Up-regulation of autophagy-related gene 5 (ATG5) protectsdopaminergic neurons in a zebrafish model of Parkinson’sdiseaseReceived for publication, October 26, 2016, and in revised form, August 27, 2017 Published, Papers in Press, September 19, 2017, DOI 10.1074/jbc.M116.764795

Zhan-ying Hu, Bo Chen, Jing-pu Zhang1, and Yuan-yuan MaFrom the Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College,Beijing 100050, China

Edited by Paul E. Fraser

Parkinson’s disease (PD) is one of the most epidemic neu-rodegenerative diseases and is characterized by movementdisorders arising from loss of midbrain dopaminergic (DA)neurons. Recently, the relationship between PD and auto-phagy has received considerable attention, but informationabout the mechanisms involved is lacking. Here, we reportthat autophagy-related gene 5 (ATG5) is potentially impor-tant in protecting dopaminergic neurons in a 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced PD mod-el in zebrafish. Using analyses of zebrafish swimming behavior,in situ hybridization, immunofluorescence, and expressions ofgenes and proteins related to PD and autophagy, we found thatthe ATG5 expression level was decreased and autophagy fluxwas blocked in this model. The ATG5 down-regulation led to theupgrade of PD-associated proteins, such as �-synuclein, Parkin,and PINK1, aggravation of MPTP-induced PD-mimicking path-ological locomotor behavior, DA neuron loss labeled by tyrosinehydroxylase (TH) or dopamine transporter (DAT), and blockedautophagy flux in the zebrafish model. ATG5 overexpressionalleviated or reversed these PD pathological features, rescuedDA neuron cells as indicated by elevated TH/DAT levels, andrestored autophagy flux. The role of ATG5 in protecting DAneurons was confirmed by expression of the human atg5 genein the zebrafish model. Our findings reveal that ATG5 has arole in neuroprotection, and up-regulation of ATG5 mayserve as a goal in the development of drugs for PD preventionand management.

Parkinson’s disease (PD)2 is one of the most prevalent motor-related neurodegenerative diseases, which is diagnosed clini-

cally by static tremor, progressive rigidity, bradykinesia, andpostural abnormality, and is characterized by dopaminergicneuron loss and Lewy body (LB) accumulation in the substantianigra neurons of PD patients. Lewy bodies (LBs) are inclusionbodies of some protein aggregates within neurons in PD,dementia with LB, Alzheimer’s disease, and also in othersynucleinopathies (1).Typical LBs arise in the brainstem ascytoplasmic, round to elongated inclusions of 8 –30 �m indiameter, with a dense eosinophilic core and a narrow pale-stained rim (2). In 1997, Spillantini et al. (3) reported that �-sy-nuclein (�-syn) is the main component of LBs. Physiologically,�-syn is a presynaptic neuronal protein, and as a down-regula-tor of tyrosine hydroxylase (TH) activity, it can modulate pro-duction of dopamine (DA) and control DA cellular levels (4).DA is an important transmitter between the substantia nigraand corpus striatum for human movement. Reduction of DAlevels is the direct cause for motor dysfunction of PD patients,and TH is a key enzyme for DA biosynthesis. Thus, the TH levelgenerally is regarded as a positive biomarker for dopaminergicneuron survival.

�-syn protein is a critical protein for neuron survival, butdysregulation of �-syn via aggregation, mutation, or misfoldingof overexpressed protein can lead to neurodegeneration andDA neuron death in PD (4 – 6). Recently, numerous groupsreported the pathological mechanism of �-syn. The main path-ological action of �-syn resulted from its oligomeric state orfibrillization, and this format can cause LB formation, mito-chondrial dysfunction, endoplasmic reticulum stress, oxidativestress, proteasome impairment, disruption of plasma mem-brane and pore formation, and finally DA neuron death (7, 8).Another important pathological action of �-syn fibrils is itstransmission among neurons via endocytosis, plasma mem-brane penetration, or exosome pathways, thus propagating theLB pathology to other brain regions thereby contributing to theprogressiveness of PD (3, 9 –11). So, a putative conclusion isconverged that PD therapy may be facilitated by inhibition of�-syn aberrant species formation or acceleration of �-synaggregation elimination.

Additionally, PTEN-induced putative kinase 1 (PINK1) wasdetected within a subset (5–10%) of LBs and Parkin co-localizedwith �-syn in LBs, which suggests that PINK1 and Parkin arealso components of LBs (12–14). Mutations in Parkin andPINK1 were found in PD, which led to their deficient interac-tion and preventing the clearance of damaged mitochondria via

This work was supported by National Natural Science Foundation of ChinaGrant 81173043, Foundation for Innovative Research Groups of theNational Natural Science Foundation of China Grant 81321004, and Chi-nese Academy of Medical Sciences Initiative for Innovative Medicine Grant2016-I2M-2-006). The authors declare that they have no conflicts of inter-est with the contents of this article.

This article contains supplemental Figs. S1–S4.1 To whom correspondence should be addressed. E-mail: zhangjingpu@

imb.pumc.edu.cn or zjp5577@126.com.2 The abbreviations used are: PD, Parkinson’s disease; dpf, day post-

fertilization; LB, Lewy body; MO, morpholino oligonucleotide; MPTP,1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine; TH, tyrosine hydroxy-lase; WIFA, whole-mount immunofluorescent assay; WISH, whole-mount in situ hybridization; �-syn, �-synuclein; DA, dopaminergic;NAC, N-acetylcysteine; ANOVA, analysis of variance; hmRNA, humanRNA; IOD, integral optical density; BAF, bafilomycin A1.

croARTICLE

18062 J. Biol. Chem. (2017) 292(44) 18062–18074

© 2017 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

autophagy (15–17). Normally, Parkin, as an E3 ubiquitin ligase,and PINK1, as a mitochondrially targeted kinase, functiontogether in a common pathway to remove dysfunctional mito-chondria by autophagy (18, 19). Thus, defects of Parkin orPINK1 can cause not only accumulation of dysfunctional mito-chondria and release of reactive oxygen species, but also LBaccumulation, including �-syn species (11).

Recently, several studies and reviews have shown that abnor-mal autophagy contributes to neurodegenerative diseases thatmanifest abnormal protein accumulation. The autophagy path-way plays an important role in the pathological process of neu-rodegenerative disease and therapeutic modulation (20 –23).Conversely, PD-related proteins, such as �-syn, PINK1, andParkin, also participate in regulating autophagy (24 –26).Klucken and co-workers (27) demonstrated that the impairedautophagy–lysosomal pathway by bafilomycin A1 (BAF) (aninhibitor of autophagolysosomes) in the diseased brain not onlylimited intracellular degradation of misfolded proteins, but alsoled to a detrimental microenvironmental response, includinguptake, inflammation, and cellular damage due to enhanced�-syn protein secretion. Stefanis and co-workers (28) reportedthat lysosomal dysfunction contributed to �-syn accumulationand the related toxicity. The results indicate the correlation ofautophagy with synucleinopathies.

Furthermore, protective roles of autophagy-related gene 5(atg5) on neurons in synucleinopathies were reported. atg5deficiency in mice led to progressive deficits in motor functionwith accumulation of cytoplasmic inclusion bodies in neuronsin mice (20). ATG5-dependent autophagy acted as a protectivemechanism during apoptotic cell death induced by MPP� tox-icity in a cell model (29). In patients with PD, ATG5 proteinlevels were altered, which suggests that ATG5 deficit is a riskfactor that may serve as a PD-related marker gene (30). There-fore, ATG5 may play a key role in autophagy-regulated neuro-degenerative disease. In the basic autophagy process, ATG5conjugates to ATG12 and forms a ubiquitin-conjugating com-plex, which plays a crucial role in autophagic vacuole formation(31, 32). In addition, ATG5 functions in regulation of embry-onic nervous system development and differentiation inzebrafish (33, 34). Our earlier study showed that ATG5 wasexpressed mainly in the zebrafish embryonic brain region andaffected transcription of pink1 and �-syn (33). However, themolecular mechanism of ATG5’s protective action on DA sur-vival remains unclear.

