; 62:75-80.

Nakajima A, Fukami T, Kobayashi Y, Watanabe A, Nakajima M, Yokoi

T. Human arylacetamide deacetylase is responsible for deacetylation of

rifamycins: rifampicin, rifabutin, and rifapentine, Biochem Pharmacol.

2011; 82( 11);1747–1756.

Nannelli A, Chirulli V, Longo V. Expression and induction by rifampicin

of CAR- and PXR-regulated CYP2B and CYP3A in liver, kidney and

airways of pig. Toxicology. 2008; 252:105–112.

Naseer MI, Ullah N, Ullah I, Koh PO, Lee HY, Park MS, Kim

MO.Vitamin C protects against ethanol and PTZ-induced apoptotic

neurodegeneration in prenatal rat hippocampal neurons. Synapse.

2011; 65(7): 562–571.

Naveen Tirkey, Sangeeta Pilkhwal, Anurag Kuhad, Kanwaljit

Chopra.Hesperidin, a citrus bioflavonoid, decreases the oxidative stress

produced by carbon tetrachloride in rat liver and kidney. BMC

Pharmacology. 2005; 5(2):1-8.doi:10.1186/1471-2210-5-2

Bibliography

193

Nelson SD, Mitchell JR, Timbrell JA, Snodgrass WR, Corcoran GB.

Isoniazid and iproniazid: activation of metabolites to toxic intermediates

in man and rat. Science. 1976; 193(4256): 901-903.

Neuzil J, Thomas SR, Stocker R. Requirement for, promotion, or

inhibition by alpha-tocopherol of radical-induced initiation of plasma

lipoprotein lipid peroxidation. Free Radic Biol Med.1997;22:57–71.

Nishikimi M, Fukuyama R, Minoshima S, Shimizu N, Yagi K. Cloning

and chromosomal mapping of the human nonfunctional gene for L-

gulono-γ-lactone oxidase, the enzyme for L-ascorbic acid biosynthesis

missing in man. J Biol Chem. 1994; 269: 13685–13688.

Nkosi CZ, Opoku AR, Terblanche SE. Effect of pumpkin seed

(Cucurbita pepo) protein isolate on the activity levels of certain plasma

enzymes in CCl4-induced liver injury in low protein fed rats. Phy Res.

2005;19:341–5.

Nordmann R. Alcohol and antioxidant systems. Alcohol and Alcoholism.

1994; 29: 513–522.

Odigie IP, Okpoko FB, Ojobor PD. Antioxidant effects of vitamin C and

E on phenyl hydrazine-induced haemolysis in Sprague Dawley rats:

evidence for a better protection by vitamin E. Nig Postgrad Med J. 2007;

14: 1-7.

Bibliography

194

Ohkawa H, Ohishi N, Yagi K. Assay of lipid peroxide in animal tissue by

TBA reaction. Anal Biochem. 1979;95:351-8

Ohnishi T, Suzuki T, Suzuki Y, Ozawa K. A comparative study of

plasma membrane Mg2+ ATPase activities in normal, regenerating and

malignant cells. Biochem Biophys Acta.1962; 684 :67-74.

Ohta Y, Kongo-Nishimura M, Hayashi T, Kishikawa T. Effect or Oren-

gedoku-To (Huanglian-Jie-Du-Tang) extract on disruption of hepatic

antioxidant defense system in rats treated with D-galactosamine. J

Ethanopharmacol. 2002; 94: 323–329.

Omaye ST, Turnbull JD, Sauberlich HE. Selected methods for the

determination of ascorbic acid in animal cells, tissues and fluids.

Methods Enzymol.1979; 62:1–11.

Ortotani, Novelli G. Conti A, Raffade de Gondio A, Moraldi E cantini.

The effect of glutathione and N. Acetyl cysteine on lipid peroxidative

damage in patients with early septic shock. Am J RespirCrit Care Med.

2010; 161:1907-11.