Compound MPTP is a mitochondrial toxin and primarilycauses damage to the nigrostriatal DA pathway with a profoundloss of DA neurons in the striatum and substantia nigra in miceand primates. MPTP as a standard compound used for estab-lishing PD models in vivo or in vitro has been accepted widely(35, 36). MPTP treatment on zebrafish larvae also has beenshown to cause loss of diencephalic dopaminergic neurons andbehavioral defects in swimming responses (37, 38). Mutationsin Parkin and PINK1 made zebrafish vulnerable to sub-effectivedoses of MPTP (39, 40). In zebrafish, the molecular markers THand DAT are available for identification of dopaminergic neu-rons at 3 days post-fertilization (dpf) (41). At this stage, thexpression patterns are similar to those observed in the adult(42, 43). Therefore, in this study we used MPTP to establish a

PD model in zebrafish, and we examined the effects of regulat-ing ATG5 on PD progression. We found that down-regulationor up-regulation of ATG5 notably impacted levels of the PD-related markers and the autophagy process. An appropriatelevel of ATG5 could restore expression levels of PD-markergenes disrupted by MPTP and reverse the pathological progressof PD.

Results

PD-like symptoms are accompanied by impaired autophagicflux in the MPTP-induced zebrafish larvae model

A PD-like model was established by exposing zebrafish larvaeto MPTP. A locomotion assay showed that swimming behaviorof the larvae was disturbed after exposure to MPTP, in whichzebrafish swimming velocity and distance were significantlysuppressed, and their activity duration was also moderatelyreduced by MPTP treatment (Fig. 1A). The detailed assay of thelocomotion was investigated by stratification in a low active,active, and high active status according to the speed of the lar-vae. The swimming parameters (including swimming distance,duration, and velocity) in the “active state” (speed between 0.2and 4 cm/s) were significantly inhibited, whereas the “lowactive” (speed below 0.2 cm/s) swimming was moderatelyreduced by MPTP, and the “high active” (speed over 4 cm/s)movement was sporadic and is included in the “overall” data(supplemental Fig. S1). This suggests that MPTP mainlyaffected larval “active” swimming behavior. The data indicatedsignificant locomotor defects caused by MPTP. In addition,expression of the dopaminergic neuron marker gene th wasdown-regulated at both transcription and translation levels(Fig. 1B), which suggests that MPTP resulted in a decrease indopaminergic neuron number. The key component of LBs,�-syn protein in human PD, is not found in zebrafish, but inzebrafish �- and �-synucleins do exist, and mainly the �-synexerts a similar role to the human �-syn protein (44, 45). Fur-thermore, the PD-related proteins �-syn, PINK1, and Parkinwere detected and up-regulated by MPTP in a dose-dependentmanner, but their mRNA levels were not changed (Fig. 1, C–E).These results indicate that MPTP-induced PD-like symptomsof motor dysfunction, loss of dopaminergic neurons, andabnormal increase of the PD proteins were similar to those inthe mouse MPTP-PD model (46).

Based on our previous results that ATG5 regulated expres-sion of nervous system developmental genes, including �-synand pink1 (33), we explored autophagy mechanisms in MPTP-induced neuronal toxicity by examining expression of theautophagy-related gene atg5 in MPTP-treated larvae. Theresults showed that ATG5 mRNA and protein levels wereclearly down-regulated by MPTP in a dose-dependent manner(Fig. 2A), which suggests that ATG5 is involved in MPTP-in-duced PD pathology. In addition, levels of autophagic fluxmarkers, selective receptor p62 and LC3B II proteins, were mea-sured and increased in an MPTP dose-dependent manner (Fig.2, B and C). However, transcription of the lc3 gene did notchange in zebrafish larvae (Fig. 2, B and C). Generally, anincrease of LC3B II protein presents in a normal autophagyprocess. To prove an increase of LC3B II protein also occurring

Dopaminergic neuron guardian in zebrafish-PD model

J. Biol. Chem. (2017) 292(44) 18062–18074 18063

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

in MPTP-impaired autophagy, a BAF experiment was per-formed, and the result shows that BAF caused an apparentelevation of the LC3B II protein whether MPTP was added ornot added (supplemental Fig. S2), indicating an impairedautophagy flux with elevation of LC3B II levels in the MPTP-PDmodel. These data showed that MPTP impaired autophagicflux in zebrafish larvae. Furthermore, to check whether theATG5 decrease was related to oxidative stress, we tested anantioxidant N-acetylcysteine (NAC) effect on MPTP-depen-dent atg5 mRNA. The results show that NAC did not recover

the level of MPTP-dependent atg5 mRNA under NAC concen-tration below 200 �mol but rescued atg5 mRNA by NAC at 500�mol (Fig. 2D), which may hint that at least partly oxidativestress restricted ATG5 transcription under MPTP treatment.

Level of ATG5 correlates with autophagy flux and keyPD-related proteins in zebrafish larvae

To examine the effects of ATG5 on PD-related genes andautophagy flux, ATG5 capped mRNA and an ATG5 morpho-lino oligonucleotide (5MO) that binds to the initiation site of

Figure 1. MPTP induced low movement and dysregulation of PD-related protein in zebrafish larvae. A, larvae were exposed to 50 �M MPTP at 5 dpf.Movement data (distance, duration, and velocity) of the larvae were recorded for 20 min in the dark at 6 dpf. A representative swimming trajectory (5 min) ispresented. Scatter diagrams show the behavior changes that were derived from 12 larvae. Statistics comparison (p value) was performed between WT andMPTP groups. B–E, larvae were exposed to 100 and 200 �M MPTP at 2 dpf for 1 day and collected to assess mRNA and protein levels of TH (B), �-syn (C), Parkin(D), and PINK1 (E). D and E, RT-PCR results of pink1, parkin, and �-actin were performed at the same gel; pink1 and parkin shared the �-actin bands, and thesamples were collected from one experiment. *, p values �0.05; **, p values �0.01; ***, p values �0.001 versus untreated groups (one-way ANOVA). The datain B–E were from three independent gels.

Dopaminergic neuron guardian in zebrafish-PD model

18064 J. Biol. Chem. (2017) 292(44) 18062–18074

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

ATG5 mRNA and inhibits translation were injected separatelyinto zebrafish embryos to up-regulate or down-regulate ATG5.LC3B II, p62 protein, and PD-related proteins TH, �-syn,PINK1, and Parkin were detected by Western blotting. Theresults showed that compared with wild-type (WT) and lacZ-injected larvae, overexpression of ATG5 decreased p62 proteinand increased LC3B II protein, which suggests that ATG5mRNA injection elevated the level of autophagy. In contrast,ATG5 knockdown increased p62 protein and decreased thelevel of LC3B II (Fig. 3, A–C), which suggests that autophagicflux was blocked and might have resulted from inhibition ofLC3B I to LC3B II conversion. These data imply that ATG5 is apositive regulator of autophagy flux.

Further experiments showed that when zebrafish larvae wereinjected with ATG5 mRNA, the level of TH protein was similar

to the WT group, and �-syn, Parkin, and PINK1 proteinswere moderately suppressed or had no obvious change com-pared with the WT group and lacZ group. When the atg5gene was knocked down, the TH protein was significantlydown-regulated, whereas �-syn, PINK1, and Parkin proteinswere up-regulated (Fig. 3D). These data indicate that ATG5decrease can promote dopaminergic neuron loss with anincrease of the PD-related proteins. Furthermore, the levelof parkin mRNA was tested using RT-PCR, and the resultshowed that atg5 down-regulation really had an active effecton parkin mRNA levels, but atg5 overexpression did notapparently affect parkin transcription levels (see data shownin supplemental Fig. S3). So, the function of ATG5 probablyis involved in some PD-related gene transcription andautophagosome formation.

Figure 2. atg5 gene was suppressed, and autophagic flux was impaired in zebrafish larvae exposed to MPTP. A–C, larvae were exposed to 100 and 200�M MPTP at 2 dpf for 1 day and collected to measure mRNA and protein levels of ATG5 (A), LC3B (B), and p62 (C). D, antioxidant NAC effect on MPTP-dependentatg5 mRNA tested by RT-PCR. Statistics comparison was carried out between MPTP-treated and untreated groups. *, p values �0.05; **, p values �0.01; ***, pvalues �0.001 versus the untreated groups (one-way ANOVA). The data were from three independent gels.

Dopaminergic neuron guardian in zebrafish-PD model

J. Biol. Chem. (2017) 292(44) 18062–18074 18065

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

ATG5 levels negatively correlate with MPTP toxicity indopaminergic neurons

Loss of dopaminergic neurons in the diencephalon is keyevidence for PD pathology. We measured and compared thenumber of dopaminergic neurons in the diencephalon usingwhole-mount in situ hybridization (WISH) and whole-mountimmunofluorescent assay (WIFA) among five groups as fol-lows: MPTP; MPTP plus ATG5 mRNA; MPTP plus lacZ;MPTP plus 5MO; and MPTP plus MisMO. In the MPTPgroups, the number of dopaminergic neurons, integral opticaldensity (IOD), and distribution of the th gene signal was signif-icantly reduced in the larval diencephalon; the IOD in somedopaminergic neurons in the diencephalon was clearly en-hanced (Fig. 4). In the MPTP plus ATG5-mRNA groups, thenumber of dopaminergic neurons was clearly more than in theMPTP groups; the IOD per neuron still showed dose-depen-dent changes, but the changes were gradual (Fig. 4). In theMPTP plus lacZ control groups, the number of dopaminergicneurons in the diencephalon was similar with the MPTP-treated groups, but the IOD and IOD per neuron were slightlyreduced. In contrast, compared with the MPTP groups, the

MPTP plus ATG5-MO groups showed dose-dependent de-creases in the number of dopaminergic neurons and IOD (Fig.4). In the MPTP plus MisMO control groups, there were noobvious changes compared with the MPTP-treated groups.These results were confirmed using WIFA (Fig. 5) with ananti-TH antibody and using detection of the dat gene by WISH(Fig. 6), which showed the same changes as those in Fig. 4.These results indicated that the sensitivity of the larvae toMPTP-induced neurotoxicity was notably impacted by thelevel of ATG5, in that ATG5 prevented loss of DA neuronsduring MPTP exposure.

Locomotor activity is another important index of the PD syn-drome. Larval locomotion, such as swimming distance, veloc-ity, and duration, was significantly inhibited in the MPTP groupcompared with the WT control group (Fig. 7). The locomotionparameters were not significantly different between the ATG5mRNA-injected and WT groups (Fig. 7A), which suggests thatATG5 overexpression did not alter WT larval behaviors. How-ever, in the MPTP plus ATG5 mRNA group, the active locomo-tion parameters (swimming distance, duration, velocity, andtrajectory) were significantly improved compared with the

Figure 3. Autophagy marker proteins and PD-related proteins were regulated by the autophagy-related gene atg5 in zebrafish larvae. ATG5 mRNA,lacZ, 5MO, or MisMO was injected into embryos at the 1– 4-cell stage, respectively. The larvae were collected at 3 dpf for protein detection by Western blotting.lacZ was as a control of atg5 up-regulation, and MisMO was as a control of atg5 gene down-regulation. A, ATG5 protein level was regulated by atg5 mRNA and5MO injection, respectively. B, in contrast, p62 expression was down-regulated or up-regulated by ATG5 mRNA and 5MO. C, level of LC3 II was positivelyup-regulated by ATG5 mRNA and negatively by 5MO, which suggests that the level of autophagy was increasing and decreasing, accordingly. D, PD-relatedproteins, �-syn, Parkin, and PINK1 were elevated by ATG5 knockdown and descended by ATG5 overexpression; DA marker protein, TH, was reversely changedby ATG5 regulation. Here, as a loading control, �-ACTIN images were reused, because the protein samples were obtained from one experiment, �-syn, PINK1,PARKIN, and TH shared the �-ACTIN bands. The means and S.D. were derived from three independent gels. *, p values �0.05; **, p values �0.01 versus WT group(one-way ANOVA).

Dopaminergic neuron guardian in zebrafish-PD model

18066 J. Biol. Chem. (2017) 292(44) 18062–18074

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

MPTP group and MPTP plus lacZ group (Fig. 7A). Theseresults suggest that MPTP-induced locomotor aberration canbe rescued by up-regulation of ATG5 in zebrafish larvae. Incontrast, in the MPTP plus 5MO group, the swimming dis-tance, duration, and trajectory were more impaired comparedwith the MPTP group and MPTP plus MisMO group (Fig. 7B).The locomotor data suggested that ATG5 deficiency aggra-vated MPTP-induced behavioral defects and dopaminergicneuron loss. Within the no-MPTP groups, in the group of5MO-injected larvae the mean values of locomotion durationwere moderately greater and the speed was slower than those inthe WT group (Fig. 7B). These differential effects were moreclearly expressed in the active state (supplemental Fig. S4).

Human ATG5 antagonize MPTP-induced neuronal toxicity inzebrafish

To validate functional conservation of ATG5 protection onDA neurons between humans and zebrafish, we tested theeffect of human ATG5 on the zebrafish PD model. The validityof hATG5 was assessed by transfecting SH-SY5Y cells withhuman ATG5 5�-capped mRNA (hmRNA). The human ATG5-ATG12 protein complex was up-regulated (Fig. 8A). hmRNAand lacZ were then injected into zebrafish embryos at the 1– 4-cell stage, and the expression pattern of the th gene in the larvalbrain was detected by WISH. The results showed that the num-

ber of DA neurons was increased or recovered in the larvalventral diencephalon as indicated by the th signal in the MPTPplus hATG5 mRNA groups compared with MPTP groups with-out ATG5 mRNA and lacZ plus MPTP groups (Fig. 8, B and C).Thus, the effect of human ATG5 mRNA on dopaminergic neu-rons was very similar to that of zebrafish ATG5 mRNA. Theseresults suggest that both sequence (protein identity of 82%) (33)and function of zebrafish ATG5 are highly homologous tohuman ATG5. Both ATG5 proteins antagonized MPTP-in-duced dopaminergic neuronal toxicity in zebrafish.

Discussion

The key component of LBs, �-syn protein in human PD, isnot found in zebrafish, but �- and �-synucleins exist inzebrafish brain. Previous studies have indicated that roles ofhuman �- and �-syn proteins are discrepant on LBs formation;human �-syn is considered a potent inhibitor of �-syn aggrega-tion by forming �/�-syn hetero-oligomers up to a tetramer thatdo not further propagate (47, 48). However, there are conservedfunctions between human �-syn and zebrafish �-syn in neu-ral dopaminergic homeostasis and PD pathology (42, 43).Zebrafish and human �-syn are 71% identical (42). In this study,levels of �-syn increased following MPTP treatment or ATG5knockdown. Based on previous studies showing MPTP as a typ-ical neurotoxin inducing a PD model in mice (49, 50), and dien-

Figure 4. ATG5 impacted MPTP-induced dopaminergic neuron toxicity signed by in situ hybridization. Embryos were injected with 5MO, MisMO, ATG5,or lacZ, respectively, at the 1– 4-cell stage and exposed to 100 and 200 �M MPTP at 2 dpf for 1 day. Larvae were then collected for analysis. lacZ was as a controlof atg5 mRNA, and MisMO was as a control of atg5 MO injection. A, in situ hybridization detected th gene expression using an antisense th RNA probe. A senseth RNA probe was used as a negative control. Scale bar, 50 �m. B, scatter diagrams show number change of dopaminergic neurons affected by atg5 expressionand MPTP exposure. C, graphs show the IOD and “IOD/dopaminergic neuron,” which indicates an average value of IOD per dopaminergic neuron cell in thelarval ventral diencephalon. *, injected groups and/or MPTP-exposed groups compared with the untreated group (the group without injection and withoutMPTP, WT); #, ATG5 mRNA/lacZ/5MO/MisMO-injected groups compared with uninjected groups at the same concentration of MPTP in (B and C). The meansand S.D. were derived from eight larvae. */#, p values �0.05; **/##, p values �0.01; ***/###, p values �0.001 (one-way ANOVA).