Osama A Alkhamees. Protective Effects of Vitamin-P and Vitamin-C on

Hypercholesterolemia -induced Oxidative Hepatic Damage and Lipid

Profile Changes in Female Rats: A Comparative Study. Journal of

Applied Pharmaceutical Science. 2013; 3(4): 099-105.

Bibliography

195

OShea RS, Dasarathy S, McCullough AJ. et al. Alcoholic liver disease.

AASLD practice guidelines. Hepatology. 2010; 51(1): 307-328.

Ostapowicz G, Fontana RJ,Schiodt FV, Larson A, Davron JT, Steven

HB, et al. Results of a prospective study of acute liver failure at 17

tertiary care centers in the United states. Ann Intern Med. 2002;

137(12):947-954.

Ozer A, Bruick RK. Non-heme dioxygenases: Cellular sensors and

regulators jelly rolled into one. Nat Chem Biol. 2007; 3(3): 144–153.

Padayatt SJ, Katz A, WangY, Eck P, Kwon O, Lee JH, et al.Vitamin C

as an antioxidant evaluation of its role in disease prevention. J Am Coll

Nutr. 2003;22(1):18–35.

Padma V, Suja V, Shyamala Devi CS, Prema .Hepatoprotective effect of

Liv-52 on antitubercular drug induced hepatotoxicity in rats, Fitoterapia.

1998; 69( 6): 520-522.

Pal R, Rana S, Vaiphei K, Singh K. Effect of different doses of

carotenoids in isoniazid-rifampicin induced hepatotoxicity in rats. Trop

Gastroenterol 2008; 29(3):153-9.

Pal R, Rana SV, Vaipheib K, Singha K. Isoniazid-rifampicin induced

lipid changes in rats. Clinica Chimica Acta. 2008; 389(1–2): 55–60.

Pandit A. Drug-Induced Hepatotoxicity: A Review, J Appl Pharm Sci.

2012; 02( 05) :233-243.

Bibliography

196

Papiya Bigoniya, Kailash Singh. Ulcer protective potential of

standardized Hesperidin, a citrus flavonoid isolated from Citrus sinensis.

Rev Bras Farma.2014; 24(3): 330-340.

Pari L, Karthikeyan A, Karthika P, Rathinam A. Protective effects of

Hesperidin on oxidative stress, dyslipidaemia and histological changes

in iron-induced hepatic and renal toxicity in rats. Toxicology Reports.

2014; 2:46–55.

Park H J, Kim M J, Ha E, Chung J H. Apoptotic effect of hesperidin

through caspase3 activation in human colon cancer cells, SNU-C4.

Phytomedicine. 2008; 15(1–2):147–151.

Parmar MY, Shah P, Thakkar V, Gandhi TR. Hepatoprotective activity

of Amomum subulatum Roxb against ethanol-induced liver damage. Int

J Green Pharm.2009; 3(3): 250-254.

Partha Pal, Sayantan Ray.Alcoholic Liver Disease: A comprehensive

Review. EMJ. 2016;1(2):85-92 .

Patel T, Roberts LR, Jones BA and Gores GJ. Dysregulation of

apoptosis as mechanism of liver disease: an overview. Semin Liver Dis.

1998; 18(2):105-114.

Patil JR, Chidambara Murthy KN, Jayaprakasha GK, Chetti MB, Patil

BS. Bioactive compounds from Mexican lime (Citrus aurantifolia) juice

Bibliography

197

induce apoptosis in human pancreatic cells. J Agric Food Chem. 2009;

57(22):10933–10942.

Perez-Cruz I, Cárcamo JM, Golde DW. Caspase-8 dependent TRAIL-

induced apoptosis in cancer cell lines is inhibited by vitamin C and

catalase. Apoptosis. 2007; 12(1): 225-34.

Pradeep K, Park SH, Ko KC. Hesperidin a flavanoglycone protects

against g-irradiation induced hepatocellular damage and oxidative

stress in Sprague–Dawley rats. Eur J Pharmacol. 2008; 587(1-3): 273–

280.