Dopaminergic neuron guardian in zebrafish-PD model

J. Biol. Chem. (2017) 292(44) 18062–18074 18067

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

cephalic DA neuron loss and behavioral defects in zebrafishlarvae (24, 25), we established MPTP-induced PD model inzebrafish and found behavioral symptoms and DA neuron losssimilar to the mouse PD model. Moreover, the PD model pre-sented not only accumulated �-syn, PINK1, and Parkin pro-teins but impaired autophagy processes as well. We concludethat MPTP induces a zebrafish PD model with characteristicssimilar to the mouse PD model.

Currently, many studies indicated that PINK1 and Parkincan join into LBs together with �-syn in PD. Normally, PINK1and Parkin are regarded as neuroprotective proteins. PINK1can recognize and anchor to the outer membrane of impairedmitochondria, then recruit Parkin on the impaired mitochon-dria; they function together in a common pathway to removedysfunctional mitochondria by autophagy (18, 19). However,upon exposure to mitochondrial toxins, Parkin binds �-syn andPINK1 on the surface of damaged mitochondria, and overex-pression of �-syn induces mitochondrial fragmentation anddysfunction along with neurodegeneration (51, 52). Also deg-

radation of the impaired or useless mitochondria with accumu-lated PINK1 and Parkin–�-syn proteins is prevented (53).Their accumulation forms inclusion body or LBs in brain. Thus,the increase of �-syn, PINK1, and Parkin is regarded as a sym-bol of LB accumulation. In addition, PINK1 and Parkin are alsopositive for autophagy activation and act at the initiation stageof autophagosome formation. The ATG5–ATG12–ATG16conjugate acts at the elongation stage of autophagosome for-mation, downstream of PINK1/Parkin’s action (53). However,we find that ATG5 down-regulation increased levels of parkin,pink1, and �-syn mRNA (see supplemental Fig. S3 and Ref. 33)and proteins, indicating that the up-regulation of the three pro-teins in this study may have resulted from both promotion ofthe three gene transcription and a blocked autophagy fluxcaused by atg5 deficiency. In this situation, elevation of �-syn,PINK1, and PARKIN combined with TH decrease indicatesaccumulation of PD-related proteins and DA neuron death,which is aggravated by ATG5 deficiency in MPTP-induced PDmodel.

Figure 5. ATG5 protection on DA neurons was confirmed by whole-mount immunofluorescent histochemistry. A, whole-mount immunofluo-rescent histochemistry was performed to assess the distribution and numberof DA neurons using the anti-TH antibody in the zebrafish larva diencepha-lons at 3 dpf. Scale bar, 50 �m. B, scatter diagrams show number change ofdopaminergic neurons influenced by atg5 up- or down-regulation in theMPTP model. The results were similar to the distribution of th mRNA in thelarval brain. lacZ was as a control of atg5 mRNA, and MisMO was as a control ofatg5 MO injection. *, injected groups and/or MPTP-exposed groups com-pared with the untreated group (the group without injection and withoutMPTP, WT); #, ATG5 mRNA/lacZ/5MO/MisMO-injected groups compared withuninjected groups at the same concentration of MPTP in A and B. The meansand S.D. were derived from eight larvae. */#, p values �0.05; **/##, p values�0.01; ***/###, p values �0.001 (one-way ANOVA).

Figure 6. ATG5 regulated dopaminergic neuron survival signed by datsignal in situ in MPTP-induced PD model. A, in situ hybridization detecteddat mRNA expression in the larval brain at 3 dpf. The result was similar to thatfor th in Fig. 4A. Scale bar, 50 �m. B, graphs show the relative IOD in the larvalventral diencephalon. lacZ was a control of atg5 mRNA, and MisMO was acontrol of atg5 MO injection. *, injected groups and/or MPTP-exposed groupscompared with the untreated group (the group without injection and with-out MPTP, WT); #, ATG5 mRNA/lacZ/5MO/MisMO-injected groups comparedwith uninjected groups at the same concentration of MPTP. The means andS.D. were derived from eight larvae. */#, p values �0.05; **/##, p values �0.01;***/###, p values �0.001 (one-way ANOVA).

Dopaminergic neuron guardian in zebrafish-PD model

18068 J. Biol. Chem. (2017) 292(44) 18062–18074

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

More and more data suggest a central role of autophagy inthe molecular mechanisms of PD pathogenesis (54). Dysfunc-tion of some autophagy-related proteins, including ULK1,ULK2, beclin1, VPS34, and AMBRA1, which are involved inautophagy initiation and autophagosome formation, are asso-ciated with the disease process of PD (55). Mice with an atg5defect developed pathological features of PD such as defects inmovement and accumulation of cytoplasmic LBs in neurons(20). In this study, we found that atg5 morphants were vulner-able to sub-effective doses of MPTP, and MPTP-treated larvaepresented aberrant swimming behavior (movement distance,velocity, and swimming duration) and loss of DA neurons. Inaddition, under MPTP treatment, the ATG5 protein level wassignificantly decreased, which suggested that an atg5 deficiencymight be important in PD pathological processes. These datademonstrated that ATG5 dysfunction enhanced the proteinaccumulation of PD related proteins �-syn, Parkin, and PINK1.In contrast, ATG5 up-regulation preserved DA neuron numberand locomotor behavior and maintained the proteins at near-physiological levels, indicating that ATG5 can exert protectionagainst MPTP-induced PD. Despite a few reports on anti-PDeffects of ATG5, several studies have implicated �-syn, Parkin,and PINK1 in autophagy and have shown that atg5 knockdownsignificantly increased �-syn levels in vitro (56 –59). Our previ-ous study demonstrated that in zebrafish, ATG5 down-regula-tion enhanced transcription of PINK1 and �-syn; conversely,ATG5 up-regulation moderately suppressed the two gene tran-scriptions (33). ATG5 probably is a protein with multiple func-tions; except for its pro-autophagy role, ATG5 can down-regu-late expression of neural development- and function-related

genes for homeostasis of the neural development. In the PDcondition, elevation of parkin and pink1 mRNA levels cannotonly promote the autophagy process but can aggravate accu-mulation of excess PARKIN and PINK1 proteins due to animpaired autophagy pathway by ATG5 deficiency.

ATG5 is a highly conserved key factor for regulating forma-tion of autophagic vacuoles and autophagy level (33, 60). ATG5functions in elongation of the isolation membrane, LC3B lipi-dation, and its correct localization (61). In this study, ATG5knockdown inhibited conversion of LC3B I into LC3B II, andATG5 overexpression increased the level of LC3B II anddecreased the p62 level (Fig. 3A). This may be one of reasonsthat ATG5 deficiency enhanced sensitivity of larvae to MPTP-induced neurotoxicity by suppression of LC3B II formation. Aswe know, LC3B II is derived from LC3B I that becomes conju-gated to phosphatidylethanolamine, which is mediated orderlyby Atg7, Atg3, and the ATG12-ATG5-Atg16L complex (62–64). Therefore, we hypothesize that ATG5 dysfunction plays akey role as an accelerating factor in the pathological processesof PD by causing deficient autophagosomes and increasingexpression of PD-related genes in the zebrafish PD model.

In summary, MPTP causes PD symptoms, which may bepartially mediated by ATG5 deficiency. Adequate ATG5 lev-els can inhibit accumulation of PD-related proteins in DAneurons by modulation of gene transcription and promoteautophagosome formation, which facilitates DA neuron sur-vival and resists PD damage. We conclude that ATG5 mod-ulation may be a potential therapeutic target for screeningnew drugs against parkinsonism.