Preziosi P. Isoniazid: metabolic aspects and toxicological correlates.

Curr Drug Metab. 2007; 8(8): 839–851.

Ramappa V, Aithal GP. Hepatotoxicity Related to Anti-tuberculosis

Drugs: Mechanisms and Management. Journal of Clinical and

Experimental Hepatology. 2013; 3(1):37-49.

doi:10.1016/j.jceh.2012.12.001.

Recknagel RO and Glende EA. Spectrophotometric detection of lipid

conjugated dienes. Methods Enzymol. 1984; 105: 331-337.

Reiter RJ, Tan DX, Osuna C, Gitto E. Actions of melatonin in the

reduction of oxidative stress. A review. J Biomed Sci. 2000;7(6):444–58.

Bibliography

198

Richards VE, Chau B, White MR, McQueen CA. Hepatic gene

expression and lipid homeostasis in C57BL/6 mice exposed to

hydrazine or acetylhydrazine. Toxicol Sci. 2004; 82:318–332.

Riedl SJ, Shi Y. Molecular mechanisms of caspase regulation during

apoptosis. Nat Rev Mol Cell Biol. 2004; 5(11):897–907.

Ringseis R, Muschick A, Eder K. Dietary Oxidized Fat Prevents

Ethanol-Induced Triacylglycerol Accumulation and Increases

Expression of PPARa Target Genes in Rat Liver. J Nutr. 2007; 137(1):

77-83.

Roohbakhsh A, Parhiz H, Soltani F, Rezaee R, Iranshahi M. Molecular

mechanisms behind the biological effects of hesperidin and hesperetin

for the prevention of cancer and cardiovascular diseases. Life Sci.

2015; 124:64-74. doi: 10.1016/j.lfs.2014.12.030.

Roy B, Chowdhury A, Kundu S. Increased risk of antituberculosis drug-

induced Hepatotoxicity in individuals with glutathione S-transferase M1

'null' mutation. J Gastroenterol Hepatol. 2001;16 (9):1033-7.

Rukkumani R, Aruna K, Suresh Varma P, Menon VP. Influence of

ferulic acid on circulatory prooxidant–antioxidant status during alcohol

and PUFA induced toxicity. J Physiol Pharmacol. 2004 ; 55(3) : 551–

561.

Bibliography

199

Sabesin SM, Kuiken LB and Ragland JB. Hepatoprotective effects of

polyprenols from Ginkgo biloba L. leaves on CCl4-induced

hepatotoxicity in rats. Fitoterapia. 2011; 82(6): 834-840.

Sabiu S, Taofik O. Sunmonu, Emmanuel O. Ajani, Taofeek O. Ajiboye.

Combined administration of silymarin and vitamin C stalls

acetaminophen-mediated hepatic oxidative insults in Wistar rats.

Brazillian journal of pharmacology. 2015 ;25 :29–34.

Sabiu S, Wudil AM, Sunmonu TO. Combined administration of

Telfairaoccidentalis and Vernonia amygdalina leaf powders ameliorates

garlic-inducedhepatotoxicity in Wistar rats. Pharmacologia.2014; 5:

191–198.

Sahu BD, Kuncha M, Sindhura GJ, Sistla R. Hesperidin attenuates

cisplatin-induced acute renal injury by decreasing oxidative stress,

inflammation and DNA damage. Phytomedicine. 2013; 20(5): 453-60.

Saiprasad G, Chitra P, Manikandan R, Sudhandiran G. Hesperidin

induces apoptosis and triggers autophagic markers through inhibition of

Aurora-A mediated phosphoinositide-3-kinase/ Akt/mammalian target

of rapamycin and glycogen synthase kinase-3 beta signalling cascades

in experimental colon carcinogenesis. Eur J Cancer. 2014; 50(14):

2489-2507.

Bibliography

200

Salonen RM, Nyyssonen K, Kaikkonen J, Porkkala-Sarataho E,

Voutilainen S, Rissanen TH, et al. Effect of combined Vitamin C and E

supplementation on atherosclerotic progression: the antioxidant

supplementation in atherosclerosis prevention (ASAP) study.

Circulation.2003;107(7):947–953.

Sana Tufail , Javed Iqbal , Aamir Abbas. Antituberculous Treatment

Induced ALT & ALP Derangements and The Role of Onion Extract in

Male Albino Rats. APM. 2010;4(1): 33-38.

Sankar M, Johanna Rajkumar, Sridhar.Hepatoprotective activity Of

Heptoplus On Isoniazid And Rifampicin Induced Hepatotoxicity In Liver

Cell Lines. Int J Pharm Pharm Sci. 2015; 7(5): 215-219.

Santos IMS, Da Rocha-Tome A, Saldanha GB, Ferreira PMP, Militao

GCG, De Freitas RM. Oxidative stress in the hippocampus during

experimental seizures can be ameliorated with the antioxidant Vitamin

C. Oxid Med Cell. Longev.2009; 2: 214–221.

Saraswathy SD, Suja V, Gurumurthy P, Shyamala Devi CS. Effect of

LIV 100 against antitubercular drugs (isoniazid, rifampicin and

pyrazinamide) induced hepatotoxicity in rats. Indian Journal of

Pharmacology. 1998; 30(4): 233-8.

Bibliography

201

Sarich TC, Adams SP, Petricca G, Wright JM. Inhibition of isoniazid-

induced hepatotoxicity in rabbits by pretreatment with an amidase

inhibitor. J Pharmacol Exp Ther. 1999;289:695–702.

Sarich TC, Zhou T, Adams SP, Bain AI, Wall RA, Wright JM. A model of

isoniazid-induced hepatotoxicity in rabbits. J Pharmacol Toxicol

Methods. 1995; 34:109–116.

Saukkonen JJ, Cohn DL, Jasmer RM, Schenker S, Jereb JA. Official

ATS Statement: Hepatotoxicity of antituberculosis therapy. Am J Respir

Crit Care Med. 2006;174(8): 935-952.

Seiichiro Fujisawa, Mariko Ishihara, Toshiko Atsumi, Yoshinori Kadoma.

A Quantitative Approach to the Free Radical Interaction Between Alpha-

tocopherol or Ascorbate and Flavonoids. In vivo. 2006; 20: 445-452.

Selvendiran K, Sakthisekaran D. Chemopreventive effect of piperine on

modulating lipid peroxidation and membrane bound enzymes in

benzo(a)pyrene induced lung carcinogenesis. Biomed

Pharmacother. 2004; 58(4): 264–277.

Seung-Woo Hong, Dong-Hoon Jin, Eun-Sil Hahm, Sei-Hyun Yim,Jong-

Seok Lim, Keun-Il Ki. Ascorbate (vitamin C) induces cell death through

the apoptosis-inducing factor in human breast cancer cells. Oncology

Reports.2007;18: 811-815,

Bibliography

202

Sha Li, Hor-Yue Tan, Ning Wang, Zhang-Jin Zhang, Lixing Lao, Chi-

Woon Wong, et al. The Role of Oxidative Stress and Antioxidants in

Liver Diseases. Int J Mol Sci. 2015; 16(11): 26087–26124.

Shailja Chambial, Shailendra Dwivedi, Kamla Kant Shukla, Placheril J.

John, Praveen Sharma. Vitamin C in Disease Prevention and Cure: An

Overview. Ind J Clin Biochem. 2013; 28(4):314–328.

Shailja Chambial, Shailendra Dwivedi, Kamla Kant Shukla, Placheril J.

John. Praveen Sharma.Vitamin C in Disease Prevention and Cure: An

Overview. Ind J Clin Biochem. 2013; 28(4):314–328.

Shang Z. Abdulqader, Inaam A.Mustafa. The Protective Role of Vitamin

C against Formaldehyde induced-hepatotoxicity and nephrotoxicity in

Male Rats . JPBS. 2014; 9(4):21-26.