Figure 7. Larval locomotor behavior was modulated by ATG5 level in MPTP-induced PD model. Embryos were injected with 5MO, MisMO, ATG5 mRNA,or lacZ at the 1– 4-cell stage and exposed to 50 �M MPTP at 5 dpf. At 6 dpf, for both low active and active states, larval swimming distance, movement duration,and swimming velocity in the different groups were recorded for 20 min and compared with WT control. Spontaneous movement trajectory during 5 minis also presented. lacZ was as a control of atg5 mRNA, and MisMO was as a control of atg5 MO injection. A, larval movement defects were rescued in theATG5 mRNA-injected larvae exposed to MPTP compared with MPTP-treated groups without mRNA injection and WT groups. B, larval swimmingbehavioral disorders were exacerbated in the 5MO-injected larvae exposed to MPTP compared with MPTP-treated groups without 5MO injection andWT groups. Scatter diagrams were used to show the changes; the data were derived from 24 larvae for A and 12 larvae for B. A multiple variable ANOVAtest was used in comparison with WT, atg5 mRNA, MPTP, MPTP plus atg5 mRNA, lacZ, MPTP plus lacZ, and among WT, 5MO, MisMO, MPTP plus 5MO, andMPTP plus MisMO groups.

Dopaminergic neuron guardian in zebrafish-PD model

J. Biol. Chem. (2017) 292(44) 18062–18074 18069

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

Experimental procedures

Fish husbandry and embryo and larvae preparation

Zebrafish (Danio rerio) wild-type AB strain was originallyobtained from the College of Life Sciences and Technology,Tsinghua University. Fish feeding, breeding, maintenance, andstaging were performed as described previously (65). Briefly,embryos and larvae were incubated in 280 mg/liter TropicalMarine Artificial Seawater crystal (CNSIC Marine Biotechnol-ogy Co., Ltd., China) at 28.5 °C. The embryos were obtained bynatural mating, and synchronous embryos at the appropriatestage were collected. They were fixed with 4% paraformalde-hyde in phosphate-buffered saline for in situ hybridization andwhole-mount immunohistochemistry or immersed in TRIzolreagent for mRNA isolation.

Synthesis and microinjection of morpholino oligonucleotides(MOs) and capped mRNAs

5MO and MisMO were designed by and purchased fromGene Tools LLC; their sequences were described previously(33). 5MO was used to inhibit ATG5 expression by binding toATG5 initiation codon sites, and MisMO was used as a control.The injection of 0.5 nl of 50 �M 5MO or MisMO was conducted

at the 1– 4-cell embryo stage. Clone of a full-length cDNAencoding ATG5, capped mRNA synthesis, and injection wereperformed as described in a previous study (33). Human ATG5cDNA was cloned from the SH-SY5Y cell line based on its pub-lished sequence (GenBankTM JQ924061.1). lacZ cDNA frag-ment according to pEASY-T1 Simple (TransGen Biotech,CB111-01) was subcloned into pBluescript II SK� plasmid bySangon Biotech (Shanghai) Co., Ltd. Capped mRNA of humanatg5 and lacZ was prepared as described above.

Chemical treatment

MPTP was purchased from Sigma (M0896). Stock solutionsof MPTP (100 mM) were made using double distilled H2O andwere stored at �20 °C. MPTP was added to the embryo mediaat final concentrations of 50, 100, 200, and 500 �M at 2 and 5dpf. One day later, after washing three times with normal rear-ing solution, larvae were used for neurobehavioral detection,fixed in 4% paraformaldehyde for in situ hybridization andwhole-mount immunohistochemistry assay, or collected forextraction of total protein or RNA.

NAC (Sigma, A7250) was dissolved in fish water to create a100 mM stock solution and then diluted to a concentration of

Figure 8. Human ATG5 partially prevented DA neuron loss induced by MPTP in zebrafish. A, human ATG5 protein level was validated by Western blottingthat showed an ATG5-ATG12 protein conjugate of 56 kDa was up-regulated in SH-SY5Y cell line. B, zebrafish embryos were injected with human ATG55�capped-mRNA (hmRNA) and lacZ at the 1– 4-cell stage, exposed to 200 or 500 �M MPTP during 2–3 dpf, and then collected and fixed. Whole-mount in situhybridization using the antisense th RNA probe shows that human ATG5 overexpression partly prevented dopaminergic neuron loss. C, scatter diagrams shownumber change of dopaminergic neurons, and the graphs show IOD and IOD/dopaminergic neuron, indicating the protective efficiency of human ATG5 on DAneurons in the larval brain. *, hmRNA/lacZ-injected groups compared with untreated group (no MPTP); #, hmRNA/lacZ-injected groups compared withuninjected groups at the same concentration of MPTP. The means and S.D. were derived from 7 to 10 larvae. */#, p values �0.05; **/##, p values �0.01; ***/###,p values �0.001 (one-way ANOVA). Scale bar, 50 �m.

Dopaminergic neuron guardian in zebrafish-PD model

18070 J. Biol. Chem. (2017) 292(44) 18062–18074

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

100, 200, 500 and 1000 �M in fish water (66). Larvae at 2 dpfwere exposed to the MPTP mixed with NAC solution for 1 dayand then collected for RT-PCR detection of atg5 mRNA.

Bafilomycin A1 (Sigma, B1793) was dissolved in DMSO tocreate a 25 mM stock solution and then diluted to a concentra-tion of 20 nM in fish water (67). Larvae at 3 dpf were exposed tothe BAF solution for 6 h and then collected for detection; 0.1%DMSO was used as a solvent control.

SH-SY5Y cell transfection and detection

SH-SY5Y cells were obtained from Dr. Shuying Wang(Xuanwu Hospital, Capital Medical University). SH-SY5Y cellswere grown in RPMI 1640 medium supplemented with 15%heat-inactivated fetal bovine serum (Hyclone) and cultured at37 °C under humidified 5% CO2 atmosphere. SH-SY5Y cellswere transfected with capped ATG5 mRNA using Lipo-fectamine 2000 (Invitrogen) according to the manufacturer’sprotocol. After 2 days in culture, cells were collected for RT-PCR and Western blotting.

WISH

For the preparation of sense and antisense RNA probes, thand dat cDNA fragment sequences were cloned using PCR (theparameters are presented in Table 1) into the pGEM-T plasmid.Antisense and sense RNA probes were synthesized using theDIG RNA labeling kit (Roche Applied Science, 1175041)according to the manufacturer’s instructions. Embryos werefixed with 4% paraformaldehyde overnight at 4 °C. Larvae at 3dpf or longer were pretreated by DNase of 3 units/200 �l at37 °C for 24 h prior to starting the hybridization to removegenomic DNA pseudo-positive interference. In situ hybrid-ization was performed as described by Whitlock and West-erfield (68).

WIFA

Larvae were collected at 3 dpf and pretreated with proteinaseK (Tiangen, RT403). The procedure has been described previ-

ously (69). Briefly, larvae were incubated in the primary anti-body, rabbit anti-mouse TH monoclonal antibody (Minipore,MAB318), at a dilution of 1:500 overnight at 4 °C. They werethen incubated with a FITC-conjugated anti-rabbit secondaryantibody at a dilution of 1:2000 overnight at 4 °C. Images weretaken using an inverted phase-contrast fluorescence micro-scope (Olympus, IX 51).

RT-PCR

Embryos, larvae, or cells at selected stages were collected intoTRIzol reagent (Sigma). Total RNA was extracted following theTRIzol reagent RNA extraction kit manual. First-strand cDNAswere synthesized by reverse transcription using the Moloneymurine leukemia virus RTase cDNA synthesis kit (Promega).PCR amplification cycles and primer pairs are listed in Table 1.�-Actin was amplified as a template loading control. PCRparameters were 94 °C for 5 min (94 °C for 30 s, 54 –55 °C for30 s, and 72 °C for 1 min) for 22–35 cycles and 72 °C for 10 min.