Sharma GR, Immanuel C, Kailasam S, Narayana AS, Venkatesan P.

Rifampin-induced release of hydrazine from isoniazid. A possible cause

of hepatitis during treatment of tuberculosis with regimens containing

isoniazid and rifampin. Am Rev Respir Dis. 1986; 133(6):1072–1075.

Shashank Kumar, Abhay K. Pandey .Chemistry and Biological Activities

of Flavonoids: An Overview. The Scientific World Journal. 2013 ;2013:1-

16.

Bibliography

203

Shiha TY, Paib CY, Yang P, Chang WL, Ning-Chi Wang NC , Hua

OYP. A Novel Mechanism Underlies the Hepatotoxicity of

Pyrazinamide, Antimicrob Agents Chemother. 2013; 57(4): 1685-1690.

Shoko Kobayashi, Soichi Tanabe. Evaluation of the anti-allergic activity

of Citrus unshiu using rat basophilic leukemia RBL-2H3 cells as well as

basophils of patients with seasonal allergic rhinitis to pollenInternational

Journal of Molecular Medicine. 2006; 17(3):511-5.

Singh A, Bhat TK, Sharma OP.Clinical Biochemistry of Hepatotoxicity. J

Clinic Toxicol. 2011; S4:001. doi:10.4172/2161-0495.S4-001.

Singh M, Sasi P, Rai G, Gupta VH, Amarapurkar D, Wangikar PP.

Studies on toxicity of antitubercular drugs namely isoniazid, rifampicin,

and pyrazinamide in an in vitro model of HepG2 cell line. Med Chem

Res. 2011; 20(9): 1611-15.

Singh Robin, Kumar Sunil, Rana AC, Sharma Nidhi. Different models of

hepatotoxicity and related liver diseases: A Review. IRJP.

2012;3(7):86-95.

Singh RP, Agarwal R. Natural flavonoids targeting deregulated cell

cycle progression in cancer cells. Curr Drug Targets. 2006;7(3):345–54.

Sinha AK. Colorimetric assay of catalase. Anal. Biochem.1972; 47: 389-

394.

Bibliography

204

Siow RC, Richards JP, Pedley KC, Leake DS, Mann GE. Vitamin C

protects human vascular smooth muscle cells against apoptosis

induced by moderately oxidized LDL containing high levels of lipid

hydroperoxides. Arterioscler Thromb Vasc Biol. 1999;19:2387-94.

Smirnoff N, Wheeler GL. Ascorbic acid in plants: biosynthesis and

function. Crit Rev Biochem Mol Biol. 2000; 35(4):291-314.

Sodhi CP, Rana SV, Mehta SK, Vaiphei K, Attari S, Mehta S. Study of

oxidative-stress in isoniazid-rifampicin induced hepatic injury in young

rats. Drug Chem Toxicol. 1997;20:255–69.

Sodhi CP, Rana SV, Mehta SK, Vaiphei K, Attri S, Thakur S, et al.

Study of oxidative stress in isoniazid induced hepatic injury in young

rats with and without protein energy malnutrition. J Biochem Toxicol.

1996;11(30):139-146.

Stangeland T, Remberg SF, Lye KA. Total antioxidant activity in 35

Ugandan fruits and vegetables. Food Chem. 2008;113: 85–91.

Steele MA, Burk RF, DesPrez RM. Toxic hepatitis with isoniazid and

rifampicin. Chest .1991; 99(2):465‑71.

Stekhoren MA, Bonting SL. Transport of ATPases: properties and

functions. Physiol Rev.1981; 61: 1–76.

Bibliography

205

Sudhir Kumar, Khushboo Ambreen, Rolee Sharma, Kaleshwar P Singh.