Western blotting

The immunoblotting procedure has been previously de-scribed in the literature (70). Briefly, total protein of zebrafishembryos or SH-SY5Y cells was extracted with the RIPA lysis kit(Applygen Technologies Inc., C1053) and separated using 10%SDS-PAGE. The following procedure is the same as used in ourprevious study (33). The membranes were incubated with pri-mary antibody at a dilution of 1:1000 overnight at 4 °C. Theprimary antibodies were as follows: anti-human ATG5 (Abcam,ab54033); mouse anti-human ACTB antibody (ZhongshanGoldbridge, TA09); mouse anti-GAPDH mAb (ZhongshanGoldbridge, TA08); rabbit anti-mouse TH monoclonal anti-body (Minipore, MAB318); p62 rabbit polyclonal antibody(MBL, PM045); LC3 mouse monoclonal antibody (MBL,M186-3); PINK1 (D8G3) rabbit mAb antibody (CST, catalogno. 6946); Parkin mAb antibody (CST, catalog no. 4211); and�/�-syn (Syn205) mouse mAb antibody (CST, catalog no.

Table 1Primer pairs and parameters of PCR in the studyF is forward; R is reverse.

Gene name Primer sequence Annealing temperature Cycles

th F, TACAGCCCAGATAACATCCCTC 54 35R, TTAGTTTCTCAGTAGCGTCCACAA

dat F, GCTATGGGAGGGATGGAGTCTGT 54 35R, AGGAACCGTACTTGGGAGGATTG

lc3b F, AAAGGAGGACATTTGAGCAG 55 28R, AATGTCTCCTGGGAAGCGTA

parkin F, GCTGCGGGTCATCTTTGCT 52 30R, CTCCGTGAATCCGGTTTGG

p62 F, CCTGGGTTTCCGTTCACT 55 30R, TACTTTGGTCCGCTTTCC

atg5 F, ATGATAATGGCAGATGACAAGG 55 28R, TCAGTCACTCGGTGCAGG

�-actin F, AGGGAAATCGTGCGTGACATCA 55 22R, ACTCATCGTACTCCTGCTTGCTGA

pink1 F, GGGAGTGGATCATCTGTGC 52 30R, TCTGCCATCTGGACCTTGT

�-syn F, ATGGATGTTTTTATGAAGGGGC 55 30R, TTACGCCTCGGGCTCATAATCCTGG

hatg5 F, ATGACAGATGACAAAGATG 55 30R, TCAATCTGTTGGCTGTGGG

Dopaminergic neuron guardian in zebrafish-PD model

J. Biol. Chem. (2017) 292(44) 18062–18074 18071

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

2644). The membranes were then treated with horseradish per-oxidase-conjugated secondary antibodies and visualized byenhanced chemiluminescence using the SuperSignal� WestPico chemiluminescent substrate (Thermo Fisher Scientific,34080) with the AlphaEase� FC Imaging System.

Behavioral experiment

Spontaneous movement of larvae was analyzed by ZebraLab(Viewpoint, ZebraLab 3.3) instrument. The larvae were placedseparately in the wells of a 96-well plate (1 fish/well). Locomo-tor distance, swimming duration, velocity, and swimming trackwere recorded in darkness. Velocity lower than 0.2 cm/s wasdefined as low active movement, velocity higher than 4 cm/swas defined as high active movement, and velocity between 0.2and 4 cm/s was defined as active movement. The velocitythreshold values were set based on our preliminary experiment,by which zebrafish swim behavior can be better sorted intonormal status or MPTP-induced inactive status. Larval behav-iors were recorded for 20 min, and data were collected once per5 min. In this study, high active movement was rare, so wemainly analyzed low active and active movement; but the dataof high active movement was included in the overall data.

Data analysis

In behavioral assays of larvae, data were shown by scatterplots. Statistical analyses were performed using t test in com-parison with the WT group and the MPTP group (Fig. 1A),using multiple variable ANOVA test in comparison with WT,mRNA, MPTP, lacZ, MPTP plus mRNA, lacZ plus MPTP, andwith WT, MO, MisMO, MPTP plus MO, and MPTP plusMisMO groups in Fig. 7.

Data from Western blottings and RT-PCR were relative val-ues versus wild types or versus the untreated groups, in whichthe mean values of wild types or the untreated groups aredefined as 1. The means and standard deviations were derivedfrom independent triplicates and are presented as mean � S.D.in histograms.

Scatter diagram was used to show and compare the changesof dopaminergic neuron number among the groups treated dif-ferently; line charts showed average values of IOD per groupand average IOD per dopaminergic neuron in the larval ventraldiencephalon, respectively. Standard deviations were shown inall graphs (n �7).

Statistical analyses for RT-PCR, Western blotting, WISH,and WIFA were performed using one-way ANOVA tests, and pvalues �0.05 were considered as significant. */#, p values �0.05;**/##, p values �0.01; and ***/###, p values �0.001.

Author contributions—J. P. Z. conceived and designed the project.Z. Y. H. and B. C. performed the experiments and data analysis.Y. Y. M. finished the RT-PCR experiments in Fig. 2D. Z. Y. H. andJ. P. Z. wrote the manuscript.

Acknowledgments—We thank Professor Anming Meng (TsinghuaUniversity) for providing zebrafish AB stain seedlings, and we thankJie Meng for fish husbandry.

References1. Ma, M. R., Hu, Z. W., Zhao, Y. F., Chen, Y. X., and Li, Y. M. (2016)

Phosphorylation induces distinct �-synuclein strain formation. Sci. Rep. 6,37130

2. Giráldez-Pérez, R., Antolín-Vallespín, M., Muñoz, M., and Sánchez-Capelo, A. (2014) Models of �-synuclein aggregation in Parkinson’s dis-ease. Acta Neuropathol. Commun. 2, 176

3. Spillantini, M. G., Schmidt, M. L., Lee, V. M., Trojanowski, J. Q., Jakes, R.,and Goedert, M. (1997) �-Synuclein in Lewy bodies. Nature 388,839 – 840

4. Emamzadeh, F. N. (2016) �-Synuclein structure, functions, and interac-tions. J. Res. Med. Sci. 21, 29

5. Kanaan, N. M., and Manfredsson, F. P. (2012) Loss of functional �-sy-nuclein: a toxic event in Parkinson’s disease? J. Parkinsons Dis. 2, 249 –267

6. Peng, X., Peng, X. M., Tehranian, R., Dietrich, P., Stefanis, L., and Perez,R. G. (2005) �-Synuclein activation of protein phosphatase 2A reducestyrosine hydroxylase phosphorylation in dopaminergic cells. J. Cell Sci.118, 3523–3530

7. Longhena, F., Faustini, G., Missale, C., Pizzi, M., Spano, P., and Bellucci, A.(2017) The contribution of �-synuclein spreading to Parkinson’s diseasesynaptopathy. Neural Plast. 2017, 5012129

8. Jellinger, K. A. (2010) Basic mechanisms of neurodegeneration: a criticalupdate. J. Cell. Mol. Med. 14, 457– 487

9. Gallegos, S., Pacheco, C., Peters, C., Opazo, C. M., and Aguayo, L. G.(2015) Features of �-synuclein that could explain the progression andirreversibility of Parkinson’s disease. Front. Neurosci. 9, 59

10. Wong, Y. C., and Krainc, D. (2017) �-synuclein toxicity in neurodegen-eration: mechanism and therapeutic strategies. Nat. Med. 23, 1–13

11. Lopes da Fonseca, T., Villar-Piqué, A., and Outeiro, T. F. (2015) The in-terplay between �-synuclein clearance and spreading. Biomolecules 5,435– 471

12. Gandhi, S., Muqit, M. M., Stanyer, L., Healy, D. G., Abou-Sleiman, P. M.,Hargreaves, I., Heales, S., Ganguly, M., Parsons, L., Lees, A. J., Latchman,D. S., Holton, J. L., Wood, N. W., and Revesz, T. (2006) PINK1 protein innormal human brain and Parkinson’s disease. Brain 129, 1720 –1731