Anti-Tuberculosis Drug-Induced Hepatotoxicity: A Review. IJBR. 2014;

5(3):423-437

Susara Ruwan Kumara Madduma Hewage, Mei Jing Piao, Kyoung Ah

Kang, Yea Seong Ryu, Xia Han, Min Chang Oh et al. Hesperidin

Attenuates Ultraviolet B-Induced Apoptosis by Mitigating Oxidative

Stress in Human Keratinocytes. Biomol Ther. 2014; 5(3):423-437.

Tacke FT, Luedde, trautwein C. Inflammatory pathways in liver

homeostasis and liver injury. Clin Rev Allergy Immunol. 2009; 36:4-12.

Talalay P, Fahey JW, Holtzclaw WD, Prestera T, Zhang Y.

Chemoprotection against cancer by phase 2 enzyme induction. Toxicol

Lett. 1995; 82-83: 173-179.

Tamilselvam K, Braidy N, Manivasagam T, Essa MM, Prasad NR,

Karthikeyan S, et al. Neuroprotective effects of hesperidin, a plant

flavanone, on rotenone-induced oxidative stress and apoptosis in a

cellular model for Parkinson's disease.Oxid Med Cell Longev.

2013;2013:102741.

Tang N, Deng R, Wang Y, Lin M, Li H, Qiu Y, et al. GSTM1 and GSTT1

null polymorphisms and susceptibility to anti-tuberculosis drug-induced

liver injury: a meta-analysis. Int J Tuberc Lung Dis. 2013;17:17–25.

Bibliography

206

Tarasankar Maity, Ayaz Ahmad, Nilanjan Pahari. Evaluation of

hepatotherapeutic effects of Mikania Scandens (L.) Willd. On alcohol

induced hepatotoxicity in rats. Int J Pharm Pharm Sci. 2012; 4(3): 490-

494.

Tasduq SA, Peerzada K, Koul S, Bhat R, Johri RK. Biochemical

manifestations of anti‑tuberculosis drugs induced hepatotoxicity and the

effect of silymarin. Hepatol Res. 2005; 31(3):132‑5.

Tayal V, Kalra BS, Agarwal S, Khurana N, Gupta U. Hepatoprotective

effect of tocopherol against isoniazid and rifampicin induced

hepatotoxicity in albino rabbits. Indian J Exp Biol. 2007;45(12):1031-6.

Tayal V, Kalra BS, Agarwal S, Khurana N, Gupta U. Hepatoprotective

effect of tocopherol against isoniazid and rifampicin induced

hepatotoxicity in albino rabbits. Indian J Exp Biol. 2007; 45(12):1031-6.

Temple RJ. Himmel MH. Safety of newly approved drugs: implications

for prescribing. JAMA.2002; 287(17): 2273-2275.

Tierney, Lawrence M, McPhee, Stephen J, Papadakis, Maxine A.

Current Medical Diagnosis & treatment. 45th ed. McGraw- Hill;

2006.666-9.

Tostmann A, Boeree MJ, Aarnoutse RE, De Lange WC, Van der Ven

AJ, Dekhuijzen R. Antituberculosis drug-induced hepatotoxicity: concise

up-to-date review. J Gastroenterol Hepatol.2008; 23(2): 192-202.

Bibliography

207

Tostmann A, Boeree MJ, Aarnoutse RE, De Lange WC, Van Der Ven

AJ, Dekhuijzen R. Anti-tuberculosis drug-induced hepatotoxicity:

Concise up-todate review. J Gastroenterol Hepatol. 2008; 23(2): 192-

202.

Tsui WMS. Drug – associated changes in the liver. Current diagnostic

pathol 2003;9:96-104.

Ungo JR, Jones D, Ashkin D, Hollender ES, Bernstein D, Albanese AP,

Pitchenik AE. Antituberculosis drug-induced hepatotoxicity. The role of

hepatitis C virus and the human immunodeficiency virus. Am J Respir

Crit Care Med. 1998; 157(6): 1871-1876.

Uwe Wenzel, Alexander Nickel, Sabine Kuntz, Hannelore Daniel.

Ascorbic acid suppresses drug-induced apoptosis in human colon

cancer cells by scavenging mitochondrial superoxide anions.