13. Um, J. W., Stichel-Gunkel, C., Lübbert, H., Lee, G., and Chung, K. C.(2009) Molecular interaction between parkin and PINK1 in mammalianneuronal cells. Mol. Cell. Neurosci. 40, 421– 432

14. Murakami, T., Moriwaki, Y., Kawarabayashi, T., Nagai, M., Ohta, Y., De-guchi, K., Kurata, T., Morimoto, N., Takehisa, Y., Matsubara, E., Ikeda, M.,Harigaya, Y., Shoji, M., Takahashi, R., and Abe, K. (2007) PINK1, a geneproduct of PARK6, accumulates in �-synucleinopathy brains. J. Neurol.Neurosurg. Psychiatry 78, 653– 654

15. Corti, O., Lesage, S., and Brice, A. (2011) What genetics tells us about thecauses and mechanisms of Parkinson’s disease. Physiol. Rev. 91,1161–1218

16. Geisler, S., Holmström, K. M., Treis, A., Skujat, D., Weber, S. S., Fiesel,F. C., Kahle, P. J., and Springer, W. (2010) The PINK1/Parkin-mediatedmitophagy is compromised by PD-associated mutations. Autophagy 6,871– 878

17. Nguyen, T. N., Padman, B. S., and Lazarou, M. (2016) Deciphering thesignals of molecular PINK1/Parkin mitophagy. Trends Cell Biol. 26,733–744

18. Durcan, T. M., and Fon, E. A. (2015) The three ’P’s of mitophagy: PARKIN,PINK1, and post-translational modifications. Genes Dev. 29, 989 –999

19. Barodia, S. K., Creed, R. B., and Goldberg, M. S. (2017) Parkin and PINK1functions in oxidative stress and neurodegeneration. Brain Res. Bull. 133,51–59

20. Hara, T., Nakamura, K., Matsui, M., Yamamoto, A., Nakahara, Y., Suzuki-Migishima, R., Yokoyama, M., Mishima, K., Saito, I., Okano, H., and Miz-ushima, N. (2006) Suppression of basal autophagy in neural cells causesneurodegenerative disease in mice. Nature 441, 885– 889

21. García-Arencibia, M., Hochfeld, W. E., Toh, P. P., and Rubinsztein, D. C.(2010) Autophagy, a guardian against neurodegeneration. Semin. Cell Dev.Biol. 21, 691– 698

Dopaminergic neuron guardian in zebrafish-PD model

18072 J. Biol. Chem. (2017) 292(44) 18062–18074

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

22. Nah, J., Yuan, J., and Jung, Y. K. (2015) Autophagy in neurodegenera-tive diseases: from mechanism to therapeutic approach. Mol. Cells 38,381–389

23. Martinez-Vicente, M. (2015) Autophagy in neurodegenerative diseases:from pathogenic dysfunction to therapeutic modulation. Semin. Cell Dev.Biol. 40, 115–126

24. Lynch-Day, M. A., Mao, K., Wang, K., Zhao, M., and Klionsky, D. J. (2012)The role of autophagy in Parkinson’s disease. Cold Spring Harb. Perspect.Med. 2, a009357

25. Pickrell, A. M., and Youle, R. J. (2015) The roles of PINK1, Parkin andmitochondrial fidelity in Parkinson’s disease. Neuron 85, 257–273

26. Nardin, A., Schrepfer, E., and Ziviani, E. (2016) Counteracting PINK/Parkin deficiency in the activation of mitophagy: a potential therapeu-tic intervention for Parkinson’s disease. Curr. Neuropharmacol. 14,250 –259

27. Poehler, A. M., Xiang, W., Spitzer, P., May, V. E., Meixner, H., Rocken-stein, E., Chutna, O., Outeiro, T. F., Winkler, J., Masliah, E., and Klucken,J. (2014) Autophagy modulates SNCA/�-synuclein release, thereby gen-erating a hostile microenvironment. Autophagy 10, 2171–2192

28. Xilouri, M., Brekk, O. R., and Stefanis, L. (2016) Autophagy and �-sy-nuclein: relevance to Parkinson’s disease and related synucleopathies.Mov. Disord. 31, 178 –192

29. Garcia-Garcia, A., Anandhan, A., Burns, M., Chen, H., Zhou, Y., andFranco, R. (2013) Impairment of Atg5-dependent autophagic flux pro-motes paraquat- and MPP�-induced apoptosis but not rotenone or 6-hy-droxydopamine toxicity. Toxicol. Sci. 136, 166 –182

30. Chen, D., Zhu, C., Wang, X., Feng, X., Pang, S., Huang, W., Hawley,R. G., and Yan, B. (2013) A novel and functional variant within theATG5 gene promoter in sporadic Parkinson’s disease. Neurosci. Lett.538, 49 –53

31. Gordy, C., and He, Y. W. (2012) The crosstalk between autophagy andapoptosis: where does this lead? Protein Cell 3, 17–27

32. Mizushima, N. (2002) Molecular mechanism of autophagy: the role of theApg12 conjugation system. Seikagaku 74, 523–537

33. Hu, Z., Zhang, J., and Zhang, Q. (2011) Expression pattern and functionsof autophagy-related gene atg5 in zebrafish organogenesis. Autophagy 7,1514 –1527

34. Lv, X., Jiang, H., Li, B., Liang, Q., Wang, S., Zhao, Q., and Jiao, J. (2014) Thecrucial role of Atg5 in cortical neurogenesis during early brain develop-ment. Sci. Rep. 4, 6010

35. Dauer, W., and Przedborski, S. (2003) Parkinson’s disease: mechanismsand models. Neuron 39, 889 –909

36. Yokoyama, H., Kuroiwa, H., Kasahara, J., and Araki, T. (2011) Neurophar-macological approach against MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahy-dropyridine)-induced mouse model of Parkinson’s disease. Acta Neuro-biol. Exp. 71, 269 –280

37. Sallinen, V., Torkko, V., Sundvik, M., Reenilä, I., Khrustalyov, D., Kaslin, J.,and Panula, P. (2009) MPTP and MPP� target specific aminergic cellpopulations in zebrafish larvae. J. Neurochem. 108, 719 –731

38. Wen, L., Wei, W., Gu, W., Huang, P., Ren, X., Zhang, Z., Zhu, Z., Lin, S.,and Zhang, B. (2008) Visualization of monoaminergic neurons andneurotoxicity of MPTP in live transgenic zebrafish. Dev. Biol. 314,84 –92

39. Haque, M. E., Mount, M. P., Safarpour, F., Abdel-Messih, E., Callaghan, S.,Mazerolle, C., Kitada, T., Slack, R. S., Wallace, V., Shen, J., Anisman, H.,and Park, D. S. (2012) Inactivation of Pink1 gene in vivo sensitizes dop-amine-producing neurons to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyri-dine (MPTP) and can be rescued by autosomal recessive Parkinson diseasegenes, Parkin or DJ-1. J. Biol. Chem. 287, 23162–23170

40. Anichtchik, O., Diekmann, H., Fleming, A., Roach, A., Goldsmith, P., andRubinsztein, D. C. (2008) Loss of PINK1 function affects development andresults in neurodegeneration in zebrafish. J. Neurosci. 28, 8199 – 8207

41. Xi, Y., Noble, S., and Ekker, M. (2011) Modeling neurodegeneration inzebrafish. Curr. Neurol. Neurosci. Rep. 11, 274 –282

42. Lam, C. S., Korzh, V., and Strahle, U. (2005) Zebrafish embryos are sus-ceptible to the dopaminergic neurotoxin MPTP. Eur. J. Neurosci. 21,1758 –1762

43. Guo, S., Wilson, S. W., Cooke, S., Chitnis, A. B., Driever, W., andRosenthal, A. (1999) Mutations in the zebrafish unmask shared regulatorypathways controlling the development of catecholaminergic neurons.Dev. Biol. 208, 473– 487