Carcinogenesis. 2004; 25(5):703-712.

Vargas-Mendoza N, Madrigal-Santillán E, Morales-González Á.

Hepatoprotective effect of silymarin. World Journal of Hepatology.

2014;6 (3):144-149. doi:10.4254/wjh.v6.i3.144.

Vesna Kunti, Jasmina Brbori, Ivanka Holclajtner - Antunovi, Snezana

Uskokovi-Markovi. Evaluating the bioactive effects of flavonoid

hesperidin – A new literature data survey. Vojnosanit Pregl. 2014; 71(1):

60–65.

Bibliography

208

Vidhya A and Indira M. Protective effect of Quercetin in the Regression

of Ethanol-Induced Hepatotoxicity. Indian J Pharm Sci. 2009; 71(5):

527–532.

Vijaya Padma V, Suja R, Shyamala Devi CS. Hepatoprotetive effect of

Liv.52 on Antitubercular Drug induced Hepatotoxicity in rats. Fitoterapia

(LXIX). 1998; 6: 520-522.

Vinson JA and Jang J. In vitro and in vivo lipoprotein antioxidant effect

of a citrus extract and ascorbic acid on normal and hypecholesterolemic

human subjects. J Med Food. 2001; 4(4): 187-192.

Visnagri A, Kandhare AD, Chakravarty S, Ghosh P, Bodhankar SL.

Hesperidin, a flavanoglycone attenuates experimental diabetic

neuropathy via modulation of cellular and biochemical marker to

improve nerve functions. Pharm Biol. 2014; 52(7): 814-28.

Vollbracht C, Schneider B, Leendert V, Weiss G, Auerbach L, Beuth J.

Intravenous vitamin C administration improves quality of life in breast

cancer patients during chemo-/radiotherapy and aftercare: results of a

retrospective, multicentre, epidemiological cohort study in Germany.

2011; 25(6):983-990.

Wang P, Pradhan K, Zhong X, Ma X. Isoniazid metabolism and

hepatotoxicity. Acta Pharmaceutica Sinica B. 2016;6(5):384-392.

Bibliography

209

Wang X, Hasegawa J, Kitamura Y, Wang Z, Matsuda A, Shinoda W, et

al. Effects of hesperidin on the progression of hypercholesterolemia and

fatty liver induced by high-cholesterol diet in rats. J Pharmacol Sci.

2011; 117:129-138.

Wen X, Wang JS, Neuvonen PJ, Backman JT. Isoniazid is a

mechanism-based inhibitor of cytochrome P450 1A2, 2A6, 2C19 and

3A4 isoforms in human liver microsomes. Eur J Clin Pharmacol. 2002;

57(11):799-804.

Wen X, Wang JS, Neuvonen PJ, Backman JT. Isoniazid is a

mechanism-based inhibitor of cytochrome P450 1A2, 2A6, 2C19 and

3A4 isoforms in human liver microsomes. Eur J Clin Pharmacol. 2002;

57(11):799-804.

Westphal JF, Vetter D, Brogard JM. Hepatic side-effects of antibiotics.

J. Antimicrob. Chemother. 1994; 33(3): 387- 401.

Whitehouse LW, Lodge AWBY, Thomas BH. Metabolic disposition of

pyrazinamide in the rat: identification of a novel in vivo metabolite

common to both rat and human. Biopharmaceutics & Drug Disposition.

1987;8(4): 307-318.

Wilcox LJ, Borradaile NM, Dreu LE, Huff MW. Secretion of hepatocyte

apoB is inhibited by the flavonoids, naringenin and hesperetin, via

Bibliography

210

reduced activity and expression of ACAT2 and MTP. J Lipid Res. 2001;

42(5):725–734.

Wintergerst ES, Maggini S, Hornig DH. Immune-enhancing role of

vitamin C and zinc and effect on clinical conditions. Ann Nutr Metab.

2006;50(2):85–94. doi:10.1159/000090495

World Health Organization (WHO), Global tuberculosis report WHO;

2015.

Wu CC, Bratton SB. Regulation of the intrinsic apoptosis pathway by

reactive oxygen species. Antioxidants & redox signalling 2013; 19(6):

546–558.

Wu D, Cederbaum AI. Alcohol, oxidative stress and free radical

damage. Alcohol Res Health. 2003; 27(4): 277-284.

Wu D, Zhai Q, Shi X. Alcohol-induced oxidative stress and cell

responses. J Gastroenterol Hepatol. 2006; 21(3):S26-29.

Wu G, Fang YZ, Yang S, Lupton JR, Turner ND. Glutathione

metabolism and its implications for health. J Nutr. 2004;134(3):489–492.

Wu N, Sarna LK, Siow YL, Karmin O. Regulation of hepatic cholesterol

biosynthesis by berberine during hyperhomocysteinemia. Am J Physiol

Regul Integr Comp Physiol. 2011; 69: R635-R643.

Bibliography

211

XavierS M, Barbosa C, Barros DO, Silva RF, Oliveria AA, Freitas RM.

Vitamin C antioxidant in hippocampus of adult Wistar rats after seizures

and status epilepticus induced by pilocarpine. Neurosci Lett.

2007;420(1): 76–79.

Yin XM, Ding WX. Death receptor activation-induced hepatocyte

apoptosis and liver injury. Curr Mol Med. 2003;3(6):491–508.

Yoshida H, Takamura N, Shuto T, Ogata K, Tokunaga J, Kawai K, Kai

H. The citrus flavonoids hesperetin and naringenin block the lipolytic

actions of TNF-alpha in mouse adipocytes. Biochem Biophys Res

Commun. 2010; 394(3):728-32. doi: 10.1016/j.bbrc.2010.03.060.

You M, Crabb DW. Recent advances in alcoholic liver disease. II.

Minireview: molecular mechanisms of alcoholic fatty liver. Am J Physiol

Gastrointest Liver Physiol. 2005; 287:G4–G63.

You M, Fischer M, Deeg MA and Crabb DW. Ethanol induces fatty acid

synthesis pathways by activation of sterol regulatory element-binding

protein (SREBP). J Biol Chem.2002; 277(32): 29342-29347.

Young IS, Woodside JV. Antioxidants in health and disease. J Clin

Pathol. 2001; 54(3):176-86.

Zakhari S. Overview: How Is Alcohol Metabolized by the Body? Alcohol

Research & Health. 2006; 29(4):245-254.

Bibliography

212

Zhang H, Huang C, Wang Y, Lu Z, Zhuang N, Zhao D, et al. Hepatitis B

virus X protein sensitizes TRAIL-induced hepatocyte apoptosis by

inhibiting the E3 ubiquitin ligase A 20. PLOS One.

2015;10(5):e0127329.

Zimmerman HJ. Hepatic injury from the treatment of infectious and

parasitic diseases. In Zimmerman HJ. Hepatotoxicity: the adverse

effects of drugs and other chemicals on the liver. 2nd ed. Philadelphia:

Lippincott. 1999;589:73-96.

Zimmerman HJ.Drug induced liver disease. Cli Liver Dis. 2004;4:73-96.

List of publications

213

11. LIST OF PUBLICATIONS

1. Nathiya S, Rajaram S, Philips Abraham. Hesperidin alleviates

antitubercular drug induced oxidative stress, inflammation and

apoptosis in rat liver. International journal of Biomedical

Research. 2016; 7(7): 439-446.

2. Nathiya S, Rajaram S, Philips Abraham, Vennila G, Sivakami.

Hepatoprotective and antioxidant effect of Hesperidin against

Isoniazid, Rifampicin and Pyrazinamide induced hepatotoxicity in

rats. Journal of Pharmacy Research. 2015; 9(7):469-475.

vinayaka mission's research foundation · declaration by the candidate i, nathiya. s. declare...

Documents