44. Toni, M., and Cioni, C. (2015) Fish synucleins: an update. Mar. Drugs 13,6665– 6686

45. Milanese, C., Sager, J. J., Bai, Q., Farrell, T. C., Cannon, J. R.,Greenamyre, J. T., and Burton, E. A. (2012) Hypokinesia and reduceddopamine levels in zebrafish lacking �- and �1-synucleins. J. Biol.Chem. 287, 2971–2983

46. L’Episcopo, F., Tirolo, C., Caniglia, S., Testa, N., Serra, P. A., Impagnatiello,F., Morale, M. C., and Marchetti, B. (2010) Combining nitric oxide releasewith anti-inflammatory activity preserves nigrostriatal dopaminergic in-nervation and prevents motor impairment in a 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine model of Parkinson’s disease. J. Neuroinflam-mation 7, 83

47. Hashimoto, M., Rockenstein, E., Mante, M., Mallory, M., and Masliah, E.(2001) �-Synuclein inhibits �-synuclein aggregation: a possible role as ananti-parkinsonian factor. Neuron 32, 213–223

48. Israeli, E., and Sharon, R. (2009) �-Synuclein occurs in vivo in lipid asso-ciated oligomers and forms hetero oligomers with �-synuclein. J. Neuro-chem. 108, 465– 474

49. Meredith, G. E., Totterdell, S., Beales, M., and Meshul, C. K. (2009)Impaired glutamate homeostasis and programmed cell death in achronic MPTP mouse model of Parkinson’s disease. Exp. Neurol. 219,334 –340

50. Blesa, J., and Przedborski, S. (2014) Parkinson’s disease: animal models anddopaminergic cell vulnerability. Front. Neuroanat. 8, 155

51. Norris, K. L., Hao, R., Chen, L. F., Lai, C. H., Kapur, M., Shaughnessy, P. J.,Chou, D., Yan, J., Taylor, J. P., Engelender, S., West, A. E., Lim, K. L., andYao, T. P. (2015) Convergence of Parkin, PINK1, and �-synuclein onstress-induced mitochondrial morphological remodeling. J. Biol. Chem.290, 13862–13874

52. Nakamura, K., Nemani, V. M., Azarbal, F., Skibinski, G., Levy, J. M., Egami,K., Munishkina, L., Zhang, J., Gardner, B., Wakabayashi, J., Sesaki, H.,Cheng, Y., Finkbeiner, S., Nussbaum, R. L., Masliah, E., and Edwards, R. H.(2011) Direct membrane association drives mitochondrial fission by theParkinson disease-associated protein �-synuclein. J. Biol. Chem. 286,20710 –20726

53. Li, J., Li, S., Zhang, L., Ouyang, L., and Liu, B. (2015) Deconvoluting thecomplexity of autophagy and Parkinson’s disease for potential therapeuticpurpose. Oncotarget 6, 40480 – 40495

54. Kesidou, E., Lagoudaki, R., Touloumi, O., Poulatsidou, K. N., and Sime-onidou, C. (2013) Autophagy and neurodegenerative disorders. NeuralRegen. Res. 8, 2275–2283

55. Miki, Y., Tanji, K., Mori, F., Utsumi, J., Sasaki, H., Kakita, A., Takahashi, H.,and Wakabayashi, K. (2016) Alteration of upstream autophagy-relatedproteins (ULK1, ULK2, Beclin1, VPS34 and AMBRA1) in Lewy body dis-ease. Brain Pathol. 26, 359 –370

56. Colasanti, T., Vomero, M., Alessandri, C., Barbati, C., Maselli, A., Camp-erio, C., Conti, F., Tinari, A., Carlo-Stella, C., Tuosto, L., Benincasa, D.,Valesini, G., Malorni, W., Pierdominici, M., and Ortona, E. (2014) Role of�-synuclein in autophagy modulation of primary human T lymphocytes.Cell Death Dis. 5, e1265

57. Zhang, H., Duan, C., and Yang, H. (2015) Defective autophagy in Parkin-son’s disease: lessons from genetics. Mol. Neurobiol. 51, 89 –104

58. Bingol, B., Tea, J. S., Phu, L., Reichelt, M., Bakalarski, C. E., Song, Q.,Foreman, O., Kirkpatrick, D. S., and Sheng, M. (2014) The mitochondrialdeubiquitinase USP30 opposes parkin-mediated mitophagy. Nature 510,370 –375

59. Chu, C. T. (2010) A pivotal role for PINK1 and autophagy in mitochon-drial quality control: implications for Parkinson disease. Hum. Mol. Genet.19, R28 –R37

60. Levine, B., and Klionsky, D. J. (2004) Development by self-digestion: mo-lecular mechanisms and biological functions of autophagy. Dev. Cell 6,463– 477

Dopaminergic neuron guardian in zebrafish-PD model

J. Biol. Chem. (2017) 292(44) 18062–18074 18073

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

61. Walsh, C. M., and Edinger, A. L. (2010) The complex interplay betweenautophagy, apoptosis, and necrotic signals promotes T-cell homeostasis.Immunol. Rev. 236, 95–109

62. Klionsky, D. J., Baehrecke, E. H., Brumell, J. H., Chu, C. T., Codogno, P.,Cuervo, A. M., Debnath, J., Deretic, V., Elazar, Z., Eskelinen, E. L., Fink-beiner, S., Fueyo-Margareto, J., Gewirtz, D., Jäättelä, M., Kroemer, G., et al.(2011) A comprehensive glossary of autophagy-related molecules and pro-cesses (2nd Ed.). Autophagy 7, 1273–1294

63. Wirawan, E., Vanden Berghe, T., Lippens, S., Agostinis, P., and Vandena-beele, P. (2012) Autophagy: for better or for worse. Cell Res. 22, 43– 61

64. Xu, M., Zhang, Q., Li, P. L., Nguyen, T., Li, X., and Zhang, Y. (2016)Regulation of dynein-mediated autophagosomes trafficking by ASM inCASMCs. Front. Biosci. 21, 696 –706

65. Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., and Schilling,T. F. (1995) Stages of embryonic development of the zebrafish. Dev. Dyn.203, 253–310

66. Arnold, M. C., Forte, J. E., Osterberg, J. S., and Di Giulio, R. T. (2016)Antioxidant rescue of selenomethionine-induced teratogenesis in ze-brafish embryos. Arch. Environ. Contam. Toxicol. 70, 311–320

67. Varga, M., Sass, M., Papp, D., Takács-Vellai, K., Kobolak, J., Dinnyés, A.,Klionsky, D. J., and Vellai, T. (2014) Autophagy is required for zebrafishcaudal fin regeneration. Cell Death Differ. 21, 547–556

68. Whitlock, K. E., and Westerfield, M. (2000) The olfactory placodes of thezebrafish form by convergence of cellular fields at the edge of the neuralplate. Development 127, 3645–3653

69. Higashijima, S., Hotta, Y., and Okamoto, H. (2000) Visualization of cranialmotor neurons in live transgenic zebrafish expressing green fluorescentprotein under the control of the islet-1 promoter/enhancer. J. Neurosci.20, 206 –218

70. Yousefi, S., Perozzo, R., Schmid, I., Ziemiecki, A., Schaffner, T., Scapozza,L., Brunner, T., and Simon, H. U. (2006) Calpain-mediated cleavage ofAtg5 switches autophagy to apoptosis. Nat. Cell Biol. 8, 1124 –1132

Dopaminergic neuron guardian in zebrafish-PD model

18074 J. Biol. Chem. (2017) 292(44) 18062–18074

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

Zhan-ying Hu, Bo Chen, Jing-pu Zhang and Yuan-yuan Main a zebrafish model of Parkinson's disease

) protects dopaminergic neuronsATG5Up-regulation of autophagy-related gene 5 (

doi: 10.1074/jbc.M116.764795 originally published online September 19, 20172017, 292:18062-18074.J. Biol. Chem. 

  10.1074/jbc.M116.764795Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2017/09/19/M116.764795.DC1

  http://www.jbc.org/content/292/44/18062.full.html#ref-list-1

This article cites 70 references, 11 of which can be accessed free at

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